Patent Application
20100166784
A paper copy of the sequence listing and a computer readable form of the same sequence listing are appended below and herein incorporated by reference. The information recorded in computer readable form is identical to the written sequence listing, according to 37 C.F.R. 1.821 (f).
The invention encompasses methods and compositions for modulating Th17 cell development.
T helper (Th) 17 and regulatory T (Treg) cells are recently described subsets of CD4+T cells that play critical opposing roles in a variety of inflammatory disorders. Pro-inflammatory Th17 cells are characterized by the production of a distinct profile of effector cytokines, including IL-17 (or IL-17A), IL-17F, and IL-6, whereas anti-inflammatory Treg cells play an important role in the preservation of self-tolerance and prevention of autoimmunity.
One aspect of the present invention encompasses a method of modulating an immune response. The method comprises modulating Th17 cell development.
Another aspect of the present invention encompasses a method of modulating Th17 cell development. The method comprises modulating Batf expression.
Yet another aspect of the present invention encompasses an isolated nucleic acid comprising a Batf binding site.
Other aspects and iterations of the invention are described more thoroughly below.
The application file contains at least one photograph executed in color. Copies of this patent application publication with color photographs will be provided by the Office upon request and payment of the necessary fee.
The present invention encompasses a method to modulate the development of Th17 or Treg cells. As such, the present invention provides methods of modulating an immune response in a host. In particular, the present invention provides a nucleic acid sequence that modulates the development of Th17 or Treg cells.
In one aspect, the present invention encompasses a nucleic acid sequence that Batf or Batf3 is capable of binding (“Batf binding site”). In some embodiments, the Batf binding site may be 20, 15, 10, 8, 7, 6, 5, 4, or 3 nucleotides long. In preferred embodiments, the Batf binding site may be 10, 9, 8, 7, 6, 5 or 4 nucleotides long. Binding of Batf or Batf3 to the Batf binding site initiates or increases transcription of a nucleic acid sequence operably linked to the Batf binding site. In an exemplary embodiment, the Batf binding site may be 7 nucleotides long. In some embodiments, the sequence of the Batf binding site may be WKHBDVT, wherein the letters represent the nucleotide codes assigned by the International Union of Biochemistry (IUB) Nomenclature Committee. In certain embodiments, the sequence of the Batf binding site may be a sequence in Table A. As Batf or Batf3 may have a preference for the different binding sites encoded by the sequence, sequences may be tailored to bind Batf or Batf3 at the desired strength to tailor the desired response. By way of non-limiting example, binding of Batf to the Batf binding site in the IL-17 promoter increases transcription of IL-17. For more details, see the examples.
In one embodiment of the invention, the Batf binding site may be operably linked to a nucleic acid sequence. For instance, in some embodiments, the Batf binding site may be operably linked to a promoter. A promoter may be positioned 5′ (upstream) or 3′ (downstream) of a nucleic acid sequence under its control. The distance between the promoter and a nucleic acid sequence may be approximately the same as the distance between that promoter and the native nucleic acid sequence it controls. In some embodiments, the Batf binding site may be operably linked to a natural promoter nucleic acid sequence in the cell. In other embodiments, the Batf binding site may be operably linked to a promoter derived from sources including viral, bacterial, fungal, plants, insects, and animals. A promoter may regulate the expression of a nucleic acid component constitutively, or differentially with respect to the cell, the tissue, or the organ in which expression occurs or, with respect to the developmental stage at which expression occurs, or in response to external stimuli such as physiological stresses, pathogens, metal ions, or inducing agents (i.e. an inducible promoter). Non-limiting representative examples of promoters may include the bacteriophage T7 promoter, bacteriophage T3 promoter, SP6 promoter, lac operator-promoter, tac promoter, SV40 late promoter, SV40 early promoter, RSV-LTR promoter, CMV IE promoter, SV40 early promoter or SV40 late promoter and the CMV IE promoter. Additionally, the promoter may be a CMV immediate early promoter/enhancer (pCMV) or the CMV enhancer/chicken β-actin promoter (pCAG).
The Batf binding site may also be operably linked to a reporter nucleic acid sequence. Non-limiting examples of suitable reporter proteins may include a fluorescent protein (e.g., green fluorescent protein, red fluorescent protein, and the like), a luciferase, alkaline phosphatase, beta-galactosidase, beta-lactamase, horseradish peroxidase, or variants thereof. Other examples of reporter nucleic acid sequences are known in the art.
In certain embodiments of the invention, the Batf binding site may be introduced into cells. The nucleic acid may be delivered to the cell using a viral vector or via a non-viral method of transfer. Viral vectors suitable for introducing nucleic acids into cells may include retroviruses, adenoviruses, adeno-associated viruses, rhabdoviruses, and herpes viruses. Non-viral methods of nucleic acid transfer may include naked nucleic acid, liposomes, and protein/nucleic acid conjugates. The exogenous nucleic acid that is introduced to the cell may be linear or circular, may be single-stranded or double-stranded, and may be DNA, RNA, or any modification or combination thereof.
In general, the exogenous nucleic acids are introduced into the eukaryotic cells by transfection. Methods for transfecting nucleic acids are well known to persons skilled in the art. Transfection methods may include, but are not limited to, viral transduction, cationic transfection, liposome transfection, dendrimer transfection, electroporation, heat shock, nucleofection transfection, magnetofection, nanoparticles, biolistic particle delivery (gene gun), and proprietary transfection reagents such as Lipofectamine, Dojindo Hilymax, Fugene, jetPEI, Effectene, or DreamFect.
