Patent Application
20180051263
The present disclosure relates to enzymes, mutants thereof, fatty acid synthesis, nucleic acids, host cells and organisms, assays, bi-functional fatty acid compositions, and uses thereof.
The biochemical mechanism of fatty acid biosynthesis is universally similar among all organisms. Generally, fatty acids are synthesized by the repeated iteration of four-reactions, which start with an acyl-primer, which is elongated, two carbons per cycle, using carbon atoms derived from a malonyl moiety. The four sequential reactions that make up this cycle generate 3-ketoacyl-thioester, 3-hydroxyacyl-thioester, and 2-enoyl-thioester derivative intermediates, and finally an acyl-thioester derivative that is two carbons longer than the initial acyl primer. In bacteria, typified by the E. coli system, and higher plant plastids, these reactions are catalyzed by a dissociable, type II fatty acid synthase that is composed of the four enzymes 3-ketoacyl-ACP synthase (KAS), 3-ketoacyl-ACP reductase (encoded by fabG), 3-hydroxyacyl-ACP dehydratase (encoded by fabA), and enoyl-ACP reductase (encoded by fabI) (Rock et al., Biochim Biophys. Acta 1302: 1-16 (1996)). In contrast, a type I fatty acid synthase, which is composed of four enzyme components that occur as domains on a multifunctional protein(s), occurs in other eukaryotes (Jenni et al., Science 311: 1263-1267 (2006); and Maier et al., Science 311: 1258-1262 (2006)). However, in both type I and type II fatty acid synthase systems acyl derivatives are bound to phosphopantetheine cofactors.
In the type II fatty acid synthase system, there are three genetically and biochemically distinct KAS isomers, namely KASI (encoded by fabB), KASII (encoded by fabF), and KASIII (encoded by fabH) (Rock et al. (1996), supra; Garwin et al., J. Biol. Chem. 255: 11949-11956 (1980)); and Jackowski et al., J. Biol. Chem. 262: 7927-7931 (1987)). Their functions have been studied extensively in E. coli. They differ in their specificities for acyl-thioester substrates, having optimum activities for substrates of different acyl-chain lengths and different thioesters. While KASI and KASII catalyze the condensation between acyl-ACP (of longer acyl-chain length) with malonyl-ACP substrates, KASIII specifically utilizes acetyl-CoA as a substrate for the condensing reaction with malonyl-ACP (Tsay et al., J. Biol. Chem. 267: 6807-6814 (1992); and Heath et al., J. Biol. Chem. 271: 1833-1836 (1996)), and thus initiates fatty acid biosynthesis.
The general mechanism of fatty acid biosynthesis in Gram-positive bacteria, such as B. subtilis, is similar to that of E. coli (Magnuson et al., Microbiol. Rev. 57: 522-542 (1993)). One major difference is that B. subtilis produces large quantities of branched-chain fatty acids (BCFAs) and unsaturated fatty acids as a result of the expression of a unique Δ5 desaturase (Aguilar et al., J. Bacteriol. 180: 2194-2200 (1998)). The BCFAs and the unsaturated fatty acids together maintain membrane fluidity in response to lower growth temperatures. The BCFAs are branched with methyl groups at the iso- and anteiso positions (i.e., 13-methyltetradecanoic, 12-methyltetradecanoic acid, and 14-methylpentadecanoic acid), and they are biosynthesized by a type II FAS that has the ability to initiate this process by using branched acyl-CoAs that are derived from the branched chain amino acids, leucine, isoleucine, and valine (Willecke et al., J. Biol. Chem. 246: 5264-5272 (1971)). Thus, the B. subtilis FAS enzyme must have the capacity to utilize such branched acyl-CoA substrates. Genomics-based analysis of the B. subtilis genome has led to the identification of KASII (Shujman et al., J. Bacteriol. 183: 3032-3040 (2001)) and KASIII homologous genes; however, it appears that this bacterium does not contain a sequence-recognizable KASI homolog. In B. subtilis KASII is an essential enzyme, which is encoded by yjaY. Two B. subtilis KASIII-encoding genes, bfabHA (yjaX) and bfabHB (yhfB), have been characterized, and these have the capacity to catalyze the condensation of branched acyl-CoAs with malonyl-ACP (Choi et al., J. Bacteriol. 182: 365-370 (2000); and Smirnova et al., J. Bacteriol. 183: 2335-2342 (2001)). These two genes code for 312- and 325-residue proteins that share 43% sequence identity.
KASIII has been characterized in several bacterial (Tsay et al., J. Biol. Chem. 267: 6807-6814 (1992); Han et al., J. Bacteriol. 180: 4481-4486 (1998); Qiu et al., J. Biol. Chem. 274: 36465-36471 (1999); Choi et al., J. Bacteriol. 182: 365-370 (2000a); Choi et al., J. Bacteriol. 182: 365-370 (2000b); Choi et al., J. Biol. Chem. 275: 28201-28207 (2000c); Davies et al., Structure 8: 185-195 (2000); Khandekar et al., Biochem. Biophys. Res. Comm 270: 100-107 (2000); Khandekar et al., J. Biol. Chem. 276: 30024-30030 (2001); Qiu et al., J. Mol. Biol. 307: 341-356 (2001); Revill et al., J. Bacteriol. 183: 3526-3530 (2001); Huynh et al., Acta Crystallogr. Sect. F. Struct. Biol. Cryst. Comm 65: 460-462 (2009); Wen et al., Protein Expr. Purif. 65: 83-91 (2009); Singh et al., FEMS Microbiol. Lett. 301: 188-192 (2009); Gajiwala et al., FEBS Lett. 583: 2939-2946 (2009); and Pereira et al., Acta Crystallogr. D. Biol. Crystallogr. 68: 1320-1328 (2012)), protozoan (Waters et al., Mol. Biochem. Parsitol. 123: 85-94 (2002); and Prigge et al., Biochem. 42: 1160-1169 (2003)), and plant species (Clough et al., J. Biol. Chem. 267: 20992-20998 (1992); Jaworski et al., Plant Physiol. 90: 41-44 (1989); Tai et al., Plant Physiol. 106: 801-802 (1994); Abbadi et al., Biochem. J. 345 (Pt. 1): 153-160 (2000); Dehesh et al., Plant Physiol. 125: 1103-1114 (2001); Li et al., Tree Physiol. 28: 921-927 (2008); and Gonzalez-Mellado et al., Planta 231: 1277-1289 (2010)). Functionally characterized KASIII enzymes exhibit diverse substrate specificities, utilizing acyl-CoA substrates ranging from short, straight-chain acyl-CoAs (e.g. acetyl-CoA, propionyl-CoA (Choi et al. (2000a), supra; Clough et al. (1992), supra; and Abbadi et al. (2000), supra), branched-chain acyl-CoAs (e.g., isobutyryl-CoA and ante-isovaleryl-CoA (Han et al. (1998), supra; Choi et al. (2000a), supra; Khandekar et al. (2001), supra; Singh et al. (2009), supra; and Qiu et al., Protein Sci. 14: 2087-2094 (2005)) to long-chain acyl-CoAs (e.g., lauroyl-CoA, palmitoyl-CoA (Choi et al. (2000b), supra; and Scarsdale et al., J. Biol. Chem. 276: 20516-20522 (2001)).
By virtue of diverse substrate specificities shown by KASIII enzymes from different organisms, this enzyme is thought to determine the fatty acid profile of the organism, particularly the structure of the omega-end of the fatty acid products (Choi et al. (2000a), supra; Gajiwala et al. (2009), supra; and Pereira et al. (2012), supra). For example, in many Gram-positive bacteria (i.e., Bacillus subtilis, Streptomyces glaucescens, and Staphylococcus aureus), KASIII can utilize both branched-chain and straight-chain substrates, resulting in the production of both branched- and straight-chain fatty acids (Han et al. (1998), supra; Choi et al. (2000a), supra; Pereira et al. (2012), supra; and Qiu et al. (2005), supra). In contrast, KASIII from Gram-negative bacteria (e.g., E. coli) appears to prefer straight-chain acyl-CoA substrates, which results in the production of straight-chain fatty acids (Choi et al. (2000a), supra).
The active site residues and substrate binding pocket are well conserved among KASIII from different species. Three residues, Cys112, His244 and Asn274, form the catalytic triad in E. coli KASIII and carry out two half reactions as a part of the Claisen condensation (
After decarboxylation, the resulting negative charge on its thioester carbonyl is stabilized by His244 and Asn274. A carbanion is formed on its α-carbon that attacks the acetate bound to Cys112. The tetrahedral transition state is stabilized by an oxyanion hole formed by Cys112 and Gly306, which eventually breaks down to give acetoacetyl-ACP as the product.
The US imports almost 10 million barrels of petroleum a day (U.S.E.I. Administration Monthly Energy Review (2011), www.eia.gov/energy_in_brief/foreign_oil_dependence.cfm) to create a multi-billion dollar plastics and specialty chemical industry that obtains its monomers from petroleum feedstocks. Currently, only a limited number of bio-based products are available in the market including polylactic acid (PLA), polyhydroxybutyrate (PHB), and polyethylene terephthalate (PET), which is based on 1,3-propanediol, and emerging products based on succinic acid and adipic acid (Frost and Sullivan, Global Bio-Based Plastics Market (2009), www.frost.com/prod/servlet/report-toc.pag?repid=M4A1-01-00-00-00). However, the global marketplace for the bio-plastics “green” market is projected to expand to over a billion dollars (Ceresana Research, Market Study: Bioplastics (2011), www.ceresana.com/en/market-studies/plastics/bioplastics), and with increasing awareness about reduced environmental impacts of bio-based plastics, the market for these products will continue to grow.
The present disclosure seeks to provide materials and methods for characterizing and using 3-ketoacyl-acyl carrier protein (ACP) synthases III (KASIII) in the production of bi-functional fatty acids. This and other objects and advantages, as well as inventive features, will become apparent from the detailed description provided herein.
A mutant Bacillus subtilis is provided. The mutant B. subtilis does not express a functional 3-ketoacyl-acyl carrier protein (ACP) synthase III (KASIII) selected from the group consisting of KASIIIA and KASIIIB. In an embodiment, the mutant B. subtilis does not express a functional KASIIIA and a functional KASIIIB.
A method of making the mutant B. subtilis is also provided. The method comprises introducing into wild-type B. subtilis a mutation selected from the group consisting of a mutation that prevents expression of a functional KASIIIA and a mutation that prevents expression of a functional KASIIIB. In an embodiment, the method comprises introducing into wild-type B. subtilis a mutation that prevents expression of a functional KASIIIA and a mutation that prevents expression of a functional KASIIIB.
Also provided is a mutant Rhodospirillum rubrum. The mutant R. rubrum does not express a functional polyhydroxyalkanoate (PHA) polymerase selected from the group consisting of PhaC1, PhaC2, and PhaC3. In an embodiment, the mutant R. rubrum does not express a functional PhaC1, a functional PhaC2, and a functional PhaC3.
Thus, also provided is a method of making the mutant R. rubrum. The method comprises introducing into wild-type R. rubrum a mutation selected from the group consisting of a mutation that prevents expression of a functional PhaC1, a mutation that prevents expression of a functional PhaC2, and a mutation that prevents expression of a functional PhaC3. In an embodiment, the method comprises introducing into wild-type R. rubrum a mutation that prevents expression of a functional PhaC1, a mutation that prevents expression of a functional PhaC2, and a mutation that prevents expression of a functional PhaC3.
Further provided is a method of characterizing substrate specificity of a KASIII. The method comprises expressing the KASIII, which is not expressed in wild-type B. subtilis, in an above-described mutant B. subtilis and assessing the production of ω-functionalized fatty acids. In an embodiment, the KASIII is derived from an organism, the wild-type of which produces ω-functionalized fatty acids. In another embodiment, the KASIII is derived from an organism, the wild-type of which does not normally produce ω-functionalized fatty acids.
Still further provided is another method of characterizing substrate specificity of a KASIII enzyme. The method comprises expressing the KASIII, which is not expressed in wild-type R. rubrum, in an above-described mutant R. rubrum and assessing the production of ω-functionalized fatty acids. In an embodiment, the KASIII is derived from an organism, the wild-type of which produces ω-functionalized fatty acids. In another embodiment, the KASIII is derived from an organism, the wild-type of which does not normally produce ω-functionalized fatty acids.
Yet still further provided is a method of altering the specificity of a KASIII for at least one of its substrates. The method comprises introducing into the KASIII one or more mutations comprising at least one mutation, which causes the rotamer conformation of a phenylalanine in the KASIII corresponding to Phe304 in KASIII from E. coli to change. In one embodiment, the KASIII is from E. coli, and the one or more mutations comprises a mutation of Leu220, alone or in further combination with Val215. The mutation of Leu220 can be Leu220Met, and the mutation of Val215 can be Val215Phe. The rotamer conformation of Phe304 can be changed from an active site-distal rotamer conformation, in which the Phe304 is oriented away from the active site, to an active site-proximal rotamer conformation, in which the side chain of Phe304 faces towards the active site. In another embodiment, the KASIII is KASIIIA from B. subtilis, and the one or more mutations comprises a mutation of Met213, alone or in further combination with Phe208. The mutation of Met213 can be Met213Leu, and the mutation of Phe208 can be Phe208Val. The rotamer conformation of Phe297 can be changed from an active site-distal rotamer conformation, in which the Phe297 is oriented away from the active site, to an active site-proximal rotamer conformation, in which the side chain of Phe297 faces towards the active site. In yet another embodiment, the KASIII is KASIIIB from B. subtilis, and the one or more mutations comprise a mutation of Trp221 and a mutation of Val226. The mutation of Trp221 can be Trp221Val, and the mutation of Val226 can be Val226Leu. The rotamer conformation of Phe310 can be changed from an active site-distal rotamer conformation, in which the Phe310 is oriented away from the active site, to an active site-proximal rotamer conformation, in which the side chain of Phe310 faces towards the active site. In still yet another embodiment, the KASIII is from the KASIII is from Aeromonas hydrophila, Bacteroides vulgatus, Brevibacierium linens, Capnocytophaga gingivalis, Thermus aquaticus, Bacillus licheniformis, Desulfovibrio vulgaris, Bacillus subtilis subsp. S, Haliangium ochraceum, Alicyclobacillus acidocaldarius, Staphylococcus aureus, Legionella pneumophila, or Myxococcus xanthus.
