The levels of observation that have been studied by the methodological developments of recent years in molecular biology, are the genes themselves, the translation of these genes into RNA, and the resulting proteins. The question of which gene is switched on at which point in the course of the development of an individual, and how the activation and inhibition of specific genes in specific cells and tissues are controlled is correlatable to the degree and character of the methylation of the genes or of the genome. In this respect, pathogenic conditions may manifest themselves in a changed methylation pattern of individual genes or of the genome.
Colorectal cancer is the fourth leading cause of cancer mortality in men and women, although ranking third in frequency in men and second in women. The 5-year survival rate is 61% over all stages with early detection being a prerequisite for curative therapy of the disease. Up to 95% of all colorectal cancers are adenocarcinomas of varying differentiation grades.
Sporadic colon cancer develops in a multistep process starting with the pathologic transformation of normal colonic epithelium to an adenoma which consecutively progresses to invasive cancer. The progression rate of benign colonic adenomas depends strongly on their histologic appearance: whereas tubular-type adenomas tend to progress to malignant tumors very rarely, villous adenomas, particularly if larger than 2 cm in diameter, have a significant malignant potential.
During progression from benign proliferative lesions to malignant neoplasms several genetic and epigenetic alterations occur. Somatic mutation of the APC gene seems to be one of the earliest events in 75 to 80% of colorectal adenomas and carcinomas. Activation of K-RAS is thought to be a critical step in the progression towards a malignant phenotype. Consecutively, mutations in other oncogenes as well as alterations leading to inactivation of tumour suppressor genes accumulate.
Aberrant DNA methylation within CpG islands is among the earliest and most common alterations in human malignancies leading to abrogation or overexpression of a broad spectrum of genes. In addition, abnormal methylation has been shown to occur in CpG rich regulatory elements in intronic and coding parts of genes for certain tumours. In contrast to the specific hypermethylation of tumour suppressor genes, an overall hypomethylation of DNA can be observed in tumour cells. This decrease in global methylation can be detected early, far before the development of frank tumour formation. Also, correlation between hypomethylation and increased gene expression was reported for many oncogenes. In colon cancer, aberrant DNA methylation constitutes one of the most prominent alterations and inactivates many tumor suppressor genes such as p14ARF, p16INK4a, THBS1, MINT2, and MINT31 and DNA mismatch repair genes such as hMLH1.
In the molecular evolution of colorectal cancer, DNA methylation errors have been suggested to play two distinct roles. In normal colonic mucosa cells, methylation errors accumulate as a function of age or as time-dependent events predisposing these cells to neoplastic transformation. For example, hypermethylation of several loci could be shown to be already present in adenomas, particularly in the tubulovillous and villous subtype. At later stages, increased DNA methylation of CpG islands plays an important role in a subset of tumours affected by the so called CpG island methylator phenotype (CIMP). Most CIMP+ tumours, which constitute about 15% of all sporadic colorectal cancers, are characterised by microsatellite instability (MIN) due to hypermethylation of the hMLH1 promoter and other DNA mismatch repair genes. By contrast, CIMP− colon cancers evolve along a more classic genetic instability pathway (CIN), with a high rate of p53 mutations and chromosomal changes.
However, the molecular subtypes do not only show varying frequencies regarding molecular alterations. According to the presence of either micro satellite instability or chromosomal aberrations, colon cancer can be subclassified into two classes, which also exhibit significant clinical differences. Almost all MIN tumours originate in the proximal colon (ascending and transversum), whereas 70% of CIN tumours are located in the distal colon and rectum. This has been attributed to the varying prevalence of different carcinogens in different sections of the colon. Methylating carcinogens, which constitute the prevailing carcinogen in the proximal colon have been suggested to play a role in the pathogenesis of MIN cancers, whereas CIN tumours are thought to be more frequently caused by adduct-forming carcinogens, which occur more frequently in distal parts of the colon and rectum. Moreover, MIN tumours have a better prognosis than do tumours with a CIN phenotype and respond better to adjuvant chemotherapy.
The identification of markers for the differentiation of colon carcinoma as well as for early detection are main goals of current research.
5-methylcytosine is the most frequent covalent base modification in the DNA of eukaryotic cells. It plays a role, for example, in the regulation of the transcription, in genetic imprinting, and in tumorigenesis. Therefore, the identification of 5-methylcytosine as a component of genetic information is of considerable interest. However, 5-methylcytosine positions cannot be identified by sequencing since 5-methylcytosine has the same base pairing behaviour as cytosine. Moreover, the epigenetic information carried by 5-methylcytosine is completely lost during PCR amplification.