Upon introduction to the cell, the exogenous nucleic acid may be integrated into a chromosome. In some embodiments, integration of the exogenous nucleic acid into a cellular chromosome may be achieved with a mobile element. Non-limiting examples of a mobile element may include a transposon or a retroelement. A variety of transposons are suitable for use in the invention. Examples of DNA transposons that may be used include the Mu transposon, a P element transposon from Drosophila, and members of the Tc1/Mariner superfamily of transposons such as the sleeping beauty transposon from fish. A variety of retroelements may be suitable for use in the invention and may include LTR-containing retrotransposons and non-LTR retrotransposons. Non-limiting examples of retrotransposons may include Copia and gypsy from Drosophila melanogaster, the Ty elements from Saccharomyces cerevisiae, the long interspersed elements (LINEs), and the short interspersed elements (SINEs) from eukaryotes. Suitable examples of LINEs may include L1 from mammals and R2Bm from silkworm.
In other embodiments, integration of the exogenous nucleic acid into a cellular chromosome may be mediated by a virus. Viruses that integrate nucleic acids into a chromosome may include adeno-associated viruses and retroviruses. Adeno-associated virus (AAV) vectors may be from human or nonhuman primate AAV serotypes and variants thereof. Suitable adeno-associated viruses may include AAV type 1, AAV type 2, AAV type 3, AAV type 4, AAV type 5, AAV type 6, AAV type 7, AAV type 8, AAV type 9, AAV type 10, or AAV type 11. A variety of retroviruses may be suitable for use in the invention. Retroviral vectors may either be replication-competent or replication-defective. The retroviral vector may be an alpharetrovirus, a betaretrovirus, a gammaretrovirus, a deltaretrovirus, an epsilonretrovirus, a lentivirus, or a spumaretrovirus. In a preferred embodiment, the retroviral vector may be a lentiviral vector. The lentiviral vector may be derived from human, simian, feline, equine, bovine, or lentiviruses that infect other mammalian species. Non-limiting examples of suitable lentiviruses may include human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV), and equine infectious anemia virus (EIAV). In an exemplary embodiment, the lentiviral vector may be an HIV-derived vector.
Integration of the exogenous nucleic acid into a chromosome of the cell may be random. Alternatively, integration of the exogenous nucleic acid may be targeted to a particular sequence or location of a chromosome. Typically, the general environment at the site of integration may affect whether the integrated exogenous nucleic acid is expressed, as well as its level of expression.
In some embodiments, the cells may be derived from the digestive system, the skeletal system, the muscular system, the nervous system, the endocrine system, the respiratory system, the circulatory system, the reproductive system, the integumentary system, the lymphatic system, or the urinary system. In preferred embodiments, the sample may be derived from the lymphatic system. In a more preferred embodiment, the sample may be immune cells derived from the lymphatic system. In some embodiments, the immune cells derived from the lymphatic system may be neutrophils, eosinophils, basophils, lymphocytes, monocytes, macrophages, or progenitor cells that produce these cells. In preferred embodiments, the immune cells derived from the lymphatic system may be lymphocytes, such as T cells, B cells or natural killer (NK) cells or progenitor cells that produce lymphocytes. In preferred embodiments, the immune cells derived from the lymphatic system may be T cells.
Methods for purification or enrichment of certain cell types from a sample are well known in the art and are discussed in Ausubel et al., (2003) Current Protocols in Molecular Biology, John Wiley & Sons, New York, N.Y., or Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. One skilled in the art will know which parameters may be manipulated to optimize purification or enrichment of cells of interest. Most commonly, cells are purified or enriched using immunoaffinity to antigens expressed on the surface of the cells. In short, the sample, consisting of a mixture of cells to be separated is incubated with a solid support, usually superparamagnetic beads that facilitate later steps. The solid support is coated with antibodies against a particular surface antigen, causes the cells expressing this antigen to attach to the solid support. If the solid support is superparamagnetic beads, the cells attached to the beads (expressing the antigen) can be separated from the sample by attraction to a strong magnetic field. The procedure may be used for positively selecting the cells expressing the antigen(s) of interest. In negative selection the antibody used is against surface antigen(s), which are known to be present on cells that are not of interest, therefore enriching the sample with the cells of interest.
In some aspects, one or more of the nucleic acid sequences described above may be introduced into and stably expressed in an animal. For instance, transgenic mice may be generated using procedures well known to those of skill in the art. In some embodiments, the introduced nucleic acid sequence may be randomly integrated into the chromosome of the animal. In other embodiments, the nucleic acid sequence is integrated at a specific site in the chromosome of the animal. Suitable animals may include commonly used laboratory animals, such as rodents.
In some aspects, the invention provides for modulation of an immune response by modulating Th17 cell development.
