Patent Application
20240011108
The present disclosure pertains to methods of and kits for detecting and measuring a target nucleic acid using a mass spectrometric method. Further, the present disclosure relates to methods and kits for disease diagnostics.
The capacity to accurately detect and quantify biomolecules is of great importance in multiple fields including basic biochemistry research, diagnostic and therapeutic medicine as well as water and food safety. Many potential diagnostic DNA molecules and therapeutic proteins at the edge of detection by present methods need to be absolutely quantified. The discovery of biologically important nucleic acids by semi quantitative “counting” methods such as polymerase chain reaction (PCR) amplification and DNA sequencing on polystyrene oligo synthesis microbeads has revealed important molecules (Consortium, 2011) that need to be absolutely quantified alongside standards by linear and Gaussian hybridization assays. Current techniques such as PCR are not able to accurately quantify molecules at these levels of zeptomole (10−21) to yoctomole (10−24) amounts under assay (Rutledge, 2003).
PCR (Chin, 2013) has been used to detect as little as a single polymerase template but is non-linear, may show false negative results, has large quantitative errors, and the mathematical procedure to extract absolute quantification from PCR reactions is daunting (Rutledge, 2003). Analysis of HIV and other animal viruses by PCR has a significant false negative rate (Xie, 2020; Xiao, 2020). A wide range of sensitivity values have been reported for Hybridization and Hybridization Chain reaction (Basiri, 2020; Santhanam, 2020, Doddapaneni, 2020; Jiao, 2020; Vermisoglou, 2020). A recent application of quantitative DNA based assays on solid supports may have reached the pico molar (pM) concentration range or using fluorescence that uses a broad absorption range, using electrochemical detection or TIRF that is not inherently linear and Gaussian or using schemes with multiple rounds of amplification by PCR or HCR followed by enzyme amplification that may show multiplication of error (Xu, 2016) Shi, Guo, Xiong and or ultrasensitive refences. In contrast mass spectrometry is more specific to a single mass to charge ratio instead of a broad spectrum, is inherently linear and Gaussian and can be amplified with one round of enzyme amplification to reach pM or lower concentration ranges.
Total internal reflectance of fluorescence (TIRF) can be used in the qualitative detection of nucleotides in DNA sequences (Vandamme, 1995). However, the signal is non-linear such that that calibration can be out by 1000 fold (Tobos, 2019; Tangemann, 1995) and relies on the aggregation of qualitative data that prevents computing of a safe detection limit (Rissin, 2010). Quantification from TIRF has practical limitations and was recently shown to provide results similarto those of enzyme amplification using horseradish peroxidase (HRP) (Li, 2017).
Mass spectrometry is a linear and Gaussian analytical technique (Razumienko, 2008; Bowden, 2012) that detects adenosine at 100 picomolar concentration (100 pM) where 1 microlitre injected (1 μL) corresponds to 100 attomole (100 amol) on column even prior to enzyme amplification (Florentinus, 2011; Onisko, 2007).
Liquid chromatography electrospray ionization tandem mass spectrometry (LC-ESI-MS/MS) has some powerful advantages compared to other methods that can directly detect proteins from blood to ng/ml levels without immunological or enzymatic amplification (Munge, 2005).
Immuno-Matrix Assisted Laser Desorption/Ionization (MALDI) directly analyzes immune complexes of proteins or peptides (Li, 2017) but has not been as useful for DNA. Moreover, its signal does not benefit from enzyme amplification and only reaches ng/ml sensitivity.
Similarly, liquid chromatography inductively coupled plasma mass spectrometry (LC-ICP-MS) may commonly reach ng/ml levels similar to the existing detection limits of ELISA (Shukla, 2013).
Existing electrochemical methods have been reported to reach the yoctomole range. However, the signal is not inherently linear or Gaussian (Saiki, 1985; Rissin, 2010).
UV/VIS detection is not as sensitive or specific as mass spectrometry; but the combination of enzyme amplification and UV/VIS detection powerfully increased the sensitivity of UV/VIS analysis. The use of enzyme amplification by alkaline phosphatase (AP), DNA polymerase, horse radish peroxidases or luciferase has increased the useful sensitivity of methods such as UV-VIS, ECL or fluorescent detection (Ronaghi, 1996; Chen, 1994; Florentinus-Mefailoski, 2014; Walt, 2013; Munge, 2005; Saiki, 1985; Sun, 2006; Shukla, 2013; Chin, 2013; Tobos, 2019; Vandamme, 1995; Tangemann, 1995; Tucholska, 2009; Li, 2017; Razumienko, 2008; Bowden, 2012; Florentinus-Mefailoski, 2015; Florentinus, 2011; Onisko, 2007).
Using enzyme linked immuno mass spectrometric assay (ELiMSA), proteins and antibodies have been previously absolutely quantified on polystyrene supports using 96-well plate with deoxycholate or N-octyl glucoside modified, LC-ESI-MS compatible protein interaction buffers (Florentinus-Mefailoski, 2014; Florentinus-Mefailoski, 2016; Florentinus-Mefailoski, 2014; Florentinus-Mefailoski, 2015). ELiMSA assay has been described in U.S. Pat. No. 9,964,538. Compared to direct measurement by traditional colorimetric enzyme linked immunosorbent assay (ELISA), which reaches nanogram amounts of proteins, ELiMSA has reached picogram sensitivity for the detection of protein using alkaline phosphatase streptavidin (APSA) enzyme conjugate that is detectable to 50 femtogram (Florentinus-Mefailoski, 2015).
Detection of prostate specific antigen (PSA) and antibodies using the APSA enzyme conjugate reached high yoctomole range on normal phase silica stationary phase (Florentinus-Mefailoski, 2014; Florentinus-Mefailoski, 2015; Florentinus-Mefailoski, 2016). Protein detection by ELiMSA was blind tested to show results that agreed with the commercial fluorescent and ECL systems at high concentrations, but was far more sensitive and continued to show linear quantification of far below 1 ng/ml (femto mole range) (Florentinus-Mefailoski, 2015).
The quantification of nucleic acid by mass spectrometry can be difficult. For example, buffers typically used with nucleic acid binding, hybridization and reaction contain salts such as NaCl to promote nucleic acid interaction. However, inorganic salts such as NaCl cannot easily be used in mass spectrometric measurements.
Accordingly, there is a need for linear and Gaussian assays for detection and quantification of nucleic acids that is sensitive at low concentrations, for example where the nucleic acid is present in a femto molar to atto molar concentration range, and/or preferably compatible with MS.
It has been shown presently that low concentrations of target nucleic acid molecule from for example biological samples or PCR reaction products can be sensitively and specifically detected and quantified. Methods described herein include methods that involve amplification using selective capture and/or detection oligonucleotide probes coupled with measuring an enzymatic activity of a reporter enzyme such as alkaline phosphatase (AP) for detection by mass spectrometric (MS) methods. Further, it has been shown that when at least one primer of a PCR reaction is functionalized with a secondary target moiety such as biotin, the PCR product can be directly detected and quantified with a reporter enzyme detection probe that binds to the secondary target moiety and that has enzymatic activity that amplifies the presence of the PCR product for detection by MS.
Further, it has been shown that volatile buffers can be used to replace salt such as NaCl in one or more buffers to minimize residual salt in MS analysis.
The methods of the present disclosure are useful as selective and sensitive diagnostic methods.
Accordingly, in one aspect, the present disclosure includes a method of detecting a target nucleic acid molecule comprising
The detection oligonucleotide probe can be a detection oligonucleotide primer. In such cases, the step comprises amplifying the target nucleic acid molecule with a detection oligonucleotide primer, in an amplification solution and binding any amplified target to the detection oligonucleotide probe in the second binding solution under conditions for forming a target:detection complex.
In another aspect, the present disclosure includes a method of quantifying the amount of a target nucleic acid molecule in a sample comprising the steps:
In another aspect, the present disclosure includes a method of detecting a target nucleic acid molecule comprising
In another aspect, the present disclosure includes a method of quantifying the amount of a target nucleic acid molecule in a test sample comprising the steps:
In another aspect, the present disclosure includes a method of detecting HIV comprising a method of detecting a target nucleic acid molecule of the present disclosure, wherein the target nucleic acid molecule is a HIV nucleic acid molecule.
In another aspect, the present disclosure includes a method of detecting SARS-CoV2 comprising a method of detecting a target nucleic acid molecule of the present disclosure, wherein the target nucleic acid molecule is a SARS-CoV2 nucleic acid molecule.
In another aspect, the present disclosure includes a kit comprising:
In another aspect, the present aspect includes a kit comprising:
In another aspect, the present disclosure includes a nucleic acid of sequence selected from SEQ ID 2 to 37.
Other features and advantages of the present disclosure will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples while indicating preferred embodiments of the disclosure are given by way of illustration only, since various changes and modifications within the spirit and scope of the disclosure will become apparent to those skilled in the art from this detailed description.
An embodiment of the present disclosure will now be described in relation to the drawings in which:
Unless otherwise indicated, the definitions and embodiments described in this and other sections are intended to be applicable to all embodiments and aspects of the present disclosure herein described for which they are suitable as would be understood by a person skilled in the art.
The term “or” “and/or” as used herein means that the listed items are present, or used, individually or in combination. In effect, this term means that “at least one of” or “one or more” of the listed items is used or present.
As used in the present disclosure, the singular forms “a”, “an” and “the” include plural references unless the content clearly dictates otherwise. For example, an embodiment including “a compound” should be understood to present certain aspects with one compound, or two or more additional compounds.
In embodiments comprising an “additional” or “second” component, such as an additional or second compound, the second component as used herein is chemically different from the other components or first component. A “third” component is different from the other, first, and second components, and further enumerated or “additional” components are similarly different.
As used in this disclosure and claim(s), the words “comprising” (and any form of comprising, such as “comprise” and “comprises”), “having” (and any form of having, such as “have” and “has”), “including” (and any form of including, such as “include” and “includes”) or “containing” (and any form of containing, such as “contain” and “contains”), are inclusive or open-ended and do not exclude additional, unrecited elements or process steps.
The term “consisting” and its derivatives as used herein are intended to be closed terms that specify the presence of the stated features, elements, components, groups, integers, and/or steps, and also exclude the presence of other unstated features, elements, components, groups, integers and/or steps.
The term “consisting essentially of”, as used herein, is intended to specify the presence of the stated features, elements, components, groups, integers, and/or steps as well as those that do not materially affect the basic and novel characteristic(s) of these features, elements, components, groups, integers, and/or steps.
The term “suitable” as used herein means that the selection of the particular compound or conditions would depend on the specific synthetic manipulation to be performed, the identity of the molecule(s) to be transformed and/or the specific use for the compound, but the selection would be well within the skill of a person trained in the art.
The term “amine” or “amino,” as used herein, whether it is used alone or as part of another group, refers to groups of the general formula NR′R″, wherein R′ and R″ are each independently selected from hydrogen or C1-6alkyl.
The term “atm” as used herein refers to atmosphere.
The term “MS” as used herein refers to mass spectrometry.
The term “aq.” as used herein refers to aqueous.
MeOH as used herein refers to methanol.
MeCN as used herein refers to acetonitrile.
HCl as used herein refers to hydrochloric acid.
μwave as used herein refers to a microwave reaction vessel.
LCMS as used herein refers to liquid chromatography-mass spectrometry.
TRIS as used herein refers to tris(hydroxymethyl)aminomethane.
EDTA as used herein refers to ethylenediaminetetraacetic acid.
The term “adenosine monophosphate” or “AMP” as used herein means a compound having the structure:
or pharmaceutically acceptable salts or solvates thereof as well as mixtures thereof. AMP can be obtained for example from Sigma Aldrich.
The term “Amplex® Red” or “AR” as used herein means:
or pharmaceutically acceptable salts or solvates thereof as well as mixtures thereof. Amplex® Red can be obtained for example from Resazurin which is structurally related and has the formula 7-Hydroxy-3H-phenoxazin-3-one 10-oxide is also referred to as Amplex® Red. Accordingly, Amplex® Red as used herein includes both AR and Resazurin.
The term “5-Bromo-4-chloro-3-indolyl phosphate” or “BCIP” means as used herein a compound having the structure:
or pharmaceutically acceptable salts or solvates thereof as well as mixtures thereof. BCIP can be obtained for example from Sigma Aldrich.
The term “ionizable product”, as used herein means a product generated by a reporter enzyme, that comprises one or more ionizable groups. For example, an ionizable product may have one or more basic or amine groups for positive ionization and one or more acidic or hydroxyl groups for negative ionization. Ionizable groups may include ═NH, —NH2, guanidinium, methyl, ethyl, alky, phenyl, ribose, inositiol, phospholipid, carbohydrate, nucleic acid, carbonyl, aldehyde, ketone, carboxyl, hydroxyl, enol, guanidium, imidazole, sulfhydryl, disulfide, sulfate, phosphate, sulfonyl, nitrate, nitric oxide, thioester, ester, ether, anhydride, phosphoryl, mixed anhydride, and/or other ionizable groups known in the art. An ionizable product assessed, optionally efficiently enters the gas phase by electrospray ionization.
The term “L-(+)-2-amino-6-phosphonohexanoic acid” as used herein means:
or pharmaceutically acceptable salts or solvates thereof as well as mixtures thereof. L-(+)-2-amino-6-phosphonohexanoic acid can be obtained for example from Sigma Aldrich.
The term “Lumigen® TMA-3” or “TMA-3” as used herein means
or pharmaceutically acceptable salts or solvates thereof as well as mixtures thereof. TMA-3 can be obtained for example from Beckman Coulter Company.
The term “Lumigen® TMA-6” or “TMA-6” as used herein means
or pharmaceutically acceptable salts or solvates thereof as well as mixtures thereof. TMA-6 can be obtained for example from Beckmann Coulter Company.
The term “4-Methylumbelliferyl phosphate” or “4-MUP” as used herein means a compound having the structure:
or pharmaceutically acceptable salts or solvates thereof as well as mixtures thereof. 4-MUP can be obtained for example from Sigma Aldrich.
The term “Naphthol ASMX phosphate” as used herein means a compound having the structure:
or pharmaceutically acceptable salts or solvates thereof as well as mixtures thereof. Naphthol ASMX phosphate can be obtained for example from Sigma Aldrich.
The term “O-phospho-DL-Threonine” as used herein means a compound having the structure:
or pharmaceutically acceptable salts or solvates thereof as well as mixtures thereof. O-phospho-DL-Threonine can be obtained for example from Sigma Aldrich.
The term “Para nitrophenol phosphate” or “PNPP” as used herein means a compound having the structure:
or pharmaceutically acceptable salts or solvates thereof as well as mixtures thereof. Para nitrophenol phosphate can be obtained for example from Sigma Aldrich.
The term “phenylbenzene ω phosphono-α-amino acid” as used herein means compound having the structure:
or pharmaceutically acceptable salts or solvates thereof as well as mixtures thereof. Phenylbenzene w phosphono-a-amino acid can be obtained for example from Sigma Aldrich.
