Method and detector for identifying subtypes of human papilloma viruses

Information

  • Patent Application
  • 20070031827
  • Publication Number
    20070031827
  • Date Filed
    September 12, 2006
    17 years ago
  • Date Published
    February 08, 2007
    17 years ago
Abstract
A detector for detecting and simultaneously diagnosing at least one subtype of human papilloma viruses (HPV) contained in a biological sample is provided. The detector comprises: a carrier, a plurality of micro-dots immobilized on the carrier, wherein each micro-dot is for identifying one particular HPV subtype, and the HPV subtype is one selected from a group consisting of 39 different HPV subtypes; and at least one oligonucleotide sequence contained in each the micro-dot that is specific to the one particular HPV subtype, wherein the at least one oligonucleotide sequence serves as a detection probe that hybridizes specifically with an L1 gene sequence of the one particular HPV subtype to form a hybridization complex as a detection indicator, so that each micro-dot identifies one particular HPV subtype via a corresponding oligonucleotide of the one particular HPV subtype, and thereby detecting and simultaneously identifying subtypes of human papilloma viruses.
Description
FIELD OF THE INVENTION

The present invention relates to a method and a detector for detecting human papilloma viruses, and more particularly to a method and a detector for simultaneously detecting and identifying subtype of human papilloma viruses (HPV).


BACKGROUND OF THE INVENTION

In humans, more than 70 genetically distinct strains of human papilloma virus (HPV) have been identified based on DNA hybridization studies. According to some reports, different HPV types cause distinct diseases. For example, “Low-risk” HPVs, e.g., HPV 6 and HPV 11, cause benign hyperplasias such as genital warts, while “high-risk” HPVs, e.g., HPV-16, HPV-18, HPV-31, HPV-33, HPV-54, and the like, can cause cancers such as cervical or penile carcinoma.


Cervical cancer is the most common cancer in women. The consorts are often men with penile warts. Sexual activity appears to be an important predisposing factor of the epidemic disease and precancerous lesions. In early 5 to 10 years during the development of cervical cancer, cervical cells form cervical intraepithelial neoplasm.


Recently, in order to decrease the incidence of cervical cancer, Pap smear is used for the cervical cancer screening. However, the Pap smear has a false negative rate of about 30%˜40%. In addition, it is known that more that 95% of cervical carcinoma tissue contain detectable DNA sequences for known varieties of the human papilloma virus (HPV). Hence, the combination of Pap smear and HPV detection for the cervical cancer screening is necessarily considered.


The Applicant cooperates with the hospital to do the epidemiological research in women cervical cancer by using Pap smear and HPV detection, wherein the HPV detection is proceeded by using polymerase chain reaction and nucleotide sequencing. There are 2424 women aged from 16 to 84 for the epidemiology research, wherein 1963 women provide the effective specimen. The research results are shown as follows.

    • 1) 1.9% (37/1963) of the women have abnormal cytological smears.
    • 2) 12.7% (244/1926) of the women with normal cytological smears but have HPV infection.
    • 3) The HPV prevalence in the women with abnormal cytological smears is 51.4% (19/37) and positively relative to the degree of the abnormal cytological smears, wherein the incidence of abnormal non-typical squamous cells is 23.1%, the incidence of low abnormal epithelial cells is 41.7%, and the incidence of high abnormal epithelial cells is 75%.
    • 4) The subtypes of human papilloma viruses detected in the specimens are HPV 52, HPV 58, HPV 70, HPV 16, HPV 18, HPV 68, HPV 33, HPV 66, HPV 35, HPV 37, HPV 54, HPV 59, HPV 67, HPV 72, HPV 69, HPV 82, HPV 39, HPV 31, HPV 32, HPV HLT7474-S, HPV 6, HPV CP8061, HPV 62, HPV CP8304, HPV 44, HPV 11, HPV 61, HPV 74, HPV 42 and HPV 43.


The conventional HPV detecting kits are only used for detecting 18 subtypes of human papilloma viruses including high risk HPV 16, HPV 18, HPV 31, HPV 33, HPV 35, HPV 39, HPV 45, HPV 51, HPV 52, HPV 56, HPV 58, HPV 59 and HPV 68, and detecting low risk HPV 6, HPV I1, HPV 42, HPV 43 and HPV 44.


However, according to the comparison of the epidemiology research and the conventional HPV detecting kits, several clinically-important subtypes of human papilloma viruses contained in a specimen could not be identified by the conventional HPV detecting kits. In addition, the conventional HPV detecting kits only tell the information of HPVs contained in a specimen by two categories, high risk HPVs or low HPVs, rather than tell the definite subtypes as which they are classified. Therefore, except the high risk HPVs and the low risk HPVs, if other HPV subtypes are contained in the specimen, the conventional HPV detecting kits can not identify immediately, which would seriously affects the diagnosis accuracy. Furthermore, the conventional HPV detecting kits lack the system control for checking the house-keeping genes contained in a specimen. Without the system control, it will be hard to confirm whether the detecting protocols are precisely followed. That is, the user can not tell the positive/negative result comes from the HPV subtypes presence/absence or comes from the incorrect protocols execution. Therefore, the conventional detecting kit without the system control would not be able to provide a convincing result.


From the above description, it is known that the conventional detecting kit can not identify many HPV subtypes at the same time and it does not include an internal control in the detecting system. Therefore, how to simultaneously detect many HPV subtypes contained in a biological simple and design an accurate internal control in the detecting kits have become a major problem waited to be solved. In order to overcome the foresaid drawbacks of the conventional HPV detecting kits, the present invention provides a method and a detector for simultaneously detecting and identifying subtypes of human papilloma viruses contained in a sample.


SUMMARY OF THE INVENTION

It is therefore an object of the present invention to provide a detector for simultaneously detecting and identifying subtypes of human papilloma viruses (HPV) contained in a sample.


The main purpose of the present invention is to provide a HPV detecting kit, which is able to diagnose multiple HPV subtypes (up to 39 different subtypes) at the same time, allowing the rapid and reliable detection and identification of HPV possibly present in a biological sample.


It is another object of the present invention to provide a rapid and reliable method to detect and identify the HPV present in a biological sample.


It is another object of the present invention to provide a HPV detecting kit with high specificity and accuracy, which includes an internal control to show whether the detecting process is well handled so that the detecting result is dependable.


It is another object of the present invention to provide a number of oligonucleotides as probes for detecting and identifying the HPV present in a biological sample.


According to one aspect of the present invention, a detector for detecting and simultaneously diagnosing at least one subtype of human papilloma viruses (HPV) contained in a biological sample, comprises: a carrier, a plurality of micro-dots immobilized on the carrier, wherein each micro-dot is for identifying one particular HPV subtype, and the HPV subtype is one selected from a group consisting of (HPV 6, HPV 1, HPV 16, HPV 18, HPV 26, HPV 31, HPV 32, HPV 33, HPV 35, HPV 37, HPV 39, HPV 42, HPV 43, HPV 44, HPV 45, HPV 51, HPV 52, HPV 53, HPV 54, HPV 55, HPV 56, HPV 58, HPV 59, HPV 61, HPV 62, HPV 66, HPV 67, HPV 68, HPV 69, HPV 70, HPV 72, HPV 74, HPV 82, HPV CP8061, HPV CP8034, HPV LIAE5, HPV MM4, HPV MM7 and HPV MM8); and at least one oligonucleotide sequence contained in each the micro-dot that is specific to the one particular HPV subtype, wherein the at least one oligonucleotide sequence serves as a detection probe that hybridizes specifically with an LI gene sequence of the one particular HPV subtype to form a hybridization complex as a detection indicator, so that each micro-dot identifies one particular HPV subtype via a corresponding oligonucleotide of the one particular HPV subtype, and thereby detecting and simultaneously identifying subtypes of human papilloma viruses.


In accordance with the present invention, the at least one oligonucleotide that hybridizes specifically with an LI gene sequence of the one particular HPV subtype is respectively chosen from the following list for each HPV subtype: (SEQ ID NO: 1-SEQ ID NO: 12) for HPV 6, (SEQ ID NO: 13-SEQ ID NO:24) for HPV 11, (SEQ ID NO:25-SEQ ID NO:36) for HPV 16, (SEQ ID NO:37-SEQ ID NO:48) for HPV 18, (SEQ ID NO:49-SEQ ID NO:58) for HPV 26, (SEQ ID NO:59-SEQ ID NO:68) for HPV 31, (SEQ ID NO:69-SEQ ID NO:79) for HPV 32, (SEQ ID NO:80-SEQ ID NO:90) for HPV 33, (SEQ ID NO:91-SEQ ID NO:100) for HPV 35, (SEQ ID NO:101-SEQ ID NO:1 12) for HPV 37, (SEQ ID NO:113-SEQ ID NO:123) for HPV 39, (SEQ ID NO: 124-SEQ ID NO: 133) for HPV 42, (SEQ ID NO: 134-SEQ ID NO: 143) for HPV 43, (SEQ ID NO: 144-SEQ ID NO: 154) for HPV 44, (SEQ ID NO: 155-SEQ ID NO: 165) for HPV 45, (SEQ ID NO: 166-SEQ ID NO: 177) for HPV 51, (SEQ ID NO:178-SEQ ID NO:189) for HPV 52, (SEQ ID NO:190-SEQ ID NO:199) for HPV 53, (SEQ ID NO:200-SEQ ID NO:209) for HPV 54, (SEQ ID NO:210-SEQ ID NO:218) for HPV 55, (SEQ ID NO:219-SEQ ID NO:228) for HPV 56, (SEQ ID NO:229-SEQ ID NO:239) for HPV 58, (SEQ ID NO:240-SEQ ID NO:250) for HPV 59, (SEQ ID NO:251-SEQ ID NO:261) for HPV 61, (SEQ ID NO:262-SEQ ID NO:272) for HPV 62, (SEQ ID NO:273-SEQ ID NO:283) for HPV 66, (SEQ ID NO:284-SEQ ID NO:294) for HPV 67, (SEQ ID NO:295-SEQ ID NO:305) for HPV 68, (SEQ ID NO:306-SEQ ID NO:316) for HPV 69, (SEQ ID NO:317-SEQ ID NO:328) for HPV 70, (SEQ ID NO:329-SEQ ID NO:341) for HPV 72, (SEQ ID NO:342-SEQ ID NO:353) for HPV 74, (SEQ ID NO:354-SEQ ID NO:362) for HPV 82, (SEQ ID NO:363-SEQ ID NO:374) for HPV CP8061, (SEQ ID NO:375-SEQ ID NO:386) for HPV CP8034, (SEQ ID NO:387-SEQ ID NO:397) for HPV L1AE5, (SEQ ID NO:398-SEQ ID NO:408) for HPV MM4, (SEQ ID NO:409-SEQ ID NO:419) for HPV MM7, and (SEQ ID NO:420-SEQ ID NO:429) for HPV MM8.


Preferably, the carrier is a nylon membrane.


Preferably, the carrier is a glass plate.


Preferably, the detector is an oligonucleotide biochip.


Preferably, the at least one oligonucleotide has a length between 15-30 bases.


Preferably, the detector further comprises a micro-dot containing a Glutaldehyde-3-phosphodehydrogenase (GAPDH) gene, which is used as an internal control.


According to another aspect of the present invention, a method for detecting and simultaneously diagnosing at least one subtype of human papilloma viruses (HPV) contained in a biological sample is provided. The detecting method comprises steps of: amplifying an L1 gene fragment of human papilloma viruses (HPV) contained in the biological sample and obtaining an amplification product by polymerase chain reaction (PCR) using primers labeled with signaling substance; hybridizing the amplification product with a detector according to claim 1 to form a hybridization complex; removing nonhybridized the amplification product; and detecting the hybridization complex through detecting the signaling substance, thereby detecting and simultaneously identifying HPV subtypes contained in the biological sample.


Preferably, the amplification product has a length of 450 base pairs by using MY09 as sense primer and MY11 as anti-sense primer in polymerase chain reaction (PCR).


Preferably, the amplification product has a length of 190 base pairs by using MY11 as sense primer and GP6+ as anti-sense primer in polymerase chain reaction (PCR).


Preferably, the signaling substance is biotin.


Preferably, the biotin reacts with avidin-alkalinephosphatase to show the hybridization result by presenting a particular color.


Preferably, the signaling substance is a fluorescent substance.


Preferably, the fluorescent substance is Cyanine 5.


