Patent Application
20230374518
Autophagy, the lysosome-dependent clearance of intracellular contents, plays important roles in organism development and health. The failure to remove mitochondria by autophagy, or mitophagy, results in defects in cellular homeostasis and health, and contributes to multiple diseases. For example, mutations in genes responsible for mitophagy manifest as inheritable forms of Parkinson's disease and Alzheimer's disease. As a result, understanding the mechanisms that regulate mitophagy under different cellular contexts is crucial to the understanding of biology and health.
Aspects of the disclosure relate to compositions and methods for modulating (e.g., inhibiting or promoting) expression of certain mitochondrial regulatory proteins, for example Marf and mitofusin (Mfn). The disclosure is based, in part, on modulation of Marf or Mfn to regulate expression or activity of certain proteins involved in autophagy, for example Vmp1 and vps13D. In some aspects, the disclosure relates to modulation of pink1 to regulate expression or activity of certain proteins involved in autophagy, for example vps13D. In some embodiments, compositions and methods described by the disclosure are useful for treating diseases related to aberrant autophagy or mitochondrial function, such as familial neurological movement disorders.
Accordingly, in some aspects, the disclosure provides a method for treating a disease associated with mitochondrial dysfunction in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a mitofusin (Mfn) modulator.
In some embodiments, a Mfn modulator increases expression or activity of a mitofusin. In some embodiments, a Mfn modulator inhibits expression or activity of a mitofusin. In some embodiments, a mitofusin is Mitofusin 2 (Mfn2).
In some embodiments, a Mfn modulator directly modulates expression or activity of a mitofusin. In some embodiments, a Mfn modulator selectively inhibits expression or activity of a mitofusin. In some embodiments, a Mfn modulator indirectly modulates expression or activity of a mitofusin.
In some embodiments, a Mfn modulator is a nucleic acid, polypeptide, or small molecule. In some embodiments, a nucleic acid is an interfering nucleic acid selected from the group consisting of double stranded RNA (dsRNA), siRNA, shRNA, miRNA, and antisense oligonucleotide (ASO).
In some embodiments, a polypeptide comprises an RNA-guided nuclease. In some embodiments, an RNA-guided nuclease comprises a CRISPR-Cas nuclease.
In some embodiments, a small molecule comprises a proteolysis targeting chimera (PROTAC), a kinase modulator, or an E3 ubiquitin ligase modulator. In some embodiments, a kinase modulator comprises a PINK1 modulator. In some embodiments, a E3 ubiquitin ligase modulator comprises a Mule ligase modulator or Parkin modulator.
In some embodiments, a subject is a mammal. In some embodiments, a subject is a human. In some embodiments, a subject comprises one or more mutations in vps13d. In some embodiments, one or more mutations comprise a frameshift, missense, or partial duplication mutation. In some embodiments, a disease associated with mitochondrial dysfunction is a neurological movement disorder.
In some embodiments, a Mfn modulator is delivered to a neuron of the subject. In some embodiments, a therapeutically effective amount of a Mfn modulator restores normal mitochondrial function in the subject.
In some aspects, the disclosure provides a method for identifying a subject as having a VPS13D-associated disease, the method comprising detecting in a biological sample obtained from a subject an increased level of mitofusin (Mfn) expression or activity relative to a control sample.
In some embodiments, a subject is a mammal. In some embodiments, a subject is a human. In some embodiments, a mitofusin is Mitofusin 2 (Mfn2). In some embodiments, a subject comprises one or more mutations in vps13d.
In some embodiments, methods described herein further comprise administering to the subject one or more Mfn modulators.
In some aspects, the disclosure provides a method for modulating expression or activity of vps13D in a cell (e.g., in a cell of a subject), the method comprising administering to the subject a therapeutically effective amount of a Pink1 modulator.
In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is in a subject. In some embodiments, the subject is a human subject. In some embodiments, the cell or subject comprises one or more mutations in a vps13D gene.
Aspects of the disclosure relate to compositions and methods for modulating (e.g., inhibiting or promoting) expression of certain mitochondrial regulatory proteins, for example Marf and mitofusin (Mfn) and/or PTEN-induced kinase 1 (PINK1). The disclosure is based, in part, on modulation of Marf or Mfn and/or PINK1 to regulate expression or activity of certain proteins involved in autophagy, for example Vmp1 and vps13D. In some embodiments, compositions and methods described by the disclosure are useful for treating diseases related to aberrant autophagy or mitochondrial function, such as familial neurological movement disorders.
In some aspects, the disclosure relates to compositions and methods for treating a subject having or suspected of having a disease associated with mitochondrial dysfunction. As used herein, a “subject” is interchangeable with a “subject in need thereof”, both of which may refer to a subject having a disease associated with mitochondrial dysfunction, or a subject having an increased risk of developing such a disease relative to the population at large. A subject in need thereof may be a subject having a mitochondrion that exhibits aberrant activity, or a subject having one or more mutations in a gene that results in aberrant mitochondrial function (e.g., vps13d). A subject can be a human, non-human primate, rat, mouse, cat, dog, or other mammal. In some embodiments, a subject is a human. In some embodiments, a subject is an invertebrate, for example a fly (e.g., Drosophila) or a nematode (e.g., C. elegans).
As used herein, a “disease associated with mitochondrial dysfunction” refers to a disease characterized by aberrant (e.g., reduced, relative to a healthy individual) mitochondrial activity. In some embodiments, a disease associated with mitochondrial dysfunction is caused by a loss of efficiency in the electron transport chain and reductions in the synthesis of high-energy molecules, such as adenosine-5′-triphosphate (ATP). In some embodiments, a subject having a disease associated with mitochondrial dysfunction is also characterized by aberrant endoplasmic reticulum (ER) contact and/or dysregulated autophagy. Examples of diseases associated with mitochondrial dysfunction include but are not limited to familial neurological movement disorders (e.g., ataxia, dystonia, chorea, VPS13D motor diseases, etc.), Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, Friedreich's ataxia, cardiovascular diseases, such as atherosclerosis and other heart and vascular conditions, diabetes and metabolic syndrome, autoimmune diseases, such as multiple sclerosis, systemic lupus erythematosus, and type 1 diabetes, neurobehavioral and psychiatric diseases, such as autism spectrum disorders, schizophrenia, and bipolar and mood disorders, gastrointestinal disorders, fatiguing illnesses, such as chronic fatigue syndrome and Gulf War illnesses, musculoskeletal diseases, such as fibromyalgia and skeletal muscle hypertrophy/atrophy, cancer, and chronic infections.