As demonstrated in the examples, modulating Batf or Batf3 expression may modulate the development of a Th17 cell. As used herein, the phrase “modulating Batf expression” refers to modulating the amount of Batf or Batf3 or the activity of Batf or Batf3. In certain embodiments, modulating Batf expression refers to modulating the amount of Batf or Batf3. In some embodiments, the amount of Batf or Batf3 may be increased. In other embodiments, the amount of Batf or Batf3 may be decreased. The amount of Batf or Batf3 may be modulated by modulating the expression of Batf or Batf3 respectively. Methods of modulating the expression of Batf may include modulating inducers of Batf or Batf3 expression. Non-limiting examples of Batf or Batf3 inducers may include STAT3, IL-6, leukemia inhibitory factor (LIF), and the EBV-encoded EBNA2. Batf expression may also be modulated by modulating expression of the Batf or Batf3 nucleic acid sequence at transcription or translation. For example, the nucleic acid sequence encoding the Batf or Batf3 polypeptide may be altered such that levels of functional messenger RNA (mRNA) (and, consequently, a functional polypeptide) are increased, decreased or not made. Alternatively, the mRNA may be altered such that levels of the polypeptide are increased, decreased or not made. Non-limiting examples of methods to modulate Batf or Batf3 transcription or translation may include RNA interference agents (RNAi) or gene targeting methods. Standard methods for modulating transcription or translation of a specific nucleic acid sequence are known to individuals skilled in the art. Guidance may be found in Current Protocols in Molecular Biology (Ausubel et al., John Wiley & Sons, New York, 2003) or Molecular Cloning: A Laboratory Manual (Sambrook & Russell, Cold Spring Harbor Press, Cold Spring Harbor, N.Y., 3rd edition, 2001).
In some embodiments, modulating Batf expression refers to modulating the activity of Batf or Batf3. As used herein, the phrase “modulating Batf or Batf3 activity” refers to modulating the activity of Batf or Batf3 by modulating the activity of the functional polypeptide complex containing Batf or Batf3. In some embodiments, modulating Batf or Batf3 activity may include modulating the activity of a Batf or Batf3 interaction partner. In other embodiments, modulating Batf or Batf3 activity may include modulating the level of Batf or Batf3 phosphorylation. Batf or Batf3 phosphorylation may be modulated by modulating Batf or Batf3 phosphorylation sites, for instance, serine 43, or by modulating the activity of kinases that phosphorylate Batf or Batf3. Batf or Batf3 activity may also be modulated by modulating Batf or Batf3 binding to the Batf binding site, or activation or transcription of nucleic acids functionally linked to the Batf binding site. Modulating Batf or Batf3 activity may be with an agonist or antagonist. An agonist or antagonist may be a molecule that inhibits or attenuates the biological activity of a Batf or Batf3 polypeptide. Non-limiting examples of suitable antagonists or agonists may include natural compounds, synthetic compounds, small organic compounds, nucleic acids, carbohydrates, peptides, peptide nucleic acids, peptidomimetics, antibodies, antisense oligonucleotides, or aptamer oligonucleotides. In one embodiment, a suitable antagonist or agonist may be an antibody. In another embodiment, a suitable antagonist or agonist may be a small molecule inhibitor. Batf or Batf3 activity may also be modulated by altering Batf or Batf3. For example, Batf or Batf3 may be altered by changing the number or sequence of phosphorylation sites on Batf or Batf3, altering the nucleic acid binding ability of Batf or Batf3, or altering the ability of Batf or Batf3 to interact with other polypeptides.
A microarray study comparing the nucleic acid expression of activated Batf+/+ and Batf−/−T cells revealed 110 nucleic acid sequences whose expression is highly dependent on Batf (Table 2). Modulating these Batf-dependent nucleic acids may modulate Th17 cell development. Therefore, in some embodiments, Th17 development may be modulated by modulating a nucleic acid sequence of Table 2. In a preferred embodiment, Th17 development may be modulated by modulating RORγt. In another preferred embodiment, Th17 development may be modulated by modulating RORα. In yet another preferred embodiment, Th17 development may be modulated by modulating the aryl hydrocarbon receptor (AHR). In another preferred embodiment, Th17 development may be modulated by modulating IL-22. In still another preferred embodiment, Th17 development may be modulated by modulating IL-17. In an additional preferred embodiment, Th17 development may be modulated by modulating DLGH2. In some embodiments, Th17 cell numbers may be modulated by modulating one or more of the sequences of Table 2. This may be done using standard pharmacotherapeutic techniques described above.
In some aspects of the invention, cell therapy techniques may be appropriate for modulating an immune response. Generally speaking, cell therapy describes the introduction of new cells into a tissue in order to treat a disease. As applied to the invention, immune cells may be harvested from a subject and modified as described above, and then reintroduced into the subject using techniques known in the art.
Yet another aspect of the present invention encompasses methods for modulating an immune response. In some embodiments, the immune response may be an autoimmune response. In other embodiments, the immune response may be an anti-tumor immune response. In certain embodiments, the immune response may be against a pathogen. In each of the above embodiments, the method comprises modulating Th17 cells, as described in section II above.