An isolated or purified nucleic acid molecule comprising a nucleotide sequence encoding a mutant KASIII is also provided. The isolated or purified nucleic acid molecule can be a vector. The mutant KASIII comprises one or more mutations comprising at least one mutation, which causes the rotamer conformation of a phenylalanine in the KASIII corresponding to Phe304 in KASIII from E. coli to change. In one embodiment, the KASIII is from E. coli, and the one or more mutations comprises a mutation of Leu220, alone or in further combination with Val215. The mutation of Leu220 can be Leu220Met, and the mutation of Val215 can be Val215Phe. The rotamer conformation of Phe304 can be changed from an active site-distal rotamer conformation, in which the Phe304 is oriented away from the active site, to an active site-proximal rotamer conformation, in which the side chain of Phe304 faces towards the active site. In another embodiment, the KASIII is KASIIIA from B. subtilis, and the one or more mutations comprises a mutation of Met213, alone or in further combination with Phe208. The mutation of Met213 can be Met213Leu, and the mutation of Phe208 can be Phe208Val. The rotamer conformation of Phe297 can be changed from an active site-proximal rotamer conformation to an active site-distal rotamer conformation. In yet another embodiment, the KASII is KASIIIB from B. subtilis, and the one or more mutations comprise a mutation of Trp221 and a mutation of Val226. The mutation of Trp221 can be Trp221Val, and the mutation of Val226 can be Val226Leu. The rotamer conformation of Phe310 can be changed from an active site-proximal rotamer conformation, in which the side chain of Phe310 faces towards the active site, to an active site-distal rotamer conformation, in which the Phe310 is oriented away from the active site. In still yet another embodiment, the KASIII is from the KASIII is from Aeromonas hydrophila, Bacteroides vulgatus, Brevibacterium linens, Capnocytophaga gingivalis. Thermus aquaticus. Bacillus licheniformis, Desulfovibrio vulgaris, Bacillus subtilis subsp. S, Haliangium ochraceum, Alicyclobacillus acidocaldarius, Staphylococcus aureus, Legionella pneumophila, or Myxococcus xanthus.
A host cell or organism is also provided. The host cell or organism comprises an above-described isolated or purified nucleic acid molecule.
Further provided is an isolated or purified mutant KASIII. The mutant KASIII comprises one or more mutations comprising at least one mutation, which causes the rotamer conformation of a phenylalanine in the KASIII corresponding to Phe304 in KASIII from E. coli to change. In one embodiment, the KASIII is from E. coli, and the one or more mutations comprises a mutation of Leu220, alone or in further combination with Val215. The mutation of Leu220 can be Leu220Met, and the mutation of Val215 can be Val215Phe. The rotamer conformation of Phe304 can be changed from an active site-distal rotamer conformation, in which the Phe304 is oriented away from the active site, to an active site-proximal rotamer conformation, in which the side chain of Phe304 faces towards the active site. In another embodiment, the KASIII is KASIIIA from B. subtilis, and the one or more mutations comprises a mutation of Met213, alone or in further combination with Phe208. The mutation of Met213 can be Met213Leu, and the mutation of Phe208 can be Phe208Val. The rotamer conformation of Phe297 can be changed from an active site-proximal rotamer conformation, in which the side chain of Phe297 faces towards the active site, to an active site-distal rotamer conformation, in which Phe297 is oriented away from the active site. In yet another embodiment, the KASIII is KASIIIB from B. subtilis, and the one or more mutations comprise a mutation of Trp221 and a mutation of Val226. The mutation of Trp221 can be Trp221Val, and the mutation of Val226 can be Val226Leu. The rotamer conformation of Phe310 can be changed from an active site-proximal rotamer conformation, in which the side chain of Phe310 faces towards the active site, to an active site-distal rotamer conformation, in which Phe310 is oriented away from the active site. In still yet another embodiment, the KASIII is from the KASIII is from Aeromonas hydrophila, Bacteroides vulgatus, Brevibacterium linens, Capnocytophaga gingivalis, Thermus aquaticus, Bacillus licheniformis, Desulfovibrio vulgaris, Bacillus subtilis subsp. S, Haliangium ochraceum, Alicyclobacillus acidocaldarius, Staphylococcus aureus. Legionella pneumophila, or Myxococcus xanthus.
Still further provided is an in vitro, high-throughput spectrophotometric method of assaying KASIII activity. The method comprises (i) incubating holo-ACP, malonyl-CoA, dithiothreitol (DTIT), acyl-CoA, NADPH, and malonyl-CoA:ACP transacylase (FabD), (ii) adding KASIII and 3-ketoacyl-ACP reductase (FabG), and (iii) measuring the change in absorbance at 340 nm when NADPH is converted to NADP+ during reduction of 3-ketoacyl-ACP to 3-hydroxyl-acyl-ACP by FabG. In an embodiment, the acyl-CoA is a straight-chain-CoA, a branched-chain-CoA or a hydroxylated-CoA. Preferably, incubating in (i) is for about two minutes, e.g., two minutes, in the presence of a buffer, such as sodium phosphate buffer, at neutral pH, e.g., pH 7.2.
Even still further provided is a method of producing bi-functional fatty acids in a host cell or organism. The method comprises introducing into a host cell or organism, which comprises one or more ω-functionalized acyl-CoAs, and expressing therein a nucleic acid molecule comprising a nucleotide sequence encoding a KASIII, which can use one or more of the ω-functionalized acyl-CoAs as a substrate. The one or more ω-functionalized acyl-CoAs can be functionalized at the ω-position with a moiety comprising a hydroxyl group, a benzoyl group, a cyclic group, a branched-chain group, an amino group, or a halo group. The host cell or organism can be a mutant R. rubrum, such as a mutant R. rubrum described above.
) and bfabHB::pM4B (
), which carry lacZ reporter fusions for each KASIII-coding paralog were grown on LB medium at either 37° C. (
) or 16° C. (
). At the indicated optical density, aliquots of the cultures were removed and β-galactosidase activity was determined. Data represent average of three determinations±standard error.
) and ΔbfabHB (bfabHB::erm;
) grown on minimal medium at 37° C. showing the effect of deleting the bfabHA and bfabHB genes on fatty acid composition of B. subtilis. Data represent average of three determinations±standard error.
) and ΔbfabHB (bfabHB::erm;
) grown on minimal medium at 37° C. Data represent average of three determinations±standard error.
) and ΔbfabHB (bfabHB::erm;
) grown on minimal medium at 37° C. Data represent average of three determinations±standard error.
) and ΔbfabHB (bfabHB::erm;
) were grown on minimal medium at 16° C. Data represent average of three determinations±standard error.
) and ΔbfabHB (bfabHB::erm;
) grown on minimal medium at 16° C. Data represent average of three determinations±standard error.
) and ΔbfabHB (bfabHB::erm;
) grown on minimal medium at 16° C. Data represent average of three determinations±standard error.
) or with (
) 10 μM anteiso-C16 fatty acid, compared to the ΔbfabHA ΔbfabHB::erm double mutant rescued by the inclusion of 10 μM anteiso-C16 fatty acid in the media (□).
) or with (
) anteiso-C16 fatty acid, compared to the ΔbfabHA ΔbfabHB::erm double mutant rescued by the inclusion of 10 μM anteiso-C16 fatty acid in the media (□), wherein BCFA is branched chain fatty acids, normal FA is normal fatty acids, and exogenous FA is exogenous fatty acids.
The present disclosure is predicated, at least in part, on the discovery that bi-functional fatty acids, including bi-functional fatty acids that do not occur naturally, can be made by introducing into a host organism, which expresses one or more acyl-CoA starter substrates of interest, an exogenous 3-ketoacyl-acyl carrier protein (ACP) synthase III (KASIII), such as a wild-type KASIII from another organism, a natural variant thereof, or a mutant thereof. KASIII catalyzes a reaction that creates a new carbon-carbon bond that links two precursor molecules together. Precursor molecules (also referred to herein as “substrates” and “starter substrates”; e.g., acetyl-CoA, isobutyryl-CoA, hydroxyl acyl-CoA, or benzoyl-CoA) are extended by two carbon atoms by condensation with malonyl-ACP. The host organism can be modified to express more or less of a given acyl-CoA starter substrate or a different acyl-CoA starter substrate. Additionally or alternatively, the host organism can be modified to reduce, preferably eliminate, fatty acid degradation and/or termination of fatty acid elongation and/or to secrete fatty acids so produced. The materials and methods have application for bio-based chemicals, such as surfactants, lubricants, food oils, polymers, and the like.
“Bi-functional fatty acid” is used herein to refer to a fatty acid, which comprises a functional group, such as a carboxyl-containing group (—COOH), at the a end and another functional group, which can be the same or different, such as a hydroxyl-containing group (—OH), a benzoyl group, a nitrogen-containing group (—N), such as an amino-containing group (e.g., an amino-carboxylic acid), or a halogen-containing group (—X) at the ω end. The functional group can be a straight chain, a branched chain (e.g., iso or ante-iso), or a cyclic group. While the production of bi-functional fatty acids has been demonstrated in bacteria herein, such production can be adapted to other hosts, such as algae, yeast, plants, and animals.
Amino acids may be identified herein in accordance with convention. Either a three-letter code or a single-letter code may be used, wherein the 20 naturally occurring amino acids are identified as follows:
In view of the above, a mutant Bacillus subtilis is provided. The mutant B. subtilis does not express a functional KASIII selected from the group consisting of KASIIIA (BsKASIIIA (bfabHA (yjaX) locus); GenBank Accession No. CAB 12974.1; nucleotide sequence [SEQ ID NO:63]; amino acid sequence [SEQ ID NO:64]) and KASIIIB (BsKASIIIB (bfabHB (yhfB) locus); GenBank Accession No. CAB 12857.1; nucleotide sequence [SEQ ID NO:65]; amino acid sequence [SEQ ID NO:66]). In one embodiment, the mutant B. subtilis does not express a functional KASIIIA and a functional KASIIIB. While wild-type B. subtilis normally produces linear, iso-branched, and ante-iso-branched fatty acids, the double deletion mutant lacks KASIII activity and fails to grow unless provided with exogenous fatty acids.
Accordingly, also provided is a method of making a mutant B. subtilis. The method comprises introducing into wild-type B. subtilis a mutation selected from the group consisting of a mutation that prevents expression of a functional KASIIIA and a mutation that prevents expression of a functional KASIIIB. The method can comprise introducing into wild-type B. subtilis a mutation that prevents expression of a functional KASIIIA and a mutation that prevents expression of a functional KASIIIB. Preferably, the mutation is a gene knock-out. A gene-deletion knock-out mutation can be preferred because it eliminates the possibility of revertants occurring.
The double deletion mutant can be “rescued” by the expression therein of a functional KASIII gene (such as an exogenous KASIII gene, e.g., a KASIII gene from Alicyclobacillus acidocaldarius). Thus, the double deletion mutant can be used to characterize an exogenous KASIII, such as in accordance with the methods exemplified herein. Chemically modified carboxylic acids can be fed to the rescued double deletion mutant to determine whether or not the exogenous KASIII can incorporate these modified carboxylic acids into the ω-end of fatty acids. For example, the KASIII from A. acidocaldarius can use 3-hydroxybutyryl-CoA (generated from the 3-hydroxybutyric acid that was provided in the media) to produce hydroxypalmitate (16-carbon chain) and hydroxystearate (18-carbon chain).
In this regard, the mutant B. subtilis can be used to characterize an exogenous KASIII, which is a wild-type KASIII, a naturally occurring variant thereof, or a mutant thereof, e.g., a mutant with altered starter substrate specificity. “Altered starter substrate specificity,” as used herein, can mean a change in the relative preference of a KASIII for one substrate over another substrate, the loss of the ability to use a given substrate, or the gain of the ability to use a given substrate. Thus, also provided is a method of characterizing substrate specificity of a KASIII. The method comprises expressing the KASIII, which is not expressed in wild-type B. subtilis, in a mutant B. subtilis, such as a mutant B. subtilis, which lacks a functional KASIIIA and a functional KASIIIB, in the presence of ω-functionalized carboxylic acid starter substrate and assessing the production of ω-functionalized fatty acids. The KASIII can be derived from an organism, the wild-type of which produces ω-functionalized fatty acids. Alternatively, the KASIII can be derived from an organism, the wild-type of which does not normally produce ω-functionalized fatty acids.
Also in view of the above, a mutant Rhodospirillum rubrum is provided. Wild-type R. rubrum generates large quantities of hydroxybutyryl-CoA, which is usually polymerized by polyhydroxyalkanoate (PHA) polymerase (encoded by the phaC gene), as a means of storing carbon and energy (Jin et al., J. Bacteriol. 194: 5522-5529 (2012)). R. rubrum specifically assembles polyhydroxybutyrate from hydroxybutyryl-CoA, which is produced from acetyl-CoA in a two-step reaction. The first step is the condensation of two acetyl-CoA molecules to form acetoacetyl-CoA (catalyzed by acetoacetyl-CoA thiolase, which is encoded by the phaA gene), and the second step is the reduction of acetoacetyl-CoA to form hydroxybutyryl-CoA (catalyzed by acetoacetyl-CoA reductase, which is encoded by the phaB gene). The R. rubrum genome contains three genes (Rru_A0275, Rru_A2413 and Rru_A1816) encoding PHA polymerases, which are designated phaC1, phaC2, and phaC3 (Jin et al., J. Bacteriol. 194: 5522-5529 (2012)). One of them (phaC1) is located in the pha operon, adjoining the phaA and the phaB genes. PhaC2 and PhaC3 share highest sequence conservation (50.2% identity), and PhaC1 is equally distinct from PhaC2 and PhaC3 (14.3% and 18.4% sequence identity, respectively). The mutant R. rubrum provided herein does not express a functional PHA polymerase selected from the group consisting of PhaC1, PhaC2, and PhaC3. In one embodiment, the mutant R. rubrum does not express a functional PhaC1, a functional PhaC2, and a functional PhaC3. The triple mutant fails to accumulate any PHA polymer, with only a slight impact on growth characteristics. The triple mutant still has the capacity to generate hydroxybutyryl-CoA.
A method of making a mutant R. rubrum is also provided. The method comprises introducing into wild-type R. rubrum a mutation selected from the group consisting of a mutation that prevents expression of a functional PhaC1, a mutation that prevents expression of a functional PhaC2, and a mutation that prevents expression of a functional PhaC3. The method can comprise introducing into wild-type R. rubrum a mutation that prevents expression of a functional PhaC1, a mutation that prevents expression of a functional PhaC2, and a mutation that prevents expression of a functional PhaC3. Preferably, the mutation is a gene knock-out. A gene knock-out mutation can be preferred because it eliminates the possibility of revertants occurring.
The mutant R. rubrum can be used to characterize an exogenous KASIII, such as in accordance with the methods described herein. The hydroxyacyl-CoA, such as hydroxybutyryl-CoA, present in the mutant R. rubrum is available as a starter substrate for the exogenous KASIII. Whether or not the exogenous KASIII incorporates the hydroxylacyl-CoA into fatty acids can be determined. Expression of A. acidocaldarius KASIII in the mutant R. rubrum, for example, results in the production of 15-hydroxy-palmitate, which does not occur normally in any known system.
In this regard, the mutant R. rubrum can be used to characterize an exogenous KASIII, which is a wild-type KASIII, a naturally occurring variant thereof, or a mutant thereof, e.g., a mutant with altered starter substrate specificity. Thus, also provided is a method of characterizing substrate specificity of a KASIII enzyme. The method comprises expressing the KASIII enzyme, which is not expressed in wild-type R. rubrum, in a mutant R. rubrum, such as a mutant R. rubrum, which lacks functional PhaC1, PhaC2, and PhaC3, in the presence of ω-functionalized acyl-CoA starter substrate and assessing the production of ω-functionalized fatty acids. The KASIII enzyme can be derived from an organism, the wild-type of which produces ω-functionalized fatty acids. Alternatively, the KASIII can be derived from an organism, the wild-type of which does not normally produce ω-functionalized fatty acids.
