Patent Application
20230123431
The present invention provides a genetically engineered bacteria or yeast cell capable of enhanced production of free lipoic acid, recombinant vectors, and methods for the production of free lipoic acid. More particularly, the free lipoic acid is R-lipoic acid.
Lipoic acid is an essential cofactor required for several key enzymes involved in aerobic metabolism and the glycine cleavage system in most organisms (Cronan et al., Advances in Microbial Physiology, RK. Poole, Editor, Academic Press. 103-146 (2005); Cronan, Microbiology and Molecular Biology Reviews 80: 429-450 (2016)). It can be used as an antioxidant for dietary supplementation due to its ability to bind directly or indirectly with free radicals (Croce et al., Toxicology in Vitro 17: 753-759 (2003)). Furthermore, findings from clinical trials have shown that lipoic acid can increase insulin sensitivity, which supports its application as an anti-diabetic drug (Lee et al., Biochemical and Biophysical Research Communications 443: 885-891 (2005)). Lipoic acid was also shown to inhibit the proliferation of breast tumor cells, indicating its potential application as an anti-cancer drug (Li et al., Genetics and Molecular Research 14: 17934-17940 (2015)). Currently, lipoic acid is obtained mainly through chemical synthesis processes, which conventionally generates equal amounts of the two enantiomeric R and S forms of lipoic acid (Balkenhohl and Paust, Zeitschrift for Naturforschung Section B-a Journal of Chemical Sciences 54: 649-654 (1999); Ide et al., Journal of Functional Foods 5: 71-79 (2013)). However, in biological systems, lipoic acid exists solely in the R form; S-lipoic acid is a by-product during chemical synthesis. Therefore, R-lipoic acid in general shows bioactivity superior to S-lipoic acid, and in some cases, S-lipoic acid is detrimental to health. For example, R-lipoic acid was shown to protect the lens in eyes from forming cataract, while S-lipoic acid showed the reverse effect by potentiating deterioration of the lens (Kilic et al., Biochem Mol Biol Int 37: 361-370 (1995)). Thus, it is beneficial to obtain R-lipoic acid in the enantiomerically pure form to maximize the health effects of lipoic acid and prevent potential side effects caused by S-lipoic acid. Yet, chiral separation and asymmetric synthesis methods used to attain pure R-lipoic acid lead to wastage of the S form of lipoic acid or precursors of undesired chirality (U.S. Pat. Nos. 5,281,722A; 6,670,484 B2; 6,864,374 B2; Purude et al., Tetra-hedron-Asymmetry 26: 281-287 (2015)), hence reducing the efficiency of resource utilization in synthesizing the compound. Moreover, compared to racemic lipoic acid synthesis, these procedures for preparing pure R-lipoic acid lengthen the production process, and require additional reagents and solvents, which incur higher manufacturing costs and greater impact on the environment. In view that chemical synthesis of R-lipoic acid also involves toxic reagents and catalysts, and entails many steps, biological engineering of microbial cell factories for production of free R-lipoic acid presents an attractive avenue for obtaining enantiomerically pure R-lipoic acid in a sustainable and environmentally-friendly manner. Bacterial production of lipoic acid through metabolic engineering has been shown in bacteria, including Escherichia coli, Pseudomonas reptilivora, Listeria monocytogenes and Bacillus subtilis, and so on (Ji et al., Biotechnology Letters 30: 1825-1828 (2008); Moon et al., Applied Microbiology and Biotechnology 83: 329-337 (2009); Christensen et al., Mol Microbiol 80: 350-363 (2011); Storm, CurrPharm Des 18: 3480-3489 (2012); Sun et al., PLoS one 12: e0169369-e0169369 (2017)). The lipoic acid biosynthesis and protein lipoylation pathways are most well-studied in E. coli over the past two decades. There are two complementary pathways for lipoic acid biosynthesis and protein lipoylation in E. coli: (i) de novo biosynthesis pathway where endogenous octanoic acid is attached to apo-proteins by LipB, followed by sulfur insertion by LipA, and (ii) scavenging pathway where exogenous lipoic acid or octanoic acid is transferred to unlipoylated apo-form of proteins by Lp1A (Sun et al., PLoS one 12: e0169369-e0169369 (2017)).
Compared to bacteria, Saccharomyces cerevisiae, a model yeast strain, offers a number of advantages for biochemical production due to its inherent abilities to withstand lower temperature, pH changes and phage attack (Chen et al., Metabolic Engineering 31: 53-61 (2015); Jin et al., Biotechnol Bioeng 113: 842-851 (2016); Foo et al., Biotechnology and Bioengineering 114: 232-237 (2017)). Importantly, unlike E. coli, yeast lacks a lipoic acid scavenging pathway that binds free lipoic acid to proteins via an ATP- and energy-expending process (Booker, Chemistry & Biology 11: 10-12 (2004)). Hence, S. cerevisiae inherently does not consume free lipoic acid, which is a beneficial characteristic that allows accumulation of our target compound, i.e. free R-lipoic acid.