The term “pyridoxamine 5-phosphate” or “PA5P” as used herein means compound having the
or pharmaceutically acceptable salts or solvates thereof as well as mixtures thereof. PA5P can be obtained for example from Sigma Aldrich.
The term “sphingosine-1 phosphate” as used herein means a compound having the structure:
or pharmaceutically acceptable salts or solvates thereof as well as mixtures thereof. Sphingosine-1 phosphate can be obtained for example from Sigma Aldrich.
The term “detection oligonucleotide probe” as used herein comprises a oligonucleotide coupled to a secondary target moiety such as biotin wherein the oligonucleotide or a portion thereof is complementary to and binds selectively to a target nucleic acid molecule, for example, but not limited to, a bacterial, viral or fungal nucleic acid sequence. The detection oligonucleotide probe can be a detection oligonucleotide primer in some embodiments. The detection oligonucleotide probe can also optionally be coupled to the secondary target moiety, such as biotin. The detection oligonucleotide probe can also optionally be coupled to an enzyme such as the reporter enzyme. For example, the detection oligonucleotide can be optionally coupled to enzymes or catalysts including but not limited to ribozyme, a DNAzyme, phosphatase (for example AP), peroxidase (for example HRP), DNA polymerase, or glucose oxidase. For example, the detection oligonucleotide probe can comprise a single stranded oligonucleotide sequence complementary to that of the target nucleic acid molecule and can selectively bind to the target nucleic acid molecule through hybridization.
It can be appreciated by a person skilled in the art that the secondary target moiety and the secondary target binding moiety have high mutual affinity such that the secondary target moiety and the secondary target binding moiety selectively bind to each other. Accordingly, it can be appreciated by a person skilled in the art that a suitable secondary target binding moiety can be selected by a person skilled in the art based on the nature of the secondary target moiety and vice versa. The following list contains non-limiting examples of pairs of selectively binding chemical entities. The secondary target moiety and the secondary target binding moiety can be selected from pairs of chemical entities listed below. For example, the secondary target moiety can be biotin. For example, the secondary target binding moiety can be avidin or streptavidin.
The term “oligonucleotide” as used herein as used herein refers to a sequence of nucleoside or nucleotide monomers consisting of naturally occurring bases, sugars and intersugar (backbone) linkages. The term also includes modified or substituted sequences comprising non-naturally occurring monomers or portions thereof. The nucleic acid sequences of the present application may be deoxyribonucleic acid sequences (DNA) or ribonucleic acid sequences (RNA) and may include naturally occurring bases including adenine, guanine, cytosine, thymidine and uracil. The sequences may also contain modified bases. Examples of such modified bases include aza and deaza adenine, guanine, cytosine, thymidine and uracil; and xanthine and hypoxanthine. The nucleic acid can be either double stranded or single stranded, and represents the sense or antisense strand. For example, the capture, detection, target or primer sequences can be oligonucleotides.
The term “reporter enzyme detection probe” as used herein comprises a reporter enzyme component comprising an enzymatic activity, coupled to a detection probe component comprising a secondary target binding moiety, for example avidin or streptavidin when the secondary target moiety is biotin. The reporter enzyme is optionally a peroxidase such as horseradish peroxidase or a phosphatase such as alkaline phosphatase although any stable enzyme that can produce ionizable products can be used including for example a lyase, hydrolase, synthase, synthetase, oxidoreductase, dehydrogenase, oxidase, transferease, isomerase, ligase, protease, such as trypsin, proteinase, peroxidase, glucose oxidase, myeloperoxidase, oxidase, monooxygenase, cytochrome, phosphatase such as alkaline phosphatase, decarboxylase, lipase, caspase, amylase, peptidase, transaminase, and kinase. Additional enzymes can include DNA or RNA polymerase, TAQ, restriction enzymes, klenow fragment, DNA ligase. The secondary target binding moiety selectively binds the secondary target moiety of the detection oligonucleotide probe. For example, the secondary target binding moiety comprises avidin or streptavidin that selectively binds a biotinylated detection oligonucleotide probe (e.g. wherein the secondary target moiety comprises biotin).
The term “selective” as used herein in reference to a probe, optionally an oligonucleotide, is used contextually, to characterize the binding properties of the probe, optionally an oligonucleotide. For example, an oligonucleotide probe that binds selectively to a given target nucleic acid molecule will bind to that target nucleic acid molecule either with greater avidity or with more specificity, relative to another, different target nucleic acid molecule. In an embodiment, the probe, optionally an oligonucleotide probe, binds at least 2 fold, 3 fold, or 5 fold more efficiently, optionally 3-5 fold, 5-7 fold, 7-10, 10-15, 5-15, or 5-30 fold more efficiently.
The term “target nucleic acid molecule” as used herein refers to any nucleic acid polymer that comprises a sequence that is complementary to the oligonucleotide portion of a detection oligonucleotide probe. For example, the target nucleic acid molecule can be RNA or DNA, or derivatives thereof. The target nucleic acid can be any nucleic acid that is at least 30 nucleotides long. For example, the target nucleic acid molecule can be about or at least 30 nucleotides, about or at least 40 nucleotides, about or at least 50 nucleotides, about or at least 80 nucleotides, about or at least 100 nucleotides, about or at least 130 nucleotides, about or at least 180 nucleotides, about 200 nucleotides, about 250 nucleotides, about 300 nucleotides, about 350 nucleotides, about 450 nucleotides, about 600 nucleotides, about 700 nucleotides, about 850 nucleotides, or about 1000 nucleotides. In some embodiments, the target nucleic acid molecule is about 30 nucleotides to about 1500 nucleotides in length. For example, the target nucleic acid molecule is about 30 nucleotides to about 1000 nucleotides in length, about 30 nucleotides to about 300 nucleotides in length, about 100 nucleotides to about 500 nucleotides in length, about 100 nucleotides to about 600 nucleotides in length, about 100 nucleotides to about 700 nucleotides in length, about 100 nucleotides to about 800 nucleotides in length, about 100 nucleotides to about 900 nucleotides in length, or about 100 nucleotides to about 1000 nucleotides in length. For example, the target nucleic acid molecule can be single stranded or double stranded. For example, the target nucleic acid molecule can be plasmid DNA, a bacterial, viral, or fungal nucleic acid molecule or a mammalian or plant nucleic acid e.g. in a gene or in mRNA. The target nucleic acid can also be a synthetic nucleic acid for detection of nucleic acid tagged compounds and the like.
Described herein is a transformative technology that permits detection of nucleic acid molecules in the femto mol to pico mol ranges and/or lower. It is demonstrated herein that detection in the zepto mol to atto mol range can be achieved.
Enzyme linked immuno sorbent assays (ELISA) are the preferred analytical method for the repetitive quantitative analysis of polypeptides molecules of biomedical importance: ELISA may use reporter enzymes such as Horseradish peroxidase (HRP) and or alkaline phosphatase (AP) coupled to specific detection antibodies that capture and bind to each analyte of importance (Engvall, 1971; Van Weemen 1971).
At present substrates for the reporter enzymes horseradish peroxidase (HRP) or alkaline phosphatase (AP) yield colored, fluorescent or luminescent products. The present disclosure provides a method for detecting the enzymatic products of reporter enzymes that ionize efficiently with a high signal to noise ratio measured by mass spectrometry. Mass spectrometry is sensitive enough to permit detections at amounts far below ECL, fluorescence or colorimetric methods, but also permits monitoring of multiple substrates and products at discrete m/z values. It is possible using the methods described herein to measure the products of common industrial reporter enzymes to zepto mol amounts or lower with limits of quantification to atto mol amounts or lower.
The use of mass spectrometry to measure small molecules may commonly reach the femto to pico mol levels with high signal to noise. The industrial enzymes HRP or AP for example are rugged and durable and have a high catalysis rate for the creation of new small molecule products. The AP or HRP enzymes are for example covalently attached to a specific detection probe such as a polypeptide or antibody that may bind their target and then catalyze many different product reactions over the course of a brief incubation. Thus, the binding of atto mol, or even sub atto mol, amounts of enzyme-probe will yield amounts of small molecule products that accumulate in the femto mol to pico mol range well within the detectable range of by LC-ESI-MS/MS.
Liquid chromatography electrospray ionization and tandem mass spectrometry (LC-ESI-MS/MS) is more sensitive than colorimetric, fluorescent or ECL detection. The combination of the enzymatic production of reported molecules coupled with sensitive mass spectrometry for highly ionizable substrates should provide sensitivity in excess of RIA but without the requirement for standards labelled with isotope or probes labeled with isotope.
Quantification of HRP and AP is demonstrated using LC-ESI-MS/MS to detect the products of the AP and HRP reporter enzyme reactions. It is demonstrated herein that a mass spectrometer can also detect the small molecule products of reporter enzyme activity bound to a specific molecular probe such as an antibody. One atto mol or less of a reporter enzyme such as AP or HRP bound to a specific molecular probe such as a detection antibody will rapidly form femto mol to pico mol amounts of reporter enzyme reaction products well within the reliable detection and quantification limits of LC-ESI-MS/MS. Hence in ELiMSA and related DNA methods (e.g. DNA ELiMSA) the reporter enzymes such as HRP or AP may produce a range of products that can be easily distinguished and detected by mass spectrometry. Antibodies coupled to reporter enzymes that are widely used in biomedical and environmental applications can now be detected and quantified using very sensitive mass spectrometry to create a sensitive and flexible system. Since mass spectrometers can separate and analyze many analytes simultaneously using the methods described herein can allow identification and quantification of many different antigens at the same time to levels far below that which is possible by direct mass spectrometric analysis.
The reaction is reporter enzyme dependent. For example, it is demonstrated herein that incubating a substrate that can be acted upon by the reporter enzyme detection probe in an appropriate substrate reaction solution produces little or no signal in the absence of the reporter enzyme detection probe. In contrast, the addition of reporter enzyme detection probe comprising HRP or AP enzyme resulted in strong detection of an ELiMSA product ion. The product ion was shown to be dependent on the presence of the enzyme, and to be both time and concentration dependent. Thus, the ELiMSA product ions show all the hallmarks of an enzyme dependent assay.
Depending on the reporter enzyme or enzyme substrate, different ionizable products can be detected. Fragments thereof can also be detected. For example, adenosine can be ionized and detected at 268 m/z or fragmented and the fragment can be detected at 136 m/z.
As shown in the examples, a capture oligonucleotide probe can be used to capture a target nucleic acid molecule. In other examples the target nucleic acid molecule can be attached, covalently or non-covalently, to a solid support (e.g. solid phase) directly and a labelled detection probe optionally a labelled primer, can be used to detect the attached target nucleic acid molecule.
In one aspect, the present disclosure includes a method of detecting a target nucleic acid molecule comprising
The detection oligonucleotide probe can be a detection oligonucleotide primer. In such cases, the step comprises amplifying the target nucleic acid molecule with a detection oligonucleotide primer, in an amplification solution and binding any amplified target to the detection oligonucleotide probe in the second binding solution under conditions for forming a target:detection complex.
It is also contemplated that the detection oligonucleotide probe can be covalently attached to the reporter enzyme directly through covalent attachment, optionally though a linker. In such a case, the target:detection complex is sufficient to react with the reporter enzyme detection probe substrate. Thus, the secondary target moiety and the secondary target binding moiety are not required. Accordingly, in another aspect, the present disclosure includes a method of detecting a target nucleic acid molecule comprising
The detection oligonucleotide probe can be a detection oligonucleotide primer. In such cases, the step comprises amplifying the target nucleic acid molecule with a detection oligonucleotide primer, in an amplification solution and binding any amplified target to the detection oligonucleotide probe in the second binding solution under conditions for forming a target:detection complex.
In some embodiments, the second binding solution, the third binding solution and the substrate reaction solution each comprises a Tris buffer.
In some embodiments, the capture oligonucleotide probe is directly immobilized to the solid phase, optionally by non-covalent or covalent binding to the solid phase.
In some embodiments, the capture oligonucleotide probe comprises a oligonucleotide that has a sequence complementary to a part of the target nucleic acid molecule that is at least 25 nucleotides in length, at least 35 nucleotides in length, optionally the capture oligonucleotide probe has a sequence complementary to a part of the sequence of the target nucleic acid molecule that is about 30 nucleotides to about 60 nucleotides in length, or about 40 nucleotides to about 55 nucleotides in length.
In some embodiments, the detection oligonucleotide probe comprises an oligonucleotide that has a sequence complementary to another part of the target nucleic acid molecule, and a secondary target moiety selected from biotin.
In some embodiments, the sequence of the oligonucleotide of the detection oligonucleotide probe complementary to the other part of the sequence of the target nucleic acid molecule is at least 25 nucleotides in length, at least 35 nucleotides in length, optionally the detection oligonucleotide probe is about 30 nucleotides to about 60 nucleotides in length, or about 40 nucleotides to about 55 nucleotides in length.
In some embodiments, the capture oligonucleotide probe and the detection oligonucleotide probe can both bind the target nucleic acid molecule at non-overlapping regions, optionally the non-overlapping regions are directly adjacent, optionally the non-overlapping regions are at least one nucleotide apart, optionally the non-overlapping regions are at least 5 nucleotides apart, optionally the non-overlapping regions are about 2 nucleotides, about 5 nucleotides, about 10 nucleotides, about 20 nucleotides, about 25 nucleotides, about 50 nucleotides, about 100 nucleotides, about 500 nucleotides, or about 1000 nucleotides apart. In some embodiments, the non-overlapping regions are about 1 kb apart. In some embodiments, the non-overlapping regions are more than 1 kb apart.
In some embodiments, when a binding solution and/or a washing solution is substantially free of inorganic salt, the binding solution and/or the washing solution is each independently a volatile solution. In some embodiments, the volatile solution comprises a volatile buffer. In some embodiments, the volatile buffer is selected from ethanolamine, ammonium bicarbonate, ammonium formate, pyridinium formate, trialkylammonium/formic acid, ammonium acetate, trialkylammonium bicarbonate, N-ethylmorpholine/acetate, trialkylammonium acetate, or combinations thereof. In some embodiments, the volatile buffer is selected from ethanolamine, ammonium acetate, trialkylammonium bicarbonate, or combinations thereof. In some embodiments, the trialkylammonium is selected from trimethylammonium, triethylammonium, or combinations thereof. In some embodiments, the volatile buffer is ethanolamine. It can be appreciated by a person skilled in the art that ammonium bicarbonate is not stable to heat. For example, ammonium bicarbonate decomposes at about or above 90° C. Accordingly, for steps involving heating, other volatile buffers such as ethanolamine is preferred.
In some embodiments, when the first binding solution, the second solution, the third binding solution, and/or the washing solution is substantially free of inorganic salt, the first binding solution, the second solution, the third binding solution, and/or the washing solution each independently comprises ethanolamine, optionally the second binding solution and the third binding solution each comprises ethanolamine, optionally the first binding solution, the second binding solution, and the third binding solution each comprises ethanolamine, optionally the washing solution comprises ethanolamine.
In some embodiments, step a) and step b) are performed simultaneously, and the first binding solution of step a) is the second binding solution of step b).