In one embodiment, the invention encompasses a method for modulating an autoimmune response. Generally speaking, the method comprises modulating Th17 cells, as described above. In particular, the method may comprise decreasing the development of Th17 cells. Non-limiting examples of autoimmune responses may include: acute disseminated encephalomyelitis (ADEM), Addison's disease, ankylosing spondylitis, antiphospholipid antibody syndrome (APS), autoimmune hemolytic anemia, autoimmune hepatitis, bullous pemphigoid, coeliac disease, dermatomyositis, diabetes mellitus type 1, goodpasture's syndrome, graves' disease, Guillain-Barré syndrome (GBS), Hashimoto's disease, idiopathic thrombocytopenic purpura, Lupus erythematosus, multiple sclerosis, myasthenia gravis, pemphigus vulgaris, pernicious anaemia, polymyositis, primary biliary cirrhosis, rheumatoid arthritis, Sjögren's syndrome, temporal arteritis (also known as “giant cell arteritis”), vasculitis, and Wegener's granulomatosis.
In particular embodiments, the automimmune response may be response against a transplanted organ. In other embodiments, the automimmune response may be a graft vs. host response.
In another embodiment, the invention encompasses a method for modulating an immune response against a pathogen. Typically, the method comprises modulating Th17 cells, as described above. During an immune response against a pathogen, Th17 cells promote inflammation and attract neutrophils. Hence, in a preferred embodiment, modulation of Th17 development may result in an increase in Th17 cell development.
Methods of modulating Th17 development are described above.
In yet another embodiment, the invention provides a method for modulating an anti-tumor immune response. The method generally comprises modulating Th17 development, as described above. Non-limiting examples of cancers that may be targeted by the invention, classified by the type of cell that resembles the tumor and, therefore, the tissue presumed to be the origin of the tumor may be a carcinoma such as breast, prostate, lung and colon cancer; a sarcoma such as bone cancer; lymphoma and leukemia; germ cell tumors such as testicular cancer; or blastic tumor or blastoma.
A further aspect of the invention provides a method to screen for modulators of Batf or Batf3. Typically, the method relies on Batf or Batf3 properties described in the invention, including binding of Batf or Batf3 to the Batf binding site and activation of transcription of nucleic acid sequences downstream of the binding sequence.
In some embodiments, screening for modulators of Batf or Batf3 may be performed in vitro by screening for modulators of Batf or Batf3 binding to the Batf binding site. Generally, these methods entail contacting a mixture of Batf or Batf3 and a nucleic acid containing the Batf binding site with a compound, and then measuring the binding.
In other embodiments, screening for modulators of Batf or Batf3 may be in a cell-based assay. In some embodiments, Batf or Batf3 activity may be measured by measuring expression of a nucleic acid target of Batf or Batf3. In other embodiments, Batf or Batf3 activity may be measured by measuring expression of a reporter nucleic acid controlled by Batf or Batf3 and introduced into cells or animals as described in section I. In such an assay, cells may be contacted with the compound and the activity of Batf or Batf3 may be measured by measuring expression of the nucleic acid controlled by the Batf binding site. Methods of measuring nucleic acid expression are known to a person skilled in the art. As Batf functions as part of a complex with other cellular polypeptides, these methods may identify compounds that inhibit Bat or Batf3f, another polypeptide required for the function of the Bat or Batf3f-containing complex, or the interaction of Batf or Batf3 with one of its partners.
Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which this invention belongs. The following references provide one of skill with a general definition of many of the terms used in this invention: Singleton et al., Dictionary of Microbiology and Molecular Biology (2nd ed. 1994); The Cambridge Dictionary of Science and Technology (Walker ed., 1988); The Glossary of Genetics, 5th Ed., R. Rieger et al. (eds.), Springer Verlag (1991); and Hale & Marham, The Harper Collins Dictionary of Biology (1991). As used herein, the following terms have the meanings ascribed to them unless specified otherwise.
“Th17 cells” refers to a discrete population of CD4+ helper T cells that has been described as the predominant source of IL-17. These cells have been named Th17 cells.
“Th17 cell development” refers to the cellular differentiation necessary for the development of a Th17 cell. A Th17 cell is ‘developed’ if it produces IL-17.
The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent techniques discovered by the inventors to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
A global survey of gene expression was used to identify transcription factors selectively expressed in various effector T cell subsets (
Since AP-1 regulates T cell differentiation and cytokine production, Batf−/− mice were generated to assess its role in effector T cells (
Batf−/− mice had no abnormalities in thymic or spleen cellularity, lymph node development (
Batf−/− mice exhibited a remarkably selective defect in one particular pathway of T cell differentiation (
To examine Batf overexpression, transgenic mice expressing FLAG-tagged Batf under the control of the CD2 promoter were generated. Batf-transgenic D011.10 T cells and CD8+T cells produced increased IL-17 when activated under TH17 conditions compared to non-transgenic T cells (
TH17 cells are the major pathogenic population in the model of experimental autoimmune encephalomyelitis (EAE). To test whether Batf−/− mice were susceptible to EAE, we immunized Batf+/+ and Batf−/− mice with myelin oligodendrocyte glycoprotein peptide 35-55 (MOG35-55) (