In some embodiments, a subject “having” or “suspected of having” a disease associated with mitochondrial dysfunction can be a subject that is known or determined to have one or more mutations in a gene associated with mitochondrial function (e.g., vps13d, PINK1, Mule, etc.), or a subject exhibiting signs and symptoms of a disease associated with mitochondrial dysfunction, including but not limited to motor dysfunction (e.g., spasticity, ataxia, chorea, dystonia), muscle atrophy, ocular dysfunction (e.g., blurry vision, trouble focusing, etc.), heart disease, kidney disease, liver disease, thyroid dysfunction, and/or neuropsychiatric manifestations (e.g., compulsive behavior, apathy, anxiety, etc.).
A subject having or suspected of having a disease associated with mitochondrial dysfunction may comprise one or more mutations in a vps13d gene. Vacuolar Protein Sorting 13 Homolog D (VPS13D) is a protein involved in trafficking of membrane proteins between the trans-Golgi network and the pre-vacuolar compartment. In humans, VPS13D is encoded by the vps13d gene, for example as set forth in NCBI Reference Sequence Accession Number NM_015378.4 (SEQ ID NO: 1) and NM_018156.4 (SEQ ID NO: 2). In some embodiments, VPS13D protein comprises the sequence set forth in NCBI Reference Sequence Accession Number NP_056193.2 (SEQ ID NO: 3) or NP_060626.2 (SEQ ID NO: 4). Examples of mutations in vps13d are known in the art and are described for example by Gauthier et al. (2018) Ann Neurol 83, 1089-1095; and Seong et al. (2018) Ann Neurol 83, 1075-1088.
As used herein, the terms “treatment”, “treating”, and “therapy” refer to therapeutic treatment and prophylactic or preventative manipulations. The terms further include ameliorating existing symptoms, preventing additional symptoms, ameliorating or preventing the underlying causes of symptoms, preventing or reversing causes of symptoms, for example, symptoms associated with a disease associated with mitochondrial dysfunction (e.g., a VPS13D neurological movement disease). Thus, the terms denote that a beneficial result has been conferred on a subject with a disorder (e.g., a disease associated with mitochondrial dysfunction), or with the potential to develop such a disorder. Furthermore, the term “treatment” is defined as the application or administration of an agent (e.g., therapeutic agent or a therapeutic composition) to a subject, or an isolated tissue or cell line from a subject, who may have a disease, a symptom of disease or a predisposition toward a disease, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve or affect the disease, the symptoms of disease or the predisposition toward disease.
Therapeutic agents or therapeutic compositions may include a compound in a pharmaceutically acceptable form that prevents and/or reduces the symptoms of a particular disease (e.g., a disease associated with mitochondrial dysfunction, such as a VPS13D neurological movement disease). For example, a therapeutic composition may be a pharmaceutical composition that prevents and/or reduces the symptoms of a disease associated with mitochondrial dysfunction. It is contemplated that the therapeutic composition of the present invention will be provided in any suitable form. The form of the therapeutic composition will depend on a number of factors, including the mode of administration as described herein. The therapeutic composition may contain diluents, adjuvants and excipients, among other ingredients as described herein.
Aspects of the disclosure relate to methods of treating certain diseases or disorders (e.g., diseases associated with mitochondrial dysfunction, such as VPS13D-associated diseases) that comprise administering a therapeutically effective amount of a mitofusin (Mfn) modulator to a subject. Mitofusins are GTPase enzymes embedded in the outer membrane of the mitochondria. Humans have two mitofusins, Mfn1 and Mfn2. In some embodiments, Mfn1 is encoded by NCBI Reference Sequence Accession Number NM_033540 (SEQ ID NO: 5). In some embodiments, Mfn1 comprises the amino acid sequence set forth in NCBI Reference Sequence Accession Number NP_284941 (SEQ ID NO: 6). In some embodiments, Mfn2 is encoded by NCBI Reference Sequence Accession Number NM_001127660 (SEQ ID NO: 7) or NM_014874 (SEQ ID NO: 8). In some embodiments, Mfn2 comprises the amino acid sequence set forth in NCBI Reference Sequence Accession Number NP_001121132 (SEQ ID NO: 9) or NP_055689 (SEQ ID NO: 10). In some embodiments, a gene encoding a mitofusin (e.g., Mfn1, Mfn2, etc.) is homologous to a marf gene in Drosophila.
A “modulator” refers to an agent that alters the transcriptional activity of a target gene, for example vps13D or mitofusin (e.g., Mfn1, Mfn2, etc.) or pink1. For example, in some embodiments a modulator of Mfn (e.g., Mfn1, Mfn2, etc.) increases the transcriptional activity of Mfn1 and/or Mfn2. in some embodiments a modulator of PINK1 increases the transcriptional activity of pink1 (e.g., human pink1). Increased transcriptional activity generally results in increased production of mRNA and/or increased protein translation (e.g., translation of Mfn1 and/or Mfn2 protein, translation of PINK1, etc.). In some embodiments a modulator of Mfn (e.g., Mfn1, Mfn2, etc.) decreases (e.g., inhibits) the transcriptional activity of Mfn1 and/or Mfn2. In some embodiments a modulator of Pink1 decreases (e.g., inhibits) the transcriptional activity of pink1. Decreased transcriptional activity generally results in decreased production of mRNA and/or decreased protein translation (e.g., translation of Mfn1 and/or Mfn2 protein, translation of PINK1 protein). A modulator can directly alter transcriptional activity of an Mfn (e.g., Mfn1 and/or Mfn2) or PINK1, or can indirectly alter Mfn (e.g., Mfn1 and/or Mfn2) or PINK1 transcriptional activity by interacting with another factor (e.g., protein) that modulates expression and/or the epigenetic state of a Mfn gene. In some embodiments, a modulator of Mfn inhibits the expression level or activity (e.g., function) of another protein that modulates transcriptional activity of a Mfn protein. For example, in some embodiments, a modulator of Mfn is an agent that inhibits or promotes phosphorylation (e.g., a kinase inhibitor or promoter) or inhibits or promotes ubiquitination (e.g., an E3 ligase inhibitor or promoter. In some embodiments, a modulator of Mfn can be a nucleic acid, polypeptide, small molecule, or any combination of the foregoing.