A relatively new and currently the most frequently used method for analysing DNA for 5-methylcytosine is based upon the specific reaction of bisulfite with cytosine which, upon subsequent alkaline hydrolysis, is converted to uracil which corresponds to thymidine in its base pairing behaviour. However, 5-methylcytosine remains unmodified under these conditions. Consequently, the original DNA is converted in such a manner that methylcytosine, which originally could not be distinguished from cytosine by its hybridisation behaviour, can now be detected as the only remaining cytosine using “normal” molecular biological techniques, for example, by amplification and hybridisation or sequencing. All of these techniques are based on base pairing which can now be fully exploited. In terms of sensitivity, the prior art is defined by a method which encloses the DNA to be analysed in an agarose matrix, thus preventing the diffusion and renaturation of the DNA (bisulfite only reacts with single-stranded DNA), and which replaces all precipitation and purification steps with fast dialysis (Olek A, Oswald J, Walter J. A modified and improved method for bisulphite based cytosine methylation analysis. Nucleic Acids Res. 1996 Dec. 15;24(24):5064-6). Using this method, it is possible to analyse individual cells, which illustrates the potential of the method. However, currently only individual regions of a length of up to approximately 3000 base pairs are analysed, a global analysis of cells for thousands of possible methylation events is not possible. However, this method cannot reliably analyse very small fragments from small sample quantities either. These are lost through the matrix in spite of the diffusion protection.
An overview of the further known methods of detecting 5-methylcytosine may be gathered from the following review article: Rein, T., DePamphilis, M. L., Zorbas, H., Nucleic Acids Res. 1998, 26, 2255.
To date, barring few exceptions (e.g., Zeschnigk M, Lich C, Buiting K, Doerfler W, Horsthemke B. A single-tube PCR test for the diagnosis of Angelman and Prader-Willi syndrome based on allelic methylation differences at the SNRPN locus. Eur J Hum Genet. 1997 March-April;5(2):94-8) the bisulfite technique is only used in research. Always, however, short, specific fragments of a known gene are amplified subsequent to a bisulfite treatment and either completely sequenced (Olek A, Walter J. The pre-implantation ontogeny of the H19 methylation imprint. Nat Genet. 1997 November;17(3):275-6) or individual cytosine positions are detected by a primer extension reaction (Gonzalgo M L, Jones P A. Rapid quantitation of methylation differences at specific sites using methylation-sensitive single nucleotide primer extension (Ms-SNuPE). Nucleic Acids Res. 1997 Jun. 15;25(12):2529-31, WO 95/00669) or by enzymatic digestion (Xiong Z, Laird P W. COBRA: a sensitive and quantitative DNA methylation assay. Nucleic Acids Res. 1997 Jun. 15;25(12):2532-4). In addition, detection by hybridisation has also been described (Olek et al., WO 99/28498).
Further publications dealing with the use of the bisulfite technique for methylation detection in individual genes are: Grigg G, Clark S. Sequencing 5-methylcytosine residues in genomic DNA. Bioessays. 1994 June;16(6):431-6, 431; Zeschnigk M, Schmitz B, Dittrich B, Buiting K, Horsthemke B, Doerfler W. Imprinted segments in the human genome: different DNA methylation patterns in the Prader-Willi/Angelman syndrome region as determined by the genomic sequencing method. Hum Mol Genet. 1997 March;6(3):387-95; Feil R, Charlton J, Bird A P, Walter J, Reik W. Methylation analysis on individual chromosomes: improved protocol for bisulphite genomic sequencing. Nucleic Acids Res. 1994 Feb. 25;22(4):695-6; Martin V, Ribieras S, Song-Wang X, Rio M C, Dante R. Genomic sequencing indicates a correlation between DNA hypomethylation in the 5′ region of the pS2 gene and its expression in human breast cancer cell lines. Gene. 1995 May 19;157(1-2):261-4; WO 97/46705 and WO 95/15373.
An overview of the Prior Art in oligomer array manufacturing can be gathered from a special edition of Nature Genetics (Nature Genetics Supplement, Volume 21, January 1999), published in January 1999, and from the literature cited therein.
Fluorescently labelled probes are often used for the scanning of immobilised DNA arrays. The simple attachment of Cy3 and Cy5 dyes to the 5′-OH of the specific probe are particularly suitable for fluorescence labels. The detection of the fluorescence of the hybridised probes may be carried out, for example via a confocal microscope. Cy3 and Cy5 dyes, besides many others, are commercially available.
Matrix Assisted Laser Desorption Ionization Mass Spectrometry (MALDI-TOF) is a very efficient development for the analysis of biomolecules (Karas M, Hillenkamp F. Laser desorption ionisation of proteins with molecular masses exceeding 10,000 daltons. Anal Chem. 1988 Oct. 15;60(20):2299-301). An analyte is embedded in a light-absorbing matrix. The matrix is evaporated by a short laser pulse thus transporting the analyte molecule into the vapour phase in an unfragmented manner. The analyte is ionised by collisions with matrix molecules. An applied voltage accelerates the ions into a field-free flight tube. Due to their different masses, the ions are accelerated at different rates. Smaller ions reach the detector sooner than bigger ones.