The loss of TH17 development in Batf−/− mice could result either from a defect within T cells or a defect in antigen-presenting cells. To distinguish these possibilities, we carried out an adoptive transfer study by injecting naïve Batf+/+CD4+T cells or a PBS control buffer into mice before MOG35-55 immunization (
Batf could control TH17 development either by regulating the expression of components of the IL-6, IL-21 or TGF-β signaling pathways, or by regulating induction of their downstream target genes. Batf−/−CD4+T cells showed normal levels of IL-6 receptor expression and IL-6-induced STAT3 phosphorylation (
Consistently, induction of IL-21, an early target of IL-6 signaling in CD4+T cells18, was significantly reduced in Batf−/− CD4+T cells activated under TH17 conditions (
To identify additional Batf targets, we performed DNA microarrays and quantitative RT-PCR comparing gene expression of Batf+/+ and Batf−/−T cells activated in the presence or absence of IL-6 and/or TGF-β (
Since RORγt acts directly on the IL-17 promoter, we tested whether forcing RORγt expression would rescue TH17 development in Batf−/−T cells. RORγt overexpression induced IL-17 production in Batf+/+T cells (
As part of our preliminary studies for this proposal, we have developed a comprehensive matrix of tissue specific transcriptional profiles to identify candidate genes important for T effector cell development. One example of a Batf-dependent gene that is induced by IL-6 in differentiating Th17 cells is DLGH2 guanylate kinase (
Among several newly discovered tumor suppressor genes, the discs large (Dlg) family represents a unique class of PDZ domain-containing membrane associated guanylate kinases (MAGUKs) that maintain cell polarity and regulate cell cycle progression. While mutations in the discs large gene lead to a loss of cell polarity and transformation of epithelial cells, very little is known about how Dlg proteins regulate lymphocyte signaling and development. We have recently reported that Dlg1 localizes to the distal pole complex in activated T cells and attenuates T cell responses (
We tested reporter activity of the IL-17 promoter in primary Batf+/+ and Batf−/−T cells (
Since Batf was required for IL-17, IL-21 and IL-22 expression (
Generation of Batf−/− mice. Murine Batf exons 1-2 were deleted by homologous recombination via a targeting vector constructed in pLNTK1 using a 1 kb genomic fragment (left arm) upstream of the Batf exon 1 and a 3.6 kb genomic fragment (right arm) downstream of exon 2. The left arm was generated by PCR from genomic DNA with the use of the following oligonucleotides: left arm forward (5′-ATTACTCGAGTGAAACAAACAGGCAGTCGCAGTG) (SEQ ID NO:3) and left arm reverse (5′-ATTACTCGAGCCTACTACCTTTCAGGGCTACTGC) (SEQ ID NO:4). The right arm was generated by PCR with the use of the following oligonucleotides: right arm forward (5′-ATTAGTCGACGCATTCTTCATGGTCCTTAGCCTTGG) (SEQ ID NO:5) and right arm reverse (5′-ATTAGTCGACCAGAGAATGAGAAATGTTGGAGG) (SEQ ID NO:6). EDJ22 embryonic stem cells were transfected with linearized targeting vector and targeted clones were identified by Southern analysis using probes A and B located 5′ to the left arm and 3′ to the right arm respectively. Probe A was generated using the oligonucleotides 5′-CAACTGGGTCTGAGTCAAGAGGT (SEQ ID NO:7) and 5′-CGTAGCCGCTGATTGTTTTAGAAC (SEQ ID NO:8) to generate a 531 by product. Probe B was generated using the oligonucleotides 5′-ACAGCTTGAACTTCAGAGCCCTCC (SEQ ID NO:9) and 5′-CACATTTAAGTCACAATAACACTGC (SEQ ID NO:10) to generate a 772 by product. The neomycin resistance cassette was deleted from successfully targeted clones by in vitro treatment of clones with Adeno-Cre virus and targeted clones with successful neo deletion were identified by Southern blot using probes A and B (
Visualization of lymph nodes. To visualize superficial inguinal lymph nodes mice were injected with 50 μl of 1% Evans Blue dye solution into each hind foot pad. After 1.5 hours mice were sacrificed and lymph nodes were visualized using a dissecting microscope.
Western analysis. Total splenocytes were stimulated with anti-CD3 for three days under TH17 conditions. Cells were then lysed in RIPA buffer, electrophoresed on 15% polyacrylamide gels and transferred to nitrocellulose. Affinity purified rabbit anti-murine Batf polyclonal serum (Brookwood Biomedical; Birmingham, Ala.) was generated by immunization with full length recombinant Batf protein. Equal protein loading was assessed by subsequent immunoblotting with antibody to β-actin (Santa Cruz Biotechnology).
Isolation of dendritic cells for flow cytometry. Spleens were isolated, cut into small pieces and digested with Collagenase B (Roche) and DNase I (Sigma) for 30 min at 37° C. Red blood cells were lysed by incubation with Red Blood Cell Lysis Buffer (Sigma) (1 minute at room temperature). Single cell suspensions were prepared by passing digested spleens through 35 μm nylon cell strainers (Fisher Scientific) and were stained with antibodies for analysis by Flow Cytometry.
Isolation of naïve T cells. Splenic single cells suspensions were generated and red blood cells were lysed by incubation with Red Blood Cell Lysis Buffer (Sigma) (1 minute at room temperature). Splenocytes were then negatively depleted of B220+ and CD8+ cells using magnetically labeled beads followed by depletion over LD columns (all Miltenyi Biotec). The depleted fraction was then stained with antibodies to CD4, CD62L and CD25 (all BDPharmingen) and CD4+CD62L+CD25− cells were sorted on a MoFlo cytometer. Sort purity was generally >98%. For some experiments, as indicated, CD4+T cells were isolated from spleens by incubation with anti-CD4 magnetic beads and selection via LS columns (Miltenyi Biotec) according to the manufacturer's recommendations.