In some embodiments, a modulator of Mfn modulates expression or activity of a ubiquitin ligase. As used herein, the term “ubiquitin ligase” refers to an enzyme that recruits an E2 ubiquitin-conjugating enzyme that has been loaded with ubiquitin, recognizes a protein substrate (e.g., a histone protein), and assists or directly catalyzes the transfer of ubiquitin from the E2 to the protein substrate (e.g., histone protein). In some embodiments, the disclosure relates to modulators of E3 ubiquitin ligase enzymes. E3 ubiquitin ligases are generally split into four families (HECT, RING-finger, U-box and PHD-finger). In some embodiments, the disclosure relates to modulators of Mule ligase. Mule ligase is an E3 ligase involved in ubiquitination of mitochondrial proteins, for example VPS13D, and is described for example by Dadson et al. (2017) Scientific Reports volume 7, Article number: 41490. Example of E3 ligase modulators include but are not limited to cyclosporine, FK506, rapamycin, lenalidomide, pomalidomide, thalidomide, PRT4165, Bortezomib, and E3 inhibitors described by Landre et al. Oncotarget. 2014 Sep; 5(18): 7988-8013. In some embodiments, a ubiquitin ligase modulator increases expression or activity of a Mfn (e.g., Mfn1, Mfn2, etc.). In some embodiments, a ubiquitin ligase modulator decreases expression or activity of a Mfn (e.g., Mfn1, Mfn2, etc.).
In some embodiments, a modulator of Mfn modulates expression or activity of a kinase. In some embodiments, the kinase is PINK1, which induces parkin protein to bind to depolarized mitochondria to induce autophagy of those mitochondria. PTEN-induced kinase 1 (PINK1) is a mitochondrial serine/threonine-protein kinase encoded by the PINK1 gene. Examples of modulators of PINK1 include but are not limited to AF-6, parkin, MB-10, DECA, celastrol, etc. In some embodiments, a kinase modulator increases expression or activity of a Mfn (e.g., Mfn1, Mfn2, etc.). In some embodiments, a kinase modulator decreases expression or activity of a Mfn (e.g., Mfn1, Mfn2, etc.).
In some embodiments, a modulator of Mfn is a selective inhibitor. In some embodiments, a modulator of PINK1 is a selective inhibitor. As used herein, a “selective inhibitor” or an inhibitor that is said to “selectively inhibit” refers to an inhibitor that preferentially inhibits activity or expression of a target molecule of a particular class compared with other molecules of the class. In some embodiments, a selective inhibitor of a target molecule of a particular class has half maximal inhibitory concentration (IC50) relative to the target molecule that is at least 2-fold, at least 4-fold, at least 8-fold, at least 10-fold, at least 20-fold, at least 30-fold, at least 40-fold, or at least 50-fold lower than the IC50 relative to one or more other members of the class. A selective inhibitor can be an inhibitor of a mitofusin (e.g., Mfn1, Mfn2, etc.), a ubiquitin ligase (e.g., an E3 ubiquitin ligase), a kinase (e.g., PINK1), etc.
In some embodiments, a modulator of Mfn is an interfering RNA. Examples of interfering RNA include, but are not limited to double stranded RNA (dsRNA), siRNA, shRNA, miRNA, and antisense oligonucleotides (ASOs). Inhibitory oligonucleotides may interfere with gene expression, transcription and/or translation. Generally, inhibitory oligonucleotides bind to a target polynucleotide via a region of complementarity. For example, binding of inhibitory oligonucleotide to a target polynucleotide can trigger RNAi pathway-mediated degradation of the target polynucleotide (in the case of dsRNA, siRNA, shRNA, etc.), or can block the translational machinery (e.g., antisense oligonucleotides). Inhibitory oligonucleotides can be single-stranded or double-stranded. In some embodiments, inhibitory oligonucleotides are DNA or RNA. In some embodiments, the inhibitory oligonucleotide is selected from the group consisting of an antisense oligonucleotide, siRNA, shRNA and miRNA. In some embodiments, inhibitory oligonucleotides are modified nucleic acids.
The term “nucleotide analog” or “altered nucleotide” or “modified nucleotide” refers to a non-standard nucleotide, including non-naturally occurring ribonucleotides or deoxyribonucleotides. In some embodiments, nucleotide analogs are modified at any position so as to alter certain chemical properties of the nucleotide yet retain the ability of the nucleotide analog to perform its intended function. Examples of positions of the nucleotide which may be derivitized include the 5 position, e.g., 5-(2-amino)propyl uridine, 5-bromo uridine, 5-propyne uridine, 5-propenyl uridine, etc.; the 6 position, e.g., 6-(2-amino)propyl uridine; the 8-position for adenosine and/or guanosines, e.g., 8-bromo guanosine, 8-chloro guanosine, 8-fluoroguanosine, etc. Nucleotide analogs also include deaza nucleotides, e.g., 7-deaza-adenosine; O- and N-modified (e.g., alkylated, e.g., N6-methyl adenosine, or as otherwise known in the art) nucleotides; and other heterocyclically modified nucleotide analogs such as those described in Herdewijn, Antisense Nucleic Acid Drug Dev., 2000 Aug. 10(4):297-310.