According to another aspect of the present invention, a probe which hybridizes to nucleic acid from an HPV subtype, the probe being selected from the group consisting of: SEQ ID NO:1-SEQ ID NO:12 and sequences fully complementary thereto, which hybridize with HPV 6; SEQ ID NO:13-SEQ ID NO:24 and sequences fully complementary thereto, which hybridize with HPV 11; SEQ ID NO:25-SEQ ID NO:36 and sequences fully complementary thereto, which hybridize with HPV 16; SEQ ID NO:37-SEQ ID NO:48 and sequences fully complementary thereto, which hybridize with HPV 18; SEQ ID NO:49-SEQ ID NO:58 and sequences fully complementary thereto, which hybridize with HPV 26; SEQ ID NO:59-SEQ ID NO:68 and sequences fully complementary thereto, which hybridize with HPV 31; SEQ ID NO:69-SEQ ID NO:79 and sequences fully complementary thereto, which hybridize with HPV 32; SEQ ID NO:80-SEQ ID NO:90 and sequences fully complementary thereto, which hybridize with HPV 33; SEQ ID NO:91-SEQ ID NO:100 and sequences fully complementary thereto, which hybridize with HPV 35; SEQ ID NO:101-SEQ ID NO:112 and sequences fully complementary thereto, which hybridize with HPV 37; SEQ ID NO:113-SEQ ID NO: 123 and sequences fully complementary thereto, which hybridize with HPV 39; SEQ ID NO: 124-SEQ ID NO:133 and sequences fully complementary thereto, which hybridize with HPV 42; SEQ ID NO:1 34-SEQ ID NO:143 and sequences fully complementary thereto, which hybridize with HPV 43; SEQ ID NO:144-SEQ ID NO:154 and sequences fully complementary thereto, which hybridize with HPV 44; SEQ ID NO:155-SEQ ID NO:165 and sequences fully complementary thereto, which hybridize with HPV 45; SEQ ID NO:166-SEQ ID NO:177 and sequences fully complementary thereto, which hybridize with HPV 51; SEQ ID NO:178-SEQ ID NO:189 and sequences fully complementary thereto, which hybridize with HPV 52; SEQ ID NO:190-SEQ ID NO:199 and sequences fully complementary thereto, which hybridize with HPV 53; SEQ ID NO:200-SEQ ID NO:209 and sequences fully complementary thereto, which hybridize with HPV 54; SEQ ID NO:210-SEQ ID NO:218 and sequences fully complementary thereto, which hybridize with HPV 55; SEQ ID NO:219-SEQ ID NO:228 and sequences fully complementary thereto, which hybridize with HPV 56; SEQ ID NO:229-SEQ ID NO:239 and sequences fully complementary thereto, which hybridize with HPV 58; SEQ ID NO:240-SEQ ID NO:250 and sequences fully complementary thereto, which hybridize with HPV 59; SEQ ID NO:251-SEQ ID NO:261 and sequences fully complementary thereto, which hybridize with HPV 61; SEQ ID NO:262-SEQ ID NO:272 and sequences fully complementary thereto, which hybridize with HPV 62; SEQ ID NO:273-SEQ ID NO:283 and sequences fully complementary thereto, which hybridize with HPV 66; SEQ ID NO:284-SEQ ID NO:294 and sequences fully complementary thereto, which hybridize with HPV 67; SEQ ID NO:295-SEQ ID NO:305 and sequences fully complementary thereto, which hybridize with HPV 68; SEQ ID NO:306-SEQ ID NO:316 and sequences fully complementary thereto, which hybridize with HPV 69; SEQ ID NO:317-SEQ ID NO:328 and sequences fully complementary thereto, which hybridize with HPV 70; SEQ ID NO:329-SEQ ID NO:341and sequences fully complementary thereto, which hybridize with HPV 72; SEQ ID NO:342-SEQ ID NO:353 and sequences fully complementary thereto, which hybridize with HPV 74; SEQ ID NO:354-SEQ ID NO:362 and sequences fully complementary thereto, which hybridize with HPV 82; SEQ ID NO:363-SEQ ID NO:374 and sequences fully complementary thereto, which hybridize with HPV CP8061; SEQ ID NO:375-SEQ ID NO:386 and sequences fully complementary thereto, which hybridize with HPV CP8034; SEQ ID NO:387-SEQ ID NO:397 and sequences fully complementary thereto, which hybridize with HPV L1AE5; SEQ ID NO:398-SEQ ID NO:408 and sequences fully complementary thereto, which hybridize with HPV MM4; SEQ ID NO:409-SEQ ID NO:419 and sequences fully complementary thereto, which hybridize with HPV MM7; and SEQ ID NO:420-SEQ ID NO:429 and sequences fully complementary thereto, which hybridize with HPV MM8.


The foregoing and other features and advantages of the present invention will be more clearly understood through the following descriptions with reference to the drawings, wherein:




BRIEF DESCRIPTION OF THE DRAWINGS


FIG. 1 is a schematic view showing the detector according to a preferred embodiment of the present invention;



FIG. 2(a) is a schematic view showing the detector according to a preferred embodiment of the present invention;



FIG. 2(b) is a schematic view illustrating the subtype of human papilloma viruses identified by each dot shown in FIG. 2(a);



FIG. 3(a) is the electrophoresis result showing the analyzed PCR products using primer set MY09/MY11 according to a preferred embodiment of the present invention;



FIG. 3(b) is the electrophoresis result showing the analyzed PCR products using primer set MY11/GP6+ according to a preferred embodiment of the present invention;



FIG. 3(c) is the electrophoresis result showing the analyzed PCR products using GAPDH primer set according to a preferred embodiment of the present invention;



FIG. 4(a) is the detecting result on the detector of detecting the PCR products using primer set MY09/MY11 of HPV positive clones according to a preferred embodiment of the present invention;



FIG. 4(b) is detecting result on the detector of detecting the PCR products using primer set MY11/GP6+ of HPV positive clones according to a preferred embodiment of the present invention;



FIG. 5 is a view showing the detecting result on the detectors of detecting samples according to a preferred embodiment of the present invention;



FIG. 6(a) is a schematic view showing the detector according to another preferred embodiment of the present invention;



FIG. 6(b) is a schematic view illustrating the subtype of human papilloma viruses identified by each dot shown in FIG. 6(a);



FIG. 7(a) is a view showing the detector stained with SYBR Green II according to a embodiment of the present invention; and



FIG. 7(b) is a view showing the detecting result on the detectors of detecting samples according to a preferred embodiment of the present invention.




DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT

The present invention will now described more specifically with reference to the following embodiments. Papilloma viruses are small (50-60 nm), nonenveloped, and icosahedral DNA viruses. The DNA of many papilloma viruses, including over 50 human viruses, has been cloned and sequenced. Although there is a high degree of sequence divergence between species, all papilloma viruses share some common features of genome organization. The open reading frames (ORFs) of the virus genomes are designated an early region, a late region, and a long control region (LCR) of transcription. The early region contains genes E1-E8 (not all are present in all species), the late region contains genes L1 and L2 (where “E” denotes early and “L” denotes late), and the long control region (LCR) of transcription includes the promoter and enhancer for the viral early genes and the origin of replication. The early region encodes genes required for viral DNA replication, cellular proliferation, and, in some viruses, cellular transformation. The late region (about 3 kb) codes for the capsid proteins. L1 is the major capsid protein and is relatively well conserved among all the papilloma virus types. The L1 protein is about 500 amino acids in size. L1 probably induces the major humoral and cell-mediated responses to viral infection. The L2 proteins are about 500 amino acids in size, account for only a small proportion of the virion mass, and their function is not yet clear. The LCR region contains an origin of replication with binding sites for E1 and E2 and other cis acting sequences in the promoter and enhancer region.


Generally, PCR has been considered to be the most sensitive method for identifying HPV subtypes in biological samples. A number of different primer combinations amplifying DNA fragment from various regions of the HPV genome have been developed and used for the detection of HPV. However, primers amplifying DNA fragments in the conserved L1 region have become the most widely used in the clinical and epidemiological studies. It is because that certain region of the L1 gene presents a high degree of sequence variability in different HPV subtypes. In other words, the sequence variability among each HPV subtype could be the specific site for identifying each different HPV subtype.


In order to identify the various HPV subtypes, the Applicant focuses on the loci near the end of L1 gene to search the specific sequence variability as mentioned above. More specifically, the PCR fragment synthesized by the primer sets MY11/MY09 (as disclosed in Weimin et al., 1997, J. Clin. Microbiol. 35(6): 1304-1310) in the L1 region is the particular loci ranges where the Applicant refers to find the specific sequence variability for each HPV subtype in the present invention. Since the specific sequence variability for each HPV subtype is not only specific to a particular HPV subtype, but also distinguished from any other HPV subtype, consequently, the probes specifically hybridization with a particular HPV subtype could be selected for identifying or diagnosing HPV subtypes, which is also one of the main purposes of the present invention.


The PCR fragments synthesized by the primer sets MY11/MY09 in the L1 region are about 450 bp in length and had been published. The sequences of the fragments for each HPV subtype described in the invention are publicly available, for example, from the National Center for Biotechnology Information (NCBI) (e.g., www.ncbi.nih.gov). The 39 HPV subtypes identified in the invention includes HPV 6, HPV 11, HPV 16, HPV 18, HPV 26, HPV 31, HPV 32, HPV 33, HPV 35, HPV 37, HPV 39, HPV 42, HPV 43, HPV 44, HPV 45, HPV 51, HPV 52, HPV 53, HPV 54, HPV 55, HPV 56, HPV 58, HPV 59, HPV 61, HPV 62, HPV 66, HPV 67, HPV 68, HPV 69, HPV 70, HPV 72, HPV 74, HPV 82, HPV CP8061, HPV CP8034, HPV L1AE5, HPV MM4, HPV MM7 and HPV MM8. The original NCBI Accession number and the loci of the PCR fragments synthesized by the primer sets MY11/MY09 for different HPV subtypes are listed in Table 1:

TABLE 1AccessionHPV subtypenumber/length(bp)loci/length(bp)SEQ ID NO.HPV 6NC_000904/80126743-7151/409430HPV 11NC_001525/79316727-7135/409431HPV 16NC_001526/79046602-7013/412432HPV 18NC_001357/78576578-6992/415433HPV 26NC_001583/78556553-6967/415434HPV 31NC_001527/79126520-6931/412435HPV 32NC_001586/79616837-7245/409436HPV 33NC_001528/79096559-6967/409437HPV 35NC_001529/78516542-6953/412438HPV 37NC_001687/74216711-7125/415439HPV 39NC_001535/78336605-7019/415440HPV 42NC_001534/79176802-7210/409441HPV 43U12504/45521-435/415442HPV 44NC_001689/78336647-7061/415443HPV 45NC_001590/78586582-6996/415444HPV 51NC_001533/78086486-6897/412445HPV 52NC_001592/79426623-7031/409446HPV 53NC_001593/78566614-7022/409447HPV 54NC_001676/77596561-6972/412448HPV 55NC_001692/78226647-7061/415449HPV 56NC_001594/78446559-6967/409450HPV 58NC_001443/78246608-7016/409451HPV 59NC_001635/78966571-6985/415452HPV 61NC_001694/79896732-7146/415453HPV 62U12499/44921-429/409454HPV 66NC_001695/78246609-7017/409455HPV 67D21208/78016584-6992/409456HPV 68M73258/60422582-2996/415457HPV 69NC 002171/77006509-6923/415458HPV 70NC 001711/79056549-6963/415459HPV 72X94164/79886758-7172/415460HPV 74U40822/38911613-2027/415461HPV 82AB027021/78716536-6950/415462HPV CP8061U12479/45221-432/412463HPV CP8304U12480/45221-432/412464HPV L1AE5AF039910/36411-360/350465HPV MM4U12488/45521-435/415466HPV MM7U12489/45221-432/412467HPV MM8U12490/45221-432/412468


The sequences of the fragments of each HPV subtype described in the invention are listed below:


Human Papilloma Virus subtype 6 (6743-7151/409 bp)

