Neisseria meningitidis is a major cause of meningitis and septicemia world-wide. Meningococcal meningitis is an inflammation of the meninges, the membrane lining the brain and the spinal cord. In both meningococcal septicemia and meningococcal meningitis, damage is caused by an uncontrolled localized or systemic host inflammatory response. Group B meningococcal disease currently accounts for at least one half of all meningococcal disease in many countries including North and South America, and Europe. The emergence of a new virulent clone of group B Neisseria meningitidis, known as ET5, in Norway in the late 70's has since been responsible for prolonged epidemics in Norway, Cuba, Brazil, and Chile. These epidemics have created serious public health problems and led to intensive efforts to develop an effective group B vaccine in several of the affected countries. The absence of a U.S.-licensed group B vaccine along with the poor performance of the A and C capsular polysaccharide vaccines in children under 18 months have prevented serious consideration of routine childhood vaccination against meningococcal disease.
Neisseria meningitidis is divided into 13 serogroups, of which 9 cause invasive disease (A, B, C(C1, C1-), X, Y, W-135, Z, and L). Five the serotypes are targeted for development of vaccines due to their ability to cause epidemics, including serotypes A, B, C, Y and W135 which are the target of much vaccine research.
Vaccines against serogroups A, C, Y and W135 of Neisseria meningitidis that cause nearly all invasive meningococcal disease are available and are routinely used with excellent results. A suitable vaccine against group B strains of Neisseria meningitidis has been more difficult to develop for a variety of reasons. For instance, the capsular polysaccharide which defines the serogroup is ineffective and potentially unsafe for use in a vaccine because it has the same structure as polysialic acid found on certain human cells, specifically blood cells.
Further adding to the lack of a suitable vaccine is the fact that subcapsular antigens that are surface exposed, such as outer membrane proteins and the lipooligosaccharide (endotoxin), are antigenically variable and/or inconsistently expressed among group B strains. No single antigen has been identified that alone has all the characteristics that are essential for an effective vaccine.
In one aspect, the present technology provides a vaccine comprising native outer membrane vesicles (NOMVs) obtained from at least two meningococcal strains that have been genetically modified to provide broad based protection. The native outer membrane vesicles include three different sets of antigens based on PorA, LOS, and conserved outer membrane proteins; and the genetically modified strains have been modified to provide enhanced safety based on inactivation of lpxL1, synX, and lgtA genes. The two meningococcal strains can both express LOS having a different LOS core structure and has an alpha chains consisting of glucose and galactose. Each strain may express at least two different PorA subtype proteins or subtype epitopes which are chosen based on the most prevalent of PorA subtypes among group B case isolates. Further, the vaccine may further include a different conserved surface protein with demonstrated capacity to induce bactericidal antibodies is over-expressed in each strain and are taken from the group consisting of FHBP (GNA1870) variants 1, FHBP variants 2, and FHBP variants 3; NadA; App; NspA; TbpA and TbpB.
In a further aspect, the present technology provides a combination of NOMVs from three genetically modified, antigenically diverse Neisseria meningitidis strains. At least one of the stains is selected from (1) H44/76 HOPS-DL which has the following genetic modifications or characteristics:inactivation of the genes synX, lpxL1, and lgtA; insertion of a second porA gene (subtype P1.7-1,1) in the place of opaD; increased expression of NadA; and stabilized high expression of Opc and PorA; (2) 8570 HOPS-GAL which has the following genetic modifications or characteristics: inactivation of the genes synX, lpxL1, and lgtA; insertion of a second porA gene in place of opaD; increased expression of factor H binding protein variant 1; and stabilized high expression of PorA and Opc; and/or (3) B16B6 HPS-G2A which has the following genetic modifications or characteristics: inactivation of the genes synX, lpxL 1, and lgtA; insertion of a second porA gene in place of opaD; increased expression of factor H binding protein variant 2; and stabilized high expression of PorA and Opc. The NOMV are prepared without exposure to detergent or denaturing solvents from packed cells or from spent culture medium. The vaccine may be combined with one or more adjuvants and may be administered intramuscularly and/or intranasally.
In another aspect, the present technology provides a vaccine composition against meningococcal disease, more preferably group B meiningococcal disease, including native outer membrane vesicles (NOMVs) from one or more genetically modified strains of Neisseria meningitidis. The one or more genetically modified strains has been modified by: inactivation of the synX gene, inactivation of the lpxL1 gene, inactivation of the lgtA gene in each strain resulting in expression of a shortened or truncated lipooligosaccharides (LOS) that lacks lacto-N-neotetraose tetrasaccharide, and/or insertion of at least one second antigenically different porA gene in place of the opa gene. In another aspect, the genetically modified strain further comprises increased or stable expression of at least one minor conserved outer membrane protein, and/or stabilized expression of at least one outer membrane protein. The at least one second antigenically different porA gene may express at least one PorA subtype protein or subtype epitope selected from the most prevalent of PorA subtypes of meningitidis group B isolates.
In yet another aspect, the present technology provides a genetically modified vaccine strain of Neisseria meningitidis subtype B strain. The genetically modified vaccine strain may include H44/76 HOPS-D strain (B1), 8570 HOS-G1 strain (B2), and/or B16B6 HPS-G2A strain (B3).
In yet another aspect, the present technology provides a genetically modified vaccine strain of Neisseria meningitidis subtype B derived from: H44/76 strain comprising the genetic modifications of i) inactivation of a synX gene, ii) inactivation of the lpxL1 gene, iii) inactivation of the lgtA gene, iv) insertion of a second porA gene in the place of a opaD gene, v) increased expression of NadA compared with the native strain, and yl) stabilized increased expression of Opc and PorA proteins. In some aspects, the genetically modified strain was derived from the ET-5 wild type strain H44/76 (B:15: P1.7,16: L,3,7:P5.5,C).
In another aspect, the present technology provides a genetically modified vaccine strain of Neisseria meningitidis subtype B strain: derived from 8570 comprising the genetic modifications of: i) inactivation of a synX gene, ii) inactivation of the lpxL1 gene, iii) inactivation of the lgtA gene, iv) insertion of a second porA gene in place of opaD; v) increased expression of factor H binding protein variant 1; and yl) stabilized increased expression of PorA and Opc proteins. In some aspects, the genetically modified strain was derived from the ET-5 wild type strain 85 70(B:4: P1.19,15: L3,7v: P5.5,11,C).
In yet another aspect, the present technology provides a genetically modified vaccine strain of Neisseria meningitidis subtype B derived from B16B6 comprising the genetic modifications of: i) inactivation of a synX gene, ii) inactivation of the lpxL1 gene, iii) inactivation of the lgtA gene, iv) insertion of a second porA gene (subtype P1.22-1,4) in place of opaD; v) increased expression of factor H binding protein variant 2; and yl) stabilized increased expression of PorA and Opc proteins. In some aspects, the genetically modified strain is derived from the ET-37 wild type strain B16B6 (B:2a:P 1.5,2: L2:P5.1,2,5).
In some aspects, the present technology provides a genetically modified strain grown in iron deficient medium.