Nucleotide analogs may also comprise modifications to the sugar portion of the nucleotides. For example the 2′ OH-group may be replaced by a group selected from H, OR, R, F, Cl, Br, I, SH, SR, NH2, NHR, NR2, COOR, or, wherein R is substituted or unsubstituted C.sub.1-C.sub.6 alkyl, alkenyl, alkynyl, aryl, etc. Other possible modifications include those described in U.S. Pat. Nos. 5,858,988, and 6,291,438. A locked nucleic acid (LNA), often referred to as inaccessible RNA, is a modified RNA nucleotide. The ribose moiety of an LNA nucleotide is modified with an extra bridge connecting the 2′ oxygen and 4′ carbon.
The phosphate group of the nucleotide may also be modified, e.g., by substituting one or more of the oxygens of the phosphate group with sulfur (e.g., phosphorothioates), or by making other substitutions which allow the nucleotide to perform its intended function such as described in, for example, Eckstein, Antisense Nucleic Acid Drug Dev. 2000 Apr. 10(2):117-21, Rusckowski et al. Antisense Nucleic Acid Drug Dev. 2000 Oct. 10(5):333-45, Stein, Antisense Nucleic Acid Drug Dev. 2001 Oct. 11(5): 317-25, Vorobjev et al. Antisense Nucleic Acid Drug Dev. 2001 Apr. 11(2):77-85, and U.S. Pat. No. 5,684,143. Certain of the above-referenced modifications (e.g., phosphate group modifications) preferably decrease the rate of hydrolysis of, for example, polynucleotides comprising said analogs in vivo or in vitro. In some embodiments, the inhibitory oligonucleotide is a modified inhibitory oligonucleotide. In some embodiments, the modified inhibitory oligonucleotide comprises a locked nucleic acid (LNA), phosphorothioate backbone , and/or a 2′-OMe modification.
In some embodiments, an inhibitory nucleic acid specifically binds to at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more contiguous nucleotides of a nucleic acid (e.g., an mRNA transcript) encoding a mitofusin, for example Mfn1 (e.g., SEQ ID NO: 5) or Mfn2 (e.g., SEQ ID NO: 7 or 8). In some embodiments, an inhibitory nucleic acid comprises the sequence set forth in SEQ ID NO: 11 or 12. In some embodiments, an inhibitory nucleic acid comprises a sequence encoded by the sequence set forth in SEQ ID NO: 11 or 12.
In some embodiments, a modulator of Mfn comprises a Proteolysis Targeting Chimera (PROTAC). A “PROTAC” generally refers to a heterobifunctional small molecule composed of two active domains and a linker capable of removing specific unwanted proteins. In some embodiments, a PROTAC comprises a first domain that interacts with (e.g., specifically binds to) a mitofusin (e.g., Mfn1, Mfn2, etc.) and a second domain that interacts with (e.g., specifically binds to) and E3 ubiquitin ligase. Design and production of PROTACs is generally known, for example as described by Scheepstra et al. (2019) Comput Struct Biotechnol J.
Aspects of the disclosure relate to methods for identifying a subject as having a disease associated with mitochondrial dysfunction (e.g., a VPS13D-associated disease). The disclosure is based, in part, on the recognition that increased (e.g., elevated) levels of certain mitofusins (e.g., Mfn2) in a subject are indicative of the subject having one or more mutations in vps13D and/or the subject having a disease associated with mitochondrial dysfunction. In some embodiments, the methods comprise detecting in a biological sample obtained from a subject an increased level of mitofusin (Mfn) expression or activity relative to a control sample.
A “control sample” refers to a sample obtained from a healthy donor (e.g., a subject not having a disease associated with mitochondrial dysfunction, a subject not characterized as having one or more mutations in vps13D, etc.). As used herein, “increased” or “elevated” refers to a level of one or more mitofusins (e.g., Mfn1, Mfn2, etc.) present in a biological sample (e.g., a serum sample) is above a control level, such as a pre-determined threshold or a level of one or more mitofusins in a control sample. Controls and control levels include mitofusin protein levels obtained (e.g., detected) from a subject that does not have or is not suspected of having a disease associated with mitochondrial dysfunction. In some embodiments, a control or control level includes mitofusin protein levels prior to administration of a therapeutic agent (e.g., a modulator of Mfn). An elevated level includes a level that is, for example, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 300%, 400%, 500%, or more above a control level. An elevated level also includes increasing a phenomenon from a zero state (e.g., no or undetectable Mfn protein expression or level) to a non-zero state (e.g., some or detectable level of Mfn protein expression or presence). In some embodiments, an increase (e.g., increase in the level of one or more Mfn protein levels in the sample relative to a control or a prior sample) can be indicative of a lack of therapeutic efficacy of a therapeutic agent (e.g., therapeutic efficacy in the subject from which the sample was obtained).
Generally, a biological sample can be blood, serum (e.g., plasma from which the clotting proteins have been removed), or cerebrospinal fluid (CSF). However, the skilled artisan will recognize other suitable biological samples, such as certain tissue (e.g., bone marrow, brain tissue, spinal tissue, etc.) and cells (e.g., leukocytes, stem cells, brain cells, neuronal cells, skin cells, etc.). In some embodiments, a biological sample is a blood sample or a tissue sample. In some embodiments, a blood sample is a sample of whole blood, a plasma sample, or a serum sample. In some embodiments, a tissue sample comprises CNS tissue (e.g., brain tissue, spinal tissue, etc.). In some embodiments, a biological sample comprises mitochondria and/or mitochondrial DNA (mtDNA).
In some embodiments, a level of Mfn nucleic acid expression is detected. In some embodiments, the detection comprises performing a gene expression assay on a biological sample. A “gene expression assay” refers to a molecular, biological, or chemical assay which quantifies the relative expression level of a particular gene relative to other genes. In some embodiments, a gene expression assay quantifies the relative expression level of a particular set of genes relative to either 1) other genes or 2) each other gene in the set. Expression levels of genes may be determined by quantifying a level of DNA, RNA (e.g., total RNA, mRNA, miRNA, etc.), or proteins translated as a result of expression of the gene or set of genes.