Cell culture. For T cell differentiation assays, sorted naïve CD4+ CD62L+CD25−T cells were cultured at 0.5×106 cells/well in 48 well plates containing plate-bound anti-CD3 (from ascites) and soluble anti-CD28 (37.5; BioXcell; 4 μg/ml). Stimulation of cells without the addition of cytokines was defined as drift condition. Cultures were supplemented with anti-IL-4 (11B11; hybridoma supernatant), IFN-γ (Peprotech; 0.1 ng/ml) and IL-12 (Genetics Institute; 10 U/ml) for TH1; anti-IFN-γ (H22; BioXcell; 10 μg/ml), anti-IL-12 (Tosh; BioXcell; 10 μg/ml) and IL-4 (Peprotech; 10 ng/ml) for TH2; anti-IL-4, anti-IL-12, anti-IFN-γ, IL-6 (Peprotech; 20 ng/ml) and TGF-β (Peprotech; 0.5 ng/ml) for TH17 differentiation. In some experiments, cultures were supplemented with IL-1β (10 ng/ml), TNFα (10 ng/ml), IL-21 (50 ng/ml; all Peprotech), anti-IL-6 (MP5-20F3; eBioscience; 10 μg/ml), anti-TGF-β (1D11, R&D Biosystems, 10 μg/ml) or anti-IL-2 (JES6-1A12; BioXcell; 10 μg/ml) as indicated. For drift, TH1 and TH2 conditions cells were restimulated on day 7 with anti-CD3 and anti-CD28. Brefeldin A was added for the last 4 hours of stimulation. For TH17 conditions, cells were restimulated on day three or day seven after activation as indicated with Phorbol 12-myristate 13-acetate (PMA) (50 ng/ml; Sigma) and ionomycin (1 μM; Sigma) for 4 hours in the presence of Brefeldin A (1 μg/ml; Epicentre). Cells were then analyzed by intracellular cytokine staining and flow cytometry.
In some experiments, as indicated, magnetically purified CD4+T cells from D011.10 transgenic mice were activated with OVA (3 μM) and irradiated splenocytes in the presence of anti-IL-4, anti-IL-12, anti-IFN-γ, IL-6 and TGF-β (1 ng/ml) to induce TH17 differentiation.
To induce TH17 differentiation in total splenocytes, single cells suspensions from spleens were prepared and red blood cells were lysed. Total splenocytes were activated at 4×106 cells/well in 12 well plates containing plate-bound anti-CD3, anti-IL-4 (hybridoma supernatant), anti-IL-12 (10 μg/ml), anti-IFN-γ (10 μg/ml), IL-6 (20 ng/ml) and TGF-β (1 ng/ml). Cells were restimulated with PMA and ionomycin for 4 hours in the presence of Brefeldin A before intracellular cytokine staining and analysis by flow cytometry. For STAT3-phosphorylation assays magnetically purified CD4+T cells were stimulated with anti-CD3 and anti-CD28 in the presence of IL-6 or IL-21 (50 ng/ml) followed by intracellular staining and analysis by flow cytometry.
Isolation of Lamina Propria T cells. For isolation of lamina propria T cells, mice were sacrificed; small intestines removed, placed in cold DMEM media (10% FCS) and cleared of Peyer's patches and residual mesenteric fat tissue. Intestines were then opened longitudinally, cleared of contents and cut into 0.5 cm pieces. The pieces were washed multiple times in cold media and twice in ice cold Citrate BSA (CB-BSA) buffer followed by two 15 minute incubations in CB-BSA with agitation. After each incubation cells were vortexed to remove epithelial cells. The remaining intestinal pieces were then washed twice with cold media before digestion in media containing 75 U/ml Collagenase IV (Sigma) at 37° C. for 1 hour. The solution was vortexed at 20 min intervals to detach lymphocytes. After one hour the solution was filtered through a 35 μm strainer, the pieces were collected and digested a second time. Supernatants from both digestions were combined, washed once, suspended in the 70% fraction of a percoll gradient and overlaid with 37% and 30% percoll gradient fractions. Lymphocytes were collected at the 70-37% interface, washed once in PBS and stimulated with PMA/ionomycin for 3 hours before cells were stained for extracellular markers and intracellular cytokines.
Induction of EAE and disease scoring. Age and sex matched mice (7-10 weeks old) were immunized subcutaneously with 100 μg MOG35-55 peptide (Sigma) emulsified in CFA (IFA supplemented with 500 μg Mycobacterium tuberculosis) on day 0. On days 1 and 3, mice were injected with 300 ng Pertussis Toxin (List Biological Laboratories) intraperitonally (i.p.). Clinical scores were given on a scale of 1-5 as follows: 0, no overt signs of disease; 1, limp tail or hind limb weakness, but not both; 2, limp tail and hind limb weakness; 3, partial hind limb paralysis; 4, complete hind limb paralysis; 5, moribund state or death by EAE. Mice with a score of 4 were given 300 μl saline solution subcutaneously to prevent dehydration. Mice with a score of 5 were euthanized. Some mice died during the course of the experiment. Their score of 5 was included in the analysis for the remainder of the experiment. For T cell transfer experiments, CD4+T cells were isolated from splenic single cell suspensions by magnetic separation with anti-CD4 magnetic beads and positive selection via LS columns (Miltenyi Biotec). 1×107 MACS purified CD4+T cells were injected i.p. on day −4 followed by EAE induction on day 0 as described above.