Human Papilloma Virus subtype 6 (6743-7151/409 bp)SEQ ID NO 430tatttgttgg ggtaatcaac tgtttgttac tgtggtagat60accacacgca gtaccaacatgacattatgt gcatccgtaa ctacatcttc cacatacacc120aattctgatt ataaagagtacatgcgtcat gtggaagagt atgatttaca atttattttt180caattatgta gcattacattgtctgctgaa gtaatggcct atattcacac aatgaatccc240tctgttttgg aagactggaactttgggtta tcgcctcccc caaatggtac attagaagat300acctataggt atgtgcagtcacaggccatt acctgtcaaa agcccactcc tgaaaaggaa360aagccagatc cctataagaaccttagtttt tgggaggtta atttaaaaga aaagttttct409agtgaattgHuman Papilloma Virus subtype 11 (6727-7135/409bp)SEQ ID NO 431tatttgctgg ggaaaccact tgtttgttac tgtggtagat60accacacgca gtacaaatatgacactatgt gcatctgtgt ctaaatctgc tacatacact120aattcagatt ataaggaatacatgcgccat gtggaggagt ttgatttaca gtttattttt180caattgtgta gcattacattatctgcagaa gtcatggcct atatacacac aatgaatcct240tctgttttgg aggactggaactttggttta tcgcctccac caaatggtac actggaggat300acttatagat atgtacagtcacaggccatt acctgtcaga aacccacacc tgaaaaagaa360aaacaggatc cctataaggatatgagtttt tgggaggtta acttaaaaga aaagttttca409agtgaattaHuman Papilloma Virus subtype 16 (6602-7013/412bp)SEQ ID NO 432catttgttgg ggtaaccaac tatttgttac tgttgttgat60actacacgca gtacaaatatgtcattatgt gctgccatat ctacttcaga aactacatat120aaaaatacta actttaaggagtacctacga catggggagg aatatgattt acagtttatt180tttcaactgt gcaaaataaccttaactgca gacgttatga catacataca ttctatgaat240tccactattt tggaggactggaattttggt ctacaacctc ccccaggagg cacactagaa300gatacttata ggtttgtaacccaggcaatt gcttgtcaaa aacatacacc tccagcacct360aaagaagatg atccccttaaaaaatacact ttttgggaag taaatttaaa ggaaaagttt412tctgcagacc taHuman Papilloma Virus subtype 18 (6587-6992/415bp)SEQ ID NO 433tgtttgctgg cataatcaat tatttgttac tgtggtagat60accactccca gtaccaatttaacaatatgt gcttctacac agtctcctgt acctgggcaa120tatgatgcta ccaaatttaagcagtatagc agacatgttg aggaatatga tttgcagttt180atttttcagt tgtgtactattactttaact gcagatgtta tgtcctatat tcatagtatg240aatagcagta ttttagaggattggaacttt ggtgttcccc cccccccaac tactagtttg300gtggatacat atcgttttgtacaatctgtt gctattacct gtcaaaagga tgctgcaccg360gctgaaaata aggatccctatgataagtta aagttttgga atgtggattt aaaggaaaag415ttttctttag acttaHuman Papilloma Virus subtype 26 (6553-6967/415bp)SEQ ID NO 434tatctgttgg ggcaatcaat tgtttgttac ctgtgttgat60accacccgca gtactaaccttaccattagt acattatctg cagcatctgc atccactcca120tttaaaccat ctgattataaacaatttata agacatggcg aagaatatga attacaattt180atatttcagt tgtgtaaaataacacttaca acagatgtta tggcttacat acatttaatg240aatgcctcca tattggaggattggaatttt ggactaacct tacctcccac tgctagtttg300gaagatgcct ataggtttattaaaaactct gctactacct gtcagcgtaa cgcccctcct360gtgccaaagg aagatccttttcaaaaattt aaattttggg atgtagattt aaaagaaaaa415ttttctattg atttgHuman Papilloma Virus subtype 31 (6520-6931/412bp)SEQ ID NO 435tatttgttgg ggcaatcagt tatttgttac tgtggtagat60accacacgta gtaccaatatgtctgtttgt gctgcaattg caaacagtga tactacattt120aaaagtagta attttaaagagtatttaaga catggtgagg aatttgattt acaatttata180tttcagttat gcaaaataacattatctgca gacataatga catatattca cagtatgaat240cctgctattt tggaagattggaattttgga ttgaccacac ctccctcagg ttctttggag300gatacctata ggtttgtcacctcacaggcc attacatgtc aaaaaactgc cccccaaaag360cccaaggaag atccatttaaagattatgta ttttgggagg ttaatttaaa agaaaagttt412tctgcagatt taHuman Papilloma Virus subtype 32 (6837-7245/409bp)SEQ ID NO 436tatatgttgg ggtaatcaag tgtttctaac tgttgtggat60actacccgta gtactaacatgactgtgtgt gctactgtaa caactgaaga cacatacaag120tctactaact ttaaggaatatctacgccat gcagaggaat atgatataca gtttatattt180caattgtgca aaattacattatctgtagag gttatgtcat atatccacac catgaatcct240gacatactag acgattggaatgttggtgta gctccaccgc cctctggtac tttagaagat300agttatagat ttgtgcagtctcaggccata cgatgtcaag ctaaggtaac agcacctgaa360aaaaaggatc ctttttctgactattcattt tgggaagtaa atttatctga aaagttttct409agtgatttaHuman Papilloma Virus subtype 33 (6559-6967/409bp)SEQ ID NO 437tatttgttgg ggcaatcagg tatttgttac tgtggtagat60accactcgca gtactaatatgactttatgc acacaagtaa ctagtgacag tacatataaa120aatgaaaatt ttaaagaatatataagacat gttgaagaat atgatctaca gtttgttttt180caactatgca aagttaccttaactgcagaa gttatgacat atattcatgc tatgaatcca240gatattttag aagattggcaatttggttta acacctcctc catctgctag tttacaggat300acctataggt ttgttacctctcaggctatt acgtgtcaaa aaacagtacc tccaaaggaa360aaggaagacc ccttaggtaaatatacattt tgggaagtgg atttaaagga aaaattttca409gcagatttaHuman Papilloma Virus subtype 35 (6542-6953/412bp)SEQ ID NO 438tatttgttgg agtaaccaat tgtttgttac tgtagttgat60acaacccgta gtacaaatatgtctgtgtgt tctgctgtgt cttctagtga cagtacatat120aaaaatgaca attttaaggaatatttaagg catggtgaag aatatgattt acagtttatt180tttcagttat gtaaaataacactaacagca gatgttatga catatattca tagtatgaac240ccgtccattt tagaggattggaattttggc cttacaccac cgccttctgg taccttagag300gacacatatc gctatgtaacatcacaggct gtaacttgtc aaaaacccag tgcaccaaaa360cctaaagatg atccattaaaaaattatact ttttgggagg ttgatttaaa ggaaaagttt412tctgcagact taHuman Papilloma Virus subtype 37 (6711-7125/415bp)SEQ ID NO 439cattttatgg ggtaatcaaa tgtttatcac agttgctgat60aatacacgga acacaaacttttctattagt gtgtctactg acaatggcga agttacagaa120tataattctc aaacactcagagaataccta agacatgttg aagaatacca gctttcaatt180attttacaac tttgtaaagttcctttaaag gctgaggttt taactcagat aaatgcaatg240aattctggta tattggaagagtggcaatta ggatttgtac ctactccaga taattcagta300catgaccttt ataggtacattaattcaaag gctaccaagt gtcctgatgc agttgttgaa360aaagaaaagg aagatccctttgcaaaatat acattttgga atgtagattt aactgaaaaa415ttatcattgg atttaHuman Papilloma Virus subtype 39 (6605-7017/415bp)SEQ ID NO 440tatatgttgg cataatcaat tatttcttac tgttgtggac60actacccgta gtaccaactttacattatct acctctatag agtcttccat accttctaca120tatgatcctt ctaagtttaaggaatatacc aggcacgtgg aggagtatga tttacaattt180atatttcaac tgtgtactgtcacattaaca actgatgtta tgtcttatat tcacactatg240aattcctcta tattggacaattggaatttt gctgtagctc ctccaccatc tgccagtttg300gtagacactt acagatacctacagtctgca gccattacat gtcaaaagga tgctccagca360cctgaaaaga aagatccatatgacggtcta aagttttgga atgttgactt aagggaaaag415tttagtttgg aacttHuman Papilloma Virus subtype 42 (6802-7210/409bp)SEQ ID NO 441tatatgttgg ggaaatcagc tatttttaac tgtggttgat60actacccgta gtactaacatgactttgtgt gccactgcaa catctggtga tacatataca120gctgctaatt ttaaggaatatttaagacat gctgaagaat atgatgtgca atttatattt180caattgtgta aaataacattaactgttgaa gttatgtcat atatacacaa tatgaatcct240aacatattag aggagtggaatgttggtgtt gcaccaccac cttcaggaac tttagaagat300agttataggt atgtacaatcagaagctatt cgctgtcagg ctaaggtaac aacgccagaa360aaaaaggatc cttattcagacttttggttt tgggaggtaa atttatctga aaagttttct409actgatttaHuman Papilloma Virus subtype 43 (21-435/415 bp)SEQ ID NO 442catttgtttt gggaatcagt tgtttgttac agtggtagat60accactcgta gtacaaacttgacgttatgt gcctctactg accctactgt gcccagtaca120tatgacaatg caaagtttaaggaatacttg cggcatgtgg aagaatatga tctgcagttt180atatttcaat tatgcataataacgctaaac ccagaggtta tgacatatat tcatactatg240gatcccacat tattagaggactggaatttt ggtgtgtccc cacctgcctc tgcttctttg300gaagatactt atcgctttttgtctaacaag gccattgcat gtcaaaaaaa tgctccccca360aaggaacggg aggatccctataaaaagtat acattttggg atataaatct tacagaaaag415ttttctgcac aacttHuman Papilloma Virus subtype 44 (6647-7061/415bp)SEQ ID NO 443tatttgttgg ggaaatcagt tatttgttac tgttgtagat60actacccgta gtacaaacatgacaatatgt gctgccacta cacagtcccc tccgtctaca120tatactagtg aacaatataagcaatacatg cgacatgttg aggagtttga cttacaattt180atgtttcaat tatgtagtattaccttaacg gcggaggtaa tggcctatct tcatactatg240aatgctggta ttttagaacagtggaacttt gggttgtcgc cgcccccaaa tggtacctta300gaggacaaat acagatatgtgcagtcccag gocattacat gtcaaaagcc accccctgaa360aaggcaaagc aggacccctatgcaaaatta agtttttggg aggtggatct tagagaaaag415ttttctagtg agttgHuman Papilloma Virus subtype 45 (6582-6996/415bp)SEQ ID NO 444tatttgttgg cataatcagt tgtttgttac tgtagtggac60actacccgca gtactaatttaacattatgt gcctctacac aaaatcctgt gccaagtaca120tatgacccta ctaagtttaagcagtatagt agacatgtgg aggaatatga tttacagttt180atttttcagt tgtgcactattactttaact gcagaggtta tgtcatatat ccatagtatg240aatagtagta tattagaaaattggaatttt ggtgtccctc caccacctac tacaagtttg300gtggatacat atcgttttgtgcaatcagtt gctgttacct gtcaaaagga tactacacct360ccagaaaagc aggatccatatgataaatta aagttttgga ctgttgacct aaaggaaaaa415ttttcctccg atttgHuman Papilloma Virus subtype 51 (6486-6897/412bp)SEQ ID NO 445catttgctgg aacaatcagc tttttattac ctgtgttgat60actaccagaa gtacaaatttaactattagc actgccactg ctgcggtttc cccaacattt120actccaagta actttaagcaatatattagg catggggaag agtatgaatt gcaatttatt180tttcaattat gtaaaattactttaactaca gaggtaatgg cttatttaca cacaatggat240cctaccattc ttgaacagtggaattttgga ttaacattac ctccgtctgc tagtttggag300gatgcatata ggtttgttagaaatgcagct actagctgtc aaaaggacac ccctccacag360gctaagccag atcctttggccaaatataaa ttttgggatg ttgatttaaa ggaacgattt412tctttagatt taHuman Papilloma Virus subtype 52 (6623-7031/409bp)SEQ ID NO 446catatgttgg ggcaatcagt tgtttgtcac agttgtggat60accactcgta gcactaacatgactttatgt gctgaggtta aaaaggaaag cacatataaa120aatgaaaatt ttaaggaataccttcgtcat ggcgaggaat ttgatttaca atttattttt180caattgtgca aaattacattaacagctgat gttatgacat acattcataa gatggatgcc240actattttag aggactggcaatttggcctt accccaccac cgtctgcatc tttggaggac300acatacagat ttgtcacttctactgctata acttgtcaaa aaaacacacc acctaaagga360aaggaagatc ctttaaaggactatatgttt tgggaggtgg atttaaaaga aaagttttct409gcagatttaHuman Papilloma Virus subtype 53 (6614-7022/409bp)SEQ ID NO 447catctgttgg aacaatcagt tatttgtaac tgttgtggat60accaccagga atacaaacatgactctttcc gcaaccacac agtctatgtc tacatataat120tcaaagcaaa ttaaacagtatgttagacat gcagaggaat atgaattaca atttgtgttt180caactatgta aaatatccctgtctgctgag gttatggcct atttacatac tatgaattct240accttactgg aagactggaatataggtttg tcgcctcctg ttgccactag cttagaggac300aaatacagat atgtgaaaagtgcagctata acctgtcaaa aggatcagcc ccctcctgaa360aagcaggacc cactatctaaatataaattt tgggaggtca atttgcaaaa cagtttttct409gctgatttgHuman Papilloma Virus subtype 54 (6561-6972/412bp)SEQ ID NO 448tatttgttgg ggcaatcagg tgtttttaac agttgtagat60accacccgta gtactaacctaacattgtgt gctacagcat ccacgcagga tagctttaat120aattctgact ttagggagtatattagacat gtggaggaat atgatttaca gtttatattt180cagttatgta ccataacccttacagoagat gttatggcct atattcatgg aatgaatccc240actattctag aggactggaactttggtata acccccccag ctacaagtag tttggaggac300acatataggt ttgtacagtcacaggccatt gcatgtcaaa agaataatgc ccctgcaaag360gaaaaggagg atccttacagtaaatttaat ttttggactg ttgaccttaa ggaacgattt412tcatctgacc ttHuman Papilloma Virus subtype 55 (6647-7061/415bp)SEQ ID NO 449tatttgttgg gggaatcagt tatttgttac tgttgtagat60actacacgta gtacaaacatgacaatatgt gctgctacaa ctcagtctcc atctacaaca120tataatagta cagaatataaacaatacatg cgacatgttg aggagtttga