In other aspects, the present technology provides a genetically modified strain wherein inactivation of synX gene, lpxL1 gene, or lgtA gene is by an insertion of a drug resistance gene within the sequence of the inactivated gene.
Yet another aspect provides a vaccine including NOMVs derived from the genetically modified strains of the present technology. The NOMV are prepared from packed cells or spent culture medium without exposure to a detergent or denaturing solvent. The vaccine may further comprise one or more adjuvants. In further aspects, the genetically altered strain is altered to express iron uptake proteins.
In a further aspect, the present technology provides a vaccine against meningococcal disease comprising a variety of native outer membrane vesicles (NOMVs), wherein at least some of the NOMVs are essentially free of expression or sialylation of lipooligosaccharide (LOS), contain LOS that includes a lipid A with a penta-acyle structure and contain increased expression levels of at least one minor conserved outer membrane protein, wherein the minor conserved outer membrane protein is selected from proteins that induce bactericidal antibodies. The minor conserved outer membrane protein can be selected from the group consisting of NadA, factor H binding protein (FHBP) variant 1, and FHBP variant 2. In other aspects, at least some of the NOMV comprise shortened or truncated LOS that are essentially free of lacto-N-neotetraose (LNnT) tetrasaccharide and/or at least some of the NOMV comprise two or more different PorA proteins.
In another aspect, the present technology provides a method of eliciting an immune response to meningococcal disease in an animal or human comprising administering the composition containing NOMVs from at least one genetically altered strain of N. Meningiitdis to the animal or human for immunization against meningococcal disease. The vaccine is used for immunization against group B meningococcal disease.
In a further aspect, the present technology provides a method of preparing a genetically modified strain of N. meningitidis for use in a vaccine against meningococcal disease comprising the steps of: a) selecting a strain of meningococcal type B able to be genetically modified; b) genetically modifying the strain by inactivating the synX gene, c) genetically modifying the strain by inactivating the lpxL1 gene, d) genetically modifying the strain by inactivating the lgtA gene, and e) genetically modifying the strain by increasing expression of one or more minor conserved outer membrane proteins. In further aspects, the method further comprises genetically modifying the strain by inserting at least one second antigenically different porA gene into the open reading frame of the opa gene. In other aspects, the method further comprises the step of genetically modifying the strain to stably express or over express at least one outer membrane protein by replacing the poly-C sequence within the promoter or open reading frame of the at least one outer membrane protein with a sequence containing G and C nucleotides.
In yet another aspect, the present technology provides a method of preparing a vaccine against meningococcal disease comprising the steps of: a) culturing a genetically modified strain of N. meningitidis comprising one or more modification selected from the group consisting of inactivation of the synX gene, inactivation of the lpxL1 gene, inactivation of the IgtA gene, insertion of at least one second antigenically different porA gene in place of the opa gene, increased or stable expression of at least one minor conserved outer membrane protein, and/or stabilized expression of at least one outer membrane protein; b) expanding the culture by fermentation using the cultured strain of a) to inoculate medium in a fermentor; c) inactivating the fermented culture; d) harvesting N. meningitidis cultured cells by continuous flow centrifugation and collecting cell paste; e) isolating NOMVs from the cell paste; and f) resuspending NOMVs in buffer or carrier suitable for vaccine administration.
The present technology provides a broadly protective vaccine composition for use in immunization against meningococcal disease, more preferably Neisseria meningitidis subgroup type B. One embodiment of the present technology provides a vaccine composition including native outer membrane vesicles (NOMVs) from at least one, preferably at least two, more preferably at least three genetically modified strains of Neisseria meningitidis. Native outer membrane vesicles, also known as blebs, are vesicles formed or derived from fragments of the outer membrane of gram negative bacterium naturally given off during growth and may be obtained from culture medium or from the cells by mild methods that do not use detergents or denaturing solvents. These NOMV typically comprise outer membrane proteins (OMPs), lipids, phospholipids, periplasmic material and lipopolysaccharide (LPS) including lipooligosaccharides. Gram negative bacteria, especially pathogens like N. meningitidis, often shed NOMVs during virulent infections in a process known as blebbing. In the present technology, NOMV are vesicles produced from the outer membrane of bacteria without the used of chemical denaturation processes and are produced from the genetically modified strains which are antigenically diverse and have each been genetically modified to improve safety, antigenic stability, and the breadth of the protective immune response.
One embodiment of the present invention provides a vaccine composition comprising native outer membrane vesicles (NOMVs) derived from at least two or more genetically modified strains of N. meningitidis, preferably at least three different genetically modified strains.
Some embodiments of the present technology provide antigentically diverse strains of N. meningitidis, preferably subtype B which include at least three genetic modifications within the genome of the bacteria, more preferably at least five genetic modifications, more suitable at least six genetic modifications. The genetic modifications can include one or more of the following: 1) inactivation of the synX gene, which is essential for sialic acid biosynthesis and results in no capsule expression or sialylation of lipooligosaccharide (LOS); 2) inactivation of the lpxL1 gene which results in a significantly less toxic LOS having lipid A with a penta-acyl structure; 3) insertion of a second, antigenically different porA gene in place of one of the opa genes (OpaC or OpaD); 4) increased expression of at least one minor conserved outer membrane protein, the minor conserved outer membrane protein demonstrating the ability to induce bactericidal antibodies (for example, but not limited to, NadA, factor H binding protein (FHBP) variant 1, and FHBP variant 2); 5) inactivation of the lgtA gene in each strain which results in the expression of a shortened or truncated LOS that lacks the lacto-N-neotetraose (LNnT) tetrasaccharide; and/or 6) stabilized expression of certain outer membrane proteins, such as Opc and PorA that are susceptible to phase variation in wild type strains.
The present technology provides genetically modified strains that provide both increased safety of use and increase the breadth of the protective antibody response to meningococcal disease. In one embodiment, the genetically modified strains provide increased safety by incorporating at least one of the following mutations into the bacterial genome: deletion of the synX gene which blocks sialic acid synthesis of capsid and results in the formation of capsule-negative phenotype NOMVs, deletion of the lpxL1 gene which reduces the endotoxin activity by resulting in a penta-acyl lipid A structure, and/or deletion of the lgtA gene which block lacto-N-neotetraose biosynthesis on the lipooligosaccharide (LOS) which stabilized the truncated LOS structure; more preferably the genetically modified strains provide two of these mutations, most preferably the genetically modified strains provide all three of these mutations. In another embodiment of the present technology, the genetically modified strains have an increased breath of protective antibody response by targeting at least one of three sets of possible protective antigens contained within the NOMVs. The three possible antigens targeted include at least one of the following: PorA protein, at least one conserved minor protein, and/or the LOS core structure, and include any combination thereof. In more preferred embodiments, the genetically modified strain targets at least two of the possible protective antigens, most preferably targeting all three of the possible protective antigens.