The above mutant B. subtilis and mutant R. rubrum can be generated in accordance with any suitable method known in the art, including, but not limited to, methods described and exemplified herein. Mutations, such as substitutions, insertions, deletions, and/or side chain modifications, can be introduced into the nucleotide and amino acid sequences of the gene of interest using any suitable technique known in the art, including site-directed mutagenesis (Wu, ed., Meth. Enzymol. 217, Academic Press (1993)). The lambda red recombinase method can be used to “knock out” genes (Datsenko et al., PNAS USA 97: 6640-6645 (2000)). A kanamycin disruption cassette flanked by FLP recognition target sites can be used to excise a cassette precisely and create an in-frame deletion (Baba et al., Mol. System. Biol. 2: 2006-2008 (2006)). Permanent, marker-free, multiple gene disruptions can be created. Non-naturally occurring nucleotides and amino acids also can be used.
An isolated or purified mutant (or chimeric) KASIII derived from a wild-type KASIII, such as a KASIII from family KS1 (ketoacyl synthase 1) from www.enzyme.cbirc.iastate.edu, which website is incorporated by reference herein for its teachings regarding KASIII, is also provided. Examples include a KASIII from a bacterium, such as E. coli and B. subtilis, as described and exemplified herein. Other examples include Aeromonas hydrophila (ATCC Deposit No. 7966; GenBank Accession No. YP_857537.1; nucleotide sequence [SEQ ID NO:67]; amino acid sequence [SEQ ID NO:68]), Bacteroides vulgatus (ATCC Deposit No. 8482; GenBank Accession No. ABR38167.1; YP_001297789.1; nucleotide sequence [SEQ ID NO:77]; amino acid sequence [SEQ ID NO:78]), Brevibacterium linens (KAS_BvL1: GenBank Accession No. AAGP010000; ZP_05913013.1; nucleotide sequence [SEQ ID NO:85]; amino acid sequence [SEQ ID NO:86]; KAS_BvL2: GenBank Accession No. AAGP010000; ZP_05912949.1; nucleotide sequence [SEQ ID NO:87]; amino acid sequence [SEQ ID NO:88]), Capnocytophaga gingivalis (KAS_CG1: ATCC Deposit No. 33624; GenBank Accession No. EEK13720.1; ZP_04058441.1; nucleotide sequence [SEQ ID NO:79]: amino acid sequence [SEQ ID NO:80]; KAS_CG2: ATCC Deposit No. 33624; GenBank Accession No. EEK14223.1; ZP_04057621; nucleotide sequence [SEQ ID NO:81]; amino acid sequence [SEQ ID NO:82]; KAS_CG3: ATCC Deposit No. 33624; GenBank Accession No. EEK14078.1; ZP_04058132.1; nucleotide sequence [SEQ ID NO:83]; amino acid sequence [SEQ ID NO:84]). Thermus aquaticus (GenBank Accession No. EED09603.1; ZP_03497263.1; nucleotide sequence [SEQ ID NO:89]; amino acid sequence [SEQ ID NO:90]), Bacillus licheniformis (KAS_BaL1: ATCC Deposit No. 14580; GenBank Accession No. AAU22783.1; YP_078421.1; nucleotide sequence [SEQ ID NO:91]; amino acid sequence [SEQ ID NO:92]; KAS_BaL2: ATCC Deposit No. 14580; GenBank Accession No. AAU22657.1; nucleotide sequence [SEQ ID NO:93]; amino acid sequence [SEQ ID NO:94]), Desulfovibrio vulgaris (GenBank Accession No. ACL10038.1; YP_002437506.1; nucleotide sequence [SEQ ID NO:107]; amino acid sequence [SEQ ID NO:108], Bacillus subtilis subsp. S (ATCC Deposit No. 6633; GenBank Accession No. EFG91245.1; ZP_06874900.1; nucleotide sequence [SEQ ID NO:101]; amino acid sequence [SEQ ID NO:102]), Haliangium ochraceum (GenBank Accession No. ACY12771.1; YP_003264664.1; nucleotide sequence [SEQ ID NO: 103]; amino acid sequence [SEQ ID NO: 104]), Alicyclobacillus acidocaldarius (GenBank Accession No. ACV57087.1; nucleotide sequence [SEQ ID NO: 105]; amino acid sequence [SEQ ID NO: 106]), Staphylococcus aureus (GenBank Accession No. BAB57145.1; NP_371507.1; nucleotide sequence [SEQ ID NO:109]; amino acid sequence [SEQ ID NO: 110]), Legionella pneumophila (KAS_LP1: GenBank Accession No. CAH12499.1; YP_123672.1; nucleotide sequence [SEQ ID NO:69]; amino acid sequence [SEQ ID NO:70]; KAS_LP2: GenBank Accession No. CAH13332.1; YP_124492; nucleotide sequence [SEQ ID NO:71]; amino acid sequence [SEQ ID NO:72]; KAS_LP3: GenBank Accession No. CAH13337.1; YP_124497: nucleotide sequence [SEQ ID NO:73]; amino acid sequence [SEQ ID NO:74]; KAS_LP4: GenBank Accession No. CAH12752.1; YP_123920; nucleotide sequence [SEQ ID NO:75]; amino acid sequence [SEQ ID NO:76]), Myxococcus xanthus (KAS_MX1: GenBank Accession No. ABF92307.1; YP_628497.1; nucleotide sequence [SEQ ID NO:95]; amino acid sequence [SEQ ID NO:96]; KAS_MX2: GenBank Accession No. ABF89527.1; YP_635461.1; nucleotide sequence [SEQ ID NO:97]; amino acid sequence [SEQ ID NO:98]; KAS_MX3: GenBank Accession No. ABF92876.1; YP_629114.1; nucleotide sequence [SEQ ID NO:99]; amino acid sequence [SEQ ID NO:100]), and the like. Yet other examples include Yersinia pestis (ZP_02318831.1), Stappia aggregata (ZP_01545409.1), Erythrobacter sp. SD-21 (ZP_01865126.1 and ZP_01040217.1), Physcomitrella patens (XP_001754014.1), Synechococcus sp. CC9605 (ABB36118.1), Renibacterium salmoninarum (ATCC Deposit No. 33209; YP_001626411.1), Chloroflexus aurantiacus, and those set forth below in the “KASIII Enzymes” table. Also, see the “Examples” herein. Depending on the particular KASIII (e.g., a KASIII from family KS1 from www.enzyme.cbirc.iastate.edu) that has been mutated, such mutants can have altered substrate specificity and/or altered level of activity. Mutants can be derived from wild-type KASIIIs in accordance with methods known in the art (e.g., site-directed mutagenesis) and described and exemplified herein. Also, the same amino acid sequence can be encoded by nucleotide sequences that vary due to the degeneracy of the genetic code.
Yersinia pestis
Yersinia enterocoliticas
Vibrio Cholerae,
Vibrio splendidus
Vibrio parahaemolyticus
Vibrio alginolyticus
Vibrio harveyi, ATCC BAA
Aeromonas salmonicida
Aeromonas hydrophila
Pasteurella multocida
Haemophilus influenzae
Haemophilus ducreyi
Serratia odorifera
Serratia proteamaculans
Vibrio harveyi
Vibrio
harveyi_ATCC_BAA-1
Vibrio splendidus
Vibrio vulnificus
Xanthomonas
campestris_pv._c, a
Xanthomonas
oryzae_pv._oryz
Legionella longbeachae
Legionella
pneumophila_str
Neisseria cinerea
Neisseria elongata
Neisseria flavescens
Neisseria gonorrhoeae
Neisseria lactamica
Neisseria meningitidis
Neisseria sicca
Neisseria subflava
Francisella
tularensis_subsp
Thiobacillus denitrificans
Escherichia coli
Escherichia coli_K-12
Shigella dysenteriae
Shigella flexneri_2a_str
Klebsiella pneumoniae
Enterobacter_cloacae_sub s
Proteus mirabilis
Providencia stuartii
Bordetella parapertussis
Bordetella pertussis
Xanthobacter
autotrophicus
Rhodomicrobium vannielii
Rhodopseudomonas
palustris
Anabaena variabilis
Synechocystis sp.
Synechococcus spp.
Bacteroides ovatus
Bacteroides
thetaiotaomicron
Bacteroides fragilis
Bacteroides vulgatus
Bacteroides sp.
Capnocytophaga ochracea
Capnocytophaga gingivalis
Algoriphagus sp.
Salinibacter ruber DSM
Cytophaga hutchinsonii
Micrococcus luteus
Peptostreptococcus
anaerobius
Mycobacterium
tuberculosis
Vibrio Cholerae
Vibrio splendidus
Vibrio parahaemolyticus
Vibrioharveyi, ATCC BAA
Vibrio vulnificus
Aeromonas salmonicida
Aeromonas hydrophila
Arthrobacter aurescens
Brevibacterium linens
Cellulomonas flavigena
Rothia dentocariosa
Streptomyces coelicolor
Streptomyces griseus
Streptomyces griseus subsp
Vibrioharveyi_ATCC_BAA-1
Vibrio harveyi
Vibrio splendidus
Vibriovulnificus
Clostridium perfringens E,
Clostridium botulinum
Clostridium thermocellum
Clostridium sporogenes
Geobacillus Y412MC10
Staphylococcus aureus
Staphylococcus
epidermidis
Staphylococcus warneri
Staphylococcus capitis
Staphylococcus
haemolyticus
Staphylococcus hominis
Staphylococcus
saprophyticus
Ruminococcus flavefaciens
Ruminococcus albus
Bacillus clausii
Bacillus halodurans
Bacillus pseudofirmus
Bacillus cellulosilyticus
Bacillus selenitireducens
Bacillus cytotoxicus
Bacillus cereus
Bacillus mycoides
Bacillus thuringiensis
Bacillus coagulans
Bacillus sp.
Bacillus coahuilensis
Bacillus amyloliquefacien
Bacillus pumilus
Bacillus licheniformis
Desulfotomaculum
acetoxid
Thermus aquaticus
Thermus thermophilus
Campylobacter
fetus_subsp._f
Campylobacter
jejuni_subsp
Fusobacterium
gonidiaformans
Fusobacterium mortiferum
Fusobacterium varium
Myxococcus xanthus
Stigmatella aurantiaca
Capnocytophaga ochracea
Capnocytophaga gingivalis
Algoriphagus sp.
Flavobacterium johnsoniae
Cytophaga hutchinsonii
Clostridium botulinum
Clostridium sporogenes
Bacillus thuringiensis ser
Myxococcus xanthus
Stigmatella aurantiaca
Lactobacillus casei
Lactobacillus plantarum 1,
Lactobacillus helveticus
Lactobacillus fermentum
Lactobacillus delbrueckii
Desulfovibrio vulgaris
Desulfovibrio
desulfuricans
Streptococcus equi subsp
Streptococcus equi subsp
Legionella
pneumophila_str
Bacteroides fragilis
Bacteroides sp.
Parabacteroides distasoni
Parabacteroides sp.
Capnocytophaga gingivalis
Clostridium thermocellum
Geobacillus sp.
Bacillus cereus
Bacillus mycoides
Bacillus thuringiensis
Vibrio Cholerae
Vibrioharveyi ATCC BAA
Pseudomonas fluorescens
Pseudomonas aeruginosa
Pseudomonas
aeruginosa_PA
Pseudomonas aeruginosa
Pseudomonas
aeruginosa_PAO1
Pseudomonas putida
Pseudomonas syringae_pv._t,
Vibrio
harveyi_ATCC_BAA-1
Xanthomonas
campestris_pv._v
Xanthomonas
oryzae_pv._oryz,
Legionella longbeachae
Legionella
pneumophila_str
Campylobacter coli
Campylobacter
jejuni_subsp
Bacteroides sp.
Parabacteroides johnsoni
Lactobacillusplantarum
Staphylococcusepidermidis
Staphylococcus capitis
Bacillus cereus
Bacillus cereus
Bacillus mycoides
Bacillus thuringiensis
Bacillus thuringiensis ser
Bacillus subtilis subsp.
Bacillus licheniformis
Bacillus anthracis str
Bacillus megaterium
Aeromonas salmonicida
Aeromonas hydrophila
Haemophilus influenzae
Pseudomonas putida
Pseudomonas syringae_pv._t,
Myxococcus xanthus
Rhodomicrobium vannielii
Bacteroides sp.
Clostridium botulinum
Clostridium sporogenes
Micrococcus luteus
Bacillus cereus
Bacillus mycoides
Bacillus thuringiensis ser
Bacillus subtilis
Bacillus subtilis
Bacillus subtilis subsp.
Bacillus anthracis str
Renibacterium
salmoninaru
Yersinia
pseudotuberculosis
Vibrio alginolyticus
Vibrio vulnificus
Brevibacterium linens
Streptomycesgriseus subsp
Pseudomonas fluorescens
Pseudomonas aeruginosa
Pseudomonas putida
Pseudomonas
syringae_pv._a, s
Serratia odorifera
Serratia proteamaculans
Vibrio vulnificus
Xanthomonascampestris_pv._c,
Xanthomonas
oryzae_pv._oryz,
Legionella longbeachae
Legionella
pneumophila_str
Neisseria sicca
Fusobacterium
nucleatum_su
Myxococcus xanthus
Stigmatella aurantiaca
Eschirichia coli_K-12
Escherichia
coli_O157:H7, coli_O127:H6
Escherichia coli
A KASIII can be mutated, for example, to alter the three-dimensional conformation of the active site, which, in turn can alter substrate specificity and/or level of activity. For example, by increasing the space available for substrate binding, a KASIII may utilize a branched-chain substrate whereas the corresponding wild-type KASIII is only able to utilize a straight-chain substrate. Conversely, by decreasing the space available for substrate binding, a KASIII may utilize a strain-chain substrate whereas the corresponding wild-type KASIII is additionally or only able to utilize a branched-chain substrate.
By way of example, a KASIII from E. coli can be mutated in such a manner as to alter the orientation of F304 in relation to the active site, which consists of C112, N274, and H244 (see
By way of another example, a KASIII from B. subtilis can be mutated in such a manner as to alter the orientation of F297 in relation to the active site, which consists of C122, N267, and H237 (see
Other KASIIIs, such as a KASIII from family KS1 (ketoacyl synthase 1) from www.enzyme.cbirc.iastate.edu, which website is incorporated by reference herein for its teachings regarding KASIII), in particular a KASIII from another bacterium, can be similarly mutated. For example, a KASIII from Aeromonas hydrophila, Bacteroides vulgatus, Brevibacterium linens, Capnocytophaga gingivalis, Thermus aquaticus, Bacillus licheniformis, Desulfovibrio vulgaris, Bacillus subtilis subsp. S, Haliangium ochraceum, Alicyclobacillus acidocaldarius, Staphylococcus aureus, Legionella pneumophila, or Myxococcus xanthus can be mutated.