In yeast, there are three well-known lipoate-dependent enzyme systems: glycine cleavage system (GCV), α-ketoglutarate dehydrogenase (KGDC) and pyruvate dehydrogenase (PDH) (Schonauer et al., Journal of Biological Chemistry 284: 23234-23242 (2009)). GCV is involved in the cleavage of glycine to ammonia and C1 units, which is essential for utilization of glycine as a sole source of nitrogen (Sinclair and Dawes, Genetics 140: 1213-1222 (1995); Piper et al., FEMS Yeast Research 2: 59-71 (2002)). KGDC catalyzes the oxidative decarboxylation of 2-oxoglutarate to succinyl-CoA, a precursor of several amino acids and the source of succinate, the entry point to the respiratory chain (Repetto and Tzagoloff, Molecular and Cellular Biology 11: 3931-3939 (1991)). PDH catalyzes the oxidative decarboxylation of pyruvate, thereby linking cytosolic glycolysis and mitochondrial respiration (Boubekeur et al., Journal of Biological Chemistry, 274(30): 21044-21048 (1999)). Gcv3p, Kgd2p and Lat1p are the lipoate-bound subunits of GCV, KGDC and PDH respectively (Nagarajan and Storms, Journal of Biological Chemistry 272: 4444-4450 (1997)). Different from E. coli, lipoic acid synthesis and attachment to target proteins are less well-understood in yeast. To form lipoylated Gcv3p, Kgd2p and Lat1p, a two-step conversion has been hypothesized for lipoic acid synthesis and protein attachment in yeast mitochondria (Hermes and Cronan, Yeast 30: 415-427 (2013)). Lip2p and Lip3p were demonstrated to encode octanoyltransferases that utilize octanoyl-ACP or octanoyl-CoA to attach an octanoyl group to the apo-form of lipoate-dependent proteins (Stuart et al., FEBS Letters 408: 217-220 (1997); Marvin et al., FEMS Microbiology Letters 199: 131-136 (2001); Hermes and Cronan, Yeast 30: 415-427 (2013)). A lipoyl synthase Lip5p catalyzes the insertion of two sulfurs into the octanoate carbon chain (Sulo and Martin, Journal of Biological Chemistry 268: 17634-17639 (1993)). Ultimately, lipoic acid is bound to Gcv3p, Kgd2p and Lat1p via an amide linkage between its carboxyl group and the epsilon amino group of a lysine residue of the proteins (Sulo and Martin, Journal of Biological Chemistry 268: 17634-17639 (1993)). Interestingly, it has been discovered that Lip2p and Lip5p are required for lipoylation of all three proteins while Lip3p is required for lipoylation of Kgd2p and Lat1p but not Gcv3p (Hermes and Cronan, Yeast 30: 415-427 (2013)). To release free lipoic acid from lipoate-bound proteins, lipoamidase from Enterococcus faecalis (EfLPA), a member of the Ser-Ser-Lys family of amidohydrolases was isolated and characterized (Jiang and Cronan, Journal of Biological Chemistry 280: 2244-2256 (2005)). This enzyme has been demonstrated to liberate free lipoic acid from lipoic acid-bound H protein of GCV, and E2 subunit of KGDC and PDH from E. coli (Spalding and Prigge, PLoS one 4: e7392 (2009)). While functional heterologous expression of EfLPA has been demonstrated in bacterial hosts, the activity of EfLPA in yeast is, to the inventor's knowledge, unknown.
There is a need to improve methods for the production of free R-lipoic acid. Therefore, S. cerevisiae as a potential production host for free R-lipoic acid biosynthesis was investigated. Hereafter, lipoic acid specifically refers to R-lipoic acid.
EfLPA has been demonstrated to liberate free lipoic acid from lipoic acid-bound H protein of GCV, and E2 subunit of KGDC and PDH from E. coli (Spalding and Prigge, PLoS one 4:e7392 (2009)). The inventors employed metabolic engineering strategies to improve lipoic acid production. First, the availability of lipoate-bound proteins in yeast was confirmed and they were then characterized through liquid chromatography-tandem mass spectrometry (LC-MS/MS). The in vitro activity of EfLPA was determined in order to validate its functional expression and to select a suitable lipoylated protein as the target substrate for EfLPA. To develop a free lipoic acid-producing strain, EfLPA was modified for translocation to the mitochondria, where lipoylated proteins reside. Finally, to enhance the lipoic acid production, the selected substrate protein (i.e. Gcv3p), catalytic enzymes (i.e. Lip2p and Lip5p), and cofactor regenerating enzymes (i.e. Sam1p and Sam2p) were overexpressed (
The protein substrate that is lipoylated may be any suitable substrate known in the art and may be selected from a group comprising Gcv3p, Lat1p and Kgd2p.
It would be understood that the S-adenosylmethionine synthase may be any suitable enzyme known in the art, preferably from a cell selected from a group comprising Kluyveromyces, Candida, Pichia, Yarrowia, Debaryomyces, Saccharomyces spp., and Schizosaccharomyces pombe. Preferably, the S-adenosylmethionine synthase is S-adenosylmethionine synthase 1 (Sam1) and/or S-adenosylmethionine synthase 2 (Sam2), more preferably Sam1 and Sam2 are from Saccharomyces cerevisiae.
In some embodiments, the lipoic acid pathway genes comprise LIP2 (octanoyltransferase), LIP5 (lipoyl synthase), GCV3 (H protein of the glycine cleavage system), LPA (lipoamidase), SAM1 and/or SAM2.
In some embodiments, the lipoic acid pathway genes are expressed in mitochondria.