In some embodiments of the present technology, the synX-mutation (inactivation of the synX gene) was inserted into the genetically modified strain by a method as described in U.S. Pat. No. 6,558,677, incorporated by reference herein in its entirety. In brief summary, a pUC19-based plasmid containing the synX gene in which 200 bp sequence was replaced by a kanamycin resistance gene is used to transform the genetically modified strain. Kan resistant transformants were selected and tested by PCR for the presence of the disrupted synX gene and for the capsule negative phenotype. This synX-mutant was constructed based on results and sequence information reported by Swartley and Stephens (Swartley and Stephens (1994) J. Bacteriol. 176: 1530-1534) who showed that insertion of a transposon into the synX gene led to a capsule negative phenotype. The same or an equivalent mutation can be introduced into any transformable N. meningitidis strain. A suitable plasmid for use in transforming meningococci was constructed using the following procedure. Three DNA sequences were pieced together using the splicing by overlap extension (SOE) polymerase chain reaction (PCR) technique (Horton et al. (1989) Gene 77: 61-65). The three DNA sequences included, in order beginning at the 5′ end, synXB bases 67 to 681; the kanamycin resistance gene from pUC4K (Pharmacia LKB Biotech Co.) 671 to 1623; and synxB bases 886 to 1589. In addition, at the 5′ end, a putative uptake sequence, ACCGTCTGAA (SEQ ID NO. 10), was added by including it at the end of the PCR primer used to amplify the synXB 67 to 691 base sequence. The complete construct was amplified by PCR, purified and blunt ligated into pUC19. pUC19 was used to transform Escherichia coli DH5a and selected on LB agar with 50 μg kanamycin. A kanamycin resistant colony was selected, the DNA extracted, purified, and cut with XbaI. Another copy of the presumptive uptake sequence was ligated into this multiple cloning region site and the resulting plasmid again used to transform E. coli DH5a and kanamycin resistant colonies screened by PCR for presence of the additional uptake sequence. Plasmid DNA was isolated from a selected colony and used as a template for PCR using primers that amplified only the insert part of the plasmid excluding the ampicillin resistance gene which should not be introduced into N. meningitidis. The amplified DNA was then purified and used to transform the genetically modified N. meningitidis strain. The synX(−) mutant of N. meningitides was selected by kanamycin resistance and confirmed by PCR amplification of the modified region.
In some embodiments of the present invention, the lpxL1 gene was inactivated in the genetically modified strains to produce a reduced endotoxic LOS expressed on the NOMVs in the vaccine compositions. The lipid A of N. meningitidis LOS is normally a hexa-acyl structure and is responsible for the endotoxic properties of the LOS. Two acyl-oxy-acyl linked secondary fatty acids present in the lipid A are important for endotoxic activity. The genetically modified strain includes the lpxL1 mutant as described by van der Ley and co-workers (van der Ley, P., Steeghs, L., Hamstra, H. J., van Hove, J., Zomer, B., and van Alphen, L. Modification of lipid A biosynthesis in Neisseria meningitidis lpxL mutants: influence on lipopolysaccharide structure, toxicity, and adjuvant activity. Infection and Immunity 69(10), 5981-5990, 2001.) Deletion of the lpxL1 gene resulted in expression of normal levels of penta-acyl LOS with greatly reduced endotoxicity as tested by both rabbit pyrogen test and by cytokine release assay using human monocytes from whole blood. Other methods for disrupting the lpxL1 gene are contemplated in further embodiments of the present technology for use in developing the genetically modified strains.
In some embodiments, the genetically modified strain contains an insertion of a second, antigenically different porA gene in place of one of the opa gene (OpaC or OpaD). The major outer-membrane protein, Porin A or PorA of Neisseria meningitidis, is the product of the porA gene. PorA has wide antigenic variation and is subject to phase variations to evade immune selective pressure; therefore it is not always cross-protective to other subtypes. To increase the reactivity of the vaccine compositions against different subtypes of PorA, at least one additional porA gene is inserted into the opaC or opaD gene of the genetically altered strain. The PorA serotype selected for insertion is selected based on the most prevalent forms of PorA found in cases of subtype B meningococcal disease. Suitable PorA serotypes include, but are not limited to: P1.7-1, (from strain M1080); P1.22,14 (from strain M4410); P1.22,1,4; or other suitable PorA serotypes as to be understood by one skilled in the art or described in the current literature, for example, as described by Sacchi et al., Diversity and prevalence of PorA types in Neisseria meningitidis serogroup B in the United States, 1992-1998, J Infect Dis. 2000 October; 182(4):1169-76. The second PorA genes may be under control of any suitable strong promoter that provided expression of the PorA protein, for example the PorA promoter from suitable strains, e.g., H44/76 strain. Suitable methods of cloning the porA gene into the genetically altered strain would be known to a person skilled in the art, and can include, but is not limited to homologous recombination. For example, the porA gene may be PCR amplified from bacterial chromosomal DNA, cloned into a cloning vector and recloned into an appropriately constructed plasmid, for example pUC19, using gene splicing by a modification of the overlap extension PCR technique. This construction plasmid can be introduced into the bacterial genome via homologous recombination such as to replace the opa gene. Transformants may be selected by colony blotting with monoclonal antibodies to the Porin. These methods are known to one skilled in the art.
In further embodiments of the present technology, the modified strains have stable and/or increased expression of at least one minor outer membrane protein. Suitable minor outer membrane proteins demonstrate the ability to induce bactericidal antibodies (for example, but not limited to, NadA, factor H binding protein (FHBP) variant 1, and FHBP variant 2). Not to be bound by any theory, stabilization and/or increased expression of highly conserved surface exposed minor outer membrane proteins identified through genomic analysis as having potential to induce protective antibodies may lead to an increase in the cross-protective immune response. Suitable conserved minor proteins include, but are not limited to, NadA, FHBP variant 1 and 2, and Opc. Methods of stabilizing and/or overexpression of the minor outer membrane protein (OMP) include use of expression plasmids and homologous recombination, or other suitable methods that are known to one skilled in the art. The minor OMPs can be under a strong promoter, for example, but not limited to the N. meningitidis PorA promoter or IPTG-inducible E. Coli ptac promoter.
As described in the examples below, construct plasmids were used to establish increased expression of fHbp 1 and fHbp 2 in the genetically modified strains, where the overexpressed protein appeared properly processed, lipidated, and translocated to the surface of the outer membrane. For example, expression of v.1 under the control of IPTG-inducible E. coli Ptac promoter in strain 8570 HOPS-G (B2) was about 4-fold higher than in the parental strain 8570 and expression of v.2 in strain B16B2 HPS-G2A (B3) was 32-64 fold higher than in the parental strain B16B6 (See
In further embodiments of the present technology, the genetically modified strains include inactivation of the lgtA gene which results in the expression of a shortened or truncated LOS that lacks the lacto-N-neotetraose (LNnT) tetrasaccharide.