In some embodiments, the first binding solution, the second binding solution, the third binding solution, and the substrate reaction solution each independently has a pH of about 7 to about 10, optionally of about 7 to about 8, optionally about 8.8.
In some embodiments, any of the volatile binding solutions can be used to wash the solid support, optionally to remove any inorganic salt that may be present.
In some embodiments, the target:detection:enzyme complex is incubated with the reporter enzyme detection probe substrate in the substrate reaction solution to generate the one or more ionizable products for a period of time less than 72 hours, less than 24 hours, less than 12 hours, less than 60 minutes, less than 50 minutes, less than 40 minutes, less than 30 minutes, less than 20 minutes, less than 15 min, less than 10 min, less than 5 min, less than 2 min, or less than 1 min.
In some embodiments, at least the third binding solution among the first binding solution, the second binding solution, and the third binding solution is substantially free of inorganic salt and comprises a volatile buffer described herein.
In some embodiments, the method comprises washing the solid phase to remove any unbound reporter enzyme detection probe with the washing solution, wherein the washing solution is substantially free of inorganic salt and comprises a volatile buffer as described herein.
In some embodiments, the components of any target:detection:enzyme complex and the capture oligonucleotide probe are cross-linked prior to the optional step d) and the step e), and the cross-linking is through H-hydroxysuccinimide (NHS), N-oxysuccinimide (NOS), maleimide, hydrazide, glutaraldehyde coupling, disuccinimidyl suberate (DSS) cross-linking or PEG crosslinking.
In some embodiments, the cross-linking of the components of any target:detection:enzyme complex and the capture oligonucleotide probe is through glutaraldehyde coupling, DSS cross-linking, or PEG cross-linking.
In another aspect, the present disclosure includes a method of quantifying the amount of a target nucleic acid molecule in a sample comprising the steps:
In some embodiments, the quantification comprises comparing the intensity of the signal for one or more products against signal intensities generated using known quantities of target substance, under similar conditions.
In some embodiments, the target nucleic acid molecule is present or suspected to be present in the sample in or up to a pico mol, femto mol, or atto mol range.
In some embodiments, the target nucleic acid molecule is selected from DNA, RNA, and combinations and derivatives thereof.
In some embodiments, the sample is a biological sample, industrial product, environmental sample, or a polymerase chain reaction (PCR) reaction product. In some embodiments, the biological sample is a blood sample, urine sample, fecal sample, effusate, tissue sample or sputum sample.
In another aspect, the present disclosure includes a method of detecting a target nucleic acid molecule comprising
In some embodiments, the second primer is attached to a solid phase, optionally the second primer is attached to the solid phase through a linker.
In some embodiments, the second primer is directly attached to the solid phase, optionally by non-covalent or covalent binding to the solid phase.
In some embodiments, the separation of the unreacted modified primer from the amplified nucleic acid product is by centrifugation, filtration and/or solvent wash.
In some embodiments, the method further comprises incubating the amplified nucleic acid product comprising the modified primer with a solid phase in a second binding solution under conditions to bind the amplified nucleic acid product onto the solid phase, prior to incubating the amplified nucleic acid product with the reporter enzyme detection probe, the solid phase having a capture oligonucleotide probe attached thereon that comprises a sequence complementary to the amplified nucleic acid product, optionally, the solid phase is attached to the capture oligonucleotide probe through a linker.
In some embodiments, the capture oligonucleotide probe is directly attached to the solid phase, optionally by non-covalent or covalent binding to the solid phase.
For example, various embodiments are shown in
The “R” shown in
The linker may be a chemical bond or may for example include a moiety such as a PEG chain that ends in amine. Other moieties such as a a carbon chain that comprises an amine.
The linker can be an amine (or amine linkage once linked), or NHS, or carboxyl link or cysteine link or a PEG for example with an amine or amine reactive group or any other suitable link. Others can be used including others that are described herein or in the table below.
Various tags can be used. For example the tag may be biotin, ALFA-tag, AviTag, C-tag, Calmoudulin-Tag, Polyglutamate Tag, E-Tag, Flag-tag, HA-tag, His-Tag, myc-Tag, NE-tag, Rho1D4-Tag, S-Tag, SBP-Tag, Softag 1, Softag 3, Spot-tag, Strept-tag, T7-tag, TC-tag, Ty1 tag, V5 tag, VSV-tag, Xpress tag, Isopeptag, SpyTag, SnoopTag, DogTag, Sdy Tag, Biotin carboxyl carrier protein, glutathione-S-transferase tas, GFP tag, HaloTag, SNAP-tag, CLIP-tag, HUH-Tag, Maltose-binding protein tag, Nus-tag, thioredoxin-tag, Fc-tag, or CRDSAT-tag. Others for example described elsewhere herein can also be used. The tag is some embodiments is biotin.
As discussed covalent and non covalent attachments can be used. For example, attachment to the support, can be a covalent attachment such as [H-hydroxysuccinimide (NHS), N-oxysuccinimide (NOS), maleimide, hydrazide, glutaraldehyde coupling, or PEG cross-linking or a non-covalent attachment [Adsorption to PVDF, silica, polystyrene, nylon, etc. This may be effected through or without a linker. Such as adsorption to PVDF, polystyrene or silica or nylon, acrylamide, alginate, melamine or any of the support
The solid support can for example be a plate such as a polystyrene plate, or chemically reactive NOS polystyrene plate, and the plate may be a 96 well plate, micro well or nanowell plate, a membrane such as PVDF membrane in for example a 96 well plate, or a micro or nanosized particle such as a bead. Other attachments include for example silica, PVDF, polystyrene, nylon, acrylamide, alginate, melamine
A more specific example is shown in
In some embodiments, the capture oligonucleotide probe has a sequence complementary to a part of the sequence of the amplified nucleic acid product comprising the modified primer.
In some embodiments, the first binding solution and/or the washing solution is volatile and substantially free of NaCl.
In some embodiments, the second binding solution being volatile and substantially free of NaCl.
In some embodiments, the first binding solution or the second binding solution each comprises a volatile buffer.
In some embodiments, the volatile buffer is selected from ethanolamine, ammonium bicarbonate, ammonium formate, pyridinium formate, trialkylammonium/formic acid, ammonium acetate, trialkylammonium bicarbonate, N-ethylmorpholine/acetate, trialkylammonium acetate, and combinations thereof.
In some embodiments, the volatile buffer is selected from ethanolamine, ammonium acetate, trialkylammonium bicarbonate, and combinations thereof.
In some embodiments, the trialkylammonium is selected from trimethylammonium, triethylammonium, and combinations thereof.
In some embodiments, the volatile buffer is ethanolamine.
In some embodiments, the method further comprising washing the solid phase with a blocking agent, optionally bovine serum albumin (BSA), prior to binding the amplified nucleic acid product to the solid phase.
In some embodiments, the first binding solution or the second binding solution each independently has a pH of about 7 to about 10, optionally of about 7 to about 8, optionally about 8.8.
In some embodiments, the removing of any unbound reporter enzyme detection probe from the amplified nucleic acid product:reporter enzyme complex is by centrifugation, filtration and/or solvent wash.
In some embodiments, the amplified nucleic acid product or the amplified nucleic acid product:reporter enzyme complex is incubated with the reporter enzyme substrate in the substrate reaction solution to generate the one or more ionizable products for a period of time less than 72 hours, less than 24 hours, less than 12 hours, less than 60 minutes, less than 50 minutes, less than 40 minutes, less than 30 minutes, less than 20 minutes, less than 15 min, less than 10 min, less than 5 min, less than 2 min, or less than 1 min.
In some embodiments, the test sample is a biological sample, industrial product, or environmental sample.
In some embodiments, the biological sample is a blood sample, urine sample, fecal sample, effusate, tissue sample or sputum sample.
In some embodiments, the PCR is selected from real time PCR (rtPCR), quantitative PCR (qPCR), reverse transcription PCR, nested PCR, hybridization chain reaction, rolling circle PCR, and substrate recycling reaction.
The reporter enzyme detection probe can comprise a reporter enzyme component and a detection probe component that are coupled together, optionally covalently. It is also contemplated that in some embodiments, the detection oligonucleotide probe can be attached to the report enzyme directly through covalent attachment optionally through a linker. When the detection oligonucleotide probe is already attached to the reporter enzyme, the reporter enzyme detection probe is not required. In an embodiment, the reporter enzyme comprises peroxidase activity, monooxygenase activity, phosphatase activity, glucose oxidase, protease or caspase activity, for example the reporter enzyme is a peroxidase, monooxygenase, phosphatase, glucose oxidase, protease, endoproteinase, exopeptidase or a caspase. In another embodiment, the reporter enzyme is selected from a lyase, hydrolase, synthase, synthetase, oxidoreductase, dehydrogenase, oxidase, transferase, isomerase, ligase, protease, such as trypsin, endoproteinase, exopeptidase, proteinase, peroxidase, glucose oxidase, myeloperoxidase, oxidase, monooxygenase, cytochrome, phosphatase sicj as alkaline phosphatase, decarboxylase, lipase, caspase, amylase, peptidase, transaminase, and kinase. Additional enzymes can include DNA or RNA polymerase, TAQ, restriction enzymes, klenow fragment, DNA ligase. In yet another embodiment, the reporter enzyme is selected from HRP, AP, ligase, DNA Polymerase (for example klenow or TAQ), restriction enzymes, and proteases, cytochrome monooxygenases, glucose oxidase, GAPDH, and other glycolysis and TCA cycle enzymes.
The solid phase can be any reaction vessel, optionally a bead, rod or plate, such as a microtitre plate, for example having a polystyrene surface. The solid phase may be any surface, including metal, gold, stainless steel, plastic, glass, silica, normal phase, reverse phase, polycarbonate, polyester, PVDF, nitrocellulose, cellulose, poly styrene, polymer, iron, magnetic, coated magnetic, microbeads, nanobeads, nanotubules, nanofibers or fullerene. An immunosorbent polystyrene rod with eight to 12 protruding cylinders has been described for example in U.S. Pat. No. 7,510,687.
The binding of the target nucleic acid molecule to the detection oligonucleotide probe, and of the detection oligonucleotide probe to the reporter enzyme detection probe can occur in a buffered solution. The conversion of the substrate by the reporter enzyme detection probe can occur in a substrate reaction buffer. Suitable buffers include volatile buffers that are substantially free of NaCl and are volatile buffers that are compatible with mass spectrometric conditions. Such suitable buffers include but are not limited to ammonium bicarbonate, ammonium formate, pyridinium formate, trimethylamine/formic acid, ammonium acetate, trimethylamine bicarbonate, N-ethylmorpholine/acetate, triethylamine/formic acid, triethylamine bicarbonate, or a polymer such as polyethylene glycol or dextran sulfate and combinations thereof. Buffers that hold the pH of the solution near the optimal for the maximal activity of the reporter enzyme are preferred. These same buffers might be used for the binding of the test substance or the reaction buffer.
The same binding buffer may be used for the binding of the target nucleic acid molecule to the detection oligonucleotide probe, and of the detection oligonucleotide probe to the reporter enzyme detection probe. Optionally, the substrate reaction buffer may be the same as the binding buffer.
In embodiments comprising an amplification, the binding buffer may comprise reagents for amplification and be referred to as an amplification solution, e.g. comprising polymerase, nucleotides, etc. in a buffer suitable for amplification.
The method disclosed herein can also be performed in solution in the absence of a solid phase, wherein the target substance is not immobilized but suspended on microbeads or magnetic microbeads or in a colloidal suspension or otherwise not entirely immobilized but free to move in a solution
Substrates that produce ionizable products that provide a high signal to noise ratio are desired. For example, the selected signal to noise ratio is at least 3, at least 4, at least 5, at least 6, at least 10. In an embodiment, the signal to noise ratio is greater than or equal to 5. The signal to noise ratio is the ratio of the mass signal (peak height) to noise (amplitude of base level fluctuation). The signal to noise ratio can be determined for example, by measuring the ratio of signal intensity from a blank sample or base line compared to that of a known quantity of analyte or a sample using MS. An example of a substrate that produces an ionizable product that when ionized to a product ion has a high signal to noise ratio is naphthol ASMX phosphate, which is dephosphorylated. A high signal to noise ratio, as used herein, is a signal to noise ratio greater than at least 5, at least 6, at least 10.
The substrate requires at least one ionizable group for example comprising at least one of NO2, SO4, PO3, NH2, ═NH—, COOH, NH—NHR—, NH2—NR—NH2, ionizable for example by electrospray or MALDI, and is a substrate for a selected reporter enzyme. In the case of HRP for example, a suitable substrate is one that is able to donate an electron to H2O2. As another example, in the case of phosphatases such as AP the substrate has at least one phosphate group that may be cleaved by the enzyme.
In some embodiments, the methods of the present disclosure further comprise separating the one or more ionizable products prior to detection using MS. In some embodiments, the separation is by liquid chromatograph, centrifugation, filtration, solvent wash, and/or salt diversion. In some embodiments, separation is by liquid chromatography, optionally isocratic normal phase chromatography. In some embodiments, the liquid chromatography is by reverse-phase chromatography. In some embodiments, the reverse-phase chromatography is C18 chromatography. In some embodiments, the liquid chromatography is high-performance liquid chromatography (HPLC). In some embodiments, the HPLC is nanoflow liquid chromatography.
In some embodiments, the step of detecting the one or more ionizable products using MS comprises ionizing the one or more ionizable products, optionally by electrospray ionization (ESI), MALDI, chemical ionization, electron impact, laser desorption, electrical ionization, or heat ionization to produce one or more product ions, and subjecting the one or more product ions to MS optionally tandem MS (MS/MS).
In some embodiments, the ionizing is positive ionization or negative ionization.
In some embodiments, the produced one or more product ions have a selected signal to noise ratio that is at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9 or at least 10.
In some embodiments, the MS is selected from electrospray ionization tandem MS (ESI-MS/MS), matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF), tandem MS (MS/MS), multiple rounds of fragmentation MSN, MALDI, electrospray, nanospray, surface ionization, laser desorption & ionization, atmospheric ionization, vacuum ionization, and MS equipped with capillary electrophoresis, ultra sonic or sonic or vibration, nanodroplet or mivrodroplet sample introduction system.
In some embodiments, the detecting using MS comprises recording product ion intensity by single ion monitoring (SIM) and/or product ion parent to fragment transition by single reagent monitoring (SRM).
In some embodiments, the reporter enzyme detection probe comprises a reporter enzyme and optionally a secondary target binding moiety, and wherein the secondary target binding moiety is covalently bound to the reporter enzyme.