In some embodiments, the lipoic acid pathway genes are expressed in the mitochondria by virtue of a mitochondrial targeting peptide (MTP). It was found that proteins such as Gcv3p, Lat1p and Kgd2p could be targeted to the mitochondria through their native MTP, whereas LPA, Sam1p and Sam2p could be targeted to the mitochondria using a non-native MTP, such as the MTP from yeast cytochrome c oxidase subunit IV.
In some embodiments, the mitochondrial targeting peptide (MTP) is from yeast cytochrome c oxidase subunit IV (COX4). In some embodiments the amino acid sequence of the COX4 MTP is 5′-MLSLRQSIRFFKPATRTLCSSRYLLQQKP-3′ (SEQ ID NO: 45).
In some embodiments, the yeast is selected from a group comprising Kluyveromyces, Candida, Pichia, Yarrowia, Debaryomyces, Saccharomyces spp., and Schizosaccharomyces pombe. Preferably, the yeast is Saccharomyces cerevisiae.
In some embodiments, said at least one promoter is a constitutive promoter.
In some embodiments the lipoamidase (LPA) is from Enterococcus faecalis, termed EfLPA. Preferably, the EfLPA gene is codon-optimized for expression in S. cerevisiae. If the EfLPA gene is used, it is preferred that the protein substrate that is targeted for lipoylation is Gcv3p.
In some embodiments, the lipoic acid pathway genes are expressed from one or more plasmids. Alternatively, expression cassettes encoding one or more of the heterologous lipoic acid pathway genes may be integrated into the genome using an integrative vector such as pIS385 described in Example 1. It would be understood that integration into the host DNA may provide permanent expression, whereas plasmid expression tends to be transient.
In some embodiments, at least one of said lipoic acid pathway genes is integrated into the bacteria or yeast genome.
In some embodiments, the LIP2, LIP5, GCV3, LPA, SAM1 and/or SAM2 genes respectively encode an amino acid sequence comprising the sequence set forth in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9 and/or SEQ ID NO: 11. It would be understood that due to redundancy in the genetic code, a nucleic acid sequence may have less than 100% identity to a reference sequence and still encode the same amino acid sequence.
In some embodiments, the LIP2 gene comprises a polynucleotide sequence having at least 70% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity, or 100% sequence identity to the sequence set forth in SEQ ID NO: 2; the LIP5 comprises a polynucleotide sequence having at least 70% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity, or 100% sequence identity to the sequence set forth in SEQ ID NO: 4; the GCV3 gene comprises a polynucleotide sequence having at least 70% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity, or 100% sequence identity to the sequence set forth in SEQ ID NO: 6; the LPA gene comprises a polynucleotide sequence having at least 70% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity, or 100% sequence identity to the sequence set forth in SEQ ID NO: 8; the SAM1 gene comprises a polynucleotide sequence having at least 70% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity, or 100% sequence identity to the sequence set forth in SEQ ID NO: 10 and/or the SAM2 gene comprises a polynucleotide sequence having at least 70% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity, or 100% sequence identity to the sequence set forth in SEQ ID NO: 12.
In a second aspect, the invention provides a recombinant expression vector comprising one or more heterologous lipoic acid pathway genes operably linked to a promoter according to any aspect of the invention, wherein an expressed protein is located to the mitochondria.
In some embodiments, the promoter is a constitutive promoter.
In a third aspect, the invention provides a method of producing free lipoic acid in a genetically engineered cell, comprising the steps:
In some embodiments, the medium is supplemented with cysteine at a concentration of at least 0.05 mg/ml, at least 0.1 mg/ml, at least 0.2 mg/ml, at least 0.5 mg/ml or in the range from 0.05 mg/ml to 0.7 mg/ml, preferably in the range 0.1 mg/ml to 0.4 mg/ml.
In some embodiments, the method further comprises isolating said free lipoic acid.
In a preferred embodiment, the cell is a bacterium or a yeast cell.
More preferably, the cell is Saccharomyces cerevisiae.
Bibliographic references mentioned in the present specification are for convenience listed in the form of a list of references and added at the end of the examples. The whole content of such bibliographic references is herein incorporated by reference. Any discussion about prior art is not an admission that the prior art is part of the common general knowledge in the field of the invention.
Certain terms employed in the specification, examples and appended claims are collected here for convenience.
It must be noted that as used herein and in the appended claims, the singular forms “a”, “an”, and “the” include plural reference unless the context clearly dictates otherwise.
As used herein, the term “comprising” or “including” is to be interpreted as specifying the presence of the stated features, integers, steps or components as referred to, but does not preclude the presence or addition of one or more features, integers, steps or components, or groups thereof. However, in context with the present disclosure, the term “comprising” or “including” also includes “consisting of”. The variations of the word “comprising”, such as “comprise” and “comprises”, and “including”, such as “include” and “includes”, have correspondingly varied meanings.
The terms “nucleotide”, “nucleic acid” or “nucleic acid sequence”, as used herein, refer to an oligonucleotide, polynucleotide, or any fragment thereof, to DNA or RNA of genomic or synthetic origin which may be single-stranded or double-stranded and may represent the sense or the antisense strand, to peptide nucleic acid (PNA), or to any DNA-like or RNA-like material.