cttacagttt180atgtttcaat tatgtagtattaccttaact gctgaggtaa tggcctattt acataccatg240aatcctggta ttttggaacagtggaacttt gggttgtcgc cacccccaaa tggtacctta300gaagacaaat acagatatgtgcagtcacag gocattacat gtcaaaagcc tccccctgaa360aaggcaaagc aggacccctatgcaaaatta agtttttggg aggtagatct cagagaaaag415ttttctagtg agttaHuman Papilloma Virus subtype 56 (6559-6967/409bp)SEQ ID NO 450catttgctgg ggtaatcaat tatttgttac tgtagtagat60actactagaa gtactaacatgactattagt actgctacag aacagttaag taaatatgat120gcacgaaaaa ttaatcagtaccttagacat gtggaggaat atgaattaca atttgttttt180caattatgca aaattactttgtctgcagag gttatggcat atttacataa tatgaatgct240aacctactgg aggactggaatattgggtta tccccgccag tggccaccag cctagaagat300aaatatagat atgttagaagcacagctata acatgtcaac gggaacagcc accaacagaa360aaacaggacc cattagctaaatataaattt tgggatgtta acttacagga cagtttttct419acagacctgHuman Papilloma Virus subtype 58 (6608-7016/409bp)SEQ ID NO 451catttgctgg ggcaatcagt tatttgttac cgtggttgat60accactcgta gcactaatatgacattatgc actgaagtaa ctaaggaagg tacatataaa120aatgataatt ttaaggaatatgtacgtcat gttgaagaat atgacttaca gtttgttttt180cagctttgca aaattacactaactgcagag ataatgacat atatacatac tatggattcc240aatattttgg aggactggcaatttggttta acacctcctc cgtctgccag tttacaggac300acatatagat ttgttacctcccaggctatt acttgccaaa aaacagcacc ccctaaagaa360aaggaagatc cattaaataaatatactttt tgggaggtta acttaaagga aaagttttct409gcagatctaHuman Papilloma Virus subtype 59 (6571-6985/415bp)SEQ ID NO 452tatatgttgg cacaatcaat tgtttttaac agttgtagat60actactcgca gcaccaatctttctgtgtgt gcttctacta cttcttctat tcctaatgta120tacacaccta ccagttttaaagaatatgcc agacatgtgg aggaatttga tttgcagttt180atatttcaac tgtgtaaaataacattaact acagaggtaa tgtcatacat tcataatatg240aataccacta ttttggaggattggaatttt ggtgttacac cacctcctac tgctagttta300gttgacacat accgttttgttcaatctgct gctgtaactt gtcaaaagga caccgcaccg360ccagttaaac aggacccttatgacaaacta aagttttggc ctgtagatct taaggaaagg415ttttctgcag atcttHuman Papilloma Virus subtype 61 (6732-7146/415bp)SEQ ID NO 453tatttgttgg tttaatgaat tgtttgtaac cgttgtggat60accacccgca gtactaatttaaccatttgt actgctacat ccccccctgt atctgaatat120aaagccacaa gctttagggaatatttgcgc catacagagg agtttgattt gcaatttatt180tttcagttat gtaaaatacatttaacccct gaaattatgg cctacctaca taatatgaat240aaggccttgt tggatgactggaactttggt gtggtaccac caccctctac cagtttagaa300gacacatata ggtttttgcagtccagagct attacatgtc agaagggtgc tgctgccccg360ccgcccaagg aggatcgctatgccaagtta tccttttgga ctgttgattt acgagacaag415ttttccactg atttgHuman Papilloma Virus subtype 62 (21-429/409 bp)SEQ ID NO 454tatttgttgg tttaatgaac tgtttgttac tgtggtggat60actaccagaa gtactaattttactatttgt accgcctcca ctgctgcagc agaatacacg120gctaccaact ttagggaatttttgcgacac acggaggaat ttgatttgca atttatattt180caattgtgca aaatacagttaacccccgaa attatggcct acctgcataa tatgaacaag240gaccttttgg atgactggaactttggggtt ttacctcccc cttccactag tttagatgag300acatatcact atttcgagtctcgggctatt acatgtcaaa gggggctgcc tacccgtccc360aaggtggacc cgtatgcgcaaatgacattt tggactgtgg atcttaagga caagttgtct409actgatttgHuman Papilloma Virus subtype 66 (6609-7017/409bp)SEQ ID NO 455catatgctgg ggtaatcagg tatttgttac tgttgtggat60actaccagaa gcaccaacatgactattaat gcagctaaaa gcacattaac taaatatgat120gcccgtgaaa tcaatcaataccttcgccat gtggaggaat atgaactaca gtttgtgttt180caactttgta aaataaccttaactgcagaa gttatggcat atttgcataa tatgaataat240actttattag acgattggaatattggctta tccccaccag ttgcaactag cttagaggat300aaatataggt atattaaaagcacagctatt acatgtcaga gggaacagcc ccctgcagaa360aagcaggatc ccctggctaaatataagttt tgggaagtta atttacagga cagcttttct409gcagacctgHuman Papilloma Virus subtype 67 (6584-6992/409bp)SEQ ID NO 456tatatgctgg ggtaatcaaa tatttgttac tgttgtagac60actacacgta gtaccaacatgactttatgt tctgaggaaa aatcagaggc tacatacaaa120aatgaaaact ttaaggaataccttagacat gtggaagaat atgatttgca gtttatattt180cagctgtgca aaatatcccttactgcaaat gttatgcaat acatacacac catgaatcca240gatatattag aggactggcaatttggcctt acaccacctc cttcaggtaa tttacaggac300acatatagat ttgttacctcgcaggctatt acctgtcaaa aaacatcccc tccaacagca360aaggaagatc ctcttaaaaagtacagtttt tgggaaatca atttaaagga aaaattttct409gcagatttaHuman Papilloma Virus subtype 68 (2582-2996/415bp)SEQ ID NO 457tatttgttgg cataatcaat tatttcttac tgttgtggat60accactcgca gtaccaattttactttgtct actactactg aatcagctgt accaaatatt120tatgatccta ataaatttaaggaatatatt aggcatgttg aggaatatga tttgcaattt180atatttcagt tgtgtactataacattgtcc actgatgtaa tgtcctatat acatactatg240aatcctgcta ttttggatgattggaatttt ggtgttgccc ctccaccatc tgctagtctt300gtagatacat accgctatctgcaatcagca gcaattacat gtcaaaaaga cgcccctgca360cctactaaaa aggatccatatgatggctta aacttttgga atgtaaattt aaaggaaaag415tttagttctg aactgHuman Papilloma Virus subtype 69 (6509-6923/415bp)SEQ ID NO 458catttgttgg ggcaaccaat tgtttgttac ttgtgtagat60actacccgca gtaccaacctcactattagt actgtatctg cacaatctgc atctgccact120tttaaaccat cagattataagcagtttata aggcatggtg aggaatatga attacagttt180atatttcaat tgtgtaaaattactcttacc actgatgtaa tggcctatat ccatacaatg240aattctacta ttttggaaaattggaatttt ggccttacct tgcctcctac tgctagtttg300gaagatgcat ataggtttattaaaaattca gctactacat gtcaacgcga tgcccctgca360cagcccaagg aggatccatttagtaaatta aaattttggg acgttgatct taaagaaaag415ttttctattg atttaHuman Papilloma Virus subtype 70 (6549-6963/415bp)SEQ ID NO 459catttgttgg cataaccagt tgtttattac tgtggtggac60actacacgta gtactaattttacattgtct gcctgcaccg aaacggccat acctgctgta120tatagcccta caaagtttaaggaatatact aggcatgtgg aggaatatga tttacaattt180atatttcaat tgtgtactatcacattaact gctgacgtta tggcctacat ccatactatg240aatcctgcaa ttttggacaattggaatata ggagttaccc ctccaccatc tgcaagcttg300gtggacacgt ataggtatttacaatcagca gctatagcat gtcaaaagga tgctcctaca360cctgaaaaaa aggatccctatgacgattta aaattttgga atgttgattt aaaggaaaag415tttagtacag aactaHuman Papilloma Virus subtype 72 (6758-7172/415bp)SEQ ID NO 460catctgttgg tttaatgagc tttttgtgac agttgtagat60actactcgca gtactaatgtaactatttgt actgccacag cgtcctctgt atcagaatat120acagcttcta attttcgtgagtatcttcgc cacactgagg aatttgattt gcagtttata180tttcaactgt gtaaaattcacttaactcct gaaattatgg cctacttgca caatatgaat240aaggccttat tggatgactggaattttggt gtggtgcctc ctccttctac cagtttggat300gatacctata ggtttttgcagtctcgtgcc attacctgtc aaaagggggc tgccacccct360cctcctaaag aagatccatatgctaactta tccttttgga ctgtggattt aaaggacaaa415ttttccactg acttgHuman Papilloma Virus subtype 74 (1613-2027/415bp)SEQ ID NO 461tatttgttgg ggtaatcaat tatttgttac agttgtggat60accacacgca gtactaacatgactgtgtgt gctcctacct cacaatcgcc ttctgctaca120tataatagtt cagactacaaacaatacatg cgacatgtgg aggaatttga tttgcaattt180atttttcaat tatgtagtattaagttaact gctgaggtta tggcctatat tcatactatg240aatcctacag ttttagaagagtggaacttt gggctaacgc ctccccccaa tggtacttta300gaagacacct acagatatgtgcagtcccag gctattacat gtcaaaaacc tacgcctgat360aaagcaaagc ccaatccctatgcaaattta agtttttggg aagttaatct taaggaaaag415ttttctagtg aattaHuman Papilloma Virus subtype 82 (6536-6950/415bp)SEQ ID NO 462catttgctgg aataatcagc tttttattac ttgtgttgac60actactaaaa gtaccaatttaaccattagc actgctgtta ctccatctgt tgcacaaaca120tttactccag caaactttaagcagtacatt aggcatgggg aagaatatga attgcaattt180atatttcaat tgtgtaaaatcactttaact actgaaatta tggcttacct gcacaccatg240gattctacaa ttttagaacagtggaatttt ggattaacat tgcccccctc cgctagtttg300gaggatgcct atcgatttgtaaaaaatgca gcaacatcct gtcacaagga cagtcctcca360caggctaaag aagaccctttggcaaaatat aaattttgga atgtagacct taaggaacgc415ttttctttgg atttgHuman Papilloma Virus subtype CP8061 (21-432/412bp)SEQ ID NO 463catttgttgg ggcaatcagc tttttgtaac agttgtggac60acatcacgta gtacaaatatgtccatctgt gctaccaaaa ctgttgagtc tacatataaa120gcctctagtt tcatggaatatttgagacat ggagaagaat ttgatttgca atttatattt180caactatgtg ttattaatttaacagctgaa attatggcct acttacatcg catggatgct240acattactgg aggactggaatttttggttc ttaccacctc ctactgctag tcttggtgat300acctaccgct ttttacagtctcaggccata acctgtcaga aaaacagtcc tcctcctgca360gaaaaaaagg acccctatgcagatcttaca ttttgggagg tggatttaaa ggagcggttt412tcactagaat tgHuman Papilloma Virus subtype CP8304 (21-432/412bp)SEQ ID NO 464tatttgttgg tttaatgaaa tgtttgttac agtggtggat60actaccagaa gcaccaattttactatttgc acagctacat ctgctgctgc agaatacaag120gcctctaact ttaaggaatttctgcgccat acagaggaat atgatttgca gtttattttc180caattatgta aaatacagttaacaccagaa attatggcct acttacataa tatgaacaag240gcactgttgg atgattggaattttggtgtg ttgccacctc cttccaccag tttagatgac300acatatcgct ttttacagtctcgggccatt acctgtcaaa agggtgctgc tgcccctgcg360cccaaagagg acccttatgccgacatgtca ttttggacag ttgaccttaa ggacaagttg412tctactgatt tgHuman Papilloma Virus subtype L1AE5 (11-360/350bp)SEQ ID NO 465ggcacaacca attatttata actgtggtag acacaacacg60tagtaccaat cttaccttatctactgcaac tactaatcca gttccatcta tatatgaacc120ttctaaattt aaggaatacacacgccatgt agaggaatat gatttacaat ttatatttca180attgtgtaaa attacacttactactgatgt tatgtcttat atacataaca tggatcctac240tattttagat agttggaattttggtgttag tcctccccca tctgctagct tagtagatac300atataggttt ttacagtcatctgccattac atgtcagaag gatgtggttg ttccacaaaa350aaaggatccaHuman Papilloma Virus subtype MM4 (21-435/415 bp)SEQ ID NO 466catttgctgg aataatcagc tttttattac ttgtgttgac60actactagaa gtaccaatttaaccattagc actgctgtta ctcaatctgt tgcacaaaca120tttactccag caaactttaagcaatacatt aggcatgggg aagaatatga attgcaattt180atatttcaat tgtgtaaaatcactttaact actgaaatta tggcttacct gcacaccatg240gattctacaa ttttagaacagtggaatttt ggattaacct tgcccccctc agctagtttg300gaggatgcct atcgatttgtaaaaaatgca gcaacatcct gtcacaagga cagtcctcca360caggctaaac aagaccctttggcaaaatat aaattttgga atgtagacct taaggaacgc415ttttctttgg atttgHuman Papilloma Virus subtype MM7 (21-432/412 bp)SEQ ID NO 467catttgttgg tttaatgagt tatttgttac agttgtagat60actacccgca gtaccaatattactatttca gctgctgcta cacaggctaa tgaatacaca120gcctctaact ttaaggaatacctccgccac accgaggaat atgacttaca ggttatattg180caactttgca aaatacatcttacccctgaa attatggcat acctacatag tatgaatgaa240catttattgg atgagtggaattttggcgtg ttaccacctc cttccaccag ccttgatgat300acctatcgct atctgcagtcccgtgctatt acctgccaaa agggtccttc cgcccctgcc360cctaaaaagg atccttatgatggccttgta ttttgggagg ttgatttaaa ggacaaacta412tccacagatt tgHuman Papilloma Virus subtype MM8 (21-432/412 bp)SEQ ID NO 468tatatgctgg tttaatcaat tgtttgtcac ggtggtggat60accacccgca gcaccaattttactattagt gctgctacca acaccgaatc agaatataaa120cctaccaatt ttaaggaatacctaagacat gtggaggaat atgatttgca gtttatattc180cagttgtgta aggtccgtctgactccagag gtcatgtcct atttacatac tatgaatgac240tccttattag atgagtggaattttggtgtt gtgccccctc cctccacaag tttagatgat300acctataggt acttgcagtctcgcgccatt acttgccaaa agggggccgc cgccgccaag360cctaaggaag atccttatgctggcatgtcc ttttgggatg tagatttaaa ggacaagttt412tctactgatt tg