Isolation of CNS lymphocytes. Brain and spinal cords were removed from mice after perfusion with 30 ml of saline solution. Single cell suspensions were prepared by dispersion through sterile 35μ nylon cell strainers (Fisher Scientific) and mixed at room temperature for 1 hr in HBSS containing 0.1% collagenase, 0.1 μg/ml TLCK (N-α-tosyl-L-lysine chloromethylketone hydrochloride), and 10 μg/ml DNaseI (all Sigma). The resulting suspension was pelleted, resuspended in the 70% fraction of a Percoll gradient and overlaid by additional 37% and 30% layers. The Percoll gradient separation was achieved by centrifugation for 20 min at 2000 rpm and lymphocytes were collected at the 70-37% interface. Subsequently cells were activated with PMA and ionomycin for 3-4 hours in the presence of Brefeldin A and intracellular cytokine staining was performed.
Real time PCR. Naïve CD4+CD62L+CD25−T cells were isolated by cell sorting and activated with plate-bound anti-CD3 and soluble anti-CD28 antibodies under TH17 conditions for 3 days, unless otherwise indicated. Total RNA was isolated from the indicated cells using Quiagen RNeasy Mini Kit and cDNA was synthesized using SuperscriptIII reverse transcriptase (Invitrogen). Real time PCR analysis was performed using ABI SYBR Green master mix according to the manufacturer's instructions on an ABI7000 machine (Applied Biosystems) using the relative standard curve method. The PCR conditions were 2 min at 50° C., 10 min at 95° C. followed by 40 2-step cycles of 15 s at 95° C. and 1 min at 60° C. Primers for RORγt (RORγt Forward 5′-CGCTGAGAGGGCTTCAC(SEQ ID NO:15), RORγt reverse 5′-GCAGGAGTAGGCCACATTACA) (SEQ ID NO:16), IL-21 (IL-21 forward 5′-ATCCTGAACTTCTATCAGCTCCAC (SEQ ID NO:17), IL-21 reverse 5′-GCATTTAGCTATGTGCTTCTGTTTC (SEQ ID NO:18)), IL-22 (IL-22 forward-5′CATGCAGGAGGTGGTACCTT (SEQ ID NO:19), IL-22 reverse-5′-CAGACGCAAGCATTTCTCAG (SEQ ID NO:20)), RORα (RORα forward 5′-TCTCCCTGCGCTCTCCGCAC(SEQ ID NO:21), RORα reverse 5′-TCCACAGATCTTGCATGGA (SEQ ID NO:22)), IRF-4 (IRF-4 forward 5′-GCCCAACAAGCTAGAAAG (SEQ ID NO:23), IRF-4 reverse: 5′-TCTCTGAGGGTCTGGAAACT (SEQ ID NO:24)) and HPRT as normalization control (HPRT forward 5′-AGCCTAAGATGAGCGCC(SEQ ID NO:25), HPRT reverse 5′-TTACTAGGCAGATGGCCACA (SEQ ID NO:26)) were used to evaluate relative gene expression.
Gene expression profiling. Naïve CD4+CD62L+CD25−T cells and CD4+CD62L+CD25+ regulatory T cells were isolated from C57BL/6 mice. Naïve CD4+CD62L+CD25−T cells were differentiated under TH1 and TH2 conditions for 7 days. After restimulation with anti-CD3 and anti-CD28 for 24 hours, TH1 and TH2 cells were sorted for IFN-γ and IL-4 production respectively using cytokine secretion assays (Miltenyi Biotec) according to the Manufacturer's recommendations. For gene expression profiling of TH17 cells, naïve CD4+CD62L+CD25−T cells were activated for 3 days with anti-CD3 and anti-CD28 in the presence of anti-IL-4, anti-IL-12, anti-IFN-γ, anti-IL-2, IL-6 and TGF-β (0.5 ng/ml). For gene expression analysis in Batf−/−T cells, naive CD4+CD62L+CD25−T cells from Batf+/+ and Batf−/− mice were activated for 3 days with anti-CD3 and anti-CD28 in the presence of either anti-IL-4, anti-IL-12, anti-IFN-γ, IL-6 and TGF-β (0.5 ng/ml); anti-IL-4, anti-IL-12, anti-IFN-γ, IL-6 and anti-TGF-β; anti-IL-4, anti-IL-12, anti-IFN-γ, anti-IL-6 and TGF-β or anti-IL-4, anti-IL-12, anti-IFN-γ, anti-IL-6 and anti-TGF-β. IL-2 was neutralized in all conditions. Total RNA was isolated from cells using Quiagen Rneasy Mini Kit. Biotinylated antisense cRNA was generated using two cycle target preparation kit (Affymetrix). After fragmentation, cRNA was hybridized to Affymetrix GeneChip Mouse Genome 430 2.0 Arrays. Data were normalized and expression values were modeled using DNA-Chip analyzer (dChip) software.