An important characteristic of meningococcal LOS is phase-variation, which occurs due to high-frequency mutations in homopolymeric tracts of nucleotide residues in lgtA and other neisserial genes. These mutations switch on or off the expression of the LgtA transferase which mediates the assembly of the LOS α-chain (altering the configuration of substituents on heptose two). This phase-variable activation of the lgtA gene may lead to undesirable elongation of the LOS α-chain resulting in lacto N-neotetraose which has structural similarity to human blood cell antigens. The genetically modified strains of the present technology have the lgtA gene knocked out by disrupting the native gene with a antibiotic marker or other suitable marker (for use in screening for alternations in the gene), for example, but not limited to the zeomycin resistance gene. Methods of knocking out the lgtA gene are known to one skilled in the art including, but not limited to construct plasmids and homologous recombination or transformation. The mutated ΔlgtA gene was inactive in all modified strains during at least 22 observed passages and this was a stabilized truncated form of the LOS core structure. The deletion of the lgtA gene stabilizes the truncated α-core LOS structure, for example, providing the truncated core structures as depicted in
In further embodiments of the present technology, the genetically modified strains of N. meningitidis have stabilized expression of outer membrane proteins that are normally susceptible to phase variation in wildtype strains, for example, but not limited to, Opc and PorA. The expression of these proteins can be stabilized by methods known in the art, and include the method of replacing the polymeric repeat sequence in either the promoters or within the reading frame of the gene being stabilized with a non-repeating sequence of optimal length form maximal expression. For example, part of the poly-C or poly-G sequence in the promoter of these genes can be replaced with a sequence of the same length containing both C and G nucleotides, for example, 12 bp poly-G sequence of the promoter of opcA (see Seq. ID. No. 1) was replaced with a new sequence of the same length containing both C and G nucleotides and a Not I site (See Seq. ID No. 2, Not I site underlined). In other suitable embodiments, the poly-G sequence in the PorA promoter (for example, see Seq. ID No. 3) can be replaced with a new sequence containing both C and G nucleotides.
Further embodiments of the present technology provide growth of the vaccine strains in liquid medium containing a low level of iron in order to induce protein expression of proteins involved in uptake of iron, for example transferring binding protein A and B. In some embodiments, the medium used did not contain specific addition of iron chelators such as desferol. One suitable medium is modified from that published by B W Catlin (Catlin B W. (1973) J. Infec. Dis. 128: 178-194) by replacing sever individual amino acids with 1% casamino acids (certified, Difco Laboratories). The medium contained per liter: 0.4 g NH4Cl, 0.168 g KCl, 5.85 g NaCl, 1.065 g Na2HPO4, 0.17 g KH2PO4, 0.647 g sodium citrate, 6.25 g sodium lactate (60% syrup), 0.037 g CaCl2.2H2O, 0.0013 g MnSO4.H2O, 5 g glycerol, 0.02 g cysteine, 10 g casamino acids, 0.616 g MgSO4, and distilled water to one liter. The same iron deficient medium was used for the starter flasks and the final culture flasks or fermenters.
The vaccine composition of the present technology which includes NOMVs from at least three different genetically modified strains of subgroup B can provide three potential levels of protection or three types of antigens that each potentially induce a protective antibody response. The three antigens are the PorA protein (six different PorA subtypes are present in the vaccine, two on each of the three vaccine strains); the lipooligosaccharides (three different LOS core structures are present in the vaccine, one from each strain); and the conserved minor proteins NadA, FHBP variants 1 and 2, and Opc, which have been over expressed in the vaccine strains. Although PorA has a relatively high level of antigenic variation with several hundred different sequence variations having been identified, certain PorA serosubtypes are much more frequently encountered than others and a modest number of different serosubtypes may potentially protect against more than half of group B disease. Having more than one antigen capable of inducing bactericidal antibodies in the vaccine is important because it has been shown that when the surface density of an antigen is low, antibodies to it may not be able to initiate a complement mediated lytic event. But if antibodies to two or more such antigens are present the antibodies can together initiate complement mediated lysis. Genetically modified strains of the present invention include, but are not limited to, the three strains depicted in
The present technology provides a vaccine that provides broad spectrum protection against meningococcal disease, specifically meningococcal disease caused by Neisseria meningitidis subgroup B. The vaccine composition of the present invention can be combined with the existing tetravalent A, C, Y, and W-135 vaccine to provide protection against a majority of pathogenic serogroups of N. meningitidis. Not to be bound by any particular theory, the vaccine of the present technology may also provide back up protection against the other pathogenic serogroups as well as the minor serogroups of meningococci since the subcapsular antigens on which it is based are shared across all serogroups of meningococci.
In preferred embodiments of the present technology, the genes of interest or DNA of interest is delivered and integrated into the bacterial chromosome by means of homologous and/or site specific recombination. Integrative vectors used to deliver such genes and/or operons can be conditionally replicative or suicide plasmids, bacteriophages, transposons, or linear DNA fragments obtained by restriction hydrolysis or PCR amplicification as known by one skilled in the art. In some embodiments, integration is targeted to chromosomal regions dispensable for growth in vitro. In other embodiments, the gene of interest or DNA of interest can be delivered to the bacterium by means of episomal vectors such as circular/linear replicative plasmids, cosmids, plasmids, lysogenic bacteriophages, or bacterial artificial chromosomes. Selection of recombination events can be selected by means of selectable genetic markers such as genes conferring resistance to antibiotics (e.g., kanamycin, zeomycin, erythromycin, chloramphenicol, gentamycin, etc.), genes conferring resistance to heavy metal and/or toxic compounds or genes complementing auxotrophic mutations. Alternatively, recombination can be screened by PCR amplification, sequencing, restriction digestion or other methods known to one skilled in the art.
A “vaccine” as referred herein is defined as a pharmaceutical or therapeutic composition used to inoculate an animal in order to immunize the animal against infection by an organism, preferably a pathogenic organism. Vaccines typically comprise one or more antigens derived from one or more organisms which on administration to an animal will stimulate active immunity and protect that animal against infection with these or related pathogenic organisms.
The purified NOMVs are prepared for administration to mammals, suitably humans, mice, rats or rabbits, by methods known in the art, which can include filtering to sterilize the solution, diluting the solution, adding an adjuvant and stabilizing the solution.
Vaccines of the present invention may be administered to a human or animal by a number of routes, including but not limited to, for example, parenterally (e.g. intramuscularly, transdermally), intranasally, orally, topically, or other routes know by one skilled in the art. The term parenteral as used hereinafter includes intravenous, subcutaneous, intradermal, intramuscular, intraarterial injection, or infusion techniques. The vaccine may be in the form of a single dose preparation or in multi-dose flasks which can be used for mass vaccination programs. Suitable methods of preparing and using vaccines can be found in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., Osol (ed.) (1980) and New Trends in Developments in Vaccines, Voller et al. (eds.), University Park Press, Baltimore, Md. (1978), incorporated by reference.
A vaccine composition of the present technology is typically administered parenterally in dosage unit formulations containing standard, well-known nontoxic physiologically acceptable carriers, adjuvants, and/or vehicles.