In order to find the specific probes for identifying or diagnosing HPV subtypes, some sequence analysis software are used for finding the variety sites among the above listed sequences of different HPV subtypes, e.g., DNASTAR. The above 450-bp sequences of 39 HPV subtypes are respectively divided into several fragments and analyzed by the software. Preferably, the genetic identify compared to other HPV subtypes must be lower than 30% for finding suitable probes with high specificity. After identifying the variety sites having low genetic identity in sequences of each HPV subtype, the probes for each HPV subtype are respectively designed to specifically hybridize with these variety sites. Then, the designed probes are tested for their specificities to the corresponding HPV subtypes respectively. Preferably, the probes are 15-30 base pairs in length. Ultimately, 9-12 probes with high specificity are found for each HPV subtype. The sequences of the probes for each- HPV subtype are listed below.

UZ,14/19 HPV 6SEQ IDNO5′→3′Locus in HPV 6 1CATCCGTAACTACATCTTCC6814-6833 2ATCCGTAACTACATCTTCCA6815-6834 3CTACATCTTCCACATACACCAA6823-6844 4CATCTTCCACATACACCAAT6826-6845 5ATCTTCCACATACACCAATT6827-6846 6CCACATACACCAATTCTGAT6832-6851 7TAGCATTACATTGTCTGCTGAAG6911-6933 8TCCCTCTGTTTTGGAAGAC6959-6977 09GTTATCGCCTCCCCCAAATGGTACAT6989-7014 10CTATAGGTATGTGCAGTCACAG7025-7046 11GCCCACTCCTGAAAAGGAA7064-7082 12CTATAAGAACCTTAGT7094-7109HPV 11SEQ IDNO5′→3′Locus in HPV 11 13ATCTGTGTCTAAATC6799-6813 14TCTGTGTCTAAATCTGCTAC6800-6819 15ATCTGTGTCTAAATCTGCTACATACA6799-6824 16TGCATCTGTGTCTAAATCTG6796-6815 17AAATCTGCTACATACACTAA6809-6828 18CTAAATCTGCTACATACACTA6807-6827 19CTACATACACTAATTCAGAT6816-6835 20TAGCATTACATTATCTGCAGAAG6895-6917 21TCCTTCTGTTTTGGAGGAC6943-6961 22TTTATCGCCTCCACCAAATGGTACAC6973-6998 23TTATAGATATGTACAGTCACAGGCC7009-7033 24ACCCACACCTGAAAAAGAAAAAC7048-7070HPV 16SEQ IDNO5′→3′Locus in HPV 16 25TATGTCATTATGTGCTGCCA6659-6678 26GTGCTGCCATATCTACTTCA6670-6689 27TGCCATATCTACTTC6674-6688 28TATCTACTTCAGAAACTACA6679-6698 29CTACTTCAGAAACTACATATAA6682-6703 30ATAAAAATACTAACTTTAAG6700-6719 31CAAAATAACCTTAACTGCAGACG6773-6795 32TTCCACTATTTTGGAGGAC6821-6839 33TCTACAACCTCCCCCAGGAGGCACAC6851-6876 34TTATAGGTTTGTAACCCAG6887-6905 35ACATACACCTCCAGCACCT6923-6941 36CCTTAAAAAATACACT6956-6971HPV 18SEQ IDNO5′→3′Locus in HPV 18 37TTCTACACAGTCTCC6650-6664 38CAGTCTCCTGTACCTGGGCA6657-6676 39AGTCTCCTGTACCTGGGCAA6658-6677 40TCTCCTGTACCTGGGCAATATGA6660-6682 41CTGTACCTGGGCAATATGAT6664-6683 42ATGATGCTACCAAATTTAAG6679-6698 43TACTATTACTTTAACTGCAGATG6752-6774 44TAGCAGTATTTTAGAGGAT6800-6818 45TGTTCCCCCCCCCCCAACTACTAGTT6830-6855 46ATATCGTTTTGTACAATCTGTT6866-6887 47GGATGCTGCACCGGCTGAA6905-6923 48CTATGATAAGTTAAAG6935-6950HPV 26SEQ IDNO5′→3′Locus in HPV 26 49TAGTACATTATCTGCAGCAT6619-6638 50ATTATCTGCAGCATC6625-6639 51TGCAGCATCTGCATCCACTC6631-6650 52GCATCTGCATCCACTCCATTTAAA6635-6658 53CTCCATTTAAACCATCTGAT6648-6667 54TAAAATAACACTTACAACAGATG6727-6749 55TGCCTCCATATTGGAGGAT6775-6793 56ACTAACCTTACCTCCCACTGCTAGTT6805-6830 57CTATAGGTTTATTAAAAACTCT6841-6862 58TAACGCCCCTCCTGTGCCA6880-6898HPV 31SEQ IDNO5′→3′Locus in HPV 31 59TGCAATTGCAAACAG6592-6606 60GCAATTGCAAACAGTGATAC6593-6612 61CAATTGCAAACAGTGATACT6594-6613 62GCAAACAGTGATACTACATTTAA6599-6621 63CTACATTTAAAAGTAGTAAT6612-6631 64CAAAATAACATTATCTGCAGACA6691-6713 65TCCTGCTATTTTGGAAGAT6739-6757 66ATTGACCACACCTCCCTCAGGTTCTT6769-6794 67CTATAGGTTTGTCACCTCACAG6805-6826 68AACTGCCCCCCAAAAGCCC6844-6862HPV 32SEQ IDNO5′→3′Locus in HPV 32 69TGCTACTGTAACAACTGAAG6906-6925 70GCTACTGTAACAACTGAAGA6907-6926 71TACTGTAACAACTGA6909-6923 72ACTGTAACAACTGAAGACAC6910-6929 73CAACTGAAGACACATACAAGTC6917-6938 74CAAAATTACATTATCTGTAGAGG7005-7027 75TCCTGACATACTAGACGAT7053-7071 76TGTAGCTCCACCGCCCTCTGGTACTT7083-7108 77TTATAGATTTGTGCAGTCTCAG7119-7140 78TAAGGTAACAGCACCTGAA7158-7176 79TTTTTCTGACTATTCA7188-7203HPV 33SEQ IDNO5′→3′Locus in HPV 33 80TATGCACACAAGTAACTAGT6624-6643 81CACACAAGTAACTAG6628-6642 82ACAAGTAACTAGTGACAGTA6631-6650 83GTAACTAGTGACAGTACATATAA6635-6657 84GTACATATAAAAATGAAAAT6648-6667 85CAAAGTTACCTTAACTGCAGAAG6727-6749 86TCCAGATATTTTAGAAGAT6775-6793 87TTTAACACCTCCTCCATCTGCTAGTT6805-6830 88CTATAGGTTTGTTACCTCTCAG6841-6862 89AACAGTACCTCCAAAGGAA6880-6898 90CTTAGGTAAATATACA6910-6925HPV 35SEQ IDNO5′→3′Locus in HPV 35 91TCTGCTGTGTCTTCTAGTGA6612-6631 92TGCTGTGTCTTCTAG6614-6628 93GTGTCTTCTAGTGACAGTAC6618-6637 94CTTCTAGTGACAGTACATATAAA6622-6644 95GTACATATAAAAATGACAAT6634-6653 96TAAAATAACACTAACAGCAGATG6713-6735 97CCCGTCCATTTTAGAGGAT6761-6779 98CCTTACACCACCGCCTTCTGGTACCT6791-6816 99ATATCGCTATGTAACATCACAG6827-6848100ACCCAGTGCACCAAAACCT6866-6884HPV 37SEQ IDNO5′→3′Locus in HPV 37101TGTCTACTGACAATG6782-6796102TGTCTACTGACAATGGCGAA6782-6801103TGACAATGGCGAAGTTACAG6789-6808104GACAATGGCGAAGTTACAGA6790-6809105AATGGCGAAGTTACAGAATA6793-6812106CAGAATATAATTCTCAAACA6806-6825107TAAAGTTCCTTTAAAGGCTGAGG6885-6907108TTCTGGTATATTGGAAGAG6933-6951109ATTTGTACCTACTCCAGATAATTCAG6963-6988110TTATAGGTACATTAATTCAAAG6999-7020111TGCAGTTGTTGAAAAAGAA7038-7056112CTTTGCAAAATATACA7068-7083HPV 39SEQ IDNO5′→3′Locus in HPV 39113CTCTATAGAGTCTTC6677-6691114TAGAGTCTTCCATACCTTCT6682-6701115ATAGAGTCTTCCATACCTTC6681-6700116GTCTTCCATACCTTCTACATATG6686-6708117CTACATATGATCCTTCTAAG6700-6719118TACTGTCACATTAACAACTGATG6779-6801119TTCCTCTATATTGGACAA6827-6844120TGTAGCTCCTCCACCATCTGCCAGTT6857-6882121TTACAGATACCTACAGTCTGCA6893-6914122GGATGCTCCAGCACCTGAA6932-6950123ATATGACGGTCTAAAG6962-6977HPV 42SEQ IDNO5′→3′Locus in HPV 42124TATATGTTGGGGAAATCAGCTA6802-6823125CACTGCAACATCTGGTGATA6874-6893126GCAACATCTGGTGATACATATACAG6878-6907CTGCT127CATTAACTGTTGAAGTTATGTCA6978-7000128CCTAACATATTAGAGGAGTGGAATG7019-7044T129CACCACCACCTTCAGGAACT7053-7072130GTTATAGGTATGTACAATCAGAAG7083-7106131GCTAAGGTAACAACGCCAGAAAAAA7121-7150AGGAT132CAGACTTTTGGTTTTGGGAGGTAA7158-7181133GAAAAGTTTTCTACTGATTTA7190-7210HPV 43SEQ IDNO5′→3′Locus in HPV 43134CATTTGTTTTGGGAATCAGTTG  21-42135TGACCCTACTGTGCCCAGTA  99-118136ACTGTGCCCAGTACATATGACAATGC 106-135AAAG137GTTTATATTTCAATTATGCATAA 177-199138CCAGAGGTTATGACATATATT 211-231139CCCACATTATTAGAGGACTGGAA 244-266140CCACCTGCCTCTGCTTCTTTG 280-300141CGCTTTTTGTCTAACAAGGCCATTG 313-337142CCAAAGGAACGGGAGGATCCCTA 358-380143CTTACAGAAAAGTTTTCTGCACAAC 409-433HPV 44SEQ IDNO5′→3′Locus in HPV 40144TGCCACTACACAGTC6719-6733145CTACACAGTCCCCTCCGTCT6724-6743146TGCCACTACACAGTCCCCTC6719-6738147CAGTCCCCTCCGTCTACATATA6729-6750148CTACATATACTAGTGAACAA6742-6761149TAGTATTACCTTAACGGCGGAGG6821-6843150TGCTGGTATTTTAGAACAG6869-6887151GTTGTCGCCGCCCCCAAATGGTACC6899-6924T152ATACAGATATGTGCAGTCCCAG6935-6956153GCCACCCCCTGAAAAGGCA6974-6992154CTATGCAAAATTAAGT7004-7019HPV 45SEQ IDNO5′→3′Locus in HPV 45155TGCCTCTACACAAAATCCTG6651-6670156CTCTACACAAAATCC6654-6668157ACAAAATCCTGTGCCAAGTA6660-6679158CAAAATCCTGTGCCAAGTAC6661-6680159AATCCTGTGCCAAGTACATATG6664-6685160GTACATATGACCCTACTAAG6677-6696161CACTATTACTTTAACTGCAGAGG6756-6778162TAGTAGTATATTAGAAAAT6804-6822163TGTCCCTCCACCACCTACTACAAGTT6834-6859164ATATCGTTTTGTGCAATCAGTT6870-6891165GGATACTACACCTCCAGAA6909-6927HPV 51SEQ IDNO5′→3′Locus in HPV 51166CACTGCCACTGCTGCGGTTT6555-6574167TGCCACTGCTGCGGT6558-6572168CACTGCTGCGGTTTCCCCAA6561-6580169CCACTGCTGCGGTTTCCCCA6560-6579170CTGCGGTTTCCCCAACATTTAC6566-6587171CAACATTTACTCCAAGTAAC6578-6597172TAAAATTACTTTAACTACAGAGG6657-6679173TCCTACCATTCTTGAACAG6705-6723174ATTAACATTACCTCCGTCTGCTAGTT6735-6760175ATATAGGTTTGTTAGAAATGCA6771-6792176GGACACCCCTCCACAGGCT6810-6828177TTTGGCCAAATATAAA6840-6855HPV 52SEQ IDNO5′→3′Locus in HPV 52178TGAGGTTAAAAAGGA6695-6709179TGAGGTTAAAAAGGAAAGCA6695-6714180GAGGTTAAAAAGGAAAGCAC6696-6715181TTAAAAAGGAAAGCACATAT6700-6719182AAAGGAAAGCACATATAAAAAT6704-6725183GCACATATAAAAATGAAAAT6712-6731184CAAAATTACATTAACAGCTGATG6791-6813185TGCCACTATTTTAGAGGAC6839-6857186CCTTACCCCACCACCGTCTGCATCTT6869-6894187ATACAGATTTGTCACTTCTACT6905-6926188AAACACACCACCTAAAGGA6944-6962189TTTAAAGGACTATATG6974-6989HPV 53SEQ IDNO5′→3′Locus in HPV 53190TCCGCAACCACACAGTCTAT6681-6700191CCGCAACCACACAGT6682-6696192CCGCAACCACACAGTCTATG6682-6701193CACAGTCTATGTCTACATATAA6691-6712194CTACATATAATTCAAAGCAA6703-6722195TAAAATATCCCTGTCTGCTGAGG6782-6804196TTCTACCTTACTGGAAGAC6830-6848197TTTGTCGCCTCCTGTTGCCACTAGCT6860-6885198ATACAGATATGTGAAAAGTGCA6896-6917199GGATCAGCCCCCTCCTGAA6935-6953HPV 