Thus, in view of the above, a method of altering the specificity of a KASIII for at least one of its substrates is provided. The method comprises introducing into the KASII one or more mutations comprising at least one mutation, which causes the rotamer conformation of a phenylalanine in the KASIII corresponding to Phe304 in KASIII from E. coli to change. In one embodiment, the KASIII is from E. coli (GenBank Accession No. AAG55837.1; nucleotide sequence [SEQ ID NO:61]; amino acid sequence [SEQ ID NO:62]), and the one or more mutations comprises a mutation of Leu220, alone or in further combination with Val215. The mutation of Leu220 can be Leu220Met, and the mutation of Val215 can be Val215Phe. The rotamer conformation of Phe304 can be changed from the active site-distal rotamer conformation, in which the Phe304 is oriented away from the active site, to the active site-proximal rotamer conformation, in which the side chain of Phe304 faces towards the active site. In another embodiment, the KASIII is KASIIIA from B. subtilis, and the one or more mutations comprises a mutation of Met213, alone or in further combination with Phe208. The mutation of Met213 can be Met213Leu, and the mutation of Phe208 can be Phe208Val. The rotamer conformation of Phe297 can be changed from the active site-proximal rotamer conformation, in which the side chain of Phe297 faces towards the active site, to the active site-distal rotamer conformation, in which Phe297 is oriented away from the active site. In yet another embodiment, the KASIII is KASIIIB from B. subtilis, and the one or more mutations comprise a mutation of Trp221 and a mutation of Val226. The mutation of Trp221 can be Trp221Val, and the mutation of Val226 can be Val226Leu. The rotamer conformation of Phe310 can be changed from the active site-proximal rotamer conformation, in which the side chain of Phe310 faces towards the active site, to the active site-distal rotamer conformation, in which Phe310 is oriented away from the active site. In still yet another embodiment, the KASIII is from the KASIII is from Aeromonas hydrophila, Bacteroides vulgatus, Brevibacterium linens, Capnocytophaga gingivalis, Thermus aquaticus, Bacillus licheniformis, Desulfovibrio vulgaris, Bacillus subtilis subsp. S, Haliangium ochraceum, Alicyclobacillus acidocaldarius, Staphylococcus aureus, Legionella pneumophila, or Myxococcus xanthus.
The structure of KASIII can be found in the PDB database www.rcsb.org/pdb/home/home.do, which is hereby incorporated by reference for its teachings regarding same. The KASIII from E. coli has the PDB ID number 1EBL. The KASII from S. aureus has the PDB ID number 1ZOW. The phenylalanine in S. aureus, which corresponds to F304 in E. coli, has the active site-proximal rotamer orientation. “Altering the specificity of a KASIII for at least one of its substrates” can mean a change in the relative specificity of a given mutant KASIII for two or more substrates compared to the corresponding wild-type KASIII, gain of specificity for a substrate not utilized by the corresponding wild-type KASIII, or loss of specificity for a substrate utilized by the corresponding wild-type KASIII. Additionally or alternatively, the level of activity of a KASIII can be altered; for example, the level of activity of the mutant KASIII can be increased or decreased compared to the activity level of the corresponding wild-type KASIII. Preferably, activity levels are increased.
In view of the above, also provided is an isolated or purified nucleic acid molecule comprising a nucleotide sequence encoding a mutant KASIII. The isolated or purified nucleic acid molecule can be a vector. The mutant KASIII comprises one or more mutations comprising at least one mutation, which causes the rotamer conformation of a phenylalanine in the KASIII corresponding to Phe304 in KASIII from E. coli to change. In one embodiment, the KASIII is from E. coli, and the one or more mutations comprises a mutation of Leu220, alone or in further combination with Val215. The mutation of Leu220 can be Leu220Met, and the mutation of Val215 can be Val215Phe. The rotamer conformation of Phe304 can be changed from the active site-distal rotamer conformation, in which the Phe304 is oriented away from the active site, to the active site-proximal rotamer conformation, in which the side chain of Phe304 faces towards the active site. In another embodiment, the KASIII is KASIIIA from B. subtilis, and the one or more mutations comprises a mutation of Met213, alone or in further combination with Phe208. The mutation of Met213 can be Met213Leu. and the mutation of Phe208 can be Phe208Val. The rotamer conformation of Phe297 can be changed from the active site-proximal rotamer conformation, in which the side chain of Phe297 faces towards the active site, to the active site-distal rotamer conformation, in which Phe297 is oriented away from the active site. In yet another embodiment, the KASIII is KASIIIB from B. subtilis, and the one or more mutations comprise a mutation of Trp221 and a mutation of Val226. The mutation of Trp221 can be Trp221Val, and the mutation of Val226 can be Val226Leu. The rotamer conformation of Phe310 can be changed from the active site-proximal rotamer conformation, in which the side chain of Phe310 faces towards the active site, to the active site-distal rotamer conformation, in which Phe310 is oriented away from the active site. In still yet another embodiment, the KASIII is from Aeromonas hydrophila, Bacteroides vulgatus, Brevibacterium linens, Capnocytophaga gingivalis, Thermus aquaticus, Bacillus licheniformis, Desulfovibrio vulgaris, Bacillus subtilis subsp. S, Haliangium ochraceum, Alicyclobacillus acidocaldarius, Staphylococcus aureus, Legionella pneumophila, or Myxococcus xanthus.
When a KASIII gene is being mutated, such as to alter starter substrate specificity, mutations to the nucleotide sequence should not place the sequence out of reading frame and should not create complementary regions that could produce secondary mRNA structures. The mutant (or chimeric, such as when domains are swapped between genes) KASIII may have altered substrate specificity, e.g., reacts with an acyl-CoA substrate that differs in chain length, degree of saturation, or presence/absence of a side group (e.g., methyl group), from that which is acted upon by the wild-type (also referred to as “native”) KASIII. Alternatively, the mutant or chimeric KASIII may have altered relative substrate specificity between two or more substrates, both of which are acted upon by the wild-type KASIII. Both types of alterations in substrate specificity are encompassed by references to alterations of substrate specificity and substrate specificity-altering mutations herein. Alternatively or additionally to altered substrate specificity, the mutant or chimeric KASIII may have an altered activity level, e.g., level of synthase activity, such as the total amount of fatty acids produced, including increased or decreased activity. Altered substrate specificity and altered activity can be detected by expression of the mutant KASIII in E. coli, for example, and assay of enzyme activity.
A nucleotide sequence encoding all or a part of a KASIII can be chemically synthesized, such as by the phosphoramidite method (Beaucage et al., Tetrahedron Letters 22: 1859-1869 (1981); and Matthes et al., EMBO J. 3: 801-805 (1984)). Alternatively, a nucleotide sequence encoding all or a part of a KASIII can be amplified from the genome or mRNA of an appropriate host using polymerase chain reaction (PCR) methods or amplified from an environmental DNA sample using PCR (see, e.g., metagenomics methods). Polynucleotides can be synthesized, purified, annealed to their complementary strand, ligated, and then, optionally, cloned into suitable vectors.
The isolated or purified nucleic acid molecule comprising a nucleotide sequence encoding a KASIII, such as a mutant/chimeric KASIII, can be a vector. The vector can contain, and preferably does contain, transcription and translation control regions. A promoter can be constitutive or regulatable, such as inducible. Additional sequences that can be present in the vector include pre-processing sequences, such as transit peptide sequences and plastid transit peptide sequences.
The KASIIIs and mutant/chimeric KASIIIs identified herein can be used in whole or in part as probes in hybridization assays to identify other KASIIIs that can be used in the methods described herein. The KASIIIs or fragments thereof also can be used as primers to amplify target DNA, such as by polymerase chain reaction (PCR) and other nucleic acid amplification methods. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001); Ausubel et al., eds., Short Protocols in Molecular Biology, 5th ed., John Wiley & Sons (2002).
The nucleic acid molecule comprising a nucleotide sequence encoding a KASIII or a mutant/chimeric KASIII can be introduced into a host cell or a host organism using any suitable technique as is known in the art. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001); Ausubel et al., eds., Short Protocols in Molecular Biology, 5th ed., John Wiley & Sons (2002). Such methods include microinjection, DNA particle bombardment, electroporation, liposome fusion, Agrobacterium-mediated transformation, and methods exemplified herein. Depending on the host cell or the host organism, one method can be preferred over another as readily appreciated by one of ordinary skill in the art. The nucleotide sequence can be codon-optimized for the recipient host cell or organism.
Also provided is an isolated or purified mutant KASIII. The mutant KASIII comprises one or more mutations comprising at least one mutation, which causes the rotamer conformation of a phenylalanine in the KASIII corresponding to Phe304 in KASIII from E. coli to change. In one embodiment, the KASIII is from E. coli, and the one or more mutations comprises a mutation of Leu220, alone or in further combination with Val215. The mutation of Leu220 can be Leu220Met, and the mutation of Val215 can be Val215Phe. The rotamer conformation of Phe304 can be changed from the active site-distal rotamer conformation, in which Phe304 is oriented away from the active site, to the active-site proximal rotamer conformation, in which the side chain of Phe304 faces towards the active site. In another embodiment, the KASIII is KASIIIA from B. subtilis, and the one or more mutations comprises a mutation of Met213, alone or in further combination with Phe208. The mutation of Met213 can be Met213Leu, and the mutation of Phe208 can be Phe208Val. The rotamer conformation of Phe297 can be changed from the active site-proximal rotamer conformation, in which the side chain of Phe297 faces towards the active site, to the active site-distal rotamer conformation, in which Phe297 is oriented away from the active site. In yet another embodiment, the KASIII is KASIIIB from B. subtilis, and the one or more mutations comprise a mutation of Trp221 and a mutation of Val226. The mutation of Trp221 can be Trp221 Val, and the mutation of Val226 can be Val226Leu. The rotamer conformation of Phe310 can be changed from the active site-proximal rotamer conformation, in which the side chain of Phe310 faces towards the active site, to the active site-distal rotamer conformation, in which the Phe310 is oriented away from the active site. In still yet another embodiment, the KASIII is from Aeromonas hydrophila, Bacteroides vulgatus, Brevibacterium linens, Capnocytophaga gingivalis, Thermus aquaticus, Bacillus licheniformis, Desulfovibrio vulgaris, Bacillus subtilis subsp. S, Haliangium ochraceum, Alicyclobacillus acidocaldarius, Staphylococcus aureus, Legionella pneumophila, or Myxococcus xanthus.
Once sequenced, polypeptides can be synthesized using methods known in the art, such as, for example, exclusive solid phase synthesis, partial solid phase synthesis, fragment condensation, and classical solution synthesis. See, e.g., Merrifield, J. Am. Chem. Soc. 85: 2149 (1963), and Stewart and Young in Solid Phase Peptide Syntheses (2nd Ed., Pierce Chemical Company, 1984). Automated peptide synthesizers are commercially available, as are services that make peptides to order.
In view of the above, a host cell comprising an above-described isolated or purified nucleic acid molecule is also provided. The host cell or organism can be any suitable host cell or organism. The host cell or organism can be prokaryotic or eukaryotic, unicellular or multicellular, and undifferentiated or differentiated. If large-scale production of short-chain fatty acids is desired, e.g., as a source of a bio-based chemical (such as surfactants, lubricants, food oils, polymers, and the like) bacteria (see, e.g., U.S. Pat. App. Pub. No. 2012/0164700, which discloses examples of cyanobacteria, and U.S. Pat. App. Pub. No. 2009/0298143, which discloses methods of expression in bacteria, and both of which are hereby incorporated by reference for their teachings regarding same), yeast (see, e.g., U.S. Pat. App. Pub. No. 2011/0294174, which discloses examples of yeast in Table 26 and other fungi in Table 27 and which is hereby incorporated by reference for its teachings regarding same), and algae (see, e.g., U.S. Pat. App. Pub. No. 2011/0294174, which discloses examples of algae in Table 1 and which is hereby incorporated by reference for its teachings regarding same; also, see U.S. Pat. No. 7,935,515 and U.S. Pat. App. Pub. No. 2012/0164700, which disclose methods of expressing enzymes, specifically thioesterases, in microalgae and examples of microalgae and which are hereby incorporated by reference for their teachings regarding same; see, also, U.S. Pat. App. Pub. No. 2009/0317878, which is hereby incorporated by reference for its teachings regarding expression of genes in algae) can be preferred. A preferred bacterium is Escherichia coli, in particular the strain K27. A preferred yeast is Saccharomyces cerevisiae. Alternatively, a crop plant (e.g., maize, canola, and others), such as an oilseed crop plant or a seed cell thereof, can be preferred (see, e.g., U.S. Pat. No. 7,504,563, which discloses expression of a nucleic acid encoding an enzyme, specifically a thioesterase, in soybean seed and which is incorporated herein for its teachings regarding same). See, also, U.S. Pat. App. Pub. No. 2010/0154293, which discloses other examples of host cells in paragraph [0080] and which is incorporated herein by reference for its teachings regarding same.
Fatty acids can be harvested, or otherwise collected (e.g., isolation from media containing bacteria that secrete the fatty acids), from host cells or organisms by any convenient method. Cells can be lysed/disrupted (e.g., heat, enzymes, ultrasound, mechanical lysis, osmotic shock, acid/base addition, or infection with a lytic virus), and fatty acids can be separated from cell mass by centrifugation and extraction (e.g., extraction with hydrophobic solvent, liquefaction, supercritical CO2 extraction, or hexane extraction after freeze-drying and pulverization) and further processed/refined as necessary. See, e.g., U.S. Pat. No. 7,935,515 and U.S. Pat. App. Pub. No. 2012/0135479, which are incorporated specifically by reference for their teachings regarding same.
In view of the above, a method of producing bi-functional fatty acids in a host cell or organism is also provided. The method comprises introducing into a host cell or organism, which comprises one or more ω-functionalized acyl-CoAs, and expressing therein a nucleic acid molecule comprising a nucleotide sequence encoding a KASIII (or a mutant or chimera thereof, such as a mutant or chimera with an altered substrate specificity or an altered level of activity), such as a KASIII from family KS1 (ketoacyl synthase 1) from www.enzyme.cbirc.iastate.edu (incorporated herein by reference for its teachings regarding KASIII), e.g., a KASIII from A. acidocaldarius, which can use one or more of the ω-functionalized acyl-CoAs as a substrate. The one or more ω-functionalized acyl-CoAs can be functionalized at the ω position with a moiety comprising a hydroxyl group, a benzoyl group, a cyclic group, a branched-chain group, an amino group, or a halogen group. The host cell or organism can be a mutant R. rubrum, such as a mutant R. rubrum described above. A preferred host cell or organism can be a bacterium, such as E. coli, an alga, or a plant. Preferably, the host cell or organism, e.g., E. coli, has been mutated so that it does not express endogenous KASIII (fabH gene). More preferably, the host cell or organism, e.g., E. coli, has been modified so that it overproduces acyl-CoA starter substrate, does not degrade fatty acid, does not terminate fatty acid elongation, and/or secretes fatty acids, such as into the surrounding medium. For example, the fadD gene, which codes for acyl-CoA synthetase, which initiates degradation of fatty acids (Kelin et al., European Journal of Biochem/FEBS 19:442-450 (1971)), can be deleted. Acyl-ACP thioesterase, which results in secretion of fatty acids, can be expressed (Li et al., Metabolic engineering 14: 380-387 (2012); Zhang et al., Metabolic engineering 13: 713-722 (2011); Jing et al., BMC Biochem 12: 44 (2011)). The PHA biosynthetic operon, specifically phaA and phaB without phaC, can be expressed/over-expressed, in an effort to produce enantiopure (R) and (S)-3-hydroxybutyrate (Tseng et al., Applied and Environmental Microbiology 75: 3137-3145 (2009)).