In some embodiments, the secondary target moiety is selected from biotin, ALFA-tag, AviTag, C-tag, Calmoudulin-Tag, Polyglutamate Tag, E-Tag, Flag-tag, HA-tag, His-Tag, myc-Tag, NE-tag, Rho1D4-Tag, S-Tag, SBP-Tag, Softag 1, Softag 3, Spot-tag, Strept-tag, T7-tag, TC-tag, Ty1 tag, V5 tag, VSV-tag, Xpress tag, Isopeptag, SpyTag, SnoopTag, DogTag, Sdy Tag, Biotin carboxyl carrier protein, glutathione-S-transferase tas, GFP tag, HaloTag, SNAP-tag, CLIP-tag, HUH-Tag, Maltose-binding protein tag, Nus-tag, thioredoxin-tag, Fc-tag, and CRDSAT-tag, optionally the second target moiety is biotin.
In some embodiments, the secondary target binding moiety binds the secondary target moiety and is selected from avidin, streptavidin, calmodulin, anion-exchange resin, Mono-Q, cation-exchange resin, anti-E-tag antibody, anti-FLAG-tag antibody, anti-HA-tag antibody, nickel or cobalt chelate, anti-Myc-tag antibody, anti-NE-tag antibody, anti-Rho1 D4-tag antibody, anti-S-tag antibody, anti-Softag 1 antibody, anti-Softag 3 antibody, nanobody, streptactin, anti-T7-tag antibody, FIAsH biarsenical compounds, ReAsH biarsenical compounds, anti-Ty1 tag antibody, anti-V5 tag antibody, anti-VSV tag antibody, anti-Xpress tag antibody, pilin-C protein, SpyCatcher protein, SnoopCatcher protein, SnoopTagJr protein, SdyCatcher protein, glutathione, GFP-antibody, haloalkane substrate, benzylguanine derivatives, benzylcytosine derivatives, HUH specific DNA sequence, amylose agarose, Nus-tag antibody, anti-thioredoxin-tag antibody, protein-A sepharose, lactose, agarose, and sepharose, optionally the secondary target binding moiety is selected from avidin and streptavidin.
In some embodiments, the secondary target binding moiety binds the secondary target moiety of the detection oligonucleotide probe and is selected from avidin, and streptavidin when the secondary target moiety is biotin.
In some embodiments, the reporter enzyme is selected from a phosphatase, optionally alkaline phosphatase, lyase, hydrolase, synthase, synthetase, oxidoreductase, dehydrogenase, oxidase, transferease, isomerase, ligase, protease, such as trypsin, proteinase, peroxidase, glucose oxidase, myeloperoxidase, oxidase, monooxygenase, cytochrome, decarboxylase, lipase, caspase, amylase, peptidase, transaminase, kinase activity, DNA or RNA polymerase, optionally TAQ, restriction enzyme, klenow fragment, and DNA ligase.
In some embodiments, the reporter enzyme is selected from alkaline phosphatase, horseradish peroxidase, trypsin, cytochrome C monooxygenase, and myeloperoxidase, optionally, the reporter enzyme is alkaline phosphatase or horseradish peroxidase.
In some embodiments, the one or more ionizable products are readily ionizable under ESI-MS/MS or MALDI-TOF and generates a product ion characterized by a high signal to noise ratio, and the substrate is optionally selected from:
In some embodiments, the reporter enzyme detection probe substrate is se-lected from pyridoxamine-5-phosphate (PA5P), p-nitrophenyl phosphate (PNPP), Am-plex® Red (AR), naphthol ASMX phosphate, luminol, Lumigen® TMA3, Lumigen® TMA6, sphingosine, 4MUP, L-(+)-2-amino-6-phosphonohexanoic acid, 5-bromo-4-chloro-3-indolyl phosphate (BCIP), BluePhos®, phenylbenzene ω phosphono-α-amino acid, O-phospho-DL-threonine, adenosine monophosphate (AMP), AR (3-amino-9-ethylcarbazole), 4-CN (4-chloro-1-naphtol), DAB (3,3′-DiAminoBenzimidine), OPD (o-phenylene diamine), TMB (3,3″,5,5-tetramethylbenzidine), pNPP (p-nitrophenyl phosphate), NBT (nitroblue tetrazolium), INT (p-iodonitrotetrazolium), MUP (4-methylumbelliferyl phosphate), and FDP fluorescein diphosphate), pyrogallol.
In some embodiments, the reporter enzyme detection probe substrate is selected from:
In some embodiments, the method of detecting a target nucleic acid molecule of the present disclosure further comprises washing the solid phase with the second binding solution prior to incubating the target:detection complex with the reporter enzyme detection probe.
In some embodiments, the method of detecting a target nucleic acid molecule of the present disclosure further comprises washing the solid phase with a blocking agent, optionally bovine serum albumin (BSA), prior to binding the target nucleic acid molecule to the solid phase.
In some embodiments, the substrate reaction solution comprises a non-ionic non polymeric detergent, optionally selected from N-octylglucoside, deoxycholate, rapigest, octyl-beta-glucopyranoside, octylglucopyranoside, chaps, big chap, non-ionic acid labile surfactants, glucosides, n-Octyl-β-D-glucopyranoside, n-Nonyl-β-D-glucopyranoside thioglucosides, n-Octyl-β-D-thioglucopyranoside malto-sides, n-Decyl-β-D-maltopyranoside, n-Dodecyl-β-D-maltopyranoside, n-Undecyl-β-D-maltopyranoside, n-Tridecyl-pi-D-maltopyranoside, cymal-5. cymal-6, thiomaltosides, n-Dodecyl-β-D-thiomaltopyranoside, alkyl glycosides, octyl glucose neopentyl gly-col, polyoxyethylene glycols, triton, NP40, Tween™, Tween™ 20, Triton X-100, triton x-45, C8E4, C8E5, C10E5, C12E8, C12E9, Brij, Anapoe-58, Brij-58, and combinations thereof.
In some embodiments, the substrate reaction solution further comprises 4-iodophenylboronic acid when the substrate comprises luminol.
In some embodiments, the solid phase is a reaction vessel optionally a bead, a plate, a capillary, a filter, or a nano/micro/milli well reaction vessel, and wherein the surface is selected from paper, nitrocellulose, acrylate, plastic, polystyrene, polyvinylene fluoride (PVDF), melamine, silica, polylysine coated glass, 3-aminopropyl-triethoxysilane (APTES) treated glass, and 3-aminopropyl-trimethoxysilane (APTMS) treated glass.
In some embodiments, the attaching of the capture oligonucleotide probe to the solid phase is through H-hydroxysuccinimide (NHS), N-oxysuccinimide (NOS), maleimide, hydrazide, glutaraldehyde coupling, or PEG cross-linking.
In some embodiments, the product ion is assayed by SIM and/or SRM using an optimized fragmentation energy and m/z range.
In some embodiments, the substrate is AMP, ADP or ATP and one or the ionizable products generated comprises adenosine, the product ion of which is assayed by SIM at 268 m/z; or the substrate is CMP, CDP or CTP and one or the ionizable products generated comprises cytosine, the product ion of which is assayed by SIM at 283 m/z; or the substrate is AR and one of the one or more ionizable products generated comprises resorufin, the product ion of which is assayed by SIM at 214 m/z and SRM using the major intense fragment at 214-186 m/z.
In some embodiments, the substrate is naphthol ASMX phosphate and one of the one or more ionizable products generated comprises dephosphorylated naphthol ASMX, the product ion of which is assayed by SIM at 292 m/z and SRM using the major intense fragment at 292-171 m/z or the substrate is PA5P and one or the ionizable products generated comprises PA, the product ion of which is assayed by SIM at 169 m/z.
In some embodiments, the ionizable products are ionized to product ions in ionization solution.
In another aspect, the present disclosure includes a method of quantifying the amount of a target nucleic acid molecule in a test sample comprising the steps:
In some embodiments, the quantification comprises comparing the intensity of the signal for one or more products against signal intensities generated using known quantities of the target nucleic acid molecule, under similar conditions.
In some embodiments, the target nucleic acid molecule is present or suspected to be present in the sample in or up to a pico mol, femto mol, or atto mol range.
In some embodiments, one or more target oligonucleotide templates are detected.
In some embodiments, the target nucleic acid molecule is a plasmid DNA or a sequence comprised in a bacterial, viral, fungal, mammalian or plant genome.
In some embodiments, the bacterial genome is selected from E. coli, Staphylococcus aureus, Chlamydia, Vibrio cholera, Clostridium, Enterococci, Fusobacterium, anaerobic bacilli, Gram negative cocci, Gram positive bacilli, Haemophilus, Haemophilus influenza, Klebsiella, Lactobacillus, Listeria, Borrelia, Mycobacterium, Mycoplasma, Neisseria, Prevotella, Pseudomonas, Salmonella, Shigella, Spirochaetes, Staphylococcus, Streptococcus, and Yersinia genome.
In some embodiments, the bacterial genome is selected from E. coli, and Staphylococcus aureus.
In some embodiments, the viral genome is selected from HIV, SARS-CoV, MERS, SARS-CoV-2, Ebola virus, influenza virus, coronavirus genome, Enteroviruses, Hepatitis virus, Herpes virus, HPV, Noroviruses, Parainfluenza, Rhinoviruses, and Varicella Virus genome
In some embodiments, the viral genome is selected from HIV, SARS-CoV, MERS, SARS-CoV-2, Ebola virus, influenza virus, and coronavirus genome.
In some embodiments, the fungal genome is selected from Candida genome.
In some embodiments, the mammalian genome is a human genome.
In some embodiments, the target nucleic acid molecule has a sequence comprised in the HIV genome. In some embodiments, the target nucleic acid molecule has a sequenced comprised in the SARS-CoV-2 genome.
In another aspect, the present disclosure includes a method of detecting HIV comprising a method of detecting a target nucleic acid molecule of the present disclosure, wherein the target nucleic acid molecule is a HIV nucleic acid molecule.
In some embodiments, the method of detecting HIV comprises a method of detecting a target nucleic acid molecule of the present disclosure, wherein the capture oligonucleotide probe has a sequence selected from SEQ ID No. 14, SEQ ID No 17, SEQ ID No 20, and SEQ ID No 23.
In some embodiments, the method of detecting HIV comprises a method of detecting a target nucleic acid molecule of the present disclosure, wherein the detection oligonucleotide probe oligonucleotide has a sequence selected from SEQ ID No. 16, SEQ ID No 19, SEQ ID No 22, and SEQ ID No. 25.
In some embodiments, the method of detecting HIV comprises a method of detecting a target nucleic acid molecule of the present disclosure, wherein the capture oligonucleotide probe has a sequence selected from SEQ ID No. 14, SEQ ID No 17, SEQ ID No 20, and SEQ ID No 23.
In another aspect, the present disclosure includes a method of detecting SARS-CoV2 comprising a method of detecting a target nucleic acid molecule of the present disclosure, wherein the target nucleic acid molecule is a SARS-CoV2 nucleic acid molecule.
In some embodiments, the method of detecting SARS-CoV2 of the present disclosure comprises a method of detecting a target nucleic acid molecule of the present disclosure, wherein the capture oligonucleotide probe has a sequence selected from SEQ ID No. 6, and SEQ ID No. 13.
In some embodiments, the method of detecting SARS-CoV2 of the present disclosure comprises a method of detecting a target nucleic acid molecule of the present disclosure, wherein the detection oligonucleotide probe oligonucleotide has a sequence selected from SEQ ID No. 5, and SEQ ID No. 12.
In some embodiments of the method of detecting SARS-CoV2 of the present disclosure, the modified primer has a sequence selected from SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 7, SEQ ID No. 8, SEQ ID No. 9, and SEQ ID No. 10.
In some embodiments of the method of detecting SARS-CoV2 of the present disclosure, the second primer has a sequence selected from SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 7, SEQ ID No. 8, SEQ ID No. 9, and SEQ ID No. 10.
In some embodiments of the method of detecting SARS-CoV2 of the present disclosure, the modified primer has sequence of SEQ ID No. 2, and the second primer has sequence of SEQ ID No. 3, or SEQ ID No 8.
In some embodiments of the method of detecting SARS-CoV2 of the present disclosure, the modified primer has sequence of SEQ ID No. 3, and the second primer has sequence of SEQ ID No. 2, or SEQ ID No. 7.
In some embodiments of the method of detecting SARS-CoV2 of the present disclosure, the modified primer has sequence of SEQ ID No.7, and the second primer has sequence of SEQ ID No 3, or SEQ ID No. 8.
In some embodiments of the method of detecting SARS-CoV2 of the present disclosure, the modified primer has sequence of SEQ ID No. 8, and the second primer has sequence of SEQ ID No 2, SEQ ID No. 7.
In some embodiments of the method of detecting SARS-CoV2 of the present disclosure, the modified primer has sequence of SEQ ID No. 9, and the second primer has sequence of SEQ ID No.10.
In some embodiments of the method of detecting SARS-CoV2 of the present disclosure, the modified primer has sequence of SEQ ID No. 10, and the second primer has sequence of SEQ ID No.9.
In some embodiments of the method of detecting SARS-CoV2 of the present disclosure, the modified primer has sequence of SEQ ID No. 38, and the second primer has sequence of SEQ ID No.39.
In some embodiments of the method of detecting SARS-CoV2 of the present disclosure, the modified primer has sequence of SEQ ID No. 39, and the second primer has sequence of SEQ ID No.38.
In some embodiments of the method of detecting SARS-CoV2 of the present disclosure, the modified primer has sequence of SEQ ID No. 41, and the second primer has sequence of SEQ ID No.42.
In some embodiments of the method of detecting SARS-CoV2 of the present disclosure, the modified primer has sequence of SEQ ID No. 42, and the second primer has sequence of SEQ ID No.41.
Other primers could also be used.
In another aspect, the present disclosure includes a kit comprising:
In another aspect, the present aspect includes a kit comprising:
In some embodiments, the ionization solution comprises an acid or a base, optionally selected from formic acid, acetic acid, trifluoroacetic acid. ammonium hydroxide, methylamine, ethylamine, or propylamine.
In some embodiments, the quenching solution comprises optionally 50% Acetonitrile, 0.1% Acetic acid or 0.1% formic acid or 0.1% trifluoroacetic acid for positive ionization or 0.1% ammonium hydroxide for negative ionization.
In some embodiments, the capture oligonucleotide probe comprises a sequence selected from SEQ ID No. 6, SEQ ID No. 13, SEQ ID No. 14, SEQ ID No 17, SEQ ID No 20, SEQ ID No 23, SEQ ID No 26, SEQ ID No 29, SEQ ID No 32, and SEQ ID No 35.
In some embodiments, the oligonucleotide of the detection oligonucleotide probe comprises a sequence selected from SEQ ID No. 5, SEQ ID No. 12, SEQ ID No. 16, SEQ ID No 19, SEQ ID No 22, SEQ ID No 25, SEQ ID No 28, SEQ ID No 31, SEQ ID No 34, and SEQ ID No 37.
In some embodiments, the capture oligonucleotide probe comprises a sequence of SEQ ID No 14, and the oligonucleotide of the detection oligonucleotide probe has a sequence of SEQ ID No. 16.
In some embodiments, the capture oligonucleotide probe comprises a sequence of SEQ ID No. 6, and the oligonucleotide of the detection oligonucleotide probe has a sequence of SEQ ID No. 5.