The vaccine compositions of the present technology may further comprise one or more adjuvants. An “adjuvant” is a substance that serves to enhance, accelerate, or prolong the antigen-specific immune response of an antigen when used in combination with specific vaccine antigens but do not stimulate an immune response when used alone. Suitable adjuvants include inorganic or organic adjuvants. Suitable inorganic adjuvants include, but are not limited to, for example, an aluminium salt such as aluminum hydroxide gel (alum) or aluminium phosphate (preferably aluminium hydroxide), but may also be a salt of calcium (particularly calcium carbonate), iron or zinc, or may be an insoluble suspension of acylated tyrosine, or acylated sugars, cationically or anionically derivised polysaccharides or polyphosphazenes. Other suitable adjuvants are known to one skilled in the art. Suitable Th1 adjuvant systems may also be used, and include, but are not limited to, for example, Monophosphphorly lipid A, other non-toxic derivatives of LPS, and combination of monophosphoryl lipid A, such as 3-de-O-acrylated monophosphorly lipid A (#D-MPL) together with an aluminium salt.
Other suitable examples of adjuvants include, but are not limited to, MF59, MPLA, Mycobacterium tuberculosis, Bordetella pertussis, bacterial lipopolysaccharides, aminoalkyl glucosamine phosphate compounds (AGP), or derivatives or analogs thereof, which are available from Corixa (Hamilton, Mont.), and which are described in U.S. Pat. No. 6,113,918; e.g., 2-[(R)-3-Tetradecanoyloxytetradecanoylamino]ethyl, 2-Deoxy-4-O-phosphono-3-O—[(R)-3-tetradecanoyoxytetradecanoy 1]-2-[(R)-3-tetradecanoyoxytetradecanoylamino]-b-D-glucopyra noside, MPL™ (3-O-deacylated monophosphoryl lipid A) (available from Corixa) described in U.S. Pat. No. 4,912,094, synthetic polynucleotides such as oligonucleotides containing a CpG motif (U.S. Pat. No. 6,207,646), COG-ODN (CpG oligodeoxynucleotides), polypeptides, saponins such as Quil A or STIMULON™ QS-21 (Antigenics, Framingham, Mass.), described in U.S. Pat. No. 5,057,540, a pertussis toxin (PT), or an E. coli heat-labile toxin (LT), particularly LT-K63, LT-R72, CT-5109, PT-K9/G129; see, e.g., International Patent Publication Nos. WO 93/13302 and WO 92/19265, cholera toxin (either in a wild-type or mutant form). Alternatively, various oil formulations such as stearyl tyrosine (ST, see U.S. Pat. No. 4,258,029), the dipeptide known as MDP, saponin, cholera toxin B subunit (CTB), a heat labile enterotoxin (LT) from E. coli (a genetically toxoided mutant LT has been developed), and Emulsomes (Pharmos, LTD., Rehovot, Israel). Various cytokines and lymphokines are suitable for use as adjuvants. One such adjuvant is granulocyte-macrophage colony stimulating factor (GM-CSF), which has a nucleotide sequence as described in U.S. Pat. No. 5,078,996. The cytokine Interleukin-12 (IL-12) is another adjuvant which is described in U.S. Pat. No. 5,723,127. Other cytokines or lymphokines have been shown to have immune modulating activity, including, but not limited to, the interleukins 1-α, 1-β, 2, 4, 5, 6, 7, 8, 10, 13, 14, 15, 16, 17 and 18, the interferons-α, β and γ, granulocyte colony stimulating factor, and the tumor necrosis factors α and β, and are suitable for use as adjuvants.
The vaccine compositions can be lyophilized to produce a vaccine against N. meningitidis in a dried form for ease in transportation and storage. Further, the vaccine may be prepared in the form of a mixed vaccine which contains the NOMVs containing the proteins from the genetically altered strains described above and at least one other antigen as long as the added antigen does not interfere with the effectiveness of the vaccine and the side effects and adverse reactions are not increased additively or synergistically. The vaccine can be associated with chemical moieties which may improve the vaccine's solubility, absorption, biological half life, etc. The moieties may alternatively decrease the toxicity of the vaccine, eliminate or attenuate any undesirable side effect of the vaccine, etc. Moieties capable of mediating such effects are disclosed in Remington's Pharmaceutical Sciences (1980). Procedures for coupling such moieties to a molecule are well known in the art.
The vaccine may be stored in a sealed vial, ampule or the like. The present vaccine can generally be administered in the form of a spray for intranasal administration, or by nose drops, inhalants, swabs on tonsils, or a capsule, liquid, suspension or elixirs for oral administration. In the case where the vaccine is in a dried form, the vaccine is dissolved or suspended in sterilized distilled water before administration. Any inert carrier is preferably used, such as saline, phosphate buffered saline, or any such carrier in which the NOMV vaccine has suitable solubility.
Vaccine compositions of the present technology may include a carrier. If in a solution or a liquid aerosol suspension, suitable carriers can include, but are not limited to, salt solution, sucrose solution, or other pharmaceutically acceptable buffer solutions. Aerosol solutions may further comprise a surfactant.
Among the acceptable vehicles and solvents that may be used include water, Ringer's solution, and isotonic sodium chloride solution, including saline solutions buffered with phosphate, lactate, Tris and the like. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium, including, but not limited to, for example, synthetic mono- or di-glycerides. In addition, fatty acids such as oleic acid find use in the preparation of injectables.
Injectable preparations, for example sterile injectable aqueous or oleaginous suspensions, are formulated according to the known art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation are also a sterile injectable solution or suspension in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3-butanediol.
The presently described technology and its advantages will be better understood by reference to the following examples. These examples are provided to describe specific embodiments of the present technology. By providing these specific examples, the applicants do not limit the scope and spirit of the present technology. It will be understood by those skilled in the art that the full scope of the presently described technology encompasses the subject matter defined by the claims appending this specification, and any alterations, modifications, or equivalents of those claims.
The genetically modified strain 8570 HOPS-G1 was modified by five genetic modifications from a parental strain 8570 which had been analyzed by multilocus enzyme electrophoresis by the laboratory from whom the strain was obtained and determined to belong to the ET-5 clonal complex (Caugant, et al.) The PorA variable regions were sequenced typed and the LOS immunotype was verified before the genetic modifications were made. Strain 8570 was and ET-5 clone 4:P1.19, 15:L7v, ProB3 (ST4) Tbp2 type II. A series of five sequential genetic modifications were made to the strain as described below:
1) A second, different porA gene was inserted at the opaD locus knocking out the opaD gene. pUC19-based plasmid pA 18.4 has no antibiotic resistance marker in the insert, was used to insert a second porA gene into the chromosome at the opaD locus, disabling opaD by replacing a 100 bp sequence in the middle of the gene with the insert. The insert contained the new porA gene taken from strain M4410 (B:15:PI.22,14) and placed behind a porA promoter taken from strain H44/76. The resulting porA type was P1.19,15: P1.22,14 containing the two porin A genes.