In some embodiments, a level of Mfn protein expression (translation) is detected. In some embodiments, the detection comprises performing a Western blot. Western blots generally employ the use of a detection agent or probe to identify the presence of a protein or peptide. In some embodiments, detection of one or more Mfn proteins is performed by immunoblot (e.g., dot blot, 2-D gel electrophoresis, etc.), immunohistochemistry (IHC), or ELISA. In some embodiments, the detection agent is an antibody. In some embodiments, the antibody is an anti-Mfn antibody, for example D2D10, D1E9, 6A8, etc.
The mechanisms underlying mitophagy in animals have been defined through studies of derived cell lines. Although these elegant studies of PINK1- and Parkin-dependent mitophagy have significantly advanced our understanding of this important process, studies in animals indicate that the clearance of mitochondria in cells and tissues under physiological conditions do not always utilize the same regulatory pathways. During Drosophila development, the larval intestine undergoes an autophagy driven remodeling process where cells reduce in size and mitochondria are cleared by mitophagy. This system allowed identification of vps13d and other genes as regulators of autophagy under physiological conditions. Importantly, vps13d is an essential and conserved gene that regulates mitochondrial clearance, mitochondrial morphology, and has been implicated in human movement disorders.
Vacuolar protein sorting 13 (vps13) was discovered in yeast, and animals possess four evolutionarily conserved Vps13 family members Vps13A-D. Yeast VPS13, as well as mammalian Vps13A and C, have been implicated in the regulation of inter-organelle contact and lipid transport. However, these studies fail to address whether these human paralogs are repressors or enhancers of membrane contacts. Furthermore, no study has linked VPS13D specifically to regulation of membrane contacts.
Members of the Vps13 family possess unique functional requirements. In contrast to VPS13A-C, VPS13D is one of the most essential genes in human cell lines, and is essential for Drosophila development. Vps13D is the only Vps13 family member that contains a ubiquitin binding domain, which is required for proper mitochondrial morphology and clearance. Vps13D is also the only Vps13 family member in flies that is required for autophagy. Significantly, mutations in VPS13D have been associated with multiple diseases, including a unique group of familial neurological movement disorders involving ataxia, chorea and dystonia.
This example describes vps13d and genes that regulate autophagy and mitochondrial morphology. It was observed that Vps13D acts downstream of Vmp1/EPG-3, a regulator of autophagy and mitochondria and endoplasmic reticulum (ER) contact. Like Vps13D, loss of Vmp1 disrupts autophagy and mitochondrial morphology. Through this relationship, a novel role was identified for Vps13D, as a regulator of mitochondria and ER contact in Drosophila and human cell lines, including fibroblasts derived from patients symptomatic for VPS13D associated neurodegenerative disease. Importantly, it was also observed that Vps13D physically interacts with the regulator of mitochondrial fusion Marf, and that loss of marf suppresses vps13d mutant phenotypes. Data indicate that Vmp1, Vps13D and Marf are important factors in a pathway that regulates inter-organelle contacts in autophagy and mitochondrial morphology.
All cells were cultured at 37° C. in 5% CO2 in DMEM supplemented with 5% FBS and Penicillin/Streptomycin.
vmp1 loss-of-function, vmp1(Δ), and N terminal GFP-tagged (gfp-vmp1) vmp1 strains were edited using CRISPR/Cas9. For vmp1(Δ), the following sgRNA targeting sequences were used (5′ to 3′): sgRNA1: TGTTGTTGTGACGATTGCTC (SEQ ID NO: 13), sgRNA2: TTACGGGACTAGAAAATCAG (SEQ ID NO: 14). A 200 bp ultramer donor with 100 bp regions flanking the site of the deletion was used to facilitate the deletion, resulting in a single female fly with the deletion that was validated by DNA sequence. For gfp-vmp1, the following sgRNA targeting sequences were used (5′ to 3′): sgRNA3: TGCTGTGACATTTAAGCGGT (SEQ ID NO: 15), sgRNA4: CGAATGCTGTGACATTTAAG (SEQ ID NO: 16). A 2 kb gblock with 1 kb regions flanking the site of insertion and the GFP open reading frame was used to tag the N terminal of vmpl with gfp. A single female fly containing the insertion was collected, and validated by DNA sequencing. For vps13d-3xflag, the following sgRNA targeting sequence was used (5′ to 3′): sgRNA5:TTTATAAAATGCAATAGGT (SEQ ID NO: 17). A 2 kb region flanking the C terminal of genomic vps13d was amplified by PCR and site-directed mutagenesis was used to insert the 3xflag sequence in frame immediately before the stop codon. This fragment was inserted into a TOPO vector via TOPO cloning and sequenced to ensure no additional mutations were present and was used to tag the C terminal of vps13d with 3xflag. A single female fly containing the insertion was collected and validated by DNA sequencing.
Mosaic GFP positive RNAi-expressing cell clones were induced. To induce mosaic vmp1(Δ) and vps13d(MiMic) loss-of-function clones, hsflp, FRT19A, mRFP and hsflp;;FRT2A, Ubi-nlsGFP flies were used and crossed with vmp1(Δ) FRT19A/FM7i-pAct-GFP and vps13d(MiMic) FRT2A/TM6B flies, respectively. 8-hour eggs lays were heat shocked for 90 minutes at 37° C.
For fly genetic interaction experiments, 20 female flies were mated with 10 male flies for 3 days before being allowed to lay eggs for 48 hours on standard cornmeal agar food and then transferred to new vials. Crosses were allowed to develop until the eclosion of adults, and adult genotypes were quantified based on the presence and absence of dominant genetic markers that are associated with balancer chromosomes.
For worm genetic interaction experiments, N2 Bristol (wild-type) and epg-3(bp933) were used. Worms were cultured at 20° C. on King Agar plates with OP50 E. coli. C25H3.11/vps-13d RNAi bacterial clones and the control bacteria HT115 (expressing empty vector L4440). RNAi clones were confirmed by DNA sequencing. For synthetic lethality assay, five synchronized L1 animals were individually plated on control RNAi plates (L4440). Fifteen synchronized L1 animals were individually plated onto vps-13d RNAi plates. The number of plates exhibiting sterility or larval arrest was then calculated.