In some embodiments, the capture oligonucleotide probe comprises a sequence of SEQ ID No. 13, and the oligonucleotide of the detection oligonucleotide probe has a sequence of SEQ ID No.12.
In some embodiments, the capture oligonucleotide probe comprises a sequence of SEQ ID No 17, and the oligonucleotide of the detection oligonucleotide probe has a sequence of SEQ ID No. 19.
In some embodiments, the capture oligonucleotide probe comprises a sequence of SEQ ID No 20, and the oligonucleotide of the detection oligonucleotide probe has a sequence of SEQ ID No. 22.
In some embodiments, the capture oligonucleotide probe comprises a sequence of SEQ ID No 23, and the oligonucleotide of the detection oligonucleotide probe has a sequence of SEQ ID No. 25.
In some embodiments, the capture oligonucleotide probe comprises a sequence of SEQ ID No 26, and the oligonucleotide of the detection oligonucleotide probe has a sequence of SEQ ID No. 28.
In some embodiments, the capture oligonucleotide probe comprises a sequence of SEQ ID No 29, and the oligonucleotide of the detection oligonucleotide probe has a sequence of SEQ ID No. 31.
In some embodiments, the capture oligonucleotide probe comprises a sequence of SEQ ID No 32, and the oligonucleotide of the detection oligonucleotide probe has a sequence of SEQ ID No. 34.
In some embodiments, the capture oligonucleotide probe comprises a sequence of SEQ ID No 35, and the oligonucleotide of the detection oligonucleotide probe has a sequence of SEQ ID No. 37.
In some embodiments, the capture probe is SEQ ID NO: 44 or 45.
The capture oligonucleotide probe can also be a fragment of a capture probe described herein, for example comprising at least 70%, 80% or 90% of the probe sequence.
In some embodiments, the modified primer and the second primer are primers for a target nucleic acid molecule that has a sequence comprised in a bacterial, viral, fungal, mammalian or plant genome.
In some embodiments, the modified primer has a sequence selected from SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 7, SEQ ID No. 8, SEQ ID No. 9, SEQ ID No. 10, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 41 and SEQ ID NO: 42.
In some embodiments, the second primer has a sequence selected from SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 7, SEQ ID No. 8, SEQ ID No. 9, SEQ ID No. 10, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 41 and SEQ ID NO: 42.
In some embodiments, the modified primer has sequence of SEQ ID No. 2, and the second primer has sequence of SEQ ID No. 3, or SEQ ID No 8.
In some embodiments, the modified primer has sequence of SEQ ID No. 3, and the second primer has sequence of SEQ ID No. 2, or SEQ ID 7.
In some embodiments, the capture oligonucleotide has sequence of SEQ ID No. 6.
In some embodiments, the modified primer has sequence of SEQ ID No.7, and the second primer has sequence of SEQ ID No. 8.
In some embodiments, the modified primer has sequence of SEQ ID No. 8, and the second primer has sequence of SEQ ID No.7.
In some embodiments, the modified primer has sequence of SEQ ID No. 9, and the second primer has sequence of SEQ ID No.10.
In some embodiments, the modified primer has sequence of SEQ ID No. 10, and the second primer has sequence of SEQ ID No.9.
In some embodiments, the capture oligonucleotide has sequence of SEQ ID No. 13.
In some embodiments, the modified primer has sequence of SEQ ID No. 38, and the second primer has sequence of SEQ ID No. 39.
In some embodiments, the modified primer has sequence of SEQ ID No. 39, and the second primer has sequence of SEQ ID No. 38.
In some embodiments, the modified primer has sequence of SEQ ID No.41, and the second primer has sequence of SEQ ID No. 42.
In some embodiments, the modified primer has sequence of SEQ ID No. 42, and the second primer has sequence of SEQ ID No.41.
The primer can also be a fragment of a primer provided herein or comprise additional complementary sequence. For example, the fragment can be at least 70%, 80%, or 90% of the sequence of a primer described herein.
In some embodiments, the capture oligonucleotide has sequence of SEQ ID No. 44 or 45.
In another aspect, the present disclosure includes a nucleic acid of sequence selected from SEQ ID No. 2 to 46.
Also provided is a vector, kit or composition comprising one or more of the nucleic acids of sequence selected from SEQ ID No. 2 to 46.
The nucleic acids can in some embodiments be labelled with a tag. They may also be provided unlabelled optionally in combinations such as in a kit, with a label and reagents for producing the labelled nucleic acid.
The following non-limiting examples are illustrative of the present disclosure.
Alkaline phosphatase streptavidin conjugate (APSA) with a nominal mass of 195,000 kDa (1 mg in 1 mL of 0.01M Tris-HCl, 0.25M NaCl, pH 8.0 with 15 mg/mL Bovine Serum Albumin) was from Jackson Immuno Research Laboratories (West Grove, PA, USA). The AMP substrate and Tris buffer were from Sigma Aldrich (St Louis MO, USA). The NHS-PEG12-Biotin was from Pierce (Thermo Fisher Scientific). The NHS-PEG-NHS was 0,0′-Bis[2-(N-Succinimidyl-succinylamino)ethyl]polyethylene glycol, 2000, from Sigma Aldrich. The 96 well reactive plates were Nunc™ Immobilizer Amino plates from Thermo Fisher Scientific and Corning® DNA-BIND® 96 well plates from Sigma Aldrich. The round cover glass (5 mm Diameter, 0.16-0.19 mm thickness) was from Electron Microscopy Sciences. 3-Aminopropyltriethoxysilane (APTES) is from Thermo Fisher Scientific.
The PVDF membrane can be any common PVDF transfer membrane used for example for Western blots. For example, suitable PVDF membranes include Immobilon-P™ transfer membrane. For example, suitable PVDF membranes can have a pore size of 0.45 μm. For example, PVDF membrane can be in the form of a filter plate, optionally a multiwell filter plate. For example, the bottom of each well of a plate can be fitted with a PVDF membrane. For example, the multiwell plate can be a 96-well filter plate.
The polystyrene support used below is a 1000 Å, C-18 linker attached, non-cleavable spacer polystyrene support obtained from ChemGenes Coporation (Catalog #N-4545-10b). The polystyrene support has the following structure where DMTr refers to dimethyltrityl:
Long-chain alkylamine carboxyl controlled pore glass (CPG long-chain alkylamine support, 500 A pore size, 125-177 micron diameter) may be obtained from Pierce Chem. Co. Sephacryl S-500 may be obtained from Pharmacia. 12% cross-linked polystyrenedivinylbenzene (12% polystyrene-divinylbenzene) resin (200-400 mesh) was purchased from Polysciences.
The nucleocapsid plasmid was obtained from IDT 2019-nCoV_N_Positive Control plasmid (Cat #10006625) and transformed into DH5α from Invitrogen and plated on ampicillin plates, streaked, cultured overnight and then grown for a Qiagen maxi-preps and then quantified by 260/280 ratio. The PCR reactions will created using the ROCHE PCR buffers and with a log titration from 1, 10, 100 zeptomol, 1, 10, 100 attomol, 1, 10, 100 femtomol, 1, 10 picomol of the nucleocapsid plasmid obtained from plasmid per reaction in a Bio-Rad T100 Thermo Cycler for 35 cycles. The PCR products less than 300 bases were resolved by TBE PAGE for quantification by Gelred alongside standard and cut plasmid quantitative standard curve run into the gel.
The model 1100 HPLC was from Agilent (Santa Clara, CA, USA). The model 7725 injector was from Rheodyne (IDEX, Rohnert Park, CA). The LTQ XL linear quadrupole ion trap was from Thermo Electron Corporation (Waltham, MA, USA). The Zorbax 3.5 micron 300 Å C18 resin was from Chromatographic Specialties (Brockville, ON, CANADA).
The APSA enzyme that is a universal biotin binding signal amplification enzyme conjugate showed a linear range from 1 pg to 50 pg per 96 well with BCIP/NBT in pH 8.85 20 mM Tris by UV/VIS detection at around 600 nm.
APSA was dissolved in Reaction Buffer (20 mM Tris, pH 8.85) for assay by colorimetric reaction with BCIP/NBT dye substrate to form indigo blue in 0.1% Tween 20, and measured at 595 nm on a 96 well plate reader (Bio-Rad). Adenosine served as an absolute standard for LC-ESI-MS reactions and was dissolved in 70% acetonitrile (ACN) with 0.1% acetic acid. In parallel, APSA was reacted with AMP to form adenosine that may be sensitively detected by LC-ESI-MS. For “DNA ELiMSA” assays, the APSA was dissolved in 10 ml of reaction buffer of 20 mM Tris, pH 8.85, to yield a 1 ng per μL stock. The APSA 1 ng/μL was diluted in series by dissolving 10 μL in 10 ml reaction buffer to yield 1 pg/μL and then the working stock of 1 fg/μL (1000 ag/μL). The 1 fg/μL working stock was used to make a linear dilution series from 0.1 to 1000 femtogram per ml of buffer and reacted at 37° C. with 1 μM to 1 mM AMP for 2 h. For LC-ESI-MS/MS assays the reaction was quenched 1:1 (DF 2) in acetonitrile with 0.2% acetic acid on ice and then loaded into a 96 well plate autosampler injecting 2 μL with isocratic separation at 200 μL per minute with an Agilent 1100 HPLC over 5 micron C18 (2.1 mm×150 mm) in 7.5% or 95% acetonitrile with 0.1% acetic acid at 20 μL/min for LC-ESI-MS with a linear quadrupole ion trap (Thermo) tuned with adenosine at 268.2 [M+H]+. The AMP substrate and adenosine product from the enzyme conjugate APSA were quantified in the SIM mode and the adenosine peak data extracted after subtracting and averaging local background adjacent to the 268.24 [M+H]+ m/z chromatographic peak at about 1.2 minutes. Alternatively the SRM product of MS/MS: Full scan: m/z 120 to 400 m/z SRM: 268→136, isolation window: 2 Da, Collision energy 35 CID was monitored.
Blocking buffer can be but is not limited to a serum-based, BSA or Albumin based, polylysine-based, fibronectin-based, gelatin-based, or skim milk powder-based buffer. The blocking buffer can further comprise detergents such as non-ionic detergents including deoxycholate, n-octylglucoside N-octyl-β-glucopyranoside, Big CHAP deoxy, acid-cleavable detergent, EDTA. The blocking buffer can further comprise a buffering agent such as TRIS. It may be appreciated by a person skilled in the art that other blocking buffers similar to the ones described above can also be used depending on the specific application of the methods of the present disclosure.
Binding buffer can be but is not limited to TRIS, PBS, HEPES, MES or MOPS-based buffer. It may be appreciated by a person skilled in the art that other binding buffers similar to the ones described above can also be used depending on the specific application of the methods of the present disclosure. In some instances, the binding buffer can further comprise other components such as salts. In the case where the binding buffer comprises salts, for the MS analysis, the sample containing the one or more ionizable products may be optionally run with a salt divert valve to prevent salt from reaching the ionization source. Alternatively or additionally, the sample containing the one or more ionizable products may also be desalted by chromatography (for example using C18 chromatography column) prior to the MS analysis. Further, the sample containing the one or more ionizable products may also be diluted in organic solvent and centrifuged prior to injection.
The following shows a general method of nucleic acid adsorption and detection on a PVDF filter plate.
Using the target nucleic acid molecule, the capture oligonucleotide and the detection oligonucleotide sequences of HIV viral DNA listed in Table 6 as examples, immobilization of the specific Capture oligonucleotide probe by adsorption to Immobilon-P™ PVDF membrane in 96 well plates resulted in a signal intensity of over 55,000 arbitrary counts on a background of less than 7,000 counts from the specific detection DNA. The signal for 100 fmol of target viral DNA on column 4 independent replicates is shown in
The following shows a general method of nucleic acid adsorption and detection on a polylysine coated polystyrene plate.
Using the target nucleic acid molecule, the capture oligonucleotide and the detection oligonucleotide sequences of HIV viral DNA listed in Table 6 as examples, a signal intensity of 42,000 counts on a background of about 8,000 counts was observed when viral target nucleic acid molecule was captured on polystyrene plates coated with polylysine and crosslinked with an 5′- or 3′-aminated viral Capture oligonucleotide probe by NHS-PEG-NHS and the equivalent of 100 fmol of captured target nucleic acid molecule was injected on column. The results from the equivalent of 100 fmol target nucleic acid molecule injected on column from 3 independent replicates are shown
The following shows a general method of nucleic acid adsorption and detection on an amine-reactive Nunc Immobilizer™ Amino polystyrene plate.
Using the target nucleic acid molecule, the capture oligonucleotide and the detection oligonucleotide sequences of HIV viral DNA listed in Table 6 as examples, immobilization of the 5′- or 3′-aminated viral Capture oligonucleotide probe via amine-reactive functional groups (reactive carboxylic functional groups) in 96 well Nunc Immobilizer Amino plates resulted in 27,000 counts on a background of 3,000 counts. The results from the equivalent of 100 fmol Target nucleic acid molecule injected on column are shown in
The following shows a general method of nucleic acid adsorption and detection on an N-oxysuccinimide (NOS) surface chemistry polystyrene plate.
Using the target nucleic acid molecule, the capture oligonucleotide and the detection oligonucleotide sequences of HIV viral DNA listed in Table 6 as examples, immobilization of 5′- or 3′-aminated viral Capture oligonucleotide probe by N-oxysuccinimide (NOS) surface chemistry in Corning® DNA-BIND® 96 well plates for capturing target nucleic acid molecule resulted in 22,000 specific counts compared to a background of about 3,000 counts. The results from the equivalent of 100 fmol Target DNA injected on column from 3 independent replicates are shown in
The following shows a general method of nucleic acid detection where the capture oligonucleotide probe is 3′ linked polystyrene oligosynthesis beads in a PVDF filter plate.
Using the target nucleic acid molecule, the capture oligonucleotide and the detection oligonucleotide sequences of HIV viral DNA listed in Table 6 as examples, viral DNA captured by Capture oligonucleotide probe with 3′ links to polystyrene oligosynthesis beads in 96 well PVDF filter plate resulted in a signal of 42,000 specific counts compared to a background of about 8,000 counts. The results from the equivalent of 100 fmol Target nucleic acid molecule injected on column from 3 independent replicates are shown in
The following shows a general method of nucleic acid detection where the capture oligonucleotide probe is crosslinked to amino-silylated cover glass surface.
Using the target nucleic acid molecule, the capture oligonucleotide and the detection oligonucleotide sequences of HIV viral DNA listed in Table 6 as examples, immobilization of the 5′- or 3′-aminated viral Capture oligonucleotide probe on a glass surface via the amino-silylation of the glass and crosslinking by NHS-PEG-NHS resulted in 35,000 counts on a background of 6,000 counts. The results from the equivalent of 100 fmol Target nucleic acid molecule injected on a column from 3 independent replicates are shown in
Buffer optimization experiments are described in Examples 7 and 8 using capture oligonucleotide probe linked to polystyrene oligosynthesis beads in 96 well 0.45 μm PVDF filter plates as previously described in Example 5 with slight modifications.