The bi-functional fatty acids produced in accordance with the above methods can be used in a variety of different applications, such as surfactants, which can vary somewhat in the length of the carbon chain of the fatty acid, lubricants, which also can vary somewhat in the length of the carbon chain of the fatty acid, and polymers (e.g., polyester), which preferably do not vary in the length of the carbon chain of the fatty acid. The provision of novel bi-functional, bio-based feedstocks (e.g., hydroxy fatty acids and amino fatty acids, such as for polyamides) to the emerging biorenewable chemical industry can lead to the production of novel “green” plastics and specialty chemicals. Such chemical products can act as substitutes for petroleum-based chemical products, and be precursors for novel bio-based products. Such chemical feedstocks can be used to manufacture polymers, specifically polyesters, as well as being utilized in detergents, surfactants, solvents, paints, varnishes, lubricants, cosmetics, and specialty chemical synthesis. Thus, further provided is a composition comprising a bi-functional fatty acid produced in accordance with a method described herein. The composition can be a feedstock, for example. Still further provided is a method of using the feedstock to manufacture a composition, such as a polymer, such as a polyester, a detergent, a surfactant, a solvent, a paint, a varnish, a lubricant, a cosmetic, and the like. Even still further provided is a composition, such as a polymer, e.g., a polyester, a detergent, a surfactant, a solvent, a paint, a varnish, a lubricant, a cosmetic, and the like, produced by the method. See, e.g., Nikolau et al., Plant J. 54: 536-545 (2008), which is hereby incorporated by reference for its teachings regarding same.
Further provided is an in vitro, high-throughput spectrophotometric method of assaying KASIII activity. The method comprises (i) incubating holo-ACP, malonyl-CoA, acyl-CoA, NADPH, and malonyl-CoA:ACP transacylase (FabD), (ii) adding KASIII and 3-ketoacyl-ACP reductase (FabG), and (iii) measuring the change in absorbance at 340 nm when NADPH is converted to NADP+ during reduction of 3-ketoacyl-ACP to 3-hydroxyl-acyl ACP by FabG. The acyl-CoA can be acetyl-CoA, propionyl-CoA, isobutyryl-CoA and/or hydroxybutyryl-CoA. Such acyl-CoAs are commercially available, such as from Sigma-Aldrich, and can be synthesized by a mixed anhydride reaction in accordance with methods known in the art. Preferably, incubating in (i) is for about two minutes, e.g., two minutes, in the presence of a buffer, such as sodium phosphate buffer, at slightly alkaline pH, e.g., pH 7.2. Preferably, a disulfide-reducing agent, such as dithiothreitol (DTIT), is used in step (i). The acyl-CoA can be a straight-chain-CoA, a branched-chain-CoA, or a hydroxylated-CoA. The method can be used to assess enzymes and evaluate/compare the catalytic efficiency of enzymes with different acyl-CoA substrates. The rate of change in absorbance can be used to calculate directly the rate of the KASIII-catalyzed reaction.
The following examples serve to illustrate the present disclosure. The examples are not intended to limit the scope of the claimed invention in any way.
This example describes the selection of KASIII enzymes based on substrate diversity.
As many as 2,308 KASIII sequences collected in the ThYme database (www.enzyme.cbirc.iastate.edu; Cantu et al., Nucleic Acids Res. 39: D342-D346 (2011)) were analyzed phylogenetically in collaboration with Dr. Peter Reilly (Iowa State University). Protein sequences were aligned, and a minimum evolution method with 250 bootstrap iterations was employed. Sequences were grouped into 12 sub-families. KASIII gene sequences were selected based on fatty acid profiles of the host organisms, occurrence of the same strain in multiple sub-families, and statistical analysis of clades, for which no fatty acid data are available. KASIII gene sequences from the following organisms were chemically synthesized with codon optimization for E. coli: Aeromonas hydrophila, Erythrobacter sp SD-21, Haliangium ochraceum, Myxococcus xanthus (three sequences), Capnocytophaga gingivalis (three sequences), Brevibacterium linens (two sequences), Renibacterium salmoninarum, Legionella pneumophila (four sequences), Nocardiopsis dassonvillei, Desulfovibrio vulgaris st., Stappia aggregata, Methylosinus trichosporium, Escherichia coli (the KASIII of which acts on straight-chain primers), Aeromonas hydrophila (two sequences), Physcomitrella patens subsp patens, Synechococcus sp CC9605, Bacteroides vulgatus, Alicyclobacillus acidocaldarius (the KASIII of which acts on cyclic primers), Thermus aquaticus, Bacillus licheniformis bFabHA, Bacillus licheniformis bFabHB, Bacillus subtilis subsp spizizenii, Bacillus subtilis (the KASIII of which acts on branched-chain primers) bFabHA, and Bacillus subtilis bFabHB. While not included, Mycobacterium tuberculosis KASIII prefers long-chain primers, whereas Dichapetalum toxicarium KASIII prefers halogenated primers.
This example describes the generation and characterization of B. subtilis KASIII single and double deletion mutants.
—Bacterial Strains and Growth Conditions.
B. subtilis strain 168 was obtained from the Bacillus Genetic Stock Center (www.bgsc.org). Escherichia coli strains DH5a and BL21(DE3) were obtained from Invitrogen Corporation (Carlsbad, Calif.).
E. coli and B. subtilis were routinely grown in LB medium at 37° C. B. subtilis minimal medium was composed of Spizizen salts (Spizizen, PNAS USA 44: 1072-1078 (1958)), supplemented with 0.5% glucose and amino acids (Sueoka et al., Cold Spring Harbor Symp. Quant. Biol. 33: 695-705 (1968)). As needed, media were supplemented with erythromycin (1 μg/ml) and ampicillin (100 μg/ml). IPTG and X-gal were used at concentrations of 0.4-1 mM and 40 μg/ml, respectively. As needed, media were supplemented with 10-100 μM individual fatty acids suspended in 0.01% (v/v) Brij 58P detergent. Fatty acids were obtained from Sigma-Aldrich Corporation (St. Louis, Mo.). The purity of the commercial sources of anteiso-C16:0, iso-C16:0 and palmitoleic acid were determined by GC-MS analysis (see Table 1). Cell density was determined by monitoring A600 using a Spectronic 20D+ spectrophotometer (Thermo Fisher Scientific Inc., Waltham, Mass.) or in a 96-well plate using an ELx808 Absorbance Microplate Reader (BioTek Instruments, Inc., Winooski, Vt.). Doubling time (Td) was determined from the log-phase time points of cultures.
—DNA Manipulation.
DNA manipulation techniques, such as PCR amplification, plasmid preparation, restriction endonuclease digestion, agarose gel electrophoresis, and genetic transformation, were carried out by standard methods (Sambrook et al., Molecular Cloning: A laboratory manual, 3rd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001)). Transformation of B. subtilis was conducted on modified competent medium (Kunst et al., “Signal transduction network controlling degradative enzyme synthesis and competence in bacillus subtilis,” In: Regulation of Bacterial Differentiation, pp. 1-20, Piggot, editor, American Society for Microbiology, Washington, D.C. (1994)). All oligonucleotide sequences used are listed in Table 2.
TAATGAAAGCTGGAATAC
GGAGATAATGCTCCAG
ATTCATATGTCAAAAGC
CAGAAGAACAGCCGG
AACAAGCTGAAGTGGCTGCT
ATCACTGACTGGCCCGACTA
GCCGGAGAGACGTTATCAAA
CGTGTTTCCGTAGTGCTCAA
TATTAACCATCACGGTGCAA
GAATGTAACGTCCAACACCA
TGGAAGCCCGGTAAAATCAA
GCCGACAATTTCTCCGTAAA
ATATAAAACCGCCGGGACAT
GCATAGGTGCCGATAGCTGTA
TCAAATCGTTTTGCTTTTCG
CCAAACAGGAGATATCGATGC
ATATAAAACCGCCGGGACAT
GCATAGGTGCCGATAGCTGTAA
TCAAATCGTTTTGCTTTTCG
CCAAAGATGATGCCATTCA
CAAATTTACAAAAGCGACTA
GAGGCCCTTTCGTCTTCAA
aRestriction sites designed into the nucleotide sequences are indicated in bold and
KASIII-coding genes were expressed in E. coli strain BL21 (DE3) using pET-based vectors (Novagen, Madison, Wis.). The bfabHA gene was PCR-amplified with the primers Af1-Nco I and Ar1-Eco RI. The resulting fragment was cloned into the Nco I and Eco RI restriction sites of the pET30a vector, resulting in expression vector pET30a-bfabHA. By the analogous procedure, the bfabHB gene was also cloned into the pET30a vector, resulting in the expression vector pET30a-bfabHB.
B. subtilis KASIII-coding genes were disrupted by the insertion of the pMUTIN4 vector (Vagner et al., Microbiology 144(Pt 11): 3097-3104 (1998)) via homologous recombination. A fragment of the bfabHA gene (nucleotides 191-513) was PCR-amplified with the primers Af2-Hin dIII and Ar2-Bam HI. This bfabHA PCR-fragment was cloned into the Hin dIII and Bam HI restriction sites of pMUTIN4 vector (Vagner et al. (1998), supra). By the analogous procedure, a bfabHB fragment (from nucleotide from 415 to 843) was also cloned into the pMUTIN4 vector. The recombinant pMUTIN4 plasmids carrying the bfabHA and bfabHB gene fragments were named pM4A and pM4B, respectively.
The two B. subtilis KASIII-coding genes were deleted by using the vectors pMU4A and pMU4B, respectively, which are derivatives of pMUTIN4 (Vagner et al. (1998), supra). The pMU4A vector contained two bfabHA-derived fragments, one 5′ of the open reading frame (ORF), and the other 3′ of the ORF. The 5′-, 897-bp DNA fragment spanned from 860 bp upstream of the bfabHA ORF to 37 bp within the bFabHA ORF, and the 3′-, 897-bp DNA fragment spanned from 799 bp downstream to 98 bp within the 3′-end of the bfabHA ORF. These two fragments were initially PCR-amplified with the primer pair AUf-Pac I and AUr-Sal I, and the primer pair ADf-Sal I and ADr-Pst I, and both fragments were cloned into pMUTIN4, at the Pac I and Pst I sites. The resulting pMU4A vector contained an in-frame 135-bp bfabHA fragment missing 804 bp from the middle of the ORF; the fact that this deletion allele carried an in-frame ORF avoided any polar effect on the downstream genes of the bfabHA-containing transcription unit. The vectors pMU4B and pUCB-erm, which were used to generate the deletion allele for bfabHB, were constructed by an analogous procedure, except that the vector pUCB-erm was constructed from plasmid pUC19 and the erythromycin-resistant gene erm was inserted between the downstream and upstream DNA fragments of bfabHB ORF.
—Construction of B. subtilis Mutants.
B. subtilis gene-insertion mutant alleles were generated by transforming B. subtilis strain 168 with the plasmids pM4A and pM4B, and the desired mutants were selected by virtue of their ability to grow in lethal doses of erythromycin. PCR reactions with primers that would support amplification only from appropriately recombined alleles were conducted to verify that the single cross-over recombination-mediated integration of the vectors occurred as expected. A genomic specific primer AL and a vector specific primer RB were used to confirm the bfabHA::pM4A allele. A genomic specific primer BL and a vector specific primer RB were used to confirm the bfabHB::pM4B allele (see Table 2).
Two single-deletion strains of B. subtilis, each lacking one or the other KASIII-coding gene, were generated by homologous recombination via a two-step procedure using the vector pMU4A and pMU4B, respectively. Briefly, plasmid pMU4A or pMU4B was transformed into wild-type strain 168, followed by selection for erythromycin resistance. The recovered integrant colonies were grown in LB liquid medium without erythromycin, the overnight cultures were diluted 1:107, and about 100 μl of the diluted culture were plated on LB medium with IPTG and X-gal and screened for white colonies, indicating the loss of the lacZ-containing pMUTIN4 sequence, which would result in the deletion of the appropriate KASIII-coding gene. The nature of the deletion mutants was confirmed by PCR amplification of a specific sequence of each deletion allele.
The double-deletion mutant strain, ΔbfabHA ΔbfabHB::erm, was generated by homologous recombination via a one-step procedure, by transforming the mutant ΔbfabHA strain with the Eco RI-linearized plasmid pUCB-erm followed by selection for erythromycin resistance on media containing anteiso-C16:0 fatty acid. Primers lofAf and lofAr were used to confirm the ΔbfabHA allele. Primers lofBf and lofBr were used to confirm the ΔbfabHB and ΔbfabHB::erm alleles (see Table 2).
—Assays of β-Galactosidase.
β-galactosidase activity, expressed as Miller units (Miller, A Short Course in Bacterial Genetics: A Laboratory Manual and Handbook for Escherichia coli and Related Bacteria, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1992)), was assayed as described (Cutting et al., “Genetic Analysis,” In: Molecular Biological Methods for Bacillus, pp. 27-74, Harwood and Cutting, eds., John Wiley, Chichester (1990)) using o-nitrophenyl-β-D-galactoside as substrate.
—Protein Purification and Preparation of Antibodies.
The two B. subtilis KASIII proteins were expressed in E. coli BL21 (DE3) using the plasmid pET30a-bfabHA or pET30a-bfabHB (Novagen, San Diego, Calif.), and cultures were grown in LB medium containing the appropriate antibiotic. When the culture reached an OD600 of 0.9, 1 mM IPTG was used to induce expression. Cells were harvested, and the proteins were purified by affinity chromatography on a Ni-NTA agarose column (Qiagen, Valencia, Calif.) according to the manufacturer's instructions. Antibodies directed against the KASIIIA and KASIIIB proteins were generated by injecting each recombinant protein into a rabbit using Freund's Complete and Incomplete Adjuvants (Pierce, Rockford, Ill.).
—Protein Analysis.
Protein extracts were prepared from bacterial cells collected by centrifugation of a 3-ml aliquot of early stationary-phase growth culture. The pellet was suspended in 0.3 ml extraction buffer, consisting of 30 mM Tris-HCl, pH 8, 10 mM EDTA, and 0.5 mg/ml lysozyme, and incubated at 37° C. for 30 minutes. The lysate was further disrupted by sonication. Following centrifugation for 10 minutes at 16,100 g, the supernatant was retained for analysis. Protein concentration was determined by Bradford's method (Bradford, Anal. Biochem. 72: 248-254 (1976)) using bovine serum albumin to generate a standard curve. Immunoblot analysis was performed as described previously (Li et al., Plant Physiol. 155: 293-314 (2011)).
—Fatty Acid Analysis.
A 0.5 ml aliquot of an overnight B. subtilis culture normalized for equal cell density was collected by centrifugation at 13,200×g for 30 seconds. The cell pellet was suspended in 50 ml minimal medium or LB rich medium. Cell cultures were shaken at 250 rpm. Cells were collected at late log phase by centrifugation at 5,000×g for 10 minutes. The collected cell pellets were lyophilized and stored at −20° C. until analysis. Lipids were extracted from lyophilized bacterial cell pellets using chloroform/methanol (Ways et al., J. Lipid Res. 5: 318-328 (1964)), and fatty acids were then converted to picolinyl ester (lipidlibrary.aocs.org/ms/ms02/index.htm) (Harvey, Biomed. Mass Spectrom. 9: 33-38 (1982)) or methyl esters using methanolic-HCl at 80° C. for 60 minutes (Broekman et al., J. Bacteriol. 116: 285-289 (1973); and Broekman et al., J. Bacteriol. 117: 971-977 (1974)). The recovered picolinyl ester or fatty acid methyl esters were concentrated as needed under a stream of nitrogen gas and analyzed with GC-MS interfaced with a Mass Detector 5973 (Agilent Technologies, Santa Clara, Calif.). The double bond positions in unsaturated fatty acids were determined by GC-MS analysis of dimethyl disulfide adducts (Buser et al., Anal. Chem. 55: 818-822 (1983)).