White prepupae were collected and allowed to develop on wet filter paper for 2 hours prior to dissection. Intestines were immuno-stained as previously described with modifications. Intestines were removed in cold PBS before being placed in 4% paraformaldehyde solution for fixation at 4° C. overnight. Intestines were washed twice with PBS and then twice with 0.1% PBSTx before blocking in 5% normal goat serum for 90 minutes and incubation with primary antibody in 0.1% PBSTx overnight. Intestines were then stained with secondary antibody for 3 hours before nuclei staining and mounting. The following primary antibodies were used: rabbit anti-ref(2)p (1:1000), mouse anti-ATP synthase complex V (1:1000, Abcam #ab14748), anti-GFP (1:1000, Abcam #ab13970), rabbit anti-SERCA (1:1000) and anti-VPS13D (1:50). The following secondary antibodies were used: anti-mouse AlexaFluor 647 (Invitrogen #A-21235), anti-rabbit Alexafluor 546 (Invitrogen #A-11035) and anti-chicken AlexaFluor 488 (#A-11039). Nuclei were stained with Hoescht (Invitrogen) and samples were mounted with Vectashield (Vector Lab). Intestines expressing mCherryAtg8a puncta were fixed overnight at 4° C. in 4% paraformaldehyde before being imaged the next day. Images were acquired using a Zeiss LSM 700 confocal microscope.
Transmission electron microscopy (TEM) was conducted. Intestines were dissected in PBS (GIBCO) 2 hours after pupation and fixed in a solution of 2.5% glutaraldehyde and 2% paraformaldehyde in 0.1M sodium cacodylate buffer, pH 7.4 (Electron Microscopy Sciences) for 1 hour at room temperature followed by overnight fixation at 4° C. in fresh fix. Intestines were washed in 0.1M sodium cacodylate buffer, pH 7.4, post-fixed in 1% osmium tetroxide in distilled water for 1 hour at room temperature and washed in distilled water. Preparations were stained en bloc in 1% aqueous uranyl acetate for 1 hour at 4° C. in the dark, washed in distilled water, dehydrated through a graded ethanol series, treated with propylene oxide and infiltrated in SPI-pon/Araldite for embedding. Ultrathin sections were cut on a Leica UC7 microtome. Sections were stained with uranyl acetate and lead citrate and examined on a Phillips CM10 TEM. Images were taken down the length of the anterior region of the midgut to ensure an unbiased approach. For each genotype, at least 3 intestines were embedded and sectioned for analyses and quantification. All images were reviewed and representative images selected for analyses.
For cell culture, plated cells were prefixed in 50% media: 50% fix, 2.5% glutaraldehyde and 2% paraformaldehyde in 0.1M sodium cacodylate buffer, pH 7.4 (Electron Microscopy Sciences) for 5 minutes followed by fixation in full fix for 1 hour at room temperature. Cells were then washed with 0.1M cacodylate buffer, pH 7.4, post-fixed in 1% osmium tetroxide in distilled water for 1 hour at room temperature and washed in distilled water. Preparations were stained en bloc in 1% aqueous uranyl acetate over night at 4° C. in the dark and then washed in distilled water. The cells were then scraped and pelleted. Cell pellets were embedded in agarose, dehydrated through a graded ethanol series, treated with propylene oxide and infiltrated in SPI-pon/Araldite for embedding. Ultrathin sections were cut on a Leica UC7 microtome. Sections were stained with uranyl acetate and lead citrate and examined on a Phillips CM10 TEM. For each cell line, at least (3) 10 cm2 dishes at 60-80% confluency were embedded independently of each other and sectioned in an unbiased manner for analyses and quantification.
Tissue was lysed in 1× Laemli Sample Buffer diluted in RIPA lysis buffer (10 mM Tris-Cl PH 8.0, 1 mM EDTA PH 8.0, 0.5 mM EGTA, 2.4 mM Sodium Deoxycholate 140 mM Sodium Chloride) at a ratio of 10 μL lysis buffer per intestine and 30 μL per whole pupa. Samples were crushed in solution using a plastic pestle for 30 seconds before being boiled at 99° C. for 6 minutes. Samples were run on 7.5% polyacrylamide gel, transferred onto 0.45 μm PVDF membranes (Millipore Sigma), and probed with antibodies using standard protocols. Primary antibodies used were mouse anti-FLAG (1:1000, Millipore Sigma), rabbit anti-Marf (1:1000, from Alexander Whitworth), mouse anti-Actin (1:1000, Proteintech), and mouse anti-ATP synthase complex V (1:1000, Abcam).
For immunoprecipitations, 2-hour-old pupae were lysed in RIPA lysis buffer supplemented with 1 mM NEM, 1 mM PMSF and Halt Protease Inhibitor Cocktail (Thermo Fisher) at a ratio of 16 pupae per 250 μL lysis buffer. Pupae were crushed with a plastic pestle for 30 seconds and incubated on ice for 30 minutes before being centrifuged at 4° C. at 13,000 rpm for 10 minutes. Supernatant was filtered through 0.45 μm Cellulose Acetate filters (Millipore Sigma). 30 μL of filtered supernatant was diluted in 10 μL of 4× Laemli Sample Buffer (Biorad), boiled for 6 minutes at 99° C. and used as input. 200 μL of filtered supernatant (approximately 1 mg protein) was used for immunoprecipitation. 40 μL of anti-FLAG M2 magnetic bead slurry (Millipore Sigma) warmed to room temperature was washed twice with RIPA buffer before incubation with filtered supernatant for 2 hours at 4° C. on a rotator. Following incubation, supernatant was discarded, and beads were washed 4 times with 1 mL 0.1% PBST. Beads were eluted with 20 μL× Laemli Sample Buffer diluted in RIPA lysis buffer and boiled for 6 minutes at 99° C. 20 μL of input and eluate was run on 7.5% polyacrylamide gel for Western Blot analysis.