The PVDF filter plate was blocked with 3% BSA for 1 h and washed 3 times with 20 mM Tris-HCl, 1 mM EDTA, pH8.0 and equilibrated in binding buffers of various NaCl concentrations: 0, 0.05, 0.1, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5 and 2.0 M. Separately, capture beads were blocked with 3% BSA for 15 min and washed in 20 mM Tris-HCl, 1 mM EDTA by centrifugation and equilibrated in the various binding buffers. The capture oligonucleotide probe and target nucleic acid molecule were applied to the beads in the various binding buffers for DNA hybridization at 90° C. for 15 minutes followed by 60° C. for 1 hour. Beads were transferred to the PVDF filter plates, washed 3 times in the various binding buffers and incubated for 15 min at 37° C. with APSA. Unbound APSA was washed away in 9 washes of the various binding buffers and the beads were incubated with 1 mM AMP substrate for 2 hours in 20 mM Tris-HCl, pH 8.85. The reaction was quenched and diluted 1:20 in 100% and a final concentration of 0.1% acetic acid. The samples were separated by a C18 reverse phase 3.5 um column with a 100% acetonitrile, 0.1% acetic acid mobile phase and the adenosine product was detected by an LTQ linear ion trap at 268.2 m/z [M+H]+. Each sample was injected twice and the NaCl optimum was identified at 1.5M. The results of MS signal intensity at different concentrations of NaCl are shown in
The PVDF filter plate was blocked with 3% BSA for 1 h and washed 3 times with 20 mM Tris-HCl, 1 mM EDTA, pH8.0 and equilibrated in binding buffers of various ammonium bicarbonate concentrations: 0, 0.1, 0.5, 1.0, 1.5, 2.0, 2.5 M. Separately, capture beads were blocked with 3% BSA for 15 min and washed in 20 mM Tris-HCl, 1 mM EDTA by centrifugation and equilibrated in the various binding buffers. The capture oligonucleotide probe and target nucleic acid molecule were applied to the beads in the various binding buffers for DNA hybridization at 90° C. for 15 minutes followed by 60° C. for 1 hour. Beads were transferred to the PVDF filter plates washed 3 times in the various binding buffers and incubated for 15 min at 37° C. with APSA. Unbound APSA was washed away in 9 washes of the various binding buffers and the beads were incubated with 1 mM AMP substrate for 2 hours in 20 mM Tris-HCl, pH 8.85. The reaction was quenched and diluted 1:20 in 100% and a final concentration of 0.1% acetic acid. The samples were separated by a C18 reverse phase 3.5 um column with a 100% acetonitrile, 0.1% acetic acid mobile phase and the adenosine product was detected by an LTQ linear ion trap at 268.2 m/z [M+H]+. Each sample was injected twice and the ammonium bicarbonate optimum was identified at 1.5M. The results are shown in
The target nucleic acid molecule, capture oligonucleotide probe and detection oligonucleotide probe are HIV sequences are shown in Table 6.
The PVDF filter plate was blocked with 3% BSA for 1 h and washed 3 times with 20 mM Tris-HCl, 1 mM EDTA, pH8.0 and equilibrated in 1.5M NaCl, 20 mM Tris-HCl, 1 mM EDTA, pH8.0 (binding buffer). Separately, capture beads were blocked with 3% BSA for 15 min and washed in 20 mM Tris-HCl, 1 mM EDTA by centrifugation and equilibrated in binding buffer. The capture oligonucleotide probe and target nucleic acid molecule were applied to the beads in binding buffer for DNA hybridization at 90° C. for 15 minutes followed by 60° C. for 1 hour. Beads were transferred to the PVDF filter plates washed 3 times in binding buffers where the 1.5M NaCl was replaced by either: 0.5, 1.0, 1.5, 2.0, 2.5 M ethanolamine, 0.5, 1.0, 1.5, 2.0, 2.5 M ammonium acetate, 0.5M triethyl ammonium bicarbonate, 0.5, 1.0, 1.5, 2.0, 2.5 M ammonium bicarbonate or the standard 1.5M NaCl. APSA was applied the beads in the various binding buffers and incubated for 15 min at 37° C. Unbound APSA was washed away in 9 washes of the various binding buffers and the beads were incubated with 1 mM AMP substrate for 2 hours in 20 mM Tris-HCl, pH 8.85. The reaction was quenched and diluted 1:20 in 100% and a final concentration of 0.1% acetic acid. The samples were separated by a C18 reverse phase 3.5 um column with a 100% acetonitrile, 0.1% acetic acid mobile phase and the adenosine product was detected by an LTQ linear ion trap at 268.2 m/z [M+H]+. Each sample was injected twice and the best performing volatile buffer was 2M ethanolamine. The results are shown in
PCR primers and oligo capture and detection DNA sequences were designed using the NCBI PCR and oligo DNA algorithm PCR-BLAST that takes into account the interfering effects of miRNA and ncRNA (Tables 1 to 6). A high false negative rate observed in ruPR reactions of for SARS-CoV-2 (Xie, 2020). A flexible set of PCR primers and/or nested oligo capture sequences were designed to amplify and then capture the SARS-CoV-2 PCR products for a second stage amplification by alkaline phosphatase and LC-ESI-MS detection. The primers are compared to those recommended by the World Health Organization as a control.
Design considerations for oligonucleotide hybridization probes specific for SARS-CoV-2 nucleocapsid gene (SEQ ID No.1) that is homologous to SARS and MERS showing region targeted by the NCBI Primer-BLAST algorithm in the NC_045512.2:28274-29533 Wuhan seafood market pneumonia virus isolate Wuhan-Hu-1, nucleocapsid gene. In Table 1, capture and detection oligo sites are shown in bold underline.
ATGCACCCCGCATTACGTTTGGTGGACCCTCAGATTCAA
TAATACTGCGTCTTGGTTC
ACCGCTCTCACTCAACATGGCAAGGAAGACCTTAAATTCCCTCGAGGACAA
GGCGTTCCAATTAACACCAATAGCAGTCCAGATGACC
AAATTGGCTACTACCGAAGAGCTACCAGACGAA
TCATATGGGTTGCAACTGAGGGAGCCTTGAAT
Capture and detection regions are underlined. Italics indicate primer regions.
A first set (SARS CoV2 Set 1) of PCR primers for SARS-CoV-2 nucleocapsid are shown in Table 2. Abbreviations: FP, forward primer; RP, reverse primer; P/N polystyrene oligosynthesis bead/covalent Amine link 96 well plate; B, biotin. Optionally, the primers (e.g. SEQ ID No. 2) can be functionalized with biotin and/or be conjugated to a polystyrene oligosynthesis bead.
A second set (SARS CoV2 Set 2) of PCR primers for SARS-CoV-2 nucleocapsid gene, an example of a corresponding target nucleic acid molecule sequence and an exemplary set of corresponding capture and detection oligonucleotide probes are shown in Table 3. Abbreviations: C, capture oligo; D, detection oligo; FP, forward primer; RP, reverse primer; P/N polystyrene oligosynthesis bead/covalent Amine link 96 well plate; b, biotin; PCR, reaction product.
A third set (SARS CoV2 Set 3) of PCR primers for the SARS-CoV-2 Nucleocapsid sequence is shown in Table 4. Abbreviations: FP, forward primer; RP, reverse primer; P/N polystyrene oligosynthesis bead/covalent Amine link 96 well plate; B, biotin.
Another set (SARS CoV2 Set 4) of PCR primer design for SARS-CoV-2, an example of a corresponding target nucleic acid molecule sequence and an exemplary set of corresponding capture and detection oligonucleotide probes are shown in Table 5. Abbreviations: FP, forward primer; RP, reverse primer; P/N polystyrene oligosynthesis bead/amine link; b, biotin. A longer reaction product with the same capture and detection oligonucleotides (Table 3) results from the primers: Forward, 5′-TGGACCCCAAAATCAGCGAA-3′ (SEQ ID No. 7); Reverse, 5′-TGCCGTCTTTGTTAGCACCA-3′ (SEQ ID No. 8).
HIV specific capture and detection oligonucleotide probe sequences (HIV Set 1) and a possible corresponding target nucleic acid molecule are listed in Table 6. Other sets (HIV Sets 2 to 4) of HIV specific capture and detection oligonucleotide probe sequences and possible corresponding target nucleic acid molecules are listed in Tables 7 to 9 respectively. The bolded sequences in the target nucleic acid molecule sequences corresponding to the overlap with the capture and detection oligonucleotide probe sequences.
CAGTCCCGCCCAGGCCACGCCTCCCTGGAAAGT
CCCCAGCGGAAAG
GAAGTACTCCGGAT-3'
GAATAATAGGGCATTTACAACCATCCCTTC
AGACAGGATCAGAAGAACTT
TATTGTTATTGTGTGCATCAAAGGATAGAG
GTAAAAGACACCAATG-3′
GCCCAGAAGTAATACCCATGTTTACAGCAT
TATCAGAAGGGGCCACCCCA
GCAGCCATGCAAATGTTAAAAGAGACCATC
AATGAGGAAGC
CCACCTATCCCAGTAGGAGAAATCTATAAA
AGATGGATAATCCTGGGATT
CATTCTGGACATAAGACAAGGACCAAAAGA
ACCCTTTAGAGACTATGTAG-3′
Shiga toxin-producing E. coli (STEC) specific capture and detection oligonucleotide probe sequences (STEC Sets 1 to 3) and a possible corresponding target nucleic acid molecule are listed in Tables 10 to 12 respectively. The bolded sequences in the target nucleic acid molecule sequences corresponding to the overlap with the capture and detection oligonucleotide probe sequences.
CTTCGTTAAATAGTATACGGACAGAGATAT
CGACCCCTCTTGAACATATA
CCCACCGGGCAGTTATTTTGCTGTGGATAT
ACGAGGGCTTGATGTCTATC-3′
CCTTTAATAATATATCAGCGATACTGGGGA
CTGTGGCCGTTATACTGAAT
TCTGTTCGCGCCGTGAATGAAGAGAGTCAA
CCAGAATGTCAGATAACTGG-3′
GACACATTTACAGTGAAGGTTGACGGGAAA
GAATACTGGACCAGTCGCTG
GTTGACAGGAATGACTGTCACAATCAAATC
CAGTACCTGTGAATCAGGCT-3'
Alpha-hemolysin producing Staphylococcus aureus specific capture and detection oligonucleotide probe sequences (SAUREUS Set 1) and a possible corresponding target nucleic acid molecule are listed in Table 13. The bolded sequences in the target nucleic acid molecule sequences corresponding to the overlap with the capture and detection oligonucleotide probe sequences.
S. Aureus Specific Capture and Detection
CATATGATAGAGATTCTTGGAACCCGGTAT
ATGGCAATCAACTTTTCATG
TCCTAACAAAGCAAGTTCTCTATTATCTTC
AGGGTTTTCACCAGACTTCG-3′
FOR TABLES 6, 7, 8 9 the PCR primers may be in the first 36 bases on the 5′ side or any flanking sequence that will amplify the target that will generate product of at least 100 bp or more optimally 150, 200 or 300 bp.
P/N denotes that the sequence can comprise a phosphate end (as found in nucleotides) or an amine for example for attachment to a solid support.
PCR reactions were initiated with 10 ng of template plasmid DNA (SARS-CoV2 nucleocapsid plasmid) with the following primer combinations:
The methods described herein can be applied to detect viral target nucleic acid molecule through highly selective hybridization method when the capture oligos are immobilized to the solid state and with independent biotinylated detection oligonucleotide probes for secondary enzyme amplification by the reaction of AMP with APSA. As shown herein viral DNA can be detected using various immobilization methods of Capture oligonucleotide probe and followed by selective hybridization and APSA amplification, including: Capture oligonucleotide probe non-covalently bound to PVDF membrane, Capture oligonucleotide probe 3′ coupled to polystyrene beads in a 96 well filter plate, Capture oligonucleotide probe covalently immobilized to 96 well reactive plates, Capture oligonucleotide probe covalently immobilized to 96 well polystyrene plates through polylysine coating, and to cover glass (SiO2) by amino silylation and crosslinking.
It can be appreciated that the oligonucleotide probes of the present disclosure may be prepared according methods known to a person skilled in the art or may be purchased from existing commercial sources.
For example, capture oligonucleotides may be presented on silica, polystyrene, agarose, melamine, PVDF, or other supports. The silica, polystyrene, agarose, melamine, PVDF, or other supports can be in the form of microparticles or nanoparticles. Optionally, the silica, polystyrene, agarose, melamine, PVDF, or other supports can be a 2-dimensional surface, a 3-dimensional surface, or a 1-dimensional fibre or filament.
For example, silica microparticle or nanoparticle may be functionalized to produce reactive sites for attachment of oligonucleotides. For example, silica microparticle or nanoparticle may be functionalized with an amine group using 3-aminopropyltrimethoxysilane or with an epoxide group with 3′ glycidoxy propyltrimethoxysilane. In this case, the amine or the epoxide can serve as reactive sites for attachment of oligonucleotides. Other reactive or functional sites include silanol, hydroxyl, carboxylic acid, anything that reacts with amine or carboxyl groups, maleimide, N-hydroxysuccinimide (NHS), N-oxysuccimide (NOS) H-hydroxysuccinimide (NHS), N-oxysuccinimide (NOS), maleimide, hydrazide, glutaraldehyde coupling, or PEG cross-linking
etc. Although typical for the capture or primer to comprise an amine group and the solid support to comprise a group that can react therewith, other configurations can be used. For example, a NHS group or other NOS linker can be added to the capture oligonucleotide or primer to be attached to the solid surface and the solid surface can comprise a functionalizable amine.
For example, the oligonucleotide may be attached to reactive sites one nucleotide at a time. For example, a first nucleotide may be attached via the C1 position, the 3′-OH group or the 5′-OH group. Optionally, the first nucleotide may be attached to the solid support via a linker. For example, amine oligonucleotides may be attached to carboxyl groups, such as carboxylic acid groups, optionally through activated esters thereof. For example, the first nucleotide may be attached via the 3′-OH position and the 5′-OH may be protected with dimethyltrityl (DMT) group.
For example, the oligonucleotide may be attached in portions of oligomers of nucleotides, or it may be attached as one oligonucleotide.
The oligonucleotide may be synthesized through conventional nucleotide synthesis methods known to persons skilled in the art. During organic synthesis, the synthetic intermediates can be protected using conventional protective groups known to persons skilled in the art. For example, the nucleotide base may be protected using benzoyl group or isobutyryl group. Additionally, during organic synthesis, functional groups may be modified to increase their reactivity using methods known to persons skilled in the art. For example, carboxylic acids can be activated through activated esters such as succinimide esters. For example, thiol, mecapto or sulphide or SH-oligonucleotides may be covalently linked via an alkylating agent such as iodoacetamide.
It can be appreciated that an oligonucleotide can be attached covalently to an enzyme by methods known to persons skilled in the art. For instance, the detection oligonucleotide may be attached covalently to the detection enzyme, such as APSA.