—Growth Characteristics of Single Gene Mutant Strains.
The wild-type B. subtilis strain 168 and the isogenic mutant strains ΔbfabHA and ΔbfabHB, which lacked KASIIIA and KASIIIB, respectively, were grown at 37° C. and 16° C. (
—Expression of bfabHA and bfabHB Genes.
Protein extracts from the wild-type, ΔbfabHA and ΔbfabHB mutant strains grown at 37° C. and 16° C. were analyzed by Western blot to confirm the nature of the mutant growth phenotype of the ΔbfabHA mutant strain. The KASIIIA protein, but not the KASIIIB protein, accumulated to detectable levels in the wild-type strain, and, as expected, the KASIIIA protein was not detected in the ΔbfabHA mutant. In contrast, the KASIIIB protein, which is undetectable in the wild-type strain, was induced in the ΔbfabHA mutant.
Because the finding that the expression of the bfabHB gene is conditional on the absence of the bfabHA-encoded KASIII was unexpected, corroborative evidence for this finding was gained with an independent approach, i.e., promoter-lacZ fusion reporters. In this experiment these reporter alleles were generated by a single-crossover recombination event between a KASIII-encoding genomic locus (either bfabHA or bfabHB) and the plasmid pMUTIN4 (Vagner et al., Microbiology 144(Pt. 11): 3097-3104 (1998)), which carries one or the other KASIII-encoding fragment, fused to the lacZ gene. The resulting recombination event generated a transgenic new locus that expressed β-galactosidase under the transcriptional regulation of either of the bfabHA promoter or the bfabHB promoter.
These data therefore, indicate that, while the bfabHA gene is expressed in the wild-type, the bfabHB gene is normally silent, and its expression is induced in the absence of a functional bfabHA gene. Moreover, the growth characteristics of the two mutants ΔbfabHA and ΔbfabHB described in
—Effect of bfabHA and bfabHB Gene Deletions on Fatty Acid Composition.
Fatty acid compositions of the ΔbfabHA and ΔbfabHB mutants were compared to the wild-type strain, and these comparisons were conducted on strains that were grown at either 37° C. or 16° C. Fatty acids were chemically identified by a combination of comparing retention indices to commercial standards, MS-fragmentation of picolinyl esters (Harvey, Biomed. Mass Spectrom. 9: 33-38 (1982)), and determination of double bond positions in unsaturated fatty acids by MS-fragmentation of DMDS adducts (Buser et al., Anal. Chem. 55: 818-822 (1983)).
These analyses indicated that, at both growth temperatures, the fatty acid composition of the ΔbfabHB mutant was nearly identical to that of wild-type (
—Rescue of KASIII Deficiency in B. subtilis by Anteiso-, Iso- and Unsaturated Fatty Acids.
A KASIII-deficient strain was developed in the ΔbfabHA strain by inserting the erm gene into the bfabHB locus via a homologous double-crossover recombination event. The resulting ΔbfabHA ΔbfabHB::erm double-deletion mutant proved to be lethal, but could be rescued by the inclusion of BCFAs in the media, specifically anteiso-16:0. The absence of either KASIII proteins in the rescued double-mutant strain was confirmed by Western blot analysis. These findings established that KASIII is essential for B. subtilis cellular metabolism.
Although anteiso-16:0 could rescue the KASIII deficiency, the rescued strain grew considerably slower than the wild-type strain. Therefore, whether or not other fatty acids could improve the growth capabilities of the KASIII-deficient strain was examined. Rescue of the KASIII-deficient strain was attempted by the inclusion of anteiso- and iso-BCFAs, and normal saturated and unsaturated fatty acids of different chain lengths. These complementation experiments were conducted by providing these fatty acids in the media at three different concentrations (10, 30 and 100 μM each). At the lowest concentration tested, only anteiso-fatty acids supported the growth of the KASIII-deficient strain, and of all the chain-lengths attempted (anteiso-C5:0, C6:0, C7:0, C8:0, C9:0, C10:0, C12:0, C13:0 and C16:0), only C13:0 and C16:0 anteiso-fatty acids were successful in complementing the KASIII deficiency. At the higher concentration level (30 μM), iso-C16:0 was able to rescue growth, but none of the other shorter chain length iso-fatty acids that were attempted (i.e., iso-C4:0, C5:0, C6:0, C7:0, C9:0, and C10:0) could rescue the KASIII deficiency, even at 100 μM levels. None of the tested normal saturated chain fatty acids (n-C8:0, C10:0, C12:0, C14:0, C16:0 and C18:0) could rescue growth (at any of the tested concentrations). Rescue of this strain was also attempted with monounsaturated fatty acids, and of the three that were attempted, palmitoleic acid, n-C17:1(10) could rescue the KASIII deficiency when supplied at 30 μM, but oleic acid could not rescue the strain even at 100 μM. These results indicate that BCFAs, either iso- or anteiso, and mono-unsaturated fatty acids are important constituents that provide an essential function to B. subtilis membranes, most probably associated with maintaining membrane fluidity.
Because anteiso-16:0 is not a fatty acid that B. subtilis normally synthesizes, fatty acid analysis of the rescued strain provided novel insights into the fatty acid metabolism of this organism. For example, the anteiso-C16:0 rescued KASIII-deficient strain not only incorporated the exogenously provided fatty acid into the membrane lipids, but it metabolized this fatty acid by two rounds of elongation, indicated by the presence of anteiso-C18:0 and anteiso-C20:0, and one round of β-oxidation, indicated by the presence of anteiso-C14:0 (
Interestingly, this anteiso-C16:0-rescued KASIII-deficient strain still had the ability to synthesize significant amounts of straight-chain fatty acids (
—Comparative Efficacy of Rescue of KASIII Deficiency by Anteiso-, Iso- and Unsaturated Fatty Acids at Different Growth Temperatures.
Presupposing that the chemo-physical properties of fatty acids determine their capacity to affect membrane function, the KASIII-deficient strain, which grew only in the presence of exogenously provided fatty acids that affect membrane fluidity, provided an excellent bio-system to test the relative ability of anteiso-, iso- and unsaturated fatty acids to rescue the KASIII deficiency by modulating membrane fluidity and, hence, supporting growth. Moreover, by conducting these tests at different growth temperatures, the degree to which these different types of fatty acids maintained membrane fluidity in response to thermal tolerance was assessed (Suutari et al., Crit. Rev. Microbiol. 20: 285-328 (1994)).
Four different types of 16-carbon fatty acids (anteiso-C16:0, iso-C16:0, palmitoleic acid, and palmitic acid) were supplied in the medium to evaluate the capacity of these different fatty acids to rescue the KASIII-deficient strain at four different temperatures between 16° C. and 37° C. The rescued strains grew at different rates depending upon the type of fatty acid that was provided, which was interpreted as an indication of each fatty acid's ability to contribute to membrane functionality, by maintaining membrane fluidity as the strain was challenged with lower temperatures. At all temperatures tested, anteiso-C16:0 was most efficient in supporting growth. The second most efficient fatty acid to support growth depended on the growth temperature. At 37° C. iso-C16:0 was better able to support growth than n-C16:1(9), but at lower temperatures n-C16:1(9) was more efficient than iso-C16:0. Indeed, at or below 20° C. iso-C16:0 was incapable of supporting growth, whereas anteiso-C16:0 and n-C16:1(9) rescued the KASIII deficiency, with the former being considerably more efficient (
With the exception of the experiment conducted at 16° C., fatty acid analysis of the rescued strains indicated that the exogenously provided fatty acids and their metabolic derivatives accounted for about 90% of the cellular fatty acids (
This example describes the structural analysis of wild-type and mutant KASIII enzymes from B. subtilis and E. coli.
—Tertiary Structure Prediction of B. subtilis KASIII Enzymes.
Tertiary structures of KASIII homologs found in B. subtilis (i.e., KASIIIA and KASIIIB) were predicted using homology modeling. An NCBI BlastP search against the PDB database was used to identify sequences that shared>40% sequence identity with KASIIIA and KASIIIB protein sequences. For KASIIIA, S. aureus KASIII (PDB ID-1ZOW; chain A) showed maximum sequence identity (58%), followed by Aquifex aeolicus KASIII (PDB ID-2EBD; chain A) with 52% sequence identity. These two sequences were used as template sequences for KASIIIA, and each of these was aligned with the KASIIIA sequence using ClustalW alignment software (www.ebi.ac.uk). The target-template sequence alignments were used to model tertiary structures of KASIIIA using the alignment mode of Swiss Model (swissmodel.expasy.org). The two different models obtained were assessed for their quality using Verify3D, Gromos and Anolea, and the best model was chosen for further analysis. A similar approach was used for predicting the tertiary structure of B. subtilis KASIIIB using Thermus thermophilus KASIII (PDB ID-1UB7; chain A), which showed maximum sequence identity (44%), and S. aureus KASIII, which had 42% identity, as template sequences. The PDB files of selected models were analyzed using PyMol software (www.pymol.org).
—Gene Cloning.
The E. coli fabH gene that encodes KASIII was PCR-amplified from E. coli strain MG1655 (E. coli Genetic Stock Center, New Haven, Conn.) and cloned into pDEST17 vector using Gateway cloning (Invitrogen, Carlsbad, Calif.), resulting in the pDEST_KASIII construct. The yhfB and yjaX genes encoding B. subtilis KASIIIA and KASIIIB, respectively, were PCR-amplified from B. subtilis strain 168 (Bacillus Genetic Stock Center, Columbus, Ohio). These genes were cloned into pET30a expression vector (Novagen, Merck, Germany) to construct pET30_KASIIIA and pET30_KASIIIB, and also were cloned into the pDEST17 expression vector using Gateway cloning to generate pDEST_KASIIIA and pDEST_KASIIIB. Each pDEST17 and pET30a construct encoded an N-terminal His-tag. The resulting plasmids were confirmed by sequencing.
—Expression and Purification of Recombinant Wild-Type and Mutant KASIII Proteins.
E. coli OverExpress™ C41 (Lucigen, Middletown, Wis.) strain was used for expression of KASIII proteins from constructs pDEST_KASIII, pET30_KASIIIA, pET30_KASIIIB, pDEST_KASIIIA and pDEST_KASIIIB. The transformants were grown at 37° C. in 50 ml Luria-Bertani medium, supplemented with 100 μg/ml ampicillin (Research Products International Corps., Mount Prospect, Ill.) for pDEST_KASIII, pDEST_KASIIIA, and pDEST_KASIIIB or 50 μg/ml kanamycin (RPI Corps.) for pET30_KASIIIA and pET30_KASIIIB. The cultures were induced by the addition of IPTG (Gold Biotechnology, Olivette, Mo.) to a final concentration of 0.4 mM when the OD600 was 0.6-0.8. After incubation for another 16-18 hours at 25° C., cells were harvested by centrifugation (10,000×g, 4° C., 10 minutes). Soluble proteins were extracted by first suspending the cell pellet in lysis buffer (0.5 M NaCl, 5 mM imidazole, 20 mM Tris-HCl, pH 8.0, 0.1 mg/ml phenylmethylsulfonyl fluoride, and 0.1% Triton-X 100), followed by sonication (10-second pulses separated by three-second intervals for a total of three minutes) and centrifugation (10,000×g, 4° C., 30 minutes). The resulting supernatant (soluble protein fraction) was analyzed by running on SDS-PAGE gel. Based on the small-scale expression experiments that optimized the conditions for obtaining the highest yield of soluble recombinant KASIII proteins, the constructs pDEST_KASIII, pET30_KASIIIA, and pDEST_KASIIIB were used for large-scale expression and purification of wild-type and mutant proteins. Cultures were grown, induced, and harvested, and soluble protein was extracted as described in small-scale expression methods. The soluble protein fraction was filtered through a 0.45 μfilter (Corning, the Netherlands) and applied to 8 ml Ni-NTA His-bind resin. After washing the unbound protein with wash buffers I and II (0.5M NaCl, 20 mM Tris-HCl, pH 8.0) supplemented with 20 mM and 40 mM imidazole, respectively, the proteins of interest were eluted with the same buffer containing 250 mM imidazole. The purified His-tagged KASIII proteins were dialyzed against sodium phosphate buffer, pH 7.4, and concentrated using 10,000 molecular weight cut-off ultrafiltration centrifugation filters (Millipore, Billerica, Mass.) at 4° C. The concentrated proteins were either supplemented with 16% glycerol and stored at −80° C. or immediately used for Saturation Transfer Difference NMR experiments. Protein purity was assessed by Coomassie-staining SDS-PAGE gels, which showed the presence of near-homogenous, pure proteins (greater than 95% purity). Protein concentrations were determined by Bradford's assay (BioRad, Hercules, Calif.).
—Site-Directed Mutagenesis of E. coli and B. subtilis KASIII Enzymes.
The QuikChange® Site-Directed Mutagenesis Kit (Stratagene, La Jolla, Calif.) was used for introducing point mutations in the pDEST_KASIII, pET30_KASIIIA, and pDEST_KASIIIB constructs. Four mutants were generated from each of these constructs as indicated in Table 3 using the listed primers and their complements.
E. coli
B. subtilis
B. subtilis
—Circular Dichroism (CD) Spectroscopy of KASIII Mutants.
All CD spectra of purified KASIII proteins (0.1-0.25 mg/ml in 10 mM sodium phosphate buffer, pH 7.4) were collected with Jasco J-710 Spectropolarimeter, in a 0.1 cm cell at 25° C. Far-UV spectra were recorded with a bandwidth of 1.0 nm and a time response of eight seconds with a total of two data accumulations.
—Saturation Transfer Difference NMR Experiments.
NMR experiments were performed at 25° C. on a Bruker AV700 MHz spectrometer equipped with a 5 mm HCN cryoprobe. Samples for STD NMR experiments were prepared in 0.1 M sodium phosphate buffer (pH 7.4) with 5% D2O. The protein/ligand ratio was set as 1:100 with KASIII concentration in the 20-25 μM range. Saturation was applied as CW pulse with a power of 58-60 Hz, with on-resonance pulses at 0.62 ppm and 6.86 ppm for upfield and downfield, respectively. The off-resonance pulse was applied at 45 ppm. 3-9-19 WATERGATE suppression was used with a T1-ρ filter. Saturation time of five seconds with an additional delay of 5.1 seconds was used. A set of three replicates was acquired, with 32 scans in each replicate, for each STD NMR experiment of KASIII wild-type or mutated enzyme with a ligand, which was either acetyl-CoA or isobutyryl-CoA (Sigma-Aldrich, St. Louis, Mo.). The reference and the saturated spectra were obtained in an interleaved manner. Resonance assignments of 1H NMR spectra of free ligands were completed using 1D IH and COSY.
Control experiments were carried out by applying on- and off-resonance saturation pulses either to the ligand in the absence of protein, or to the ligand in the presence of denatured protein. Time dependence of the saturation transfer was calculated by varying the saturation times from 0.1 milliseconds to 100 seconds, which showed that five seconds were sufficient to transfer the saturation from protein to the ligand. Topspin (Bruker Biospin Corp., Billerica, Mass.) was used for processing the reference and saturated spectra and integrating areas of the peaks that showed STD effect.