Retroviral infection and analysis. mRNA was isolated from 129SvEv total thymocytes using Quiagen RNAeasy Mini Kit and cDNA was amplified by SuperscriptIII (Invitrogen). Murine RORγt transcript was amplified using primers 5′-CTCGAGGTGTGCTGTCCTGGGCTAC (SEQ ID NO:27) and 5′-CTCGAGGGGAGACGGGTCAGAGGG (SEQ ID NO:28). Underlined nucleotides indicate XhoI overhangs used to clone RORγt into XhoI digested GFP-RV2. The retrovirus based reporter hCD4-pA-GFP-RV10 has been described previously and was modified as follows to generate hCD4-pA-GFP-RV-IL-17p. The 1021 by promoter region of murine IL-17a was generated by PCR from genomic 129SvEv DNA using primers 5′-AAGCTTGAACAGGAGCTATCGGTCC (SEQ ID NO:29) and 5′-AAGCTTGAGGTGGATGAAGAGTAGTGC (SEQ ID NO:30). Underlined nucleotides indicate overhangs containing HindIII restriction sites used to clone the resulting PCR product into hCD4-pA-GFP-RV. Retroviral vectors were packaged in Phoenix E cells as described previously 2. Magnetically purified CD4+T cells were infected with viral supernatants on days 1 and 2 after activation with anti-CD3 and anti-CD28. Three days after activation cells were restimulated with PMA/ionomycin in the presence of Brefeldin A and analyzed by intracellular cytokine staining and Flow Cytometry. For the experiments in
Statistical Analysis. A Student's unpaired two-tailed t-test was used to indicate statistically significant differences between indicated groups. Differences with a P value <0.05 were considered significant.
Electrophoretic mobility shift assays. Whole cell extracts were prepared from total splenocytes activated for three days with anti-CD3, TGF-β and IL-6 as described previously. For EMSA analysis the AP-1 consensus probe, RORE element in CNS2 of the IL-17 gene8 and −187 to −155 of the IL-17 promoter (top: GGTTCTGTGCTGACCTCATTTGAGGATG (SEQ ID NO:31) and bottom: AAAAGACTGGGTGAAATTTAGTTAAAG (SEQ ID NO:32)) were used after labeling with 32P-dCTP. The probe (2.5×104 cpm per reaction) was used along with 15 μg of total cell extracts and 1 ug poly diDC as described previously. For competitor-supershift assay, Batf binding to the AP-1 consensus probe was assessed by anti-FLAG supershift. Unlabeled probes from the IL-17a, IL-21 and IL-22 promoters (Table 3) were used to compete for Batf binding to the AP-1 consensus probe. Single stranded overhangs of the competitor oligos were not filled in. Sequences identified as competitors for Batf binding were used to determine the Batf consensus motif.
CONSENSUS program for determination of Batf binding motif. Sequences of the proximal promoter regions of IL-17, IL-21, and IL-22 identified as competitors for Batf binding in the competitor-supershift EMSA assay were input into CONSENSUS version v6d14. Default program parameters were applied, except for searching the reverse complement of the input sequences (c2) and uniform background nucleotide frequencies. The program was searching potential motif lengths from 5 to 15 using the expected frequency statistic (e-value) and the optimal motif length was determined as 7. The corresponding weight matrix, with a sample size adjusted information content of 4.467, was chosen from the final cycle. The enrichment of the binding motif in the input set was verified using PATSER v3e15. Using the numerically calculated cutoff score, 38/40 of the input training sequences were identified as containing the motif.
atf Chromatin immunopreciptiation (ChIP). ChIP was performed as previously described using an affinity purified anti-Batf rabbit polyclonal antibody prepared by Brookwood Biomedical (Birmingham, Ala.). Briefly, chromatin was prepared from 1×107 CD4 T cells isolated from C57BL/6 Batf+/+ mice stimulated under TH17 polarizing conditions with anti-CD3 (2.5 μg/ml) and syngeneic splenic feeder cells, then restimulated or not at the indicated time points with PMA (50 ng/ml) and ionomycin (750 ng/ml) for 4 h. For experiments in
The role of Batf in human Th17 cells has been analyzed. Over-expression of human Batf in human cord blood derived Th17 cells showed a 2 fold increase in IL-17 production, indicating that it augments Th17 differentiation in human cells (
We have also initiated studies to determine Batfs molecular mechanism in Th17 development. One approach for this is to compare Batf to the closely related AP1 family member Batf3 with which it has 48% sequence identity. (
Surprisingly, retroviral reconstitution with either Batf or Batf3 restored IL-17 production in Batf/Batf3 double deficient T cells (
Interestingly, Batf3 is expressed both in wild type and Batf−/−Th17 cells and is also highly expressed in Th1 cells, as is Batf (
Serine phosphorylation of Batf may be important in regulating its activity. Phosphorylation of a serine residue within the DNA binding domain of Batf (S43) was suggested to inhibit Batf binding to DNA and potentially act as a dominant negative by sequestering Jun binding partners. This serine is conserved between Batf and Batf3 (
Both Batf and Batf3 restore IL4 induced IgG1 switching in Batf−/−/Batf3−/− double knockout B cells (
Transgenic Batf prolongs the ability of Th17 cells to produce IL-17. Unlike wild-type, transgenic Batf cells were capable of producing IL-17 at day ten (
This application claims the priority of U.S. provisional application No. 61/141,612, filed Dec. 30, 2008, which is hereby incorporated by reference in its entirety.
| Number | Date | Country | |
|---|---|---|---|
| 61141612 | Dec 2008 | US |