2) Starting with the strain resulting from 1, with a second PorA expressed, the expression of the outer membrane protein OpcA was stabilized by replacing a 12 bp poly-C sequence in the promoter of opcA with a new sequence of the same length containing both C and G nucleotides. Original promoter sequence (Seq. ID No. 1) (poly-G sequence italicized and bold) 5′..CATAGTTAAAACCTCTAAAATTTGGATTGTAGTCGGATATGGTAACATAACGTAAATA ATCGTTACGCTTACAATTATATTCTTAAGCTTTCATTT..3′ was replaced with a modified promoter sequence (Seq ID No. 2) containing both G and C nucleotides with a Not I site (underlined) 5′..CATAGTTAAAACCTCTAAAATTTGGATTGTAGTCGGATATGGTAACATAACGTAAATA ATCGTTACGCTTACAATTATATTCTTAAGCTTTC
ATTTT.3′ The replacement sequence was chosen to contain a restriction site for NotI to enable verification of the presence of the replacement sequence. The plasmid used for the transformation was pOpc79 (Seq. ID No. 4). The plasmid insert does not contain an antibiotic marker. Selection of transformants was based on colony blotting with monoclonal antibody to OpcA. The strain to be transformed was chosen to be an OpcA negative phase variant, and strong OpcA positive clones were identified by colony blotting. True transformants were distinguished from OpcA positive phase variants by PCR and restriction enzyme (Not I) analysis.
3) Starting with the strain resulting from 2, the gene lpxL1, which is an acyl transferase responsible for linking one of two acyl-oxy-acyl linked fatty acids to the lipid A of the LOS, was disabled by replacing a 260 bp sequence in the middle of the lpxL1 gene with an insert containing the tetM antibiotic resistance gene. The tetM gene was obtained from a plasmid pJS 1934, which was derived from the transposon Tn916 (Swartley, et al. 1993. Mol. Microbiol. 10:299-310). The plasmid used to disable the lpxL1 gene was pMn5 (Seq. ID No. 5). The presence of the insert in the lpxL1 gene was verified by PCR which produced a 3.3 kbp amplicon using primers at the beginning and end of the lpxL1 gene.
4) Starting with the strain resulting from step 3, expression of the conserved outer membrane protein GNA 1870 (variant 1) (FHBP v.1) was increased by inserting a second copy of the GNA 1870 variant 1 gene in the nspA locus, knocking out expression of NspA. The newly inserted gene was part of an insert that contained a gentamicin antibiotic resistance gene, the E. coli lac operon with the IPTG-inducible Ptac promoter, the GNA1870 variant 1 gene and the rrnB terminator, the plasmid used is depicted in
N. mening., 44-76, PCR construct
N. mening., 44-76, PCR construct
N. mening., 44-76, PCR construct
N. mening., 44-76, PCR construct
N. mening., PCR construct
5) The strain resulting from step 4 was transformed with a pUC19-based plasmid containing the synX gene in which a 200 bp sequence was replaced by a kanamycin resistance gene. Kan resistant transformants were selected and tested by PCR for the presence of the disrupted synX gene and for the capsule negative phenotype. The results verified the knockout of the synX gene.
6) The strain resulting from step 4 was transformed with a plasmid pBE-501 containing zeomycin gene knocking out the lgtA gene (Seq. ID No. 9). Plasmid pBE-501 contained the features found in Table 2. Knock-out of the lgtA gene produced expression of a shortened or truncated LOS that lacks the lacto-N-neotetraose (LNnT) tetrasaccharide (see
N. mening., 2996, PCR construct
N. mening., 2996, PCR construct
This genetically modified strain was tested to unsure retention of all five mutations and expression of all expected antigens.
The genetically modified strains were then used for production of master and production cell banks for use in vaccine manufacture as detailed in the flow-charts in
The final product obtained from Example 2 was subjected to quality control testing and preclinical safety and immunogenicity testing in mice and rabbits.
The composition of the final product vaccine was:
The vaccine composition was further analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis and western blotting.
The results are found in
The vaccine was tested in the General Safety Test as prescribed in 21 CFR 610.11. The results for the vaccine are given in Table 4.
The results of the rabbit pyrogen test for endotoxin activity are given in Table 3 for the genetically modified vaccine 8570 HOPS-G NOMV alone and the vaccine adsorbed to aluminum hydroxide adjuvant. The values given are the highest amounts tested that did not induce a fever in the rabbits (temperature increase of >0.5° C.), results of which are found in Table 5.
In summary, the vaccine alone passed at 0.4 pg/kg, the aluminum hydroxide adjuvant passed at 15 pg/kg (the largest amount per kg to be used in the clinical study), and the vaccine adsorbed to aluminum hydroxide passed at 0.5 lag/kg but failed at 1.0 pg/kg. Extrapolation of these results on a pg/kg basis suggest the adsorbed vaccine would be non-pyrogenic in humans up to a dose in the range of 25-50 μg.
The vaccine was tested for endotoxin content by measuring its ability to induce proinflammatory cytokines TNF-alpha and IL-6, from fresh whole human blood. The results are shown in
The activity of the 8570 HOPS-G NOMV Vaccine Lot #1289 was compared to the activity of deoxycholate extracted outer membrane vesicles (OMV). The vesicles were prepared using the basic method described by Fredriksen J H, et al. NIPH Annals, 14:67-80, 1991, except 0.5% deoxycholate (DOC) was used through out the procedure rather than using 1.2% DOC to resuspend the ultracentrifuge pellets. The results of this comparison are shown in
Mice were given three doses of genetically modified vaccine strain 8570 HOPS-G at four week intervals with or without adsorption to aluminum hydroxide adjuvant (REHYDRAGEL® LV). Groups of 10 mice were vaccinated intraperitoneally at 0, 4 and 8 weeks with 0.1, 0.3, 1.0 or 3.0 μg of NOMV, the vaccine groups are listed in Table 6. Serum was taken at 0, 7 and 10 weeks. The sera were tested for bactericidal antibodies against four different strains, the parent of the vaccine strain and several related strains using normal human serum as a source of complement. Pre-vaccination sera were uniformly lacking in bactericidal activity.
The results obtained with the 10-week sera (three doses of vaccine) are shown in
Bactericidal antibodies induced in mice by the 8570 HOPS-G NOMV vaccine do not show serosubtype specificity, but appear mostly independent of serosubtype and serotype (
Analysis of the specificity of the bactericidal antibody response against the heterologous strain 44/76 was undertaken by depletion of bactericidal activity with different isolated antigens. Post-vaccination mouse serum was diluted to the bactericidal endpoint (−50% killing) and incubated in 96-well microplate wells coated with different concentrations of several antigens. After 4-hrs incubation, the serum was tested for bactericidal activity and the percent removal of bactericidal antibody determined Purified LOS prepared from the target strain (immunotype L3,7) was able to remove nearly all the antibody. Purified LOS (immunotype L8v) prepared from the vaccine strain was able to remove about 70% of the antibody. The conserved protein GNA1870 (purified, recombinant protein) appeared to remove about 20% of the bactericidal activity, which, not to be bound by any particular theory, may indicate some cooperative killing involving both anti-LOS antibody and anti-GNA1870 antibody as shown in
The vaccine was also tested for immunogenicity in rabbits. Groups of four rabbits were vaccinated intramuscularly with different doses of vaccine, with or without adsorption to aluminum hydroxide adjuvant. Three doses were given at six week intervals and blood was drawn two weeks after the last injection. The bactericidal antibody response of the rabbits to four test strains was determined. The test strains included 3 isogenic variants of 8570 expressing different PorA proteins and L3,7v LOS and strain 44/76 which has a heterologous PorA and LOS with a different core structure. PorA proteins P1.19,15 and P1.22,14 were present in the vaccine, but P1.22-1,4 was not. The results of the bactericidal tests are given in
In addition to strain 8570 HOPS-G1 which was described in the Examples above, two additional vaccine strains were selected and genetically modified. The first was strain B 16B6 (B:2a:P 1.5,2:L2). This strain belongs to the genetic group ET-37 and has a class 2 PorB protein and type I transferrin binding protein B. The second was strain 44/76 (B:15:P1.7,16:L3,7), which belongs to the genetic group ET-5 and is representative of the epidemic strain responsible for the group B meningococcal epidemic in Norway in the 1970's and 1980's. It expresses a class 3 PorB protein and type II transferrin binding protein B.