Relative STD effects (ASTD) were calculated according to the equation ASTD=(Io−Isat)/Io where Isat is the signal intensity of the saturated spectrum and Io is the signal intensity of the reference spectrum (Mayer et al., J. Am. Chem. Soc. 123: 6108-6117 (2001)). STD amplification factor was calculated according to the equation: STDaf=ASTD X molar ligand excess.
Competition binding experiments were performed under the conditions described above, using a first ligand at constant concentration of 10 mM, and a competing ligand present at molar ratios of 1, 2, 4, 8 and 10-fold higher with respect to the first ligand.
—Differences in Active Site Residues of E. coli and B. subtilis KASIII Based on Homology Modeling.
The tertiary structures of B. subtilis KASIII homologs (KASIIIA encoded by yjaX, and KASIIIB encoded by yhfB) were predicted via homology modeling using the methods described above. Superposition of the E. coli KASIII crystal structure (PDB code 31L9) with predicted B. subtilis KASIIIA and KASIIIB structures allowed the identification of active site cleft residues that have different conformations in KASIII enzymes from the two organisms. A previous hypothesis suggests that the rotamer conformation of a conserved Phe (Phe-304 in E. coli) may impact substrate specificity (Gaijwala et al. (2009), supra). In accordance with this hypothesis, we observed that, whereas in Gram-negative E. coli KASIII, the side chain of this conserved Phe-304 residue is oriented away from the active site (i.e., its rotamer is in an active-site distal conformation) (
To verify these hypotheses, Val-215 and Leu-220 of E. coli KASIII were mutated to the corresponding residues in B. subtilis KASIIIA, i.e., Phe and Met, respectively (
Each of the wild-type and mutated enzymes were purified to near homogeneity, with the exception of B. subtilis KASIIIB double mutant, which formed inclusion bodies and could not be purified. CD spectra of all purified proteins were obtained to ensure that the mutants folded the same as the wild-type KASIII proteins.
STD NMR experiments elucidated interactions of these purified enzymes (both wild-type and mutated) with straight-chain substrate (acetyl-CoA) and branched-chain substrate (isobutyryl-CoA) and enabled mapping of binding epitopes on the two substrates. Relative saturation transfer to each of the binding epitopes was measured and converted to the STD amplification factor (STDaf), which is an indicator of ligand binding (Mayer et al., J. Am. Chem. Soc. 123: 6108-6117 (2001)). Ligand epitopes with high STDaf values are assumed to receive higher saturation transfer from the enzyme, and thus are in close contact with the enzyme. Comparison of STDaf values revealed differences in interaction of wild-type and mutated enzymes with straight- and branched-chain ligands.
—Ligand Binding Epitopes for E. coli and B. subtilis KASIII Enzymes.
From STD NMR experiments with E. coli KASIII, binding epitopes were found to be quite similar in the acetyl-CoA and isobutyryl-CoA ligands, irrespective of the wild-type or mutant state of KASIII tested. In both ligands the HAP proton, positioned at C-2 of the adenine ring of CoA, received the maximum saturation transfer (
Similar to E. coli KASIII, for B. subtilis KASIIIA, the binding epitopes of acetyl-CoA were the methyl group carrying HT and the adenine moiety bearing HAP, which received the largest saturation transfer (
For E. coli KASIII and B. subtilis KASIIIA, because HT. HAP protons in acetyl-CoA and HT, HB and HAP in isobutyryl-CoA received strong saturation transfer, and consequently had the highest STDaf, focus was placed on differences in saturation transfer to these protons. As HT is on the acyl end of the ligand, the amount of saturation transferred to it indicated the extent of KASIII active site's interaction with the ligand. In B. subtilis KASIIIB, in addition to HT. HAP in acetyl-CoA and HT, HB and HAP in isobutyryl-CoA, focus also was placed on HR for comparing the effect of mutations on substrate binding because it received strong saturation transfer in both acetyl-CoA and isobutyryl-CoA.
—Val215Phe and Leu220Met Mutations Improve Branched-Chain Substrate Binding in E. coli KASIII but Decrease Catalytic Activity.
Wild-type E. coli KASIII showed binding with acetyl-CoA (
To identify which of the two mutations in the E. coli double mutant had a stronger effect on substrate binding, we examined STD amplification for each of the single mutants (i.e., E. coli V215F and E. coli L220M). The V215F mutation resulted in a slight increase in STDaf for HT protons of both acetyl-CoA and isobutyryl-CoA as compared to the wild-type. However, the L220M mutation did not alter STDaf for acetyl-CoA proton HT but significantly increased STDaf for HT of isobutyryl-CoA (by ˜66%) as compared to the wild-type (
E. coli KASIII
B. subtilis KASIIIa
B. subtilis KASIIIb
C. gingivalis KASIIIa
C. gingivalis KASIIIc
26 ± 9.1
L. pneumophila KASIIIa
M. xanthus KASIIIc
—Phe208Val and Met213Leu Mutations Negatively Affect Substrate Binding in B. subtilis KASIIIA.
For wild-type B. subtilis KASIIIA, the HT protons of both acetyl and isobutyryl-CoA had similar STDaf (1.5), whereas HAP proton of isobutyryl-CoA received ˜28% higher saturation as compared to the acetyl-CoA HAP proton (
The decreased binding of acetyl-CoA and isobutyryl-CoA ligands by the B. subtilis KASIIIA mutants is accompanied by decreases in catalytic activity. Individual mutations of both residues (F208V and M213L) resulted in loss of catalytic activity with acetyl-CoA as the substrate and decreased catalytic activity towards isobutyryl-CoA (see Table 4). These data clearly indicate that both M213L and F208V mutations decrease binding and catalytic activity of B. subtilis KASIIIA enzyme with both straight- and branched-chain substrates. However, the M213L mutation has a more pronounced negative effect on the binding of substrates by B. subtilis KASIIIA, especially with the branched chain substrate (isobutyryl-CoA). Phe-208 also appears to influence branched-chain substrate binding, but to a lesser extent.
It can, therefore, be inferred that Met-213 is a critical residue for both straight- and branched-chain substrate recognition in B. subtilis KASIIIA. Phe-208 also appears to influence branched-chain substrate binding, but to a lesser extent.
—Trp-221 and Val-226 are Critical for B. subtilis KASIIIB's Folding, Substrate Recognition, and Catalytic Activity.
The wild-type B. subtilis KASIIIB enzyme exhibited very high STDaf values for both acetyl-CoA and isobutyryl-CoA, ranging from 5.0 to 10.0, as compared to STDaf values of the same ligands with B. subtilis KASIIIA which ranged from 0.5 to 2.5 (
—Role of the Conserved Phe in Substrate Binding of E. coli KASIII and B. Subtilis KASIIIA, KASIIIB.
For each of the three enzymes, mutating the two residues that were predicted to affect the orientation of the conserved Phe clearly impacted substrate binding. However, the putative roles of these mutations in determining the Phe rotamer conformation (active site-distal or active site-proximal) were not directly assessed by the STD NMR experiments. In order to investigate the role of the Phe itself in substrate binding, the conserved Phe was mutated to Ala in each of the three KASIII enzymes. The E. coli KASIII F304A mutant (nucleotide sequence [SEQ ID NO:117]; amino acid sequence [SEQ ID NO:118]) resulted in approximately 60% lower saturation transfer to the HT protons of acetyl-CoA and isobutyryl-CoA compared to the wild-type (
—Competition Binding Experiments Reveal Relative Affinities of Ligands to KASIII Enzymes.
For E. coli KASIII, a low STDaf, as seen for the HT proton of isobutyryl-CoA as compared to acetyl-CoA, could be either because isobutyryl-CoA is a poor substrate for E. coli KASIII and does not bind to the active site, or because it is a very tight binder with dissociation constant, KD, below 10−10, resulting in an extended stay in the binding site and inefficient saturation transfer (Mayer et al., J. Am. Chem. Soc. 123: 6108-6117 (2001); and Meyer et al., Ernst Schering Res. Found. Workshop: 149-167 (2004)). To investigate which of the two scenarios is true, competition binding experiments, in which the concentration of acetyl-CoA was kept constant and isobutyryl-CoA was titrated at increasing concentrations, were performed to see if the latter ligand replaces the former ligand. Competition binding data strongly suggested that acetyl-CoA was the preferred substrate for E. coli KASIII, while isobutyryl-CoA competed with acetyl-CoA only when its concentration was at least four times more than that of acetyl-CoA (
For B. subtilis KASIIIA, to determine the competition between acetyl-CoA and isobutyryl-CoA, increasing amounts of isobutyryl-CoA were titrated, while acetyl-CoA was held at a constant concentration. The results showed that isobutyryl-CoA was the preferred substrate for B. subtilis KASIIIA and always had a higher STD amplification factor for the observed proton HT than that of the acetyl-CoA HT proton (
This example describes the analysis of KASIII from Alicyclobacillus acidocaldarius.
—Expression and Purification of Recombinant A. acidocaldarius KASIII Protein.
The A. acidocaldarius KASIII gene was codon-optimized for expression in E. coli, chemically synthesized, and cloned into the pUC57 vector by Genscript USA (Piscataway, N.J., USA). The gene was further cloned into the pDEST-17 vector using Gateway Cloning (Invitrogen, Carlsbad, Calif.) resulting in the pDEST_AA construct. E. coli OverExpress™ C41 (Lucigen, Middletown, Wis.) strain was used for expression of A. acidocaldarius KASIII protein from the construct pDEST_AA. The C41 transformants were grown at 37° C. in 2 L Luria-Bertani medium and were supplemented with 100 μg/ml ampicillin (Research Products International Corps., Mount Prospect, Ill.). The cultures were induced by addition of IPTG (Gold Biotechnology, Olivette, Mo.) to a final concentration of 0.4 mM when the OD600 was 0.6-0.8. After incubation for another 16-18 hours at 25° C., cells were harvested by centrifugation (10,000×g, 4° C. 10 minutes). Soluble proteins were extracted by first suspending the cell pellet in lysis buffer (0.5 M NaCl, 5 mM imidazole, 20 mM Tris-HCl, pH 8.0, 0.1 mg/ml phenylmethylsulfonyl fluoride, and 0.1% Triton-X 100), followed by sonication (10 second pulses separated by 3 second intervals for a total of 3 minutes) and centrifugation (10,000×g, 4° C., 30 minutes). The resulting supernatant (soluble protein fraction) was analyzed for its homogeneity and purity by running on SDS-PAGE gel, which showed the presence of near-homogenous, pure proteins (greater than 95% purity).
The soluble protein fraction was filtered through a 0.45 μfilter (Corning, the Netherlands) and applied to 8 ml Ni-NTA His-bind resin. After washing the unbound protein with wash buffers I and II (0.5M NaCl, 20 mM Tris-HCl, pH 8.0) supplemented with 20 mM and 40 mM imidazole, respectively, the proteins of interest were eluted with the same buffer containing 250 mM imidazole. The purified His-tagged KASIII proteins were dialyzed against sodium phosphate buffer, pH 7.2, and concentrated using 10,000 molecular weight cut-off ultrafiltration centrifugation filters (Millipore, Billerica, Mass.) at 4° C. The concentrated proteins were either supplemented with 16% glycerol and stored at −80° C. or immediately used for KASIII activity assay. Protein concentrations were determined by Bradford's assay (BioRad, Hercules. Calif.).
—Purification of Recombinant Malonyl-CoA ACP Transacylase (MCAT or FabD), β-Ketoacyl ACP Reductase (FabG), and Holo-Acyl Carrier Protein (ACP).
FabD, FabG and ACP proteins are required for the spectrophotometric assay of KASIII. Therefore, genes encoding these proteins, namely fabD, fabG and acpP, were obtained from E. coli Hub in pCA24N expression vectors. The acpP gene was further cloned into pETDUET vector along with acpS gene that encodes for ACP synthase. These three recombinant proteins (FabD, FabG and holo-ACP) with N-terminal His-tags were purified to near-homogeneity using the same procedure as described for the purification for A. acidocaldarius KASIII. Purity of these proteins was assessed by running an SDS-PAGE gel.
—Spectrophotometric Assay to Determine A. acidocaldarius Activity with Different Substrates.
Activity of A. acidocaldarius KASIII with different acyl-CoA substrates (acetyl-CoA, isobutyryl-CoA and 3-hydroxybutyryl-CoA (Sigma-Aldrich)) was ascertained by a coupled assay. The assay was performed in 96-well plate format with three replicates for each reaction condition. In a total volume of 100 μl for each reaction the reaction mix containing 100 μM holo-ACP, 200 μM malonyl-CoA, 10 mM DTT, 50 μM acyl-CoA substrate (either acetyl-CoA, isobutyryl-CoA or 3-hydroxy-butyryl-CoA) and 200 μM NADPH in 0.1 M sodium phosphate buffer (pH 7.2) was pre-incubated with 60 μg of FabD for two minutes. The reaction was started by the addition of 30 μg of FabG and varying concentrations of A. acidocaldarius KASIIII (0.5-15 μg). Change in absorbance of NADPH that was being converted to NADP+ during reduction of 3-ketoacyl-ACP to 3-hydroxy-acyl-ACP by FabG was recorded at 340 nm using a Biotek multi-plate reader.
—Purified A. acidocaldarius KASIII, FabD, FabG and ACP.
Each of the recombinant proteins (A. acidocaldarius KASIII, FabD, FabG and holo-ACP) were purified to near-homogeneity.
—Activity of A. acidocaldarius KASIII with Acetyl-, Isobutyryl-, and 3-Hydroxybutyryl-CoA Substrates.
Spectrophotometric assay was used to assess the activity of A. acidocaldarius KASIII with various acyl-CoA substrates. The assay coupled the appearance of the KASII-product (3-ketoacyl-ACP) to the oxidation of NADPH, catalyzed by 3-ketoacyl-ACP reductase (FabG). This latter reaction resulted in a change of absorbance at 340 nm, due to the conversion of NADPH to NADP+, and the rate of this change was used to directly calculate the rate of the KASIII-catalyzed reaction. Studies of A. acidocaldarius KASIII with different substrates using this spectrophotometric assay established that this KASIII has the ability to utilize a number of different acyl-CoA substrates, particularly with higher preference for hydroxylated acyl-CoA substrate (3-hydroxybutyryl-CoA) and branched chain substrate (i.e., isobutyryl-CoA) as compared to straight chain substrate (acetyl-CoA).
This example describes the cloning of A. acidocaldarius KASIII into Rhodospirillum rubrum.
The A. acidocaldarius KASIII gene was cloned into the phaC2 locus in the R. rubrum genome via a double-crossover recombination event. The R. rubrum recipient strain for this experiment was the phaC triple mutant (ΔphaC1ΔphaC2ΔphaC3) that lacked any PhaC activity. First, the upstream flanking sequence (922 bp) of the R. rubrum phaC2 gene (Aru_2413) was cloned upstream of the A. acidocaldarius KASIII sequence, and this chimeric protein was introduced into the E. coli strain S17-1. The transformed S17-1 was co-incubated overnight with R. rubrum phaC triple mutant (ΔphaC1ΔphaC2ΔphaC3) on 0.22 μm filter for conjugation. The bacterial mixture was grown on minimal medium plate containing 25 μg/ml gentamicin for one to two weeks. The resulting colonies carry the product of a single recombination crossover event, which integrates the A. acidocaldarius KASIII gene at the phaC2 gene (Aru_2413) locus. These colonies were streaked out on another minimal medium plate containing 25 μg/ml gentamicin for colony purification. The resulting colonies were cultured in SMN rich medium for two to three days in the light without gentamicin selection. Finally, the culture was plated out on SMN rich medium containing 5% sucrose to screen for double-crossover events. The resulting colonies were PCR sequence-confirmed to carry the A. acidocaldarius KASIII gene at the phaC2 gene (Aru_2413) locus.