For example, proteins, peptides, enzymes, DNA, RNA or antibodies, oligomers or polymers may be coupled or cross linked primary amines (—NH2) found in N-terminus and many amino acids, carboxyls (—COOH at the C-terminus of each polypeptide chain and in the side chains of aspartic acid (Asp, D) and glutamic acid (Glu, E), Sulfhydryls (—SH) in the side chain of cysteine (Cys, C) and Carbonyls (—CHO) such as Ketone or aldehyde groups can be created in glycoproteins by oxidizing the polysaccharide post-translational modifications (glycosylation) with sodium meta-periodate. For example, NHS-activated acid may couple to a carboxylic acid in the presence of organic base in an anhydrous solvent. A coupling reagent such as dicyclohexylcarbodiimide (DCC) or ethyl(dimethylaminopropyl) carbodiimide (EDC) is then added to form a stable bound with a primary amine.
Optionally, cross-linking agents may be used. For example, mono, bifunctional or multifunctional cross-linking reagents may be used. For example, NHS, sulfo-NHS, DSS, BS3 (sulfo-DSS), amine-to-amine cross-linkers may be used. For example, water-soluble analog sulfo-NHS, hydroxybenzotriazole (HOBt), 1-hydroxy-7-azabenzotriazole (HOAt), and pentafluorophenol may all be used as linking reagents for nucleic acids, peptides and proteins or antibodies. For example, maleimide may be used for cross-linking thiol groups in for example cysteine.
It can be appreciated by a person skilled in the art that protein, peptides and nucleic acids present primary amines and/or hydroxyl groups, and may be modified or cross-linked through the primary amines and/or hydroxyl groups.
For example, Sulfo-SMCC (sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate), EDC 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide, Sulfo-NHS (N-hydroxysulfosuccinimide), BS3 (bis(sulfosuccinimidyl)suberate), DST (disuccinimidyl tartrate), SPDP (succinimidyl 3-(2-pyridyldithio)propionate) may be used as cross-linking agents. For example, dithiobis succinimidyl propionate can be used to cross-link amine to amine. For example, BMH bismaleimidohexane can be used to cross-link sulfhydryls to sulfhydryls, such as in cysteine residues in proteins or peptides.
For example, sulfo-EGS (ethylene glycol bis(sulfosuccinimidyl succinate)) can be used to cross-link amines to amines.
For example, SM(PEG)4 (PEGylated SMCC crosslinker) can be used to crosslink amines to sulfhydryl. These crosslinkers containing NHS-ester and maleimide groups at ends of water-soluble polyethylene glycol spacer arms (17.6 to 95.2 A).
For example, Sulfo-EMCS (N-ε-maleimidocaproyl-oxysulfosuccinimide ester) can be used to crosslink amines to sulfhydryls.
For example, Sulfo-SMPB (sulfosuccinimidyl 4-(N-maleimidophenyl)butyrate) can be used to crosslink amines to sulfhydryls.
It can be appreciated that a protein, a peptide, or an amine-containing molecule can be biotinylated using methods known to persons skilled in the art. For example, NHS-PEG4-Biotin N-Hydroxysuccinimide (NHS) is a pegylated, water-soluble reagent for biotin labeling.
Optionally, a linker may be used between an oligonucleotide and a protein such as an enzyme.
For example, the derivatization of the 1% cross-linked polystyrene resin may be performed according to the procedure of Horiki et al. (15).
For example, Polystyrene Carboxyl Resin: may be prepared by the method of Bayer et al. (16).
For example, Cyanogen bromide activation of Sephacryl S-500 may be performed as described by Biinemann (8).
For example, Chondroitin Sulfate-Coated CPG Supports: may be prepared by CPG long-chain alkylamine of chondroitin sulfate (type A or type C) with EDC (Ghosh Musso NAR 1987).
For example, oligonucleotides may be prepared by blocking with 5′-aminohexyl and 5′-Cystaminyl Phosphoramidate or other derivatives of oligonucleotides. For example, reaction of the 5′-phosphorylated oligonucleotides with 1,6-diaminohexane in the presence of 0.1 M EDC in 0.1 M N-methylimidazole, pH 6.0 may be carried out according to the direct coupling protocol described by Chu et al. (20)
For example, oligonucleotides may be attached to N-Hydroxysuccinimide-activated using N-hydroxysuccinimide-activated carboxyl Sephacryl support with 5′-aminohexyl or 5′-cystaminyl phosphoramidate or other protected oligonucleotide in 0.2 M HEPES, pH 7.7.
DNA detection assay was performed according to a method of DNA detection (Example 5) as described herein. HIV DNA was used as a target. The target nucleic acid molecule has sequence of SEQ ID No.15. The capture oligonucleotide probe of SEQ ID No.14 was used, with 3′ attached to polystyrene as solid support. The detection oligonucleotide probe of SEQ ID No. 16 was used with 5′ being biotinylated. Different concentrations of the target nucleic acid molecule were used: 0 attomolar (negative control), 1 attomolar, 2 attomolar, 3 attomolar, 4 attomolar, 5 attomolar, and 6 attomolar. The hybridization of capture and detection oligonucleotide probes to the target nucleic acid molecule was done in presence of NaCl. The solid support (polystyrene bead) was washed with buffer containing NaCl, and separated by centrifugation. The APSA enzyme reaction was performed in presence of NaCl. The reaction mixture was treated with C18 reverse phase chromatography using 70% acetonitrile in water as the mobile phase. 1 μL of the reaction product was injected on MS. MS detection was done at m/z=268.
DNA detection assay was performed according to a method of DNA detection (Example 5) as described herein. SARS-CoV2 DNA was used as a target. The target nucleic acid molecule has sequence of SEQ ID No.11. The capture oligonucleotide probe of SEQ ID No.13 was used, with 3′ attached to polystyrene as solid support. The detection oligonucleotide probe of SEQ ID No. 12 was used with 5′ being biotinylated. Different concentrations of the target nucleic acid molecule were used from 1 picomolar to 1 micromolar (0.1 attomolar, 1 attomolar, 10 attomolar, 100 attomolar, 1 femtomolar, 10 femtomolar, 100 femtomolar). Tris buffer was used as blank negative control for MS detection. Zero DNA target nucleic acid was used as negative control for the detection assay. The hybridization of capture and detection oligonucleotide probes to the target nucleic acid molecule was done in presence of NaCl. The solid support (polystyrene bead) was washed with buffer containing NaCl, and separated by centrifugation. The APSA enzyme reaction was performed in presence of NaCl. The reaction mixture was treated with C18 reverse phase chromatography using 95% acetonitrile in water, 0.1% acetic acid as the mobile phase, 20 μL/min. 1 μL of the reaction product was injected on MS. MS detection was done at m/z=268.
Synthetic DNA, PCR products and plasmid DNA were each used as target nucleic acid molecules. PCR products and plasmid DNA assays are described further in Example 16. Synthetic DNA, as used in these examples refers to single stranded DNA that is synthesized. PCR products refer to amplified DNA (optionally starting from RNA) and plasmid DNA comprises the target of interest in the context of a larger plasmid.
The PCR primers, oligonucleotide capture and detection probes designed in Example 10 were used in this Example and in Example 16. HIV, COVID, Shiga-toxin producing E. coli (STEC), and hemolysin DNA from synthetic targets and HIV and COVID plasmids were detected using various methods of the present disclosure as described below.
The capture oligonucleotide pobe was immobilized on a NOS surface chemistry 96 well polystyrene reactive plate.
In general, the capture oligonucleotide probe in surface binding buffer (10 mM Na2PO4+1 mM EDTA buffer, pH 8.5) was added to the plate and incubated at 4° C. overnight. The wells were then washed 3 times with additional surface binding buffer, and quenched and blocked with 3% BSA for 1 h. The quenched and blocked plate was washed 3 times with 20 mM Tris pH8.00+1 mM EDTA followed by 3 times with Binding Buffer (20 mM Tris pH8.00+1M NaCl+1 mM EDTA)
HIV, COVID, Shiga and hemolysin DNA from synthetic targets and the HIV and COVID plasmids were detected using capture oligonucleotide probes described herein.
The appropriate capture oligonucleotide probe was immobilized at the 3′-end or the 5′ end via an amine functionality, as mentioned on NOS surface chemistry 96 well polystyrene reactive plates. Each experiment was done in triplicates (n=3).
The synthetic (results described below), PCR or plasmid viral DNA (results described in Example 16) (e.g. the target nucleic aid molecule) and the corresponding detection oligonucleotide probe were added to each well of the plate (comprising the capture oligonucleotide probe) to start DNA hybridization for around 1.5 h. The wells were then washed 3 times with Binding Buffer (20 mM Tris pH8.00+1 M NaCl+1 mM EDTA). The plate was blocked with 1% BSA for 5 min and then incubated with APSA solution in 1% BSA for 15 min, and washed 11 times with designated buffers (6× quick wash with Binding Buffer (20 mM Tris pH8.00+1 M NaCl+1 mM EDTA), 3×5 min with 20 mM Tris pH8.00+1 M NaCl (no EDTA), and 2× with 20 mM Tris pH8.00+2M AMBIC (1×5 min and 1×15 min). The plate was then incubated with 1 mM AMP for 2 h before collecting the assay products. The collected samples were analyzed using mass spectrometry (m/z 136).
The HIV DNA sequences used are shown in Table 9. The target nucleic acid molecule has sequence of SEQ ID No. 24. The capture oligonucleotide probe of SEQ ID No. 23 was used, with 3′ attached through an amine functionality to NOS-surfaced polystyrene as solid support. The detection oligonucleotide probe of SEQ ID No. 25 was used with 5′ being biotinylated.
The SARS-Co-V 2 DNA sequences used in the assay in
Shiga-Toxin Producing E. coli (STEC) DNA Detection
The STEC DNA sequences used are shown in Table 11. The target nucleic acid molecule has sequence of SEQ ID No. 30. The capture oligonucleotide probe of SEQ ID No. 29 was used, with 3′ attached through an amine functionality to NOS-surfaced polystyrene as solid support. The detection oligonucleotide probe of SEQ ID No. 31 was used with 5′ being biotinylated.
S. aureus Hemolysin DNA Detection
The hemolysin DNA sequences used are shown in Table 13. The target nucleic acid molecule has sequence of SEQ ID No. 36. The capture oligonucleotide probe of SEQ ID No. 35 was used, with 3′ attached through an amine functionality to NOS-surfaced polystyrene as solid support. The detection oligonucleotide probe of SEQ ID No. 37 was used with 5′ being biotinylated.
Example 15 provides some details on the detection of PCR and plasmid DNA products further described here.
For PCR target, the target nucleic acid was prepared by amplification of a plasmid using a PCR reaction. An agarose gel was run visualizing the PCR products amplified from the HIV plasmid and for sensitivity comparison to methods described herein.
As described and shown here, the described methods using mass spectrometry resulted in enhanced sensitivity.
PCR reactions were run with 1 ng to 1 attogram (rep1 & rep2) as template. Reactions initiated with 1 μl HIV plasmid DNA. PCR 35 cycles, lid temp 105° C., 25 μL reaction volume, 94° C. melting (30 s), 58° C. annealing (30 s), 72° C. extension (30 s). The products were separated by a 2% Agarose gel run at 100 volts for 2 hour big gel tank, ladder runs straight). 5 μl sample loaded. 3 μl ladder loaded. InGel staining with GelRed™.
In experiments using PCR template, 5 μl of the PCR sample (same as loaded on gel) was also subjected to hybridation steps described herein.
In experiments using plasmid, plasmid was either attached via NOS to PVDF in a 96 well format or adsorbed thereon.
Further details are provided below.
An HIV Gag Pr55 coding plasmid (e.g. Accesion number GQ432554.1) was used in an assay comparing primers that hybridize within the capture oligonucleotide probe region and primers that hybridize outside the probe region of the capture oligonucleotide probe. Two sets of primers generating two PCR products of different length, one of 133 bp fragment (primers within region of capture probe) and one of 258 bp fragment (primers outside region of capture probe), were used and the PCR products were used as target nucleic acid molecule (e.g. PCR template). The assay involved the use of a capture probe and detection probe (e.g. full sandwich method) and was compared to the sensitivity PCR amplified plasmid as shown by gel and quantified using image analysis. See
PCR reactions were run with atto, femto, pico or nano gram amounts of the template HIV plasmid DNA. Reactions initiated with 1 μl HIV plasmid DNA. PCR 35 cycles, lid temp 105° C., 25 μL reaction volume, 94° C. melting (30 s), 58° C. annealing (30 s), 72° C. extension (30 s). The PCR products were used (either for gel visualization or for use in the assay described and mass spec analysis) without purification (e.g. 5 μl aliquot of reaction used directly).
The capture oligonucleotide probe (SEQ ID No. 23), and detection oligonucleotide probe (SEQ ID No. 25) for the 258 bp target are shown in Table 9. The forward primer used to generate the PCR product had sequence 5′-CCAGGCCAGATGAGAGAACC-3′ (SEQ IC No. 38). The reverse primer used to generate the PCR product had sequence 5′-TGAAGCTTGCTCGGCTCTTA-3′ (SEQ ID No. 39). The 258 target nucleic acid molecule has sequence:
For the 258 bp PCR product target, the PCR primers were outside or out flanked the capture and detection sequences. The detection was done as described below.
5 μL of the PCR sample solution, diluted into 100 μL with Binding Buffer, was used for each “DNA ELiMSA reaction” e.g. for the incubating with a capture and detection probes, for incubating with the reporter enzyme detection probe and substrate and for mass spec analysis). The capture oligonucleotide probe was covalently immobilized on NOS surface chemistry 96 well polystyrene reactive plates (n=3) through a 3′ amine on the capture oligo probe. The capture oligonucleotide probe (also referred to as Capture DNA) in Surface Binding Buffer (10 mM Na2PO4+1 mM EDTA buffer, pH 8.5) was added to the plate and incubated at 4° C. overnight. Washed 3 times with Surface Binding Buffer, and then quenched and blocked the plate with 3% BSA for 1 h and washed 3 times with 20 mM Tris pH8.00+1 mM EDTA followed by 3 times with Binding Buffer (20 mM Tris pH8.00+1 M NaCl+1 mM EDTA). Target nucleic acid molecule and detection Probe DNA was added to each well of the plate to start DNA hybridization for around 1.5 h, and washed 3 times with Binding Buffer (20 mM Tris pH8.00+1 M NaCl+1 mM EDTA). The plated was blocked with 1% BSA for 5 min and then incubated with APSA solution in 1% BSA for 15 min, and washed 10 times with designated buffers (6× quick wash with Binding Buffer (20 mM Tris pH8.00+1M NaCl+1 mM EDTA), 3×5 min with 20 mM Tris pH8.00+1M NaCl (no EDTA), and 2× with 20 mM Tris pH8.00+2M AMBIC (1×5 min and 1×15 min). The plate was then incubated with 1 mM AMP for 2 h before collecting the assay products. NTC represents the no-template-control of the PCR reaction. Error bar=STDEV
The capture oligonucleotide probe (SEQ ID No. 23), and detection oligonucleotide probe (SEQ ID No. 25) for the 133 bp target were the same as for the 258 np PCR product and are shown in Table 9. The forward primer used to generate the PCR product had sequence 5′-CCACCTATCCCAGTAGGAGAAATCTATAAAAGATGG-3′ (SEQ IC No. 41). The reverse primer used to generate the PCR product had sequence 5′-CTACATAGTCTCTAAAGGGTTCTTTTGGTCCTTGTC-3′ (SEQ ID No. 42). The target nucleic acid molecule has sequence:
Covid PCR product was also assayed using primers and probes described herein.