The essentiality (
CRISPR/CAS9 gene editing was used to create a loss-of-function vmp1 mutant Drosophila named vmp1(Δ) (
Next, vmp1(Δ) mutant cells were analyzed for phenotypes that are similar to homozygous vps13d mutant intestine cells. Consistent with vmp1 RNAi knockdown, intestines with homozygous vmp1(Δ) mutant cells lacking red fluorescent protein (RFP) accumulated the autophagic cargo receptor Ref2p (p62 in mammals) compared to neighboring control cells that possess RFP (
Mitochondria are cleared by autophagy during intestine development. Therefore, whether Vmp1, like Vps13D, is required for clearance of mitochondria in the intestine was investigated. Significantly, homozygous vmp1(Δ) mutant intestine cells lacking RFP were unable to clear mitochondria compared to neighboring control cells that express RFP based on persistence of the mitochondrial protein ATP5a (
Nest, whether the presence of mitochondria in homozygous vmp1(Δ) mutant intestine cells was due to a defect in mitophagy was investigated. The mito-QC system, which utilizes a mitochondrial protein tagged with GFP and RFP to detect when mitochondria are delivered to autolysosomes, was used. Control intestines that expressed control luc RNAi cleared most mitochondria by 2 hours after pupation as shown by the presence of RFP-positive and GFP-negative puncta (
Vmp1 is a repressor of membrane contact, and the failure to disassemble mitochondria and endoplasmic reticulum (ER) contact alters mitochondrial morphology in vmp1 mutant mammalian and C. elegans cells. Whether Vmp1 influences mitochondria and ER contact in Drosophila through TEM analyses of intestines 2 hours after pupation was investigated. Intestines with decreased Vmp1 function that express vmp1 RNAi possessed increased contact between mitochondria and ER compared to luciferase (luc) RNAi control cells (
Given the role of Vmp1 in mitochondria and ER contact, as well as the similarities between vmp1 and vps13d mutant cell phenotypes, whether or not vps13d functions in mitochondria and ER contact was investigated by TEM analyses. Intestine cells of either homozygous vps13d (ΔUBA), a mutant lacking the ubiquitin binding domain, or vps13d(ΔUBA)/chromosome deficiency (Df) for the vps13d genomic region had significantly increased mitochondria and ER contact compared to heterozygous vps13d (ΔUBA)/wild type control cells 2 hours after pupation (
HeLa cells that either lack the ubiquitin binding domain, VPS13D(ΔUBA), or are thought to be a strong loss-of-function mutant, VPS13D(KO) were analyzed. Significantly, it was observed that mitochondria and ER contact were increased in both VPS13D mutant human HeLa cell lines (
Mutations in VPS13D have been associated with familial neurological movement disorders, including ataxia, dystonia, and chorea. Given the conserved function of VPS13D in inter-organelle contact between fly and human HeLa cells, patient-derived cells with VPS13D mutations were investigated by TEM to detect whether altered mitochondria and ER contact. Remarkably, mitochondria in fibroblasts that were derived from the symptomatic VPS13D mutant (G1190D/Q1106*) patient had increased mitochondria and ER contact compared to the mitochondria in fibroblasts derived from a relative (G1190D/+) and unrelated control (
The similarities between vmp1 and vps13d mutant phenotypes indicates that these genes may be in the same genetic pathway. Consistent with being in the same pathway, vmp1 and vps13d genetically interacted in both Drosophila and C. elegans (
Next, whether Vps13d influences Vmp1 was tested. CRISPR/CAS9 was used to tag Vmp1 with GFP on the N terminus (GFP-Vmp1) (
The relationship of Vmp1 and Vps13d in the clearance of mitochondria was investigated. Mitochondrial clearance in vmp1(Δ) and vps13d(ΔUBA) double mutant intestine cells with vmp1(Δ)/+ and vps13d(ΔUBA) single mutant control cells 2 hours after pupation was investigated. Double mutant cells had similar amounts of mitochondrial ATP5a protein compared to neighboring control cells (
Mito-QC was used to investigate whether Vmp1 and Vps13D function in a shared mitophagy pathway. Control intestines that were heterozygous for the vps13d (ΔUBA) mutation cleared most mitochondria by 2 hours after pupation as shown by the presence of RFP-positive and GFP-negative puncta. By contrast, intestines that were homozygous for the vps13d (ΔUBA) mutation retained mitochondria that were both RFP- and GFP-positive 2 hours after pupation (
To investigate if Vps13D and Vmp1 function in the same pathway to regulate mitochondria and ER contact, vps13d (ΔUBA)/Df expressing either vmp1 or control rfp RNAi were analyzed by TEM. Importantly, the combined reduction of both vmp1 and vps13d function failed to enhance either the increased mitochondrial size or mitochondria and ER contact phenotypes compared to the loss of vps13d alone (
CRISPR was used to tag the endogenous Drosophila vps13d gene with 3xflag on the C terminus of the open reading frame (
The 3xFLAG epitope was used to immunoprecipitate Vps13D and potential interacting proteins. Probing with a Marf-specific antibody revealed the presence of a specific band in the vps13d-3xflag eluate that was absent in the w1118 negative control eluate (
The role that Marf may play in mitochondrial clearance in intestines 2 hour after pupation was investigated. Overexpression of Marf inhibited mitochondrial clearance (
MFN2 is an established mitochondria and ER tether that regulates mitochondrial dynamics and mitophagy. Given the physical and genetic relationship between Vps13d, Vmp1, and Marf, it was investigated whether Vmp1 and Vps13D regulates mitochondria morphology and mitochondria and ER contact sites upstream of Marf. Knockdown of marf suppressed the enlarged mitochondrial phenotypes seen in vps13d (ΔUBA/MiMic) mutants and vmp1 knockdown intestine cells (
Significantly, MFN2 knockdown in patient-derived fibroblasts (
Next, whether or not decreased marf/MFN2 function can suppress the vps13d mutant intestine cell mitochondria and ER contact phenotype was investigated. Consistent TEM analyses of mitochondria in vps13d RNAi-expressing intestine cells, reduction of marf function by RNAi suppresses the enlarged mitochondrial phenotype in vps13d (ΔUBA)/MiMic mutants (
Data described herein indicates that Vps13D physically interacts with Mfn2. It is investigated whether Mfn1 or Mfn2 protein levels are elevated in Vps13D mutant patient-derived fibroblasts compared to control fibroblasts. Knockdown of Mfn2 (or Mfn1) by siRNA is also performed to assess whether it suppresses the Vps13D mutant mitochondria and ER contact phenotype in patient-derived fibroblasts.