54SEQ IDNO5′→3′Locus in HPV 54200TACAGCATCCACGCA6633-6647201CAGCATCCACGCAGGATAGC6635-6654202ACGCAGGATAGCTTTAATAA6643-6662203CACGCAGGATAGCTTTAATA6642-6661204ATAGCTTTAATAATTCTGAC6650-6669205TACCATAACCCTTACAGCAGATG6729-6751206TCCCACTATTCTAGAGGAC6777-6795207TATAACCCCCCCAGCTACAAGTAGT6807-6832T208ATATAGGTTTGTACAGTCACAG6843-6864209GAATAATGCCCCTGCAAAGGAA6882-6903HPV 55SEQ IDNO5′→3′Locus in HPV 55210TTTGTTACTGTTGTAGATACTAC6669-6691211ATGACAATATGTGCTGCTAC6705-6724212GACAATATGTGCTGCTACAA6707-6726213TGCTACAACTCAGTCTCCAT6719-6738214CTACAACTCAGTCTCCATCT6721-6740215ACAACTCAGTCTCCATCTAC6723-6742216ATGTTGAGGAGTTTGACTTA6781-6800217TGTTGAGGAGTTTGACTTAC6782-6801218TGAGGAGTTTGACTTACAGT6785-6804HPV 56SEQ IDNO5′→3′Locus in HPV 56219CTGCTACAGAACAGT6630-6644220GCTACAGAACAGTTAAGTAA6632-6651221CAGAACAGTTAAGTAAATAT6636-6655222GAACAGTTAAGTAAATATGATGC6638-6660223GTAAATATGATGCACGAAAA6648-6667224CAAAATTACTTTGTCTGCAGAGG6727-6749225TGCTAACCTACTGGAGGAC6775-6793226GTTATCCCCGCCAGTGGCCACCAGCC6805-5830227ATATAGATATGTTAGAAGCACA6841-6862228GGAACAGCCACCAACAGAA6880-6898HPV 58SEQ IDNO5′→3′Locus in HPV 58229ATGCACTGAAGTAACTAAGG6674-6693230CACTGAAGTAACTAAGGAAG6677-6696231TGAAGTAACTAAGGA6680-6694232GAAGTAACTAAGGAAGGTAC6681-6700233CTAAGGAAGGTACATATAAAAA6688-6709234ATAAAAATGATAATTTTAAG6703-6722235CAAAATTACACTAACTGCAGAGA6776-6798236TTCCAATATTTTGGAGGAC6824-6842237TTTAACACCTCCTCCGTCTGCCAGTT6854-6879238ATATAGATTTGTTACCTCCCAG6890-6911239AACAGCACCCCCTAAAGAA6929-6947HPV 59SEQ IDNO5′→3′Locus in HPV 59240TTCTACTACTTCTTC6643-6657241ACTACTTCTTCTATTCCTAA6647-6666242ACTTCTTCTATTCCTAATGT6650-6669243TCTTCTATTCCTAATGTATACAC6653-6675244ATGTATACACACCTACCAGT6666-6685245TAAAATAACATTAACTACAGAGG6745-6767246TACCACTATTTTGGAGGAT6793-6811247TGTTACACCACCTCCTACTGCTAGTT6823-6848248ATACCGTTTTGTTCAATCTGCT6859-6880249GGACACCGCACCGCCAGTT6898-6916250TTATGACAAACTAAAG6928-6943HPV 61SEQ IDNO5′→3′Locus in HPV 61251CTGCTACATCCCCCC6803-6817252ACATCCCCCCCTGTATCTGA6808-6827253CATCCCCCCCTGTATCTGAA6809-6828254CCCCTGTATCTGAATATAAAGC6815-6836255CTGAATATAAAGCCACAAGC6824-6843256TAAAATACATTTAACCCCTGAAA6903-6925257TAAGGCCTTGTTGGATGAC6951-6969258TGTGGTACCACCACCCTCTACCAGTT6981-7006259ATATAGGTTTTTGCAGTCCAGA7017-7038260GGGTGCTGCTGCCCCGCCGCCC7056-7077261CTATGCCAAGTTATCC7089-7104HPV 62SEQ IDNO5′→3′Locus in HPV 62262CCGCCTCCACTGCTG  92-106263GCCTCCACTGCTGCAGCAGA  94-113264CTGCTGCAGCAGAATACACG 101-120265GCAGAATACACGGCTACCAA 109-128266CAGAATACACGGCTACCAAC 110-129267CAAAATACAGTTAACCCCCGAAA 189-211268CAAGGACCTTTTGGATGAC 237-255269GGTTTTACCTCCCCCTTCCACTAGTT 267-292270ATATCACTATTTCGAGTCTCGG 303-324271GGGGCTGCCTACCCGTCCC 342-360272GTATGCGCAAATGACA 372-387HPV 66SEQ IDNO5′→3′Locus in HPV 66273CAGCTAAAAGCACAT6680-6694274CAGCTAAAAGCACATTAACT6680-6699275CTAAAAGCACATTAACTAAA6683-6702276TTAACTAAATATGATGCCCG6694-6713277CTAAATATGATGCCCGTGAA6698-6717278TAAAATAACCTTAACTGCAGAAG6777-6799279TAATACTTTATTAGACGAT6825-6843280CTTATCCCCACCAGTTGCAACTAGCT6855-6880281ATATAGGTATATTAAAAGCACA6891-6912282GGAACAGCCCCCTGCAGAA6930-6948283CCTGGCTAAATATAAG6960-6975HPV 67SEQ IDNO5′→3′Locus in HPV 67284CTGAGGAAAAATCAG6655-6669285GAGGAAAAATCAGAGGCTAC6657-6676286ATCAGAGGCTACATACAAAAATG6665-6687287AGGAAAAATCAGAGGCTACA6658-6677288CTACATACAAAAATGAAAAC6673-6692289CAAAATATCCCTTACTGCAAATG6752-6774290TCCAGATATATTAGAGGAC6800-6818291CCTTACACCACCTCCTTCAGGTAATT6830-6855292ATATAGATTTGTTACCTCGCAG6866-6887293AACATCCCCTCCAACAGCA6905-6923294TCTTAAAAAGTACAGT6935-6950HPV 68SEQ IDNO5′→3′Locus in HPV 68295CTACTACTGAATCAG2653-2667296TGAATCAGCTGTACCAAATA2660-2679297GAATCAGCTGTACCAAATAT2661-2680298CAGCTGTACCAAATATTTATGA2665-2686299ATATTTATGATCCTAATAAA2677-2696300TCCTGCTATTTTGGATGAT2804-2822301TACTATAACATTGTCCACTGATG2756-2778302TGTTGCCCCTCCACCATCTGCTAGTC2834-2859303ATACCGCTATCTGCAATCAGCA2870-2891304AGACGCCCCTGCACCTACT2909-2927305ATATGATGGCTTAAAC2939-2954HPV 69SEQ IDNO5′→3′Locus in HPV 69306TATTAGTACTGTATCTGCAC6572-6591307CTGTATCTGCACAAT6580-6594308CTGTATCTGCACAATCTGCA6580-6599309TGCACAATCTGCATCTGCCA6587-6606310CAATCTGCATCTGCCACTTTTA6591-6612311CCACTTTTAAACCATCAGAT6604-6623312TAAAATTACTCTTACCACTGATG6683-6705313TTCTACTATTTTGGAAAAT6731-6749314CCTTACCTTGCCTCCTACTGCTAGT6761-6786T315ATATAGGTTTATTAAAAATTCA6797-6818316CGATGCCCCTGCACAGCCC6836-6854HPV 70SEQ IDNO5′→3′Locus in HPV 70317TGTCTGCCTGCACCGAAACG6614-6633318CTGCACCGAAACGGC6621-6635319GAAACGGCCATACCTGCTGT6628-6647320CGAAACGGCCATACCTGCTG6627-6646321CGGCCATACCTGCTGTATATAG6632-6653322CTGTATATAGCCCTACAAAG6644-6663323TACTATCACATTAACTGCTGACG6723-6745324TCCTGCAATTTTGGACAAT6771-6789325AGTTACCCCTCCACCATCTGCAAG6801-6826CT326GTATAGGTATTTACAATCAGCA6837-6858327GGATGCTCCTACACCTGAA6876-6894328CTATGACGATTTAAAA6906-6921HPV 72SEQ IDNO5′→3′Locus in HPV 72329ATCTGTTGGTTTAATGAGCT6759-6778330TTTGTGACAGTTGTAGATAC6780-6799331CTGCCACAGCGTCCT6829-6843332ACAGCGTCCTCTGTATCAGA6834-6853333CCACAGCGTCCTCTGTATCA6832-6851334AGCGTCCTCTGTATCAGAATAT6836-6857335CAGAATATACAGCTTCTAAT6850-6869336TAAAATTCACTTAACTCCTGAAA6929-6951337TAAGGCCTTATTGGATGAC6977-6995338TGTGGTGCCTCCTCCTTCTACCAGTT7007-7032339CTATAGGTTTTTGCAGTCTCGT7043-7064340GGGGGCTGCCACCCCTCCTCCT7082-7103341ATATGCTAACTTATCC7115-7130HPV 74SEQ IDNO5′→3′Locus in HPV 74342CCTACCTCACAATCG1686-1700343CTCACAATCGCCTTCTGCTA1691-1710344ACCTCACAATCGCCTTCTGC1689-1708345CAATCGCCTTCTGCTACATATA1695-1716346ACAATCGCCTTCTGCTACATAT1694-1715347CTACATATAATAGTTCAGAC1708-1727348TAGTATTAAGTTAACTGCTGAGG1787-1809349TCCTACAGTTTTAGAAGAG1835-1853350GCTAACGCCTCCCCCCAATGGTACTT1865-1890351CTACAGATATGTGCAGTCCCAG1901-1922352ACCTACGCCTGATAAAGCA1940-1958353CTATGCAAATTTAAGT1970-1985HPV 82SEQ IDNO5′→3′Locus in HPV 82354TGCTGTTACTCCATC6608-6622355TGCTGTTACTCCATCTGTTG6608-6627356ACTCCATCTGTTGCACAAAC6615-6634357AAACATTTACTCCAGCAAAC6631-6650358TAAAATCACTTTAACTACTGAAA6710-6732359TTCTACAATTTTAGAACAG6758-6776360ATTAACATTGCCCCCCTCCGCTAGTT6788-6813361CTATCGATTTGTAAAAAATGCA6824-6845362GGACAGTCCTCCACAGGCT6863-6881HPV CP8061SEQ IDLocus in HPVNO5′→3′CP8061363TCTGTGCTACCAAAACTGTT  86-105364CTACCAAAACTGTTG  92-106365ACCAAAACTGTTGAGTCTAC  94-113366AACTGTTGAGTCTACATATAAA  99-120367GTTGAGTCTACATATAAAGC 103-122368CTACATATAAAGCCTCTAGT 110-129369TGTTATTAATTTAACAGCTGAAA 189-211370TGCTACATTACTGGAGGAC 237-255371GTTCTTACCACCTCCTACTG 267-286372CTACCGCTTTTTACAGTCTCAG 303-324373AAACAGTCCTCCTCCTGCAGAA 342-363374CTATGCAGATCTTACA 375-390HPV CP8034SEQ IDLocus in HPVNO5′→3′CP8034375CAGCTACATCTGCTG  92-106376GCTACATCTGCTGCTGCAGA  94-113377ACATCTGCTGCTGCAGAATACA  97-118378TGCTGCAGAATACAAGGCCT 105-124379GCTGCAGAATACAAGGCCTC 106-125380CAGAATACAAGGCCTCTAAC 110-129381TAAAATACAGTTAACACCAGAAA 189-211382CAAGGCACTGTTGGATGAT 237-255383TGTGTTGCCACCTCCTTCCACCAGTT 267-292384ATATCGCTTTTTACAGTCTCGG 303-324385GGGTGCTGCTGCCCCTGCGCCC 342-363386TTATGCCGACATGTCA 375-390HPV L1AE5SEQ IDLocus in HPVNO5′→3′L1AE5387ATCTACTGCAACTACTAATC  69-88388CTGCAACTACTAATC  74-88389CTGCAACTACTAATCCAGTT  74-93390ACTACTAATCCAGTTCCATCTA  79-100391CTAATCCAGTTCCATCTATA  83-102392CTATATATGAACCTTCTAAA  98-117393TAAAATTACACTTACTACTGATG 177-199394TCCTACTATTTTAGATAGT 225-243395TGTTAGTCCTCCCCCATCTGCTAGCT 255-280396ATATAGGTTTTTACAGTCATCT 291-312397GGATGTGGTTGTTCCACAA 330-348HPV MM4SEQ IDLocus in HPVNO5′→3′MM4398CTGCTGTTACTCAATCTGTT  92-111399TGCTGTTACTCAATC  93-107400GTTACTCAATCTGTTGCACA  97-116401TGCACAAACATTTACTCCAG 111-130402TTACTCAATCTGTTGCACAAAC  98-119403AAACATTTACTCCAGCAAAC 116-135404TAAAATCACTTTAACTACTGAAA 195-217405TTCTACAATTTTAGAACAG 243-261406ATTAACCTTGCCCCCCTCAGCTAGTT 273-298407CTATCGATTTGTAAAAAATGCA 309-330408GGACAGTCCTCCACAGGCT 348-366HPV MM7SEQ IDLocus in HPVNO5′→3′MM7409TGCTGCTACACAGGC  93-107410GCTGCTACACAGGCTAATGA  94-113411TGCTACACAGGCTAATGAAT  96-115412CTACACAGGCTAATGAATACAC  98-119413ATGAATACACAGCCTCTAAC 110-129414CAAAATACATCTTACCCCTGAAA 189-211415TGAACATTTATTGGATGAG 237-255416CGTGTTACCACCTCCTTCCACCAGCC 267-292417CTATCGCTATCTGCAGTCCCGT 303-324418GGGTCCTTCCGCCCCTGCCCCT 342-363419TTATGATGGCCTTGTA 375-390HPV MM8SEQ IDLocus in HPVNO5′→3′MM8420TGCTACCAACACCGA  93-107421CTACCAACACCGAATCAGAA  95-114422CCAACACCGAATCAGAATATAA  98-119423CAGAATATAAACCTACCAAT 110-129424TAAGGTCCGTCTGACTCCAGAGG 189-211425TGACTCCTTATTAGATGAG 237-255426TGTTGTGCCCCCTCCCTCCACAAGTT 267-292427CTATAGGTACTTGCAGTCTCGC 303-324428GGGGGCCGCCGCCGCCAAGCCT 342-363429TTATGCTGGCATGTCC 375-390