As used herein, the term “operably linked” means that the components to which the term is applied are in a relationship that allows them to carry out their inherent functions under suitable conditions. For example, a control sequence which is “operably linked” to a protein coding sequence is ligated thereto, so that expression of the protein coding sequence is achieved under conditions compatible with the transcriptional activity of the control sequences. By way of an example, a first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Generally, operably linked DNA sequences are contiguous and, where necessary to join two protein-coding regions, in the same reading frame.
The terms “amino acid” or “amino acid sequence,” as used herein, refer to an oligopeptide, peptide, polypeptide, or protein sequence, or a fragment of any of these, and to naturally occurring or synthetic molecules. Where “amino acid sequence” is recited herein to refer to an amino acid sequence of a naturally occurring protein molecule, “amino acid sequence” and like terms are not meant to limit the amino acid sequence to the complete native amino acid sequence associated with the recited protein molecule.
As used herein, the terms “polypeptide”, “peptide” or “protein” refer to one or more chains of amino acids, wherein each chain comprises amino acids covalently linked by peptide bonds, and wherein said polypeptide or peptide can comprise a plurality of chains noncovalently and/or covalently linked together by peptide bonds, having the sequence of native proteins, that is, proteins produced by naturally-occurring and specifically non-recombinant cells, or genetically-engineered or recombinant cells, and comprise molecules having the amino acid sequence of the native protein, or molecules having deletions from, additions to, and/or substitutions of one or more amino acids of the native sequence. A “polypeptide”, “peptide” or “protein” can comprise one (termed “a monomer”) or a plurality (termed “a multimer”) of amino acid chains.
Media suitable for lipoic acid biosynthesis include LB broth, YPD, 2YT, and any other suitable culture media. The culture medium may include antibiotics such as ampicillin, kanamycin, chloramphenicol, Isopropyl p-D-1-galactopyranoside (IPTG), and L-arabinose. A person skilled in the art would know appropriate concentrations for each component.
A vector can include one or more catalytic enzyme nucleic acid(s) in a form suitable for expression of the nucleic acid(s) in a host cell. Preferably the recombinant expression vector includes one or more regulatory sequences operatively linked to the nucleic acid sequence(s) to be expressed. The term “regulatory sequence” includes promoters, enhancers, ribosome binding sites and/or IRES elements, and other expression control elements (e.g., polyadenylation signals). The design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, and the like. The expression vectors of the invention can be introduced into host cells to thereby produce proteins or polypeptides, including fusion proteins or polypeptides, encoded by nucleic acids as described herein (e.g., catalytic enzyme proteins).
The recombinant expression vectors of the invention can be designed for expression of catalytic enzyme proteins in prokaryotic or eukaryotic cells, more particularly prokaryotic cells. For example, polypeptides of the invention can be expressed in bacteria (e.g., cyanobacteria) or yeast cells. Suitable host cells are discussed further in Goeddel, (1990) Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif.Having now generally described the invention, the same will be more readily understood through reference to the following examples which are provided by way of illustration, and are not intended to be limiting of the present invention.
A person skilled in the art will appreciate that the present invention may be practiced without undue experimentation according to the methods given herein. The methods, techniques and chemicals are as described in the references given or from protocols in standard biotechnology and molecular biology textbooks.
E. coli TOP10 (Invitrogen) and Luria-Bertani (Becton, Dickinson and Company) were used for cloning experiments unless otherwise stated. 100 mg/L ampicillin was used for selection of positive colonies where applicable. The yeast strain S. cerevisiae BY4741 (ATCC) was used for genetic engineering for lipoic acid production.
S. cerevisiae BY4741 wild-type and mutant strains were cultured in rich medium YPD/YPGR (1% yeast extract, 2% peptone, and 2% D-glucose or 2% galactose with 1% raffinose), synthetic minimal medium lacking uracil SC-U (0.67% yeast nitrogen base, 0.192% uracil dropout and 2% D-glucose), medium lacking lysine SC-L (0.67% yeast nitrogen base, 0.18% lysine dropout and 2% D-glucose), medium lacking leucine SC-LE (0.67% yeast nitrogen base, 0.16% leucine dropout and 2% D-glucose), or medium lacking both leucine and uracil SC-LU (0.67% yeast nitrogen base, 0.154% leucine and uracil dropout, and 2% D-glucose). 2% agar was supplemented for making solid media. Yeast growth media components were purchased from Sigma-Aldrich, MP Biomedicals and BD (Becton, Dickinson and Company). 5-Fluoroorotic acid (5-FOA, Fermentas) or geneticin (G418, PAA Laboratories) was used for selection. Cysteine (0.2 mg/mL) and ferrous sulfate (0.2 mg/mL) (Sigma-Aldrich) were supplemented into growth culture where necessary. Yeast cells were cultivated at 30° C. in flasks and shaken at 225 rpm.
EfLPA gene (GenBank Accession No. AY735444) was codon-optimized for S. cerevisiae and synthesized by Integrated DNA Technologies. EfLPA genes with and without mitochondrial targeting peptide (MTP) sequence were ligated between PGAL1 promoter and TCYC1 terminator, which were amplified from the S. cerevisiae genomic DNA. EfLPA expression cassettes with and without MTP were inserted to the vector pRS41K (Euroscarf), resulting in plasmids pRS41K-PGAL1-mEfLPA-TCYC1 and pRS41K-PGAL1-EfLPA-TCYC1, respectively. The plasmids pRS41K-PGAL1-mEGFP-TCYC1 and pRS41K-PGAL1-EGFP-TCYC1 were similarly constructed for EGFP with and without MTP, respectively. The constructed recombinant plasmids are listed in Table 1. The list of primers used was shown in Table 2.