Screening for regulators of Marf/Mfns is conducted using the fly system because it has less genetic redundancy. In some embodiments, protein levels of either Marf, Mfns or both are influenced by both E3 ubiquitin ligases and kinases.
Similarities in Drosophila vps13d and pink1 mutant cell phenotypes were observed. This example describes double-mutant genetic analyses to determine whether vps13d and pink1 are in a common pathway that regulates mitochondria structure and removal. Mitochondrial size was compared in TEM sections of pink1 mutant with pink1;vps13d double-mutant intestine cells. These mutants had similar mitochondria area 2 h after puparium formation (
Whether Vps13D and Pink1 act within the same pathway to regulate mitophagy was also investigated. The Mito-QC system, which utilizes mitochondria-localized tandem mCherry and GFP fluorescent tags, to label mitochondria outside of autolysosomes with both mCherry and GFP and mitochondria inside autolysosomes with only mCherry as the acidic environment of the autolysosome quenches GFP signal, was used to analyze mitophagy. In control cells that are wild-type for pink1 and heterozygous for vps13d, most of the GFP signal from the Mito-QC was quenched, leaving only mCherry puncta 2 h after prepupa formation (
To further investigate the relationship between Vps13D and Pink1, the influence of these genes on Atg8a puncta in intestine cells 2 h after puparium formation was investigated. Like vps13d mutant intestine cells, pink1 mutant intestine cells possess abnormal and enlarged Atg8a localization. Both vps13d mutant (labeled by nuclear RFP) and pink1;vps13d double-mutant (lacking nuclear RFP) intestine cells possessed similar Atg8a puncta size and amounts (
Pink1 senses mitochondrial stress and facilitates ubiquitination of mitochondria-associated proteins to facilitate mitophagy. In contrast to Atg8a localization, pink1 and vps13d mutant intestine cells differ in conjugated ubiquitin localization. To further examine the relationship between these two regulators of mitochondrial clearance, conjugated ubiquitin localization in either pink1 mutant, vps13d mutant, or pink1;vps13d double-mutant cells was investigated. In contrast to vps13d mutant cells, pink1;vps13d double-mutant cells exhibited the same pattern of conjugated ubiquitin localization as pink1 single-mutant cells that was not associated with the perimeter of mitochondria (
Pink1 can directly phosphorylate ubiquitin conjugated to proteins at the Ser65 residue, resulting in a conformation change that inhibits de-ubiquitination and can lead to further ubiquitination. The vps13d mutant intestine cells were stained with an antibody specific for ubiquitin phosphorylated at Ser65. Like conjugated ubiquitin, phosphorylated ubiquitin localized around the periphery of mitochondria (labeled by ATP5a) in vps13d mutants but was absent in pink1;vps13d double mutants (
While several embodiments of the present invention have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and/or structures for performing the functions and/or obtaining the results and/or one or more of the advantages described herein, and each of such variations and/or modifications is deemed to be within the scope of the present invention. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and/or configurations will depend upon the specific application or applications for which the teachings of the present invention is/are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, the invention may be practiced otherwise than as specifically described and claimed. The present invention is directed to each individual feature, system, article, material, and/or method described herein. In addition, any combination of two or more such features, systems, articles, materials, and/or methods, if such features, systems, articles, materials, and/or methods are not mutually inconsistent, is included within the scope of the present invention.
The indefinite articles “a” and “an,” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean “at least one.”
The phrase “and/or,” as used herein in the specification and in the claims, should be understood to mean “either or both” of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Other elements may optionally be present other than the elements specifically identified by the “and/or” clause, whether related or unrelated to those elements specifically identified unless clearly indicated to the contrary. Thus, as a non-limiting example, a reference to “A and/or B,” when used in conjunction with open-ended language such as “comprising” can refer, in one embodiment, to A without B (optionally including elements other than B); in another embodiment, to B without A (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.
As used herein in the specification and in the claims, “or” should be understood to have the same meaning as “and/or” as defined above. For example, when separating items in a list, “or” or “and/or” shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as “only one of” or “exactly one of,” or, when used in the claims, “consisting of,” will refer to the inclusion of exactly one element of a number or list of elements. In general, the term “or” as used herein shall only be interpreted as indicating exclusive alternatives (i.e. “one or the other but not both”) when preceded by terms of exclusivity, such as “either,” “one of,” “only one of,” or “exactly one of.” “Consisting essentially of,” when used in the claims, shall have its ordinary meaning as used in the field of patent law.
As used herein in the specification and in the claims, the phrase “at least one,” in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase “at least one” refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, “at least one of A and B” (or, equivalently, “at least one of A or B,” or, equivalently “at least one of A and/or B”) can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.
In the claims, as well as in the specification above, all transitional phrases such as “comprising,” “including,” “carrying,” “having,” “containing,” “involving,” “holding,” and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases “consisting of” and “consisting essentially of” shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03.
Use of ordinal terms such as “first,” “second,” “third,” etc., in the claims to modify a claim element does not by itself connote any priority, precedence, or order of one claim element over another or the temporal order in which acts of a method are performed, but are used merely as labels to distinguish one claim element having a certain name from another element having a same name (but for use of the ordinal term) to distinguish the claim elements.
This application claims the benefit under 35 U.S.C. 119(e) of the filing date of U.S. provisional Application Ser. No. 63/087,111, filed Oct. 2, 2020, entitled “MARF/MFN MODULATORS AND USES THEREOF”, and U.S. provisional Application Ser. No. 63/182,508, filed Apr. 30, 2021, entitled “MARF/MFN MODULATORS AND USES THEREOF”, the entire contents of each of which are incorporated herein by reference.
This invention was made with government support under GM131689 and CA239374 awarded by the National Institutes of Health. The government has certain rights in the invention.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US21/53116 | 10/1/2021 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 63182508 | Apr 2021 | US | |
| 63087111 | Oct 2020 | US |