The sequences of the probes listed above are either identical or complementary to the corresponding sequences of HPV subtypes so that the probes can hybridize with the sequences of HPV subtypes perfectly.


According to a preferred embodiment of the present invention, a detector for detecting and simultaneously diagnosing 39 subtypes of human papilloma viruses (HPV) contained in a biological sample is provided. Please refer to FIG. 1. The detector 10 is an oligonucleotide biochip. The detector 10 includes a carrier 11 and a plurality of micro-dots 12 immobilized on the carrier 11. The carrier 11 is a nylon membrane. Each micro-dot 12 is used for identifying one particular HPV subtype. There is at least one oligonucleotide sequence contained in each micro-dot 12 that is specific to one particular HPV subtype. The oligonucleotide sequences are the probes selected from the above list for each HPV subtype respectively. For example, the probe on the carrier 11 could contain at least one sequence, which is selected from SEQ ID NO 1 to SEQ ID NO 12 (shown above), for identifying the subtype 6 of human papilloma viruses (HPV 6).


As described in the above, the probes will hybridize specifically with the L1 gene sequence of the corresponding HPV subtype. Preferably, the probes have a length between 15-30 bases. The oligonucleotide sequences contained in each micro-dot 12 serve as a detection probe, which hybridizes specifically with the L1 gene sequence of the particular HPV subtype to form a hybridization complex as a detection indicator. Therefore, each micro-dot 12 identifies a specific HPV subtype via a corresponding oligonucleotide of the specific HPV subtype, and thereby detecting and simultaneously identifying subtypes of human papilloma viruses. The sequences of the oligonucleotides provided by the present invention are specific to the epidemics of human papilloma viruses. The detector 10 is able to simultaneously identify 39 different HPV subtype that are HPV 6, HPV 11, HPV 16, HPV 18, HPV 26, HPV 31, HPV 32, HPV 33, HPV 35, HPV 37, HPV 39, HPV 42, HPV 43, HPV 44, HPV 45, HPV 51, HPV 52, HPV 53, HPV 54, HPV 55, HPV 56, HPV 58, HPV 59, HPV 61, HPV 62, HPV 66, HPV 67, HPV 68, HPV 69, HPV 70, HPV 72, HPV 74, HPV 82, HPV CP8061, HPV CP8034, HPV L1AE5, HPV MM4, HPV MM7 and HPV MM8. Furthermore, the detector 10 includes the micro-dot 12 containing a Glutaldehyde-3-phosphodehydrogenase (GAPDH) gene, which is used as an internal control.


EXAMPLE I

The method for immobilizing or mounting the above mentioned probes (oligonucleotides) on the carrier 11 (the nylon membrane) is described as follows.


1.-TTTTTTTTTTTTTTT (SEQ ID NO 469) is added to the 3′ end of the oligonucleotide provided by the present invention by terminal transferase according to the following steps 1.1 to 1.3.


1.1 Mixing the following components:

10X NEBuffer 45μl2.5 mM CoCl25μloligonucleotide5˜300pmol10˜300 mM dATP, dCTP, dTTP or dGTP1μlTerminal Transferase (20 U/μl)0.5˜5μl(NEW English BioLabs, M0252S)Add M.Q. H2O to final volume50μl


1.2 The components are mixed at 37° C. for 15-60 minutes.


1.3 10 μl of 0.2 M EDTA (pH 8.0) is added to the mixture to stop the reaction.


2. The oligonucleotide having 3′ end labeling is mounted on the carrier 11 according to the following steps 2.1 to 2.3.


2.1 The oligonucleotide having 3′ end labeling is mounted on the carrier 11 by a needle having a 400 μm wide head. The distance between each dot is 1200 μm.


2.2 The carrier 11 having the dot array 12 thereon is exposed to UV light, and the detector 10 is formed.


2.3 The detector 10 is preserved in a drying box.


EXAMPLE II

According to another preferred embodiment of the present invention, the carrier 11 could be a glass plate. The method for immobilizing or mounting the above mentioned probes (oligonucleotides) on the carrier 11 (glass plate) is described as follows.


1. The surface of the carrier 11 is treated according to the following steps 1.1 to 1.8.


1.1 The carrier 11 is cleaned in non-fluorescent and soft cleaner.


1.2 The clean carrier 11 is immersed in 10% NaOH.


1.3 The carrier 11 is oscillated in double-distilled water, 1% HCl solution and methanol in sequence for 2 minutes, and dried in an oven.


1.4 The carrier 11 is immersed in 1% 3-aminopropyltrimethoxysilane (APTMS) in 95% aqueous acetone at room temperature for about 2 minutes.


1.5 The carrier 11 is washed in acetone, and the carrier 11 is dried in the oven at 110° C. for 45 minutes.


1.6 The dried carrier 11 is immersed in 0.2% 1,4-phenylene diisothiocyanate, wherein the solvent is 10% pyridine in dimethyl formamide), at room temperature for 2 hours.


1.7 The carrier 11 is washed in methanol and acetone, and then the carrier 11 is dried.


1.8 The dried carrier 11 is preserved in a vacuum and dry box.


2. The oligonucleotides provided by the present invention are mounted on the carrier 11 (the glass plate) according to the following steps 2.1 to 2.3.


2.1 The oligonucleotide having 3′ end labeling is mounted on the carrier 11 by a needle having a 400 μm wide head. The distance between each dot is 1200 μm.


2.2 The carrier 11 is immersed in 1% NH4OH solution for about 2 minutes, washed in double-distilled water, and then dried at room temperature. Thus, the detector 10 is formed.


2.3 The detector 10 is preserved in a dried box.


According to the above description, a biochip for specifically identifying the subtypes of human papilloma viruses contained in a biological sample is provided. Please refer to FIG. 2(a). The biochip 20 includes a carrier 21 and a plurality of micro-dots 22 immobilized on the carrier 21. The carrier 21 is a nylon membrane. The actual length of the nylon membrane is about 1.44 cm and the actual width of the nylon membrane is about 0.96 cm. The micro-dots 22 are mounted on the carrier 21 according to the foresaid method, wherein the distance between each dot is about 1.2 mm and the diameter of each dot is about 0.4 mm. Each micro-dot 22 contains at least one oligonucleotide (15˜30 mer), and each micro-dot 22 is used for specifically identifying a specific HPV subtype. The sequence of the oligonucleotide is selected from the foresaid list.


The subtype of human papilloma viruses identified by each dot of the micro-dots 22 is illustrated in FIG. 2(b). SC (system control) presents the PCR product amplified from any subtype of human papilloma viruses and biotin-contained primer. NC (negative control) presents the plants DNA fragment irrelevant to HPV. IN (internal control) presents the sequence 5′-gcccagactgtgggtggcag-3′ (SEQ ID NO 470) of the housekeeping gene, Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH). In sum, the biochip 20 provided in the present invention is able to detect and simultaneously identify 39 different HPV subtypes contained in the biological sample.


According to another preferred embodiment of the present invention, a method for detecting and simultaneously diagnosing 39 subtypes of human papilloma viruses (HPV) contained in a biological sample is provided. The steps are generally described as follows. First, the L1 gene fragment of human papilloma viruses (HPV) contained in the biological sample is amplified by polymerase chain reaction (PCR) using primers labeled with signaling substance. After the amplification product is obtained, it is hybridized with the detector 11 as describe above to form a hybridization complex. Then, the nonhybridized amplification product is removed from the detector 11. Next, the detector 11 is detected for the existence of the hybridization complex through detecting the signaling substance. The micro-dot 12 having the signaling substance shown thereon means a positive result that the biological sample contains the specific HPV subtypes recognized by the corresponding micro-dot 12. Ultimately, the HPV subtypes contained in the biological sample are thereby detected and simultaneously identified.


The method provided by the present invention for detecting and simultaneously identifying 39 subtypes of human papilloma viruses contained in a sample is described as follows.


EXAMPLE III

1. The biological sample obtained from the patient is treated according to the following steps 1.1 to 1.3.


1.1 The cells are centrifuged at 1,500 rpm at 200□ for 5 minutes.


1.2 The cell pellet is washed in 10 mM Tris (pH 8.5) and dissolved in 8 mM NaOH. Then, the solution is transfer to 1.5 mL micro-tube.


1.3 A proper amount of TreTaq (1U/μl) solution is added to the micro-tube. The reaction is carried out at 95□ for 1 hour. The DNA contained in the sample is obtained after centrifugation at 13,500 rpm, 20□ for 5 minutes. The obtained DNA is preserved at −20□.


EXAMPLE IV

2 The L1 gene fragment of human papilloma viruses (HPV) contained in the biological sample is then amplified by polymerase chain reaction (PCR). The polymerase chain reactions are performed according to the following steps.


2.1 Glutaldehyde-3-phosphodehydrogenase (GAPDH) gene is used as the internal control of the polymerase chain reactions so that it could help confirm whether the detecting protocols are precisely followed. The steps are described according to the following steps 2.1.1 to 2.1.3.


2.1.1 Mixing the following components:

ReagentStockamountFinal concentrationSterile H2O2.610X Taq Buffer0.51X Taq BufferdNTP2.5mM0.4200μMTemplate1GAP241-51) primer10pmol/μl0.20.4pmol/μlGAP241-32) primer10pmol/μl0.20.4pmol/μlProTaq (PROTECH)5U/μl0.10.1U/μlTotal volume (μl)5
1)Gap241-5 (SEQ ID NO 471): CCACCAACTGCTTAGCACCCC

2)Gap241-3 (SEQ ID NO 472): TGCAGCGTACTCCCCACATCA

3) The proper amount of mineral oil is added to prevent the evaporation.


2.1.2 The polymerase chain reaction is performed according to the following programs.

Program 1Program 2Program 394° C., 15 seconds94° C.,57° C.,72° C.,3 minutes1 minute5 minutes72° C., 30 seconds40 cycles


2.1.3 The product of the polymerase chain reaction is analyzed in 2.5% agarose/EtBr (0.5×TBE).


2.2 The DNA contained in the sample is amplified by the polymerase chain reaction according to the following steps.


2.2.1 Mixing the following components:

ReagentStockAmountFinal concentrationSterile H2O4.7-5.710X Taq Buffer11× Taq BufferdNTP2.5mM0.8200μMTemplate1-2BSA10mg/ml0.10.1μg/μlPrimer1,2)10pmol/μl0.60.6pmol/μlPrimer1,2)10pmol/μl0.60.6pmol/μlProTaq (PROTECH)5U/μl0.20.1U/μlTotal volume (μl)10
1)MY09/MY11: Weimin et al., 1997, J. Clin. Microbiol. 35(6): 1304-1310

2)MY11/GP6+: Weimin et al., 1997, J. Clin. Microbiol. 35(6): 1304-1310

3) The proper amount of mineral oil is added to prevent the evaporation.