E. coli Top10
S. cerevisiae
TCACGCATTTTTTTCTTTTGC
Chromosomal integration of the expression cassettes PTEF1-GCV3-TCYC1, PTEF1-KGD2-TKGD2 and PTEF1-LAT1-TADH1 into the LYS2 site were conducted based on the method previously described by Sadowski et al. (Sadowski et al., Yeast 24: 447-455 (2007)), where the integrative vector pIS385 (Euroscarf) containing URA3 selectable marker was used for integration. In addition, the cassettes PTEF1-LIP2-TLIP2 and PPGI1-LIP5-TLIP5 were integrated into intergenic site CS6 while PADH1-mSAM1-TSAM1 and PADH1-mSAM2-TSAM2 were integrated into intergenic site CS8 (Xia et al., ACS Synthetic Biology 6: 276-283 (2017)) based on Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and CRISPR-associated (Cas) system previously established (DiCarlo et al., Nucleic Acids Research 41: 4336-4343 (2013)). To clone GCV3, LAT1, KGD2, LIP2, LIP5, SAM1 and SAM2, genomic DNA of S. cerevisiae was used as the PCR template. All proteins abovementioned were located to the mitochondria through its native MTP (for Gcv3p, Lat1p and Kgd2p) or MTP from yeast cytochrome c oxidase subunit IV (COX4) (for mEfLPA, mSam1p and mSam2p) (Maarse et al., The EMBO Journal 3: 2831-2837 (1984)). Hexa-histidine tag was added to either the C- or N-terminus of these proteins for expression analysis. Oligonucleotide primers used are listed in Table 2.
Cells were pre-cultured in 5 ml yeast extract peptone dextrose (YPD) medium overnight and then diluted in 100 ml YPD medium using 500 ml flask to achieve an initial OD600 of 0.4. After growth for 18 h, cells were harvested by centrifugation. Cell pellets were re-suspended in 25 ml lysis buffer (0.3 M NaCl, 50 mM sodium phosphate, pH 6.5). Cells were lysed with a high-pressure homogenizer (EmulsiFlex-C3, AVESTIN, Inc.) at 25000 psi. The soluble cell lysate was collected by centrifugation and mixed an equal volume of 8 M Guanidine hydrochloride. 300 μl final products were injected into Agilent 1260 Infinity binary HPLC (Agilent). The proteins were resolved with an mRP-C18 High-Recovery Protein column (Agilent) at a solvent flow rate of 1.5 ml/min and column temperature of 80° C. The mobile phases A and B were 0.1% trifluoroacetic acid/water and 0.1% trifluoroacetic acid/acetonitrile respectively. The proteins were eluted with the following gradient: 0-1 min (10%-30% B), 1-12 min (30%-50% B), 12-13 min (50%-80% B), 13-14 min (80% B), 14-15 min (80%-10% B) and 15-17 min (10% B). Protein collection started from 1 min and 12 successive 1-min fractions were collected. The proteins were dried overnight in a Speedvac concentrator (Thermo Fisher Scientific). Each fraction of proteins was re-suspended with 50 μl 0.5 M triethylammonium bicarbonate with 1 μg Glu-C(Promega). The mixture was incubated overnight.
7 μl digested peptides was loaded into Agilent 1260 infinity HPLC-Chip/MS System (Agilent) equipped with a PortID-Chip-43 (II) column (Agilent). A linear gradient of acetonitrile was used to elute the peptides from the HPLC-Chip system at a consistent flow rate of 0.35 μl/min. For LC separation, 0.2% formic acid/water (mobile phase A) and 0.2% formic acid/acetonitrile (mobile phase B) were used. The samples were eluted with the following gradient through a nano pump: 0-1 min (7%-10% B), 1-35 min (10%-30% B), 35-37 min (30%-80% B), 37-38 min (80% B), 38-40 min (80%-7% B) and 40-43 min (7% B). The eluted samples were directly infused into a mass spectrometer for detection. The mass spectra were scanned in the range of 100-1600 m/z with a scan rate of 3 spectra per second. The MS/MS scan range is 80-2000 m/z with a scan rate of 4 spectra per second. Mass data was collected in positive ion mode at a fragmentor voltage of 175 V and skimmer voltage of 65 V.
The SPIDER feature of PEAKS 8 software (Bioinformatics Solutions Inc., Waterloo, Canada) (Zhang et al., Molecular & Cellular Proteomics: MCP 11: M111.010587 (2012)) was used to identify the peptides with PTMs based on mass difference. The yeast peptides were searched with the following search parameters. The precursor mass error tolerance was 100 ppm (part-per-million) while the fragment mass error tolerance was 0.1 Da. The fixed PTM was carbamidomethylation(C) (+57.02) and variable PTMs were lipoyl (K) (+188.03), octanoyl (TS) (+126.10), oxidation (M) (+15.99) and oxidation (HW) (+15.99). The peptide and protein identification reliability score (−10lgP, where P is the probability of identification) was set at a threshold of 15 and 20 respectively, corresponding to confident identifications.