Strain B16B6 was genetically modified in much the same manner as described for strain 8570 HOPS-G1. Two genes were disabled, synX and lpxL1, to prevent capsule synthesis and sialylation of LOS and to reduce the toxicity of the LOS. A second porA gene (subtype P1.22-4) was inserted in place of the opaD gene. Variant 2 of GNA 1870 (FHBP) with the IPTG inducible E. coli Ptac promoter, was inserted in place of the nspA gene as a second copy using plasmid pBE-201 (Seq. ID. No 7). Plasmid pBE-201 (7687 b.p. for additional expression of fHBP (variant 2)) was constructed with the features as described in Table 7.
N. mening., 44-76, PCR construct
N. mening., PCR construct
N. mening., 2996, PCR construct
N. mening., 2996, PCR construct
N. mening., 44-76, PCR construct
N. mening., PCR construct
A phase variant of the resulting strain expressing a truncated alpha chain consisting of glucose and galactose. L2 LOS was selected by colony blotting. The resulting genetically modified strain was designated B16B6 HPS-G2, see
Strain 44/76 was also modified genetically in the same pattern as described for strain 8570 HOPS-G1. The two genes, synX and lpxL1, were disabled by insertion mutagenesis, a second porA gene (subtype P1.7-1, 1) was inserted along with its promoter in place of the opaD gene, and a second copy of nadA was inserted behind a porA promoter in place of the nspA gene. Plasmid pBE-311 was used for homologous recombination to insert the NadA gene, the plasmid 3-11 was constructed with the features as described in Table 8 and the sequence can be found in Seq. ID No. 8.
N. mening., 44-76, PCR construct
N. mening., 44-76, PCR construct
N. mening., 2996, PCR construct
N. mening., 2996, PCR construct
N. mening., 44-76, PCR construct
N. mening., 44-76, PCR construct
N. mening., PCR construct
In addition, expression of OpcA was stabilized by curing the phase variation associated with its gene. This was done as described for strain 8570 HOPS-G1 by breaking up the poly-G string in its promoter in Example 1. The lgtA gene was interrupted as in Example 1 producing a truncated LOS. A phase variant of the resulting strain expressing the L8 immunotype was selected by colony blotting with an L8 specific monoclonal antibody. This genetically modified strain was designated 44/76 HOPS-D as shown in
The three genetically modified strains were used to prepare laboratory lots of NOMV vaccine compositions. The strains were grown in Catlin's modified medium as one liter cultures in Fernbach flasks on a rotary shaker. The cells were harvested by centrifugation, weighed and the cell paste frozen. The cell paste was thawed and used to prepare NOMV following essentially the same procedure as described for the clinical lot of vaccine from strain 8570 HOPS-G1 as described in Example 2. The process was scaled down and ultracentrifugation twice at 225,000×g for 60 min at 2-8° C. to remove nucleic acids and all soluble, non-vesicle material.
Groups of ten CD-1 mice were vaccinated intraperitoneally with two pg of NOMV vaccine from each genetically modified vaccine strain (6 pg total for the combined vaccine with NOMV from three strains). Three doses were given at 0, 4, and 8 weeks. Blood was drawn pre-vaccination and 2 weeks following the last vaccination (at 10 weeks).
Sera from individual mice were tested for bactericidal antibodies against the homologous strains, and pooled serum from each group of 10 mice was tested against a panel of 14 heterologous group B strains and 1 group C strain expressing a broad range of different subcapsular antigens.
The combined multivalent vaccine induced a geometric mean 1:256 titer against each of the three vaccine strains and a 4-fold or greater increase in bactericidal antibodies against 13 of the heterologous strains. Two of the test strains were not killed in spite of having an antigen shared with one of the vaccine strains. The bactericidal titers observed against the panel of strains are given in the Table 9.
These results demonstrate the ability of the combined vaccine to induce bactericidal (protective) antibodies against a broad range of group B strains and potentially strains of other serogroups as well.
Analysis of the bactericidal antibodies using a bactericidal depletion test demonstrated that antibodies to all three sets of antigens were involved in killing at least some of the test strains. In some cases, it appeared that antibodies to more than one antigen were involved and acted together to produce bactericidal activity against a given strain.
Additional groups of mice were vaccinated with NOMV vaccine prepared from isogenic mutants of strain 8570 HOPS-G1. The mutant strains differed in their expression of PorA. Two mutants expressed a single PorA (one or the other of the two in the multivalent vaccine strain) and the third was a PorA knockout mutant expressing no PorA protein. Bactericidal titers induced by each of the four strains against several different test strains are shown in Table 10.
For the first five test strains in Table 10, the PorA expression had no effect on the titer of bactericidal antibodies induced by the vaccine. For the last two strain, which both express P1.14, the presence of the P1.14 epitope in the vaccine correlated with the capacity of the respective serum to kill the strain. This demonstrates that antibodies to PorA are involved in the observed killing for some strains. For other strains such as the homologous strain and strain 44/76 other antigens are responsible for most of the bactericidal activity. This was demonstrated by analysis with the bactericidal depletion assay. Results of one such assay are given in
This application is a 371 National Phase filing of International Patent Application Serial No. PCT/US2009/045818 filed Jun. 1, 2009, which claims priority to U.S. Patent Application Ser. No. 61/057,462 filed May 30, 2008. The above applications are incorporated herein by reference in their entirety.
The U.S. Government has rights in this invention.