SARS-Co-V 2 target nucleic acid molecule PCR product was prepared by the following PCR conditions. The PCR reactions initiated with 10 ng of SARS-CoV-2 positive ctrl Plasmid. (35 cycles, lid temp 105° C., 50 μL reaction volume, 94° C. melting (30 s), 58° C. annealing (30 s), 72° C. extension (1 min)). 5 μl of the products were separated and 5 μl were subjected to assays described herein. Specifically, the 25 uL PCR reaction was then aliquoted 5 uL for GEL analysis and 5 uL for Hybridization and mass spectrometry analysis.
The methods described are sensitive particularly considering that only a small volume of the total reaction volume is subjected to mass spectrometry analysis. Typically 1-2 μl of the 200 μl the final reaction volume was subjected to mass spectrometry. In each case, the “DNA EliMSA” described herein detected target with 10-100 times more sensitivity. As only 1/100 or 1/200 of the reaction volume was assayed by mass spectrometry, DNA EliMSA assays as described herein for the same level of template can be 10,000-20,000 times more sensitive.
PCR is considered to be very sensitive but can be labor intensive or time consuming as it typically involves manual gel loading, gel staining and quantification. The methods described can be automated. For example as the assays described herein can be performed in 96 well plates, 96 well injection robots can be used to automate.
Direct detection of plasmid DNA was also demonstrated.
The capture oligo probe can also be non-covalently attached.
A SARS-CoV-2 plasmid, IDT CAT10006625, was detected with Capture oligonucleotide probe absorbed to High Binding 0.45 micro PVDF 96 well filter plates. “DNA ELiMSA” performed by Capture DNA immobilized by adsorption (n=3). Capture DNA was added to the PVDF. The PVDF was blocked with 3% BSA for 1 h and washed 3 times with 20 mM Tris pH8.00+1 mM EDTA followed by 3 times with Binding Buffer (20 mM Tris pH8.00+1M NaCl+1 mM EDTA). Target nucleic acid molecule (e.g. Covid plasmid) and detection oligonucleotide probe DNA were heated to 95 C and added to each well of the plate to start DNA hybridization for around 1.5 h, and washed 3 times with Binding Buffer (20 mM Tris pH8.00+1 M NaCl+1 mM EDTA). The plate was blocked with 1% BSA for 5 min and then incubated with APSA solution in 1% BSA for 15 min, and washed 10 times with designated buffers (6× quick wash with Binding Buffer (20 mM Tris pH8.00+1M NaCl+1 mM EDTA), 3×5 min with 20 mM Tris pH8.00+1M NaCl (no EDTA), and 2× with 20 mM Tris pH8.00+2M AMBIC (1×5 min and 1×15 min). The plate was then incubated with 1 mM AMP for 2 h before collecting the assay products.
Several methods shown in
Various single stranded capture oligonucleotide probes were attached to NOS plates via an amine functionality. Other attachments can also be used. Attachment to the solid surface was either via the 3′ or 5′ end of the capture oligonucleotide probe (e.g. the amine functionality could be on the 3′ or the 5′ end or both). Both 3′ and 5′ attachments were tested and both were shown to allow detection. Both antisense and sense strands were attached and both shown to allow detection. If an antisense strand was attached to the solid support, a 5′ biotinylated forward primer was used. If a sense strand was attached to the solid support, a 5′ biotinylated reverse primer was used. Both sense and antisense strands could be attached and in such case 5′biotin labelled forward and reverse primers can be used.
In one example Biotinylated PCR Primer sequences were used with 3′ AMINE capture probe to NOS plates.
In another example biotinylated PCR primer sequences were used with 5′ amine capture to NOS plates.
The capture probe for reactions using HIV Primer 3 can be CCACCTATCCCAGTAGGAGAAATCTATAAAAGATGGATAATCCTGGGAT (SEQ ID NO: 45) which can be tethered via a 5′ amine. As demonstrated 5′ tethering and 3′ tethering can be advantageously used.
The amplified antisense strand (capture oligo probe) was 3′ AMINE Captured on a NOS plate. As an antisense strand was covalently attached to the NOS plate, a biotinylated Forward primer is used to prepare the a labelled sense strand that can adhere to the capture oligonucleotide probe. As the PCR strand being amplified is biotinulated via the primer, a detection probe is not per se necessary.
This can be referred to as a half-sandwich assay with NOS_3′-Amine Capture probe. Crude biotin-PCR 258 nt is subjected to mass spectrometry as described herein.
HIV PCR product produced is SEQ ID NO: 40 (258 nt) comprising a Biotin 5′ end eg.: Biotin-5′-SEQ ID NO: 40.
The HIV Capture III probe used in this example is (50 nt): 5′-AATCCCAGGATTATCCATCTTTTATAGATTTCTCCTACTGGGATAGGTGG-3′-Amine (SEQ ID NO: 44).
As mentioned, a Biotin labelled—Forward Primer+unlabelled Reverse Primer were used.
The biotin labelled forward primer produced, an HIV biotinylated PCR product, which was 258 nt. The PCR reaction comprising the PCR product was without purification, detected by a half-sandwich HIV PCR DNA ELiMSA (e.g. capture probe, biotinylated primer, reaction with reporter enzyme detection probe and detection of one or more ionizable products) which was performed by Capture DNA immobilized on NOS surface chemistry 96 well polystyrene reactive plates (n=3). 5 uL of the PCR sample solution diluted into 100 uL with Binding Buffer, was used for each DNA ELiMSA reaction. Zero represents no addition of a Target DNA sequence; NTC represents the no-template-control of the PCR reaction; A full-sandwich HIV DNA ELiMSA with a synthetic Target DNA sequence at 100 nM was used as the positive control. Error bar=STDEV
DNA ELiMSA was performed by Capture DNA immobilized on NOS surface chemistry 96 well polystyrene reactive plates. Capture DNA in Surface Binding Buffer (10 mM Na2PO4+1 mM EDTA buffer, pH 8.5) was added to the plate and incubated at 4° C. overnight. Washed 3 times with Binding Buffer (20 mM Tris pH8.00+1 M NaCl+1 mM EDTA), and then quenched and blocked the plate with 3% BSA for 1 h and washed 3 times with 20 mM Tris pH8.00+1 mM EDTA followed by 3 times with Binding Buffer. The PCR products were denatured, as well as the synthetic Target and Detection DNA sequences, and was added to each well of the plate to start DNA hybridization for around 1.5 h, and washed 3 times with Binding Buffer. The plated was blocked with 1% BSA for 5 min and then incubated with APSA solution in 1% BSA for 15 min, and washed 10 times with designated buffers (6× quick wash with Binding Buffer (20 mM Tris pH8.00+1 M NaCl+1 mM EDTA), 3×5 min with 20 mM Tris pH8.00+1M NaCl (no EDTA), and 2× with 20 mM Tris pH8.00+2M AMBIC (1×5 min and 1×15 min). The plate was then incubated with 1 mM AMP for 2 h before collecting the assay products. 1 or 2 μl of the assay products (200 μl) was subjected to mass spectrometry 1 or 2 uL injected (see
A similar assay was performed using 5′ amine attachment of the capture probe and a biotinylated Reverse primer.
In this assay, a single stranded sense strand HIV capture probe was covalently attached to a NOS plate through an amine at its 5′ end.
The HIV Capture III (50 nt) is Amine-5′-CCACCTATCCCAGTAGGAGAAATCTATAAAAGATGGATAATCCTGGGATT-3′ (SEQ ID NO: 45).
In this assay crude PCR product (also referred to as “raw” product) demonstrating the robustness of the method.
HIV PCR product (258 nt): Biotin-5′-TGAAGCTTGCTCGGCTCTTAGAGTTTTATAGAACCGGTCTACATAGTCTCTAAAGGGTTCTTTTGGTCCTT GTCTTATGTCCAGAATGCTGGTAGGGCTATACATTCTTACTATTTTATTTAATCCCAGGATTATCCATCTTT TATAAATTTCTCCTACTGGGATAGGTGGATTATTTGTCATCCATCCTATTTGTTCCTGAAGGGTACTAGTA GTTCCTGCTATGTCACTTCCCCTTGGTTCTCTCATCTGGCCTGG-3 (SEQ ID NO; 46) complementarity to SEQ ID NO: 40
Results are shown in
DNA ELiMSA was performed by Capture DNA immobilized on NOS surface chemistry 96 well polystyrene reactive plates. Capture DNA in Surface Binding Buffer (10 mM Na2PO4+1 mM EDTA buffer, pH 8.5) was added to the plate and incubated at 4° C. overnight. Washed 3 times with Binding Buffer (20 mM Tris pH8.00+1 M NaCl+1 mM EDTA), and then quenched and blocked the plate with 3% BSA for 1 h and washed 3 times with 20 mM Tris pH8.00+1 mM EDTA followed by 3 times with Binding Buffer. The PCR products were denatured by heat, as well as the synthetic Target and Detection DNA sequences, and was added to each well of the plate to start DNA hybridization for around 1.5 h, and washed 3 times with Binding Buffer. The plated was blocked with 1% BSA for 5 min and then incubated with APSA solution in 1% BSA for 15 min, and washed 10 times with designated buffers (6× quick wash with Binding Buffer (20 mM Tris pH8.00+1 M NaCl+1 mM EDTA), 3×5 min with 20 mM Tris pH8.00+1M NaCl (no EDTA), and 2× with 20 mM Tris pH8.00+2M AMBIC (1×5 min and 1×15 min). The plate was then incubated with 1 mM AMP for 2 h before collecting the assay products.
In this assay as little as starting template 10 fg produced a reproducible signal.
A further assay used non-covalent attachment and PVDF. In this example, HIV was detected using a half-sandwich assay where the single stranded HIV target sequence was adsorbed onto PVDF and a detection probe that is complementary and labelled with a tag is used to detect the target sequence. No capture probe is used The assay compared 0 vs. 100 pmol target.
HIV Detection III (50 nt): Biotin-5′-CTACATAGTCTCTAAAGGGTTCTTTTGGTCCTTGTCTTATGTCCAGAATG-3′ (SEQ ID NO: 25).
HIV oligo Target III: (133 nt): CCACCTATCCCAGTAGGAGAAATCTATAAAAGATGGATAATCCTGGGATTAAATAAAATAGTAAGAATGTA TAGCCCTACCAGCATTCTGGACATAAGACAAGGACCAAAAGAACCCTTTAGAGACTATGTAG (SEQ ID NO: 24).
HIV half-sandwich DNA ELiMSA was performed by the synthetic Target DNA absorbed to a 0.45 micron PVDF 96 well filter plate (n=3). The PVDF filter plate was pre-wetted by methanol, spotted with Target DNA, blocked with 3% BSA for 1 h, and washed 3 times with 20 mM Tris pH8.00+1 mM EDTA followed by 3 times with Binding Buffer Buffer (20 mM Tris pH8.00+1 M NaCl+1 mM EDTA). Denatured Detection DNA sequence was added to each well of the plate to start DNA hybridization for around 1.5 h, and washed 3 times with Binding Buffer. The plated was blocked with 1% BSA for 5 min and then incubated with APSA solution in 1% BSA for 15 min, and washed 10 times with designated buffers (6× quick wash with Binding Buffer (20 mM Tris pH8.00+1 M NaCl+1 mM EDTA), 3×5 min with 20 mM Tris pH8.00+1 M NaCl (no EDTA), and 2× with 20 mM Tris pH8.00+2M AMBIC (1×5 min and 1×15 min). The plate was then incubated with 1 mM AMP for 2 h before collecting the assay products.
As shown in
Additional assays were conducted adding SDS or non-relevant nucleic acid to assess the robustness of the method.
Covid DNA ELiMSA performed by 5′ N Capture DNA immobilized on NOS surface chemistry 96 well polystyrene reactive plates. Capture DNA in Surface Binding Buffer (10 mM Na2PO4+1 mM EDTA buffer, pH 8.5) was added to the plate and incubated at 4° C. overnight. Washed 3 times with Surface Binding Buffer, and then quenched in 20 mM Tris pH 8.5. The plate was blocked with the 3% BSA and/or blocked with 5 micro grams of salmon sperm DNA either before, during or after or after BSA or during target hybridization for 1 h and washed 3 times with 20 mM Tris pH8.00+1 mM EDTA followed by 3 times with Binding Buffer (20 mM Tris pH8.00+1 M NaCl+1 mM EDTA). The plated was blocked with 1% BSA for 5 min and then incubated with APSA solution in 1% BSA for 15 min, and washed 10 times with designated buffers (6× quick wash with Binding Buffer, 3×5 min with 20 mM Tris pH8.00+1M NaCl (no EDTA), and 2× with 20 mM Tris+2M AMBIC (1×5 min and 1×15 min). The plate was then incubated with 1 mM AMP for 2 h before collecting the assay products. Assay products were measured using mass spectrometry m/z 136.
The addition salmon sperm DNA did not appreciably affect the assay where added before BSA or in combination with BSA or during the hybridization step.
SDS was also added in other tests.
Target and Probe DNA were incubated with 0, 0.1, 0.5, 1 and 2% w/v sodium dodecyl sulfate (SDS) which was added to the designated well of the plate to start DNA hybridization for around 1.5 h. addition of SDS appeared to reduce non-specific binding at long template concentrations. The assay can tolerate high concentrations of SDS or non ionic surfactants.
PCR primers were designed for COVID which worked very well in PCR. They can also be used in methods described herein.
SARS-Co-V 2 PCR reactions were prepared using SARS-Co-V2 plasmid comprising nucleocapsid using the following PCR conditions. The PCR reactions initiated with 10 ng of SARS-CoV-2 positive ctrl Plasmid. (35 cycles, lid temp 105° C., 50 μL reaction volume, 94° C. melting (30 s), 58° C. annealing (30 s), 72° C. extension (1 min)).
As shown in
While the present disclosure has been described with reference to examples, it is to be understood that the scope of the claims should not be limited by the embodiments set forth in the examples, but should be given the broadest interpretation consistent with the description as a whole.
All publications, patents and patent applications are herein incorporated by reference in their entirety to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety. Where a term in the present disclosure is found to be defined differently in a document incorporated herein by reference, the definition provided herein is to serve as the definition for the term.
This PCT application claims priority to U.S. Application Ser. No. 63/105,554, filed Oct. 26, 2020, herein incorporated by reference.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/CA2021/051510 | 10/26/2021 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 63105554 | Oct 2020 | US |