Protein modeling for structure visualization SWISS-MODEL (Waterhouse et al., Nucleic Acids Research 46: W296-W303 (2018)) was used to build the 3D structure models of Gcv3p, Kgd2p and Lat1p proteins from their amino acid sequences using homology modelling techniques. The structures were predicted based on templates available in the SWISS-MODEL template library (SMTL) which aggregates information of experimental structures from Protein Data Bank (PDB). PyMOL Molecular Graphics System (Schrödinger, Inc., New York, USA) (Schrödinger, “The PyMOL Molecular Graphics System, Version 1.8” (2015)) was used to observe the structures.
Template homologue proteins with 41%, 37% and 48% sequence identity were used for modelling of Gcv3p, Kgd2p and Lat1p, respectively. The template protein for Gcv3p is glycine cleavage system protein H from Mycobacterium tuberculosis (PDB chain id: 3hgb.1.A), while for Kgd2p and Lat1p, only the N-termini (lipoyl domains) were modelled due to the lack of templates with crystal structure of full length. The template for the N-terminus (lipoyl domain) of Kgd2p is the lipoyl domain of E2 component of 2-oxoglutarate dehydrogenase complex in Azotobacter vinelandii (PDB chain id: 1ghj.1.A). The N-terminus of Lat1p (lipoyl domain) was modelled using the dihydrolipoyllysine-residue acetyltransferase component of the pyruvate dehydrogenase complex in Homo sapiens (PDB chain id: 1y8n.1.B).
Cells were pre-cultured in 5 ml medium overnight and then diluted in 50 ml induction medium using 200 ml flask to achieve an initial OD600 of 0.4. After overnight cell growth, the yeast cells were harvested by centrifugation. The cell pellets were re-suspended in lysis buffer (0.5 M NaCl, 20 mM sodium phosphate, 20 mM imidazole, pH 6.8) and lysed with a high-pressure homogenizer (EmulsiFlex-C3, AVESTIN, Inc.) at 25000 psi. After centrifugation, the insoluble protein and cell debris were separated from the soluble protein. To check protein expression, the soluble protein was boiled with Laemmli sample buffer (Bio-Rad) and separated on an SDS-polyacrylamide gel. The proteins in the gels were transferred onto western blotting membrane and using HRP conjugated anti-6x His-tag antibody (ThermoFisher Scientific) as described previously (Chen et al., Biotechnology for Biofuels 6: 21 (2013)). To detect protein expressed in the mitochondria, mitochondrial proteins were extracted using yeast mitochondria isolation kit (Biovision). The extracted proteins will be boiled with Laemmli sample buffer and detected through western blotting as described.
To purify the proteins, the soluble proteins were incubated with Nickel-IMAC resin (GE Healthcare) overnight for protein binding. After protein binding and washing, the His-tagged proteins were eluted with elution buffer (0.5 M NaCl, 20 mM sodium phosphate, 300 mM imidazole, pH 6.8). Protein concentrator (Thermo Scientific) was used to exchange the elution buffer with PBS buffer for downstream protein activity test.
The extraction and detection of free lipoic acid using the LC-MS/MS method developed by Chng et al. (Chng et al., Journal of Pharmaceutical and Biomedical Analysis 51: 754-757 (2010)) with modifications. Equal volume of acetonitrile was added to the supernatant of cell culture or lysate. The mixture was vortex-mixed for 2 min. After cooling at −30° C. for 30 min, the upper phase containing lipoic acid was transferred to a clean tube for evaporation to dryness. The residue was reconstituted with 200 μl of 50% acetonitrile in water. The extracted lipoic acid sample was injected into an LC-MS/MS system (Agilent 1290 liquid chromatograph and Agilent 6550 iFunnel Q-TOF) in negative mode. Chromatographic separation was achieved with an Agilent Eclipse Plus C18 column (2.1×100 mm, 1.8 μm, Agilent) at a flow rate of 0.7 ml/min by gradient solution at 0-5.8 min (80%-68% A), 5.8-6.5 min (68%-15% A) and 6.5-7 min (15%-95% A). Mobile phase A is 0.1% acetic acid (pH 4 adjusted with ammonia hydroxide solution) and mobile phase B is acetonitrile. Nebulizer was set at 40 psig, while sheath gas flow rate is 11 l/min. The optimized collision energy for lipoic acid is 8 eV. Quantification was achieved by using 2-propylvaleric Acid (Tokyo Chemical Industry Co., Ltd.) as an internal standard.
Gas chromatography-mass spectrometry (GC-MS) was also used to confirm the identity of lipoic acid. Briefly, HPLC grade ethyl acetate (Sigma) was added to either the supernatant of the cell culture or lysate to extract lipoic acid. The mixture was separated into two phases by centrifugation. The upper phase containing lipoic acid was mixed with N,O-bis(trimethylsilyl)trifluoroacetamide (BSTFA) containing 1% trimethylchlorosilane at a ratio 4:1. The derivatized lipoic acid was analyzed using GC-MS under the following conditions. An HP-5 ms column (30 m by 0.25 mm; 0.25 μm film; Agilent) was used with a helium flow rate set to 1 ml/min. Injections of 1 μl were carried out under splitless injection condition with the inlet set to 250° C. The GC temperature profile was as follows: an initial temperature of 45° C. was maintained for 2 min, followed by ramping to 280° C. at a rate of 10° C./min, where the temperature was held for 3.5 min. The mass spectrometer detector was scanned from 30 to 800 amu in the electron ionization (EI) mode. To aid peak identification, authentic lipoic acid (Sigma) standard was used as reference.