Filing Document | Filing Date | Country | Kind | 371c Date |
---|---|---|---|---|
PCT/US2009/045818 | 6/1/2009 | WO | 00 | 3/9/2011 |
Publishing Document | Publishing Date | Country | Kind |
---|---|---|---|
WO2009/158142 | 12/30/2009 | WO | A |
Number | Name | Date | Kind |
---|---|---|---|
4601903 | Frasch | Jul 1986 | A |
4727136 | Jennings et al. | Feb 1988 | A |
5705161 | Van Der Ley et al. | Jan 1998 | A |
6476201 | Lowell et al. | Nov 2002 | B1 |
6558677 | Zollinger et al. | May 2003 | B2 |
6821521 | Robinson et al. | Nov 2004 | B1 |
6921537 | Zlotnick | Jul 2005 | B2 |
7112332 | Lowell | Sep 2006 | B1 |
7238345 | Seid et al. | Jul 2007 | B1 |
7384645 | Foster et al. | Jun 2008 | B2 |
20020037295 | Lowell | Mar 2002 | A1 |
20030059444 | Zollinger | Mar 2003 | A1 |
20030180316 | Boutriau | Sep 2003 | A1 |
20030215469 | Robinson | Nov 2003 | A1 |
20040047880 | De Bolle | Mar 2004 | A1 |
20040126389 | Berthet | Jul 2004 | A1 |
20040131625 | Berthet | Jul 2004 | A1 |
20040131642 | Rosenqvist | Jul 2004 | A1 |
20050013831 | Foster | Jan 2005 | A1 |
20060034854 | Berthet | Feb 2006 | A1 |
20060047106 | Pavliak et al. | Mar 2006 | A1 |
20060088553 | Braun | Apr 2006 | A1 |
20060216307 | Berthet | Sep 2006 | A1 |
20060240045 | Berthet et al. | Oct 2006 | A1 |
20070031449 | Bos | Feb 2007 | A1 |
20070166333 | Niebla Perez | Jul 2007 | A1 |
20070196391 | O'Hagan | Aug 2007 | A1 |
20080063665 | Oster | Mar 2008 | A1 |
20080138359 | Steeghs et al. | Jun 2008 | A1 |
20080233154 | Berthet | Sep 2008 | A1 |
20080248065 | Granoff | Oct 2008 | A1 |
20090117147 | Berthet | May 2009 | A1 |
20090123499 | Devos et al. | May 2009 | A1 |
Number | Date | Country |
---|---|---|
9006696 | Jun 1990 | WO |
9201791 | Feb 1992 | WO |
9303761 | Mar 1993 | WO |
9931132 | Jun 1999 | WO |
9955873 | Nov 1999 | WO |
0025811 | May 2000 | WO |
0050074 | Aug 2000 | WO |
0109350 | Feb 2001 | WO |
2001009350 | Aug 2001 | WO |
0191788 | Dec 2001 | WO |
0209746 | Feb 2002 | WO |
03051379 | Jun 2003 | WO |
2004014417 | Feb 2004 | WO |
2004014419 | Feb 2004 | WO |
2005042571 | May 2005 | WO |
2006024946 | Mar 2006 | WO |
2006081259 | Aug 2006 | WO |
2007144316 | Dec 2007 | WO |
Entry |
---|
Van der Ley et al. Vaccine 13: 401-407, 1995, abstract. |
Aho et al., Mol. Microbiol., 5:1429-1437 (1991). |
Barenkamp et al., Infect. Immun., 60:1302-1313 (1992). |
Barlow et al., Infect. Immun., 55(11):2734-2740 (1987). |
Comanducci et al., J. Exp. Med., 195:1445-1454 (2002). |
Frosch et al., Mol. Microbiol., 4(7):1215-1218 (1990). |
Grass et al., Infect. Immun., 69:307-314 (2001). |
Hendrixson et al., Mol. Cell, 2:841-850 (1998). |
Hou et al., J. Infect. Dis., 192:580-590 (2005). |
Legrain et al., Gene, 130(1):73-80 (1993). |
Van der Ley et al., Vaccine 13:401-407 (1995). |
McGuinness et al., J. Exp. Med., 171:1871-1882 (1990). |
Nassif et al., J. Bacteriol., 173(7):2147-2154 (1991). |
Peak et al., FEMS Immunol. Med. Microbiol., 28:329-334 (2000). |
Poolman et al., J. Med. Microbiol., 19:203-209 (1985). |
Sierra et al., NIPH Ann., 14(2):195-207 (1991). |
St. Geme et al., J. Bacteriol., 182:6005-6013 (2000). |
St. Geme et al., Mol. Microbiol., 14:217-233 (1994). |
Swartley et al., J. Bacteriol., 176(5):1530-1534 (1994). |
International Search Report and Written Opinion, Int'l Appln. No. PCT/US09/45818, filed Jun. 1, 2009. |
Katial et al. “Immunogenicity and Safety Testing of a Group B Intranasal Meningocca Membrane Vesicle Vaccine” Infection and Immunity Feb. 2002, vol. 70, No. 2, pp. 702-707. |
Zollinger et al. “Development of a vaccine for Neisseria Meningitidis Group B Based on Membrane Vesicles”, Public report in Online information for the Defense Community, Jan. 10, 2006, http://www.dtic.mil/cgi-bin/GetTRDoc/Location=U2&doc=GetTRDoc.pdf&AD=ADA481545. |
Fisseha et al. “Characterization of Native Outer Membrane Vesicles from IpxL Mutant Strains of Neisseria meningitidis for Use in Parenteral Vaccination”, Infection and Immunity, Jul. 2005, vol. 73, No. 7, pp. 4070-4080. |
M. Fisseha et al, “Characterization of native outer membrane vesicles from IpxL mutant strains of Neisseria meningitids for use in parenteral vaccination”, Infection and Immunity , vol. 73, No. 7, Jul. 1, 2005, pp. 4070-4080. |
Koeberling Oliver et al. “Bactericidal antibody response elicited by a vaccine with overexpressed factor H-bidning protein and genetically attenuated endotoxin”, Journal of Infectious Diseases, JID, University of Chicago Press, Chicago IL, vol. 198, No. 2, May 27, 2008. |
Holst J., “Strategies for development of universal vaccines against meningococcal serogroup B disease: The most promising options and the challenges evaluating them,” Human Vaccines, Landes Bioscience, Georgetown, TX, US, vol. 3, No. 6, Nov. 1, 2007. |
Van Berkel et al. “A critical contributionof both CD28 and ICOS in the adjuvant activity of Neisseria meningitidis H44/76 LPS and IpxL1 LPS”, Vaccine, Elsevier LTD, GB, vol. 25, No. 24, May 24, 2007. |
Giuliani Marzia M. et al. “A universal vaccine for serogroup B meningococcus” PNAS, National Academy of Sciences, vol. 103, No. 29, Jul. 18, 2006. |
Van Der Ley et al. “Construction of Neisseria Meningitidis strains carrying multiple chromosomal copies of the porA gene for use in the production of a multivalent outer membrane vesicle vaccine”, Vaccine, vol. 14, No. 4, Jan. 1, 1995. |
Menende et al. “Recent advances in the pathogenic neisseria research” Biotechnologia Aplicada 2008 ELFOS Scientia Cub, vol. 25, No. 3, 2008. |
Extended European Search Report for Application No. 09770677.4-142 (PCT/US2009045818); Oct. 14, 2013. |
Number | Date | Country | |
---|---|---|---|
20110182942 A1 | Jul 2011 | US |
Number | Date | Country | |
---|---|---|---|
61057462 | May 2008 | US |