In order to investigate the metabolic functions of the three phaCs, single locus deletion mutants (ΔphaC1, ΔphaC2, ΔphaC3), double-loci deletion mutants (ΔphaC1ΔphaC2, ΔphaC1ΔphaC3, and ΔphaC2ΔphaC3), and a triple-loci deletion mutant (ΔphaC1ΔphaC2ΔphaC3) were created, and these mutants were characterized relative to growth, PHA yields and monomer composition of the polymer (Jin et al., J. Bacteriol. 194: 5522-5529 (2012)). Of most significance, the triple phaC mutant (ΔphaC1ΔphaC2ΔphaC3) failed to accumulate any PHA polymer, and showed only a slight impact on growth characteristics. This strain, therefore, has the capacity to generate 3-hydroxybutyryl-CoA, which could be used by a KASIII enzyme to produce o-hydroxy-branched-fatty acids. This hypothesis was tested by recombinantly expressing the A. acidocaldarius KASIII in the triple phaC R. rubrum mutant (described in Example 6), and then analyzing the fatty acids produced (described in Example 7).
This example describes the fermentation-based production of bi-functional fatty acids.
To generate omega-hydroxy fatty acid in R. rubrum, the recombinant R. rubrum carrying the A. acidocalcarius KASIII was grown on RRNCO medium (but omitting ammonium chloride, hydrogen sulfide, carbon monoxide and carbon dioxide) for five days, and the bacterial pellet was used for fatty acid analysis.
A. acidocaldarius KASIII was cloned into triple phaC R. rubrum mutant to evaluate whether this KASIII enzyme has the ability to use in vivo-generated hydroxyacyl-CoA starter substrates, and produce co-hydroxy-fatty acids. After the fermentation process involving growth of recombinant R. rubrum cells containing A. acidocaldarius KASIII on RRNCO medium, fatty acids were extracted from the bacterial cells and analyzed as described in Example 7.
This example describes the analysis of produced bi-functional fatty acids by GC-MS.
The resultant fatty acids in R. rubrum were extracted and analyzed using GC-MS. Analysis of the fatty acids from recombinant R. rubrum strain containing A. acidocaldarius KASIII demonstrated the production of 15-hydroxypalmitate, which was identified by GC-MS analyses conducted at Iowa State University's W. M. Keck Metabolomics Research Laboratory (
This example describes the in vitro characterization of Bacteroides vulgatus KASIII.
—Expression and Purification of Recombinant B. Vulgatus KASIII Protein.
The B. vulgatus KASIII gene was codon-optimized for expression in E. coli, chemically synthesized, and cloned into the pUC57 vector by Genscript USA (Piscataway, N.J., USA). The gene was further cloned into the pDEST-17 vector using Gateway Cloning (Invitrogen, Carlsbad, Calif.) resulting in the pDEST_BV construct. The E. coli OverExpress™ C41 (Lucigen, Middletown, Wis.) strain was used for expression of the B. vulgatus KASIII protein from the construct pDEST_BV. The B. vulgatus KASIII was expressed and purified using the same methods as described in Example 4.
—Spectrophotometric Assay to Determine B. Vulgatus KASIIIA Activity with Different Substrates.
Activity of B. vulgatus KASIIIA with different acyl-CoA substrates (acetyl-CoA, isobutyryl-CoA and 3-hydroxybutyryl-CoA (Sigma-Aldrich)) was ascertained by a coupled assay using the methods described in Example 4.
—Activity with Straight-, Branched-, and Hydroxy-Acyl-CoA Substrates.
Results from the spectrophotometric assay established that B. vulgatus KASIII can utilize acetyl-CoA (straight chain substrate), isobutyryl-CoA (branched-chain substrate) and 3-hydroxybutyryl-CoA (hydroxylated substrate) with a higher preference for isobutyryl-CoA and 3-hydroxybutyryl-CoA as compared to acetyl-CoA (
This example describes the in vitro characterization of Legionella pneumophila KASIIIA.
—Expression and Purification of Recombinant L. pneumophila KASIIIA Protein.
The L. pneumophila KASIIIA gene was codon-optimized for expression in E. coli, chemically synthesized, and cloned into the pUC57 vector by Genscript USA (Piscataway, N.J., USA). The gene was further cloned into the pDEST-17 vector using Gateway Cloning (Invitrogen, Carlsbad, Calif.) resulting in the pDEST_LP1 construct. The E. coli OverExpress™ C41 (Lucigen, Middletown. Wis.) strain was used for expression of the L. pneumophila KASIIIA protein from the construct pDEST_LP1. The L. pneumophila KASIIIA protein was expressed and purified using the same methods as described in Example 4.
—Spectrophotometric Assay to Determine L. pneumophila KASIII Activity with Different Substrates.
Activity of L. pneumophila KASIII with different acyl-CoA substrates (acetyl-CoA, isobutyryl-CoA and 3-hydroxybutyryl-CoA (Sigma-Aldrich)) was ascertained by a coupled assay using the methods described in Example 4.
—Activity with Straight, Branched and Hydroxy-Acyl-CoA Substrates.
Results from the spectrophotometric assay established that L. pneumophila KASIIIA can utilize acetyl-CoA (straight-chain substrate), isobutyryl-CoA (branched-chain substrate) and 3-hydroxybutyryl-CoA (hydroxylated substrate) with a higher preference for isobutyryl-CoA and 3-hydroxybutyryl-CoA as compared to acetyl-CoA (
This example describes in vivo characterization of KASIII from various biological sources (Aeromonas hydrophila, Bacteroides vulgatus, Brevibacterium linens, Capnocytophaga gingivalis. Thermus aquaticus. Bacillus licheniformis, Desulfovibrio vulgaris, Bacillus subtilis subsp. S, Haliangium ochraceum, Alicyclobacillus acidocaldarius) using B. subtilis FabH deletion mutant.
—Complementation of B. subtilis FabH Deletion Mutant with Recombinant KASIII Genes from Various Sources.
The mutant strain ΔbfabHA ΔbfabHB::(erm-Pspac::fabH) was generated by homologous recombination via a one-step procedure, by transforming the mutant ΔbfabHA strain with plasmid pUCB-erm-fabH, followed by selection for erythromycin-resistance on LB media.
The pUCB-erm-fabH vector was constructed from plasmid pUC19. The erythromycin-resistant gene erm and the exogenous fabH gene under the control of the promoter Pspac were inserted between the downstream and upstream DNA fragments of bfabHB ORF.
—Fatty Acid Analysis of B. subtilis Strains Containing Recombinant KASIII Genes.
In these experiments, a 0.5 ml aliquot of an overnight B. subtilis culture normalized for equal cell density was collected by centrifugation at 13,200×g for 30 seconds. The cell pellet was suspended in 50 ml minimal medium or LB rich medium. Cell cultures were shaken at 250 rpm. Cells were collected at late log phase by centrifugation at 5000×g for 10 minutes. The collected cell pellets were lyophilized and stored at −20° C. until analysis. Lipids were extracted from lyophilized bacterial cell pellets using chloroform/methanol, and fatty acids were then converted to methyl esters using methanolic-HCl at 80° C. for 60 minutes. The recovered fatty acid methyl esters were concentrated as needed under a stream of nitrogen gas and analyzed with GC-MS interfaced with a Mass Detector 5973 (Agilent Technologies, Santa Clara, Calif.).
—Results.
The eleven KASIII genes from diverse biological sources (namely, Aeromonas hydrophila, Bacteroides vulgatus, Brevibacierium linens, Capnocytophaga gingivalis, Thermus aquaticus, Bacillus licheniformis, Desulfovibrio vulgaris, Bacillus subtilis subsp. S, Haliangium ochraceum, Alicyclobacillus acidocaldarius) could rescue the B. subtilis FabH deletion mutant that fails to grow by itself, indicating that these KASIII enzymes can synthesize branched-chain fatty acids in vivo. Fatty acid content of B. subtilis FabH deletion mutants rescued by recombinant KASIII genes from diverse sources is shown in Table 5.
B. subtilis FabH deletion mutant
Aeromonas hydrophila
Bacteroides vulgatus
Capnocytophaga
gingivalis
Brevibacterium linens
Thermus aquaticus
Bacillus licheniformis
Bacillus licheniformis
Desulfovibrio vulgaris
Bacillus subtilis
Haliangium
ochraceum
Alicyclobacillus
acidocaldarius
This example identifies KASIII enzymes that can process atypical substrates.
KASIII enzymes from Alicyclobacillus acidocaldarius (aaKASIII), Thermus aquaticus (taKASIII), and Capnocytophaga gingivalis (cgKASIIIa), which rescued the lethal phenotype of the B. subtilis fabH deletion mutant were purified to homogeneity and then screened for binding with typical and atypical KASIII substrates. Also purified to homogeneity and screened for binding with KASIII substrates were Legionella pneumophila and Myxococcus xanthus. Typical substrates included straight-chain and branched-chain acyl-CoA primers, whereas atypical substrates included di-acid (malonyl-CoA and methylmalonyl-CoA), hydroxylated (3-hydroxybutyryl-CoA), unsaturated (crotonyl-CoA), and aromatic (such as benzoyl-CoA and phenylacetyl-CoA) acyl-CoAs. E. coli KASIII and B. subtilis KASIIIb were included as standards. The ability of the KASIII enzymes to bind to the substrates was measured via a fluorescence-based thermal shift assay, which measured the thermal stability of a protein in the presence and absence of a specific ligand or substrate. A positive shift in melting temperature of the protein (Tm) in the presence of a substrate is correlated with substrate binding and concomitant stabilization of the enzyme, whereas a negative shift in Tm suggests destabilization of the protein by the substrate. Thermal shift analysis showed that the KASIIIs from B. subtilis, A. acidocaldarius, and T. aquaticus bound a broad range of substrates, whereas C. gingivalis KASIIIa and E. coli KASIII bound to a relatively narrow range of substrates. KASIIIa from L. pneumophila bound straight-chain (C3:0 and C4:0), branched-chain (iso-C4:0 and iso-C5:0), and dicarboxylate (malonyl and methylmalonyl) acyl-CoAs. KASIIIc from M. xanthus bound straight-chain acyl-CoAs (C2:0, C4:0 and C6:0) and malonyl-CoA.
Inherent Tms in water without any ligand were measured for each of the KASIIIs (Table 6). These melting temperatures were used as the baseline Tins to measure the shift in Tm by addition of substrate. The KASIII enzymes from A. acidocaldarius and T. aquaticus were unusually thermally stable, with baseline Tms of ˜73° C. and ˜84° C., respectively. These melting temperatures are considerably higher than those for the other KASIIIs that were studied and can be correlated with their ability to survive at extremely high temperatures.
C. gingivalis
A. acidocaldarius
T. aquaticus
B. subtilis
E. coli
L. pneumophila
M. xanthus
Consistent with previous reports that E. coli KASIII has narrow substrate specificity, ecKASIII bound only short, straight-chain acyl-CoAs (acetyl-CoA and propionyl-CoA). In contrast, C. gingivalis KASIIIa bound mainly branched-chain (isovaleryl-CoA and isobutyryl-CoA) and unsaturated (crotonyl-CoA; Tm shift of 2° C.) substrates that resulted in statistically significant thermal shifts (see
B. subtilis KASIIIb and A. acidocaldarius KASIII exhibited the broadest ranges of substrate specificities. In particular, B. subtilis KASIIIb bound the straight-chain substrates (propionyl-CoA and butyryl-CoA), the branched-chain substrates (isobutyryl-CoA and isovaleryl-CoA), and a di-acidic substrate (phenylacetyl-CoA). Each of these substrates induced at least a 6° C. increase in the Tm of bsKASIIIb (see
T. aquaticus KASIII bound with rather a small range of substrates, specifically straight-chain butyryl-CoA and hexanoyl-CoA and branched-chain isobutyryl-CoA and isovaleryl-CoA substrates that resulted in 2-6° C. increases in Tm as compared to the baseline Tm (see
Amongst the four KASIIIs from L. pneumophila, LpKASIIIa was the only protein that could be thermally stabilized in the presence of potential acyl-CoA ligands (see
Of the four M. xanthus KASIII enzymes, MxKASIIIc was the only protein that was stabilized by binding to acyl-CoA ligands, specifically straight-chain acyl-CoAs (C2:0, C4:0 and C6:0) and malonyl-CoA, each of which increased the Tm of MxKASIIIc by 2-4° C. compared to the control (p-value<0.05) (see
This example describes bioengineering of E. coli for the production of o-hydroxy-branched fatty acids (HBFA).
—Disruption and Replacement of Endogenous E. coli KASIII Gene with Novel KASIII Genes that have Capability to Utilize Hydroxybutyryl-CoA as the Substrate.
Lambda recombinase method is used to create gene knockouts. The fabH gene in E. coli strain MN1655, a K12 derivative, is deleted using a kanamycin disruption cassette that is flanked by FLP recognition target sites to excise precisely the kanamycin-resistance cassette, creating an in-frame deletion. Afterwards, the PHA biosynthetic operon is overexpressed in the E. coli strain, but without the phaC gene, namely expressing the phaA and phaB genes in combination. This modification is coupled with introduction, and expression therein, of a recombinant KASIII gene that has the ability to utilize hydroxybutyryl-CoA as the substrate. This KASIII is introduced into the E. coli strain using expression cassettes that include low-copy and high-copy plasmid vectors that utilize constitutive or inducible promoters of different strengths.
—Bioengineering of E. coli KASIII Strain to Block Fatty Acid Degradation Pathway.
To maximize production of the targeted w-hydroxy-branched-fatty acids, the β-oxidation pathway can be blocked to result in the secretion of fatty acids into the growth medium. The lambda red recombinase method can be used to delete the E. coli fadD gene, which codes for acyl-CoA synthetase, the enzyme that initiates the degradation of fatty acids.
—Production of w-Hydroxy-Branched-Fatty Acids in Bioengineered E. coli KASIII Strain.
The combination of phaA, phaB and an exogenous KASIII gene, such as a wild-type gene from another organism, a natural variant thereof, or a mutant thereof, which can use hydroxybutyryl-CoA as a substrate, results in the production of w-hydroxy-branched-chain fatty acids.
All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein.
The use of the terms “a,” “an,” “the,” and similar referents in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”) provided herein, is intended merely to illuminate better the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.
Preferred embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. It should be understood that the illustrated embodiments are exemplary only, and should not be taken as limiting the scope of the invention.
This application is a Divisional of U.S. patent application Ser. No. 14/762,791, filed Jul. 29, 2015, as a National Stage Entry of international patent application no. PCT/US14/12616, filed Jan. 22, 2014, and which claims priority to U.S. provisional patent application No. 61/755,946, filed Jan. 23, 2013, which applications are incorporated herein by reference in their entireties.
The work described herein was supported, at least in part, by The National Science Foundation under contract nos. EEC0813570 and IIP1237247. Therefore, the Government of the United States of America has certain rights in the invention.
| Number | Date | Country | |
|---|---|---|---|
| 61755946 | Jan 2013 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 14762791 | Jul 2015 | US |
| Child | 15721514 | US |