S. cerevisiae BY4741 cells carrying the plasmids pRS41K-PGAL1-EGFP-TCYC1 and pRS41K-PGAL1-mEGFP-TCYC1 were grown to early logarithmic phase in induction medium (YPGR with 200 mg/L G418). The cells were harvested and mounted on a poly-L-lysine-coated glass slide. EGFP fluorescence was visualized with a fluorescent microscope (Leica DMi8).
Proteomic analysis and characterization of lipoylated proteins as substrates for free lipoic acid biosynthesis
To engineer the yeast for free lipoic acid biosynthesis, we first aimed to evaluate the availability of the various forms of lipoate-bound proteins and understand their formation process. We hypothesized that this would facilitate our selection of a suitable lipoylated protein as substrate for subsequent enzymatically cleavage by EfLPA at the amide linkage to release free lipoic acid. Lipoic acid exists covalently bound to proteins via an amide linkage in S. cerevisiae. It was hypothesized that its biosynthesis begins with the transfer of an octanoyl moiety from octanoyl-ACP to the apo form of lipoate-dependent proteins, followed by modification of the octanoyl moiety by insertion of two sulfur atoms (Schonauer et al., Journal of Biological Chemistry 284: 23234-23242 (2009)). As lipoic acid is mainly bound to three proteins, namely Gcv3p, Lat1p and Kgd2p, we sought to focus our analysis on these proteins through LC-MS/MS to better our understanding of the protein lipoylation mechanism.
To investigate the lipoylation of Gcv3p, Lat1p and Kgd2p, we extracted the total protein from S. cerevisiae and separated the proteins into 12 fractions by HPLC with reverse phase column to reduce the complexity of our protein samples. Instead of using trypsin and chymotrypsin reported previously to generate long peptide fragments (Gey et al., PLoS one 9:e103956 (2014)), in this study, each protein sample was digested with Glu-C leading to shorter peptides which gives better precision. The digested peptide mixtures were analyzed by LC-MS/MS. In total, 2,713 peptides were identified based on their m/z value and MS/MS spectra. As shown in
In addition to lipoylated peptides, we also observed octanoylated peptides in Gcv3p that likely originated from precursors of lipoate-proteins. Detection of two singly charged peptides with m/z 833.4583 and 833.4628 indicates single octanoyl modification of the Gcv3p fragment at the S100 (serine100) (100SVKSASE106; SEQ ID NO: 43) or S103 position (100SVKSASE106; SEQ ID NO: 44), respectively (
To elucidate the protein structural characteristics and visualize the locations of the octanoylation and lipolylation sites, we predicted the structures of Gcv3p, Kgd2p and Lat1p by homology modeling (
Free lipoic acid is produced by enzymatic cleavage of the amide bond linking the lipoyl moiety to the lysine of lipoate-dependent proteins with a lipoamidase. EfLPA from E. faecalis was previously shown to release lipoic acid from lipoate-modified proteins in E. coli (Spalding and Prigge, PLoS one 4: e7392 (2009)). Lipoic acid is mainly bound to three proteins, namely Gcv3p, Lat1p and Kgd2p in yeast as demonstrated in
To test the catalytic activity of EfLPA towards lipoylated proteins from yeast, EfLPA with hexa-histidine tag was expressed under the strong galactose-inducible PGAL1 promoter from a low copy-number plasmid. Lipoate-bound proteins (i.e. Gcv3p, Kgd2p and Lat1p) fused with a hexa-histidine tag were expressed individually under the strong constitutive promoter PTEF1 from the genome. As shown in
To determine whether EfLPA possesses broad-range lipoamidase activity towards lipoylated proteins from yeast, purified Gcv3p, Kgd2p and Lat1p proteins were incubated with purified EfLPA individually at 37° C. for 2 h. The extracted products from the enzymatic reaction mixtures were analyzed by LC-MS/MS. No lipoic acid was detected in the control reaction mixture containing EfLPA, Gcv3p, Kgd2p or Lat1p only. Interestingly, no lipoic acid was observed in the reaction mixtures containing EfLPA with Kgd2p or Lat1p individually. Only the reaction of EfLPA with Gcv3p resulted in a peak with m/z 205.0360 (
Taken together, the in vitro results show that Gcv3p, being a better substrate for EfLPA compared to Lat1p and Kgd2p, is the most suitable protein substrate out of the three candidates for subsequent pathway engineering to optimize free lipoic acid biosynthesis. Moreover, Gcv3p is a smaller protein than Kgd2p and Lat1p (19 kDa, 50 KDa and 52 kDa, respectively), and thus its overexpression utilizes less resource than the latter proteins. Furthermore, unlike the formation of lipoate-Gcv3p, lipoylation of Kgd2p and Lat1p requires an additional enzyme, i.e. Lip3p, which might reduce the efficiency of lipoylation and increase metabolic burden if LIP3 overexpression is additionally required. In summary, we established that EfLPA is functionally expressed in S. cerevisiae and has activity on Gcv3p, which we therefore selected as the preferred lipoylated protein substrate. These enzymes were employed for subsequent engineering of S. cerevisiae to overproduce free lipoic acid in vivo.