4) The 5' end of the MY09 and GP6+ primers could be labeled with biotin or Cy5 fluorescent substances.


2.2.2 The polymerase chain reaction is performed according to the following programs.

Program 1Program 2Program 394° C., 45 seconds94° C.,45° C.,72° C.,3 minutes1 minute5 minutes72° C., 1.5 minutes45 cycles


2.2.3 The product of the polymerase chain reaction is analyzed in 2.5% agarose/EtBr (0.5×TBE).


According to the above description, the biochip 20 is used for identifying different HPV subtypes. In one embodiment of the invention, the positive clones of human papilloma viruses are used and detected according to the foresaid method. As previously mentioned, the PCR amplification product could be obtained by different primer sets. One is primer set MY09/MY11, the other is primer set MY11/GP6+. Therefore, the positive clones are respectively amplified by PCR using MY11/MY09 primers and MY11/GP6+ primers. The products of the polymerase chain reaction are analyzed in 2.5% agarose/EtBr, and the electrophoresis results are shown in FIG. 3(a)-(c). FIG. 3(a) shows the electrophoresis result of the analyzed PCR products using primer set MY09/MY11. In FIG. 3(a), M presents DNA marker. Lane 1˜20 present HPV 6, HPV 11, HPV 16, HPV 18, HPV 26, HPV 31, HPV 33, HPV 35, HPV 44, HPV 45, HPV 52, HPV 53, HPV 54, HPV 56, HPV 59, HPV 61, HPV 66, HPV 70, HPV CP8061, and HPV L1AE5 in sequence. FIG. 3(b) shows the electrophoresis result of the analyzed PCR products using primer set MY11/GP6+. In FIG. 3(b), M presents DNA marker. Lane 1˜39 present HPV 6, 11, 16,18, 26, 31, 32, 33, 35, 37, 39, 42, 43, 44, 45, 51, 52, 53, 54, 56, 58, 59, 61, 62, 66, 67, 68, 69, 70, 72, 74, 82, CP8061, CP8304, L1AE5, MM4, MM7, and MM8 in sequence. FIG. 3(c) shows the electrophoresis result of the PCR products using GAPDH primer set. Clearly, the electrophoresis results show the PCR products with correct sizes. That is, PCR products using primer set MY09/MY11 is about 450 bp, the PCR products using primer set MY11/GP6+ is about 190 bp, and the PCR products using GAPDH primer set is about 190 bp.


EXAMPLE V

3. When the carrier 11 is a nylon membrane, the detector 10 provided by the present invention is used for identifying the subtypes of human papilloma viruses according to the following hybridization steps.


3.1 The detector 10 is immersed in 2×SSC solution for 5 minutes.


3.2 The detector 10 is immersed in a buffer containing salmon sperm DNA (50 μg/μl), and the oligonucleotides mounted on the detector 10 are pre-hybridized with the salmon sperm DNA at 35□ for 30 minutes.


3.3 The PCR product having biotin labeled thereon is added into and mixed with a buffer containing salmon sperm DNA (50 μg/μl) at 95□ for about 5 minutes. The denatured DNA is placed on ice.


3.4 The denature DNA is added to the detector 10 and hybridized with the oligonucleotides at 35□ for 4 hours or overnight.


3.5 The detector 10 is washed in 2×SSC/1% SDS solution at 35□ for 15 minutes.


3.6 The detector 10 is washed in 0.2×SSC/0.1% SDS solution at 35□ for 15 minutes.


3.7 The detector 10 is treated in 0.5% isolation reagent for 1 hour.


3.8 The detector 10 is treated with avidin-alkalinephosphatase for about 1 hour.


3.9 The detector 10 is washed in 1×PBST solution.


3.10 The detector 10 is washed in Tris/NaCl solution.


3.11 The detector 10 is treated with NBT/BCIP at room temperature to show the reacting dot in blue.


3.12 The blue dot having the specific oligonucleotide sequence presents the specific subtype of human papilloma viruses contained in the sample.


Preferably, the foresaid PCR amplified products shown in FIGS. 3(a)and 3(b) are then respectively detected by the biochip 20 according to the above steps and the results are shown in FIGS. 4(a) and 4(b). FIG. 4(a) shows the detecting result of detecting the PCR products using primer set MY09/MY11 of HPV positive clones. FIG. 4(b) shows the detecting result of detecting the PCR products using primer set MY11/GP6+ of HPV positive clones. When comparing the results shown in FIG. 4(a) and FIG. 3(b) based on the “SC” dot, it is very clear that the biochip 20 can precisely identify the subtype of human papilloma viruses. Take the result of HPV 6 as example. Since this biochip is hybridized with the PCR product amplified from HPV 6 positive clone, there should be 6 positive micro-dots shown on the biochip 20, including 2 SC micro-dots at the corners, 2 SC micro-dots in the central, and 2 micro-dots of HPV 6. The result clearly shows the exact 6 positive micro-dots without any other false positive micro-dot. Obviously, all the results of other biochips in FIGS. 4(a) and 4(b) show a clear and clean result as well. In other words, there is no cross reaction occurred in the detection, which proves that the biochip provided in the present invention has a very high specificity.


In addition, in another embodiment of the invention, the biological sample obtained from the patient is used and detected. The biochip 20 and the detection method described in the above are used for detecting and identifying the HPV subtypes contained in the sample according to the foresaid method. The results are shown in FIG. 5. When comparing the results shown in FIG. 5 and FIG. 3(b) based on the “SC” dot, the results show that HPV 53 is contained in the sample (1), HPV 45 is contained in the sample (2), HPV 52 is contained in the sample (3), and HPV 39 is contained in the sample (4). Therefore, when detecting the biological sample obtained from a patient, it is very clear that the biochip 20 can precisely identify the subtype of human papilloma viruses.


EXAMPLE VI

According to another embodiment of the present invention, the carrier 11 could be a glass plate. When the carrier 11 is a glass plate, the detector 10 provided by the present invention is used for identifying the subtypes of human papilloma viruses according to the following hybridization steps.


4.1 The PCR product having CyS labeled thereon is purified by PCR Clean Up-M System (Viogene, USA), and the PCR product is precipitated in ethanol. Then, the PCR product is dried.


4.2 The precipitated DNA is dissolved in 12 μl of the buffer (2×SSC/0.1% SDS), and centrifugated for 1 minute, and then placed on boiled water for 2 minutes. Then, the mixture is placed on ice for 5 minutes.


4.3 The mixture is centrifugated for 30 seconds, and 10 μl of the mixture is added to the left side of the dot array 22. A cover slice is carefully covered on the dot array from the left side of the dot array to prevent the bubble formation. Then, the detector 10 is place in Humid Chamber (Sigma, USA), and the dot array is faces downward at 35□ for 4 hours or overnight.


4.4 The detector 10 is vertically placed in the solution A (2×SSC/1% SDS), and the detector is slightly oscillated apart from the cover slice. Then, the detector 20 is washed in a shaker at 160 rpm for 12 minutes.


4.5 The detector 10 is washed in the solution B (0.2×SSC/0.1% SDS) and oscillated at 35□ for 12 minutes. The detector 10 is washed in water. Then the detector 10 is dried.


4.6 The dried detector 10 is scanned by GenePix™4000 (Axon, USA), excited by the light having 635 nm of wavelength, and analyzed by GenePixPro 3.0 (Axon, USA).


According to the above description, a biochip for specifically identifying the subtypes of human papilloma viruses contained in a biological sample is provided. Please refer to FIGS. 6(a) and (b). The biochip 30 includes a carrier 31 and a plurality of micro-dots 32 immobilized on the carrier 31. The carrier 31 is a glass plate. The micro-dots 32 are immobilized on the glass plate 31 according to the foresaid method. Each micro-dot 32 contains at least one oligonucleotide (15˜30mer), and each micro-dot 32 is used for specifically identifying a specific HPV subtype. The sequence of the oligonucleotide is selected from the foresaid list. The subtype of human papilloma viruses identified by each dot of the micro-dots 32 is illustrated in FIG. 6(b).


The biochip 30 is stained with SYBR Green II, scanned by GenePix™ 4000 (Axon, USA) and excited by the light having 635 nm of wavelength. The result is shown in FIG. 7(a). Preferably, the foresaid PCR amplified products are then detected by the biochip 30 according to the above steps and the results are shown in FIGS. 7(b). When comparing the results shown in FIG. 7(a) and FIG. 6(b), it is very clear that the biochip 30 can precisely identify the subtype of human papilloma viruses. The result clearly shows the exact positive micro-dots without any other false positive micro-dot. Besides, there is no cross reaction occurred in the detection, which proves that the biochip provided in the present invention has a very high specificity. Therefore, the biochip having different carriers (made of nylon membrane or glass plate) can obtain the same results and same specificities.


According to the above, the drawbacks in the conventional HPV detecting kit do not exist in the HPV detecting kit provided in the present invention. The HPV detecting kit of the present invention is able to diagnose multiple HPV subtypes (up to 39 different subtypes) at the same time, allowing the rapid and reliable detection and identification of HPV possibly present in a biological sample. Besides, an internal control is included in the detector to show whether the detecting process is well handled so that the detecting result is dependable. In addition, HPV detecting kit of the present invention has a high specificity and accuracy. Hence, the present invention not only has a novelty and a progressive nature, but also has an industry utility.


While the invention has been described in terms of what is presently considered to be the most practical and preferred embodiments, it is to be understood that the invention needs not be limited to the disclosed embodiments. On the contrary, it is intended to cover various modifications and similar arrangements included within the spirit and scope of the appended claims which are to be accorded with the broadest interpretation so as to encompass all such modifications and similar structures.

Claims
  • 1. (canceled)
  • 2. (canceled)
  • 3. (canceled)
  • 4. (canceled)
  • 5. (canceled)
  • 6. (canceled)
  • 7. (canceled)
  • 8. A method for detecting and simultaneously diagnosing at least one subtype of human papilloma viruses (HPV) contained in a biological sample, by the use of a detector wherein said detector comprises: a carrier, a plurality of micro-dots immobilized on said carrier, wherein each micro-dot is for identifying one particular HPV subtype, and said HPV subtype is one selected from a group consisting of (HPV 6, HPV 11, HPV 16, HPV 18, HPV 26, HPV 31, HPV 32, HPV 33, HPV 35, HPV 37, HPV 39, HPV 42, HPV 43, HPV 44, HPV 45, HPV 51, HPV 52, HPV 53, HPV 54, HPV 55, HPV 56, HPV 58, HPV 59, HPV 61, HPV 62, HPV 66, HPV 67, HPV 68, HPV 69, HPV 70, HPV 72, HPV 74, HPV 82, HPV CP8061, HPV CP8034, HPV L1AES, HPV MM4, HPV MM7 and HPV MM8); and at least one oligonucleotide sequence contained in each said micro-dot that is specific to said one particular HPV subtype. wherein said at least one oligonucleotide sequence serves as a detection probe that hybridizes specifically with an L1 gene sequence of said one particular HPV subtype to form a hybridization complex as a detection indicator, so that each micro-dot identifies one particular HPV subtype via a corresponding oligonucleotide of said one particular HPV subtype, and thereby detecting and simultaneously identifying subtypes of human papilloma viruses, wherein the method comprises the steps of: amplifying an L1 gene fragment of human papilloma viruses (HPV) contained in said biological sample and obtaining an amplification product by polymerase chain reaction (PCR) using primers labeled with signaling substance; hybridizing said amplification product with a said detector to form a hybridization complex; removing said amplification product that is not hybridized; and detecting said hybridization complex through detecting said signaling substance, thereby detecting and simultaneously identifying HPV subtypes contained in said biological sample.
  • 9. The method according to claim 8, wherein said amplification product has a length of 450 base pairs by using MY09 as sense primer and MY11 as anti-sense primer in polymerase chain reaction (PCR).
  • 10. The method according to claim 8, wherein said amplification product has a length of 190 base pairs by using MY11 as sense primer and GP6+ as anti-sense primer in polymerase chain reaction (PCR).
  • 11. The method according to claim 8, wherein said signaling substance is biotin.
  • 12. The method according to claim 11, wherein said biotin reacts with avidin-alkalinephosphatase to show said hybridization complex by presenting a particular color.
  • 13. The method according to claim 8, wherein said signaling substance is a fluorescent substance.
  • 14. The method according to claim 13, wherein said fluorescent substance is Cyanine 5.
  • 15. (canceled)
CROSS REFERENCE TO RELATED APPLICATION

This application is a divisional of U.S. patent application Ser. No. 10/601,497, filed Jun. 23, 2003 which is a continuation in part of U.S. patent application Ser. No. 09/885,799 filed Jun. 20, 2001, now abandoned, the entirety of which is hereby incorporated by reference into this application.

Divisions (1)
Number Date Country
Parent 10601497 Jun 2003 US
Child 11520354 Sep 2006 US
Continuation in Parts (1)
Number Date Country
Parent 09885799 Jun 2001 US
Child 10601497 Jun 2003 US