As mentioned, lipoic acid synthesis occurs in the mitochondria of yeast. To enable lipoic acid biosynthesis in vivo, EfLPA must be translocated to the mitochondria where it hydrolyzes lipoic acid from lipoylated protein substrates. To this end, a 29-amino-acid mitochondrial targeting peptide (MTP) from the yeast cytochrome c oxidase subunit IV (COX4) (Maarse et al., The EMBO Journal 3: 2831-2837 (1984)) was explored for translocating proteins to the mitochondria. As shown in
We evaluated the in vivo activity of the EfLPA in mitochondria by quantifying the lipoic acid concentrations in cell cultures grown for 3 d. We found that the wild-type BY4741 with empty plasmid and BY4741 expressing EfLPA without MTP produced no detectable lipoic acid, whilst the BY4741-mEfLPA strain expressing EfLPA in the mitochondria produced free lipoic acid at 10.1 μg/L (
The overall genetic engineering for lipoic acid production in vivo is shown in
The catalytic enzyme Lip2p, an octanoyltransferase, has been demonstrated to convert apo-Gcv3p to octanoyl-Gcv3p while another catalytic enzyme Lip5p, a lipoyl synthase, catalyzes the conversion of octanoyl-Gcv3p to lipoyl-Gcv3p (Hermes and Cronan, Yeast 30: 415-427 (2013)) (
Another possible rate-limiting factor for lipoic acid production in yeast is the availability of cofactors, particularly S-adenosylmethionine (SAM), which is required for sulfurization of the octanoyl moiety. Homologous lipoyl synthase from E. coli uses radical SAM chemistry to perform the insertion of two sulfurs into the octanoyl moiety, a process that requires both the cofactor SAM and the iron-sulfur clusters in the lipoyl synthase (Cicchillo et al., Biochemistry 43: 6378-6386 (2004)). Radical intermediates are generated from SAM to abstract hydrogen atoms from C-6 and C-8 of the octanoyl moiety, allowing for subsequent sulfur insertion by a mechanism involving carbon-centered radicals. Iron-sulfur cluster in the lipoyl synthase provides an electron during the cleavage of SAM for radical generation and also may act as the source for sulfur atoms during lipoylation (Cicchillo and Booker, Journal of the American Chemical Society 127: 2860-2861 (2005)). Therefore, increasing the availability of SAM and functional iron-sulfur clusters may drive the formation of lipoyl moiety. In S. cerevisiae, SAM can be generated from methionine and ATP by the lipoyl synthases Sam1p and Sam2p (Marobbio et al., The EMBO Journal 22: 5975-5982 (2003); Dato et al., Microbial Cell Factories 13: 147 (2014)). To increase SAM availability by regeneration from methionine and ATP, SAM1 and SAM2 were fused with MTP for mitochondria translocation and overexpressed under the weak PADH1 promoter. Overexpression of the mitochondrial mSAM1 or mSAM2 increased lipoic acid production to 14.8 μg/L and 17.0 μg/L, respectively (
While we have identified a few rate-limiting steps in the lipoic acid production pathway, there is still much space for improvement to enhance lipoic acid production. To further boost the titer of lipoic acid, ion-sulfur cluster biogenesis and SAM availability, which are limiting factors of lipoic acid bio-production, can further be engineered in the future. In addition, to generate a molecule of lipoic acid, a molar equivalent of the precursor octanoyl-ACP is required (
In this study, we aimed to develop a bio-based method for environmentally friendly lipoic acid production by metabolic engineering of S. cerevisiae. To achieve this goal, we sought to (i) understand the lipoylation process in S. cerevisiae, (ii) characterize the function of EfLPA towards lipoylated proteins from yeast, (iii) employ EfLPA to enable S. cerevisiae to produce free lipoic acid in vivo and (iv) improve lipoic acid production using metabolic engineering strategies. We first confirmed the presence of protein-bound lipoate through LC-MS/MS. Using homology modelling techniques, the protein structure of Gcv3p, Kgd2p and Lat1p were predicted and the residues for modification were found to be solvent-exposed, and hence accessible to enzymes acting on these residues. Through in vitro activity analysis, EfLPA was validated to release lipoic acid from yeast lipoyl-Gcv3p, hence demonstrating the first reported functional expression of EfLPA in yeast for releasing lipoic acid from lipoate-bound yeast protein. Subsequently, overexpression of EfLPA in the mitochondria led to lipoic acid production in vivo, thus accomplishing unprecedented free lipoic acid biosynthesis in the yeast S. cerevisiae. To enhance lipoic acid production, metabolic engineering approaches, including overexpression of pathway enzymes and regeneration of cofactors, were employed and the titer of lipoic acid production in S. cerevisiae was boosted by nearly 2.9-fold to 29.2 μg/L. Collectively, the protein analysis, enzyme characterization, structure modeling and combinatorial metabolic engineering approaches in this study provided a better understanding of the lipoic acid production pathway and revealed strategies to improve it. We envisage that the knowledge gained from this study will provide insights on lipoic acid biosynthesis in S. cerevisiae and spearhead future efforts in lipoic acid production in yeast.
| Number | Date | Country | Kind |
|---|---|---|---|
| 10202001884X | Mar 2020 | SG | national |
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/SG2021/050103 | 3/2/2021 | WO |