MALDI-TOF spectrometry is excellently suited to the analysis of peptides and proteins. The analysis of nucleic acids is somewhat more difficult (Gut I G, Beck S. DNA and Matrix Assisted Laser Desorption Ionisation Mass Spectrometry. Current Innovations and Future Trends. 1995, 1; 147-57). The sensitivity to nucleic acids is approximately 100 times worse than to peptides and decreases disproportionally with increasing fragment size. For nucleic acids having a multiply negatively charged backbone, the ionisation process via the matrix is considerably less efficient. In MALDI-TOF spectrometry, the selection of the matrix plays an eminently important role. For the desorption of peptides, several very efficient matrixes have been found which produce a very fine crystallisation. There are now several responsive matrixes for DNA, however, the difference in sensitivity has not been reduced. The difference in sensitivity can be reduced by chemically modifying the DNA in such a manner that it becomes more similar to a peptide. Phosphorothioate nucleic acids in which the usual phosphates of the backbone are substituted with thiophosphates can be converted into a charge-neutral DNA using simple alkylation chemistry (Gut I G, Beck S. A procedure for selective DNA alkylation and detection by mass spectrometry. Nucleic Acids Res. 1995 Apr. 25;23(8):1367-73). The coupling of a charge tag to this modified DNA results in an increase in sensitivity to the same level as that found for peptides. A further advantage of charge tagging is the increased stability of the analysis against impurities which make the detection of unmodified substrates considerably more difficult.
Genomic DNA is obtained from DNA of cell, tissue or other test samples using standard methods. This standard methodology is found in references such as Sambrook, Fritsch and Maniatis eds., Molecular Cloning: A Laboratory Manual, 1989.
The invention provide a method for the analysis of biological samples for features associated with the development of colon cell proliferative disorders, characterised in that the nucleic acid of at least one member of the group comprising MDR1, APOC2, CACNA1G, EGR4, AR, RB1, GPIb beta, MYOD1, WT1, HLA-F, ELK1, APC, BCL2, CALCA, CDH1, CDKN1A, CDKN1B (p27 Kip1), CDKN2a, CDKN2B, CD44, CSPG2, DAPK1, EGFR, EYA4, GSTP1, GTBP/MSH6, HIC-1, HRAS, IGF2, LKB1, MGMT, MLH1, MNCA9, MSH3, MYC, N33, PAX6, PGR, PTEN, RARB, SFN, S100A2, TGFBR2, TIMP3, TP53, TP73, VHL, CDKN1C, CAV1, CDH13, DRG1, PTGS2, THBS1, TPEF (=TMEFF2; =HPP1), DNMT1, CEA, MB, PCNA, CDC2, ESR1, CASP8, RASSF1, MSH4, MSH5 is/are contacted with a reagent or series of reagents capable of distinguishing between methylated and non methylated CpG dinucleotides within the genomic sequence of interest.
The present invention makes available a method for ascertaining genetic and/or epigenetic parameters of genomic DNA. The method is for use in the improved diagnosis, treatment and monitoring of colon cell proliferative disorders, more specifically by enabling the improved identification of and differentiation between subclasses of said disorder and the genetic predisposition to said disorders. The invention presents improvements over the state of the art in that it enables a highly specific classification of colon carcinomas, thereby allowing for improved and informed treatment of patients.
In a particularly preferred embodiment the present invention makes available methods and nucleic acids that allow the differentiation between colon carcinoma, colon adenoma and normal colon tissue.
Furthermore, the method enables the analysis of cytosine methylations and single nucleotide polymorphisms.
The genes that form the basis of the present invention can be used to form a “gene panel”, i.e. a collection comprising the particular genetic sequences of the present invention and/or their respective informative methylation sites. The formation of gene panels allow for a quick and specific analysis of the disorders they are related with. The gene panels described in this invention can be used with surprisingly high efficiency for the diagnosis, treatment and monitoring of and the analysis of colon cell proliferative disorders as described herein. The use of multiple CpG sites from a diverse array of genes, allows for a relatively high degree of sensitivity and specificity in comparison to single gene diagnostic and detection tools. Furthermore, the panel as described herein may be adapted for use in the analysis of many aspects of colon cell proliferative disorders.
In a preferred embodiment, the method comprises the following steps:
In the first step of the method the genomic DNA sample must be isolated from tissue or cellular sources. Such sources may include colon tissue samples, cell lines, histological slides, body fluids, or tissue embedded in paraffin. Extraction may be by means that are standard to one skilled in the art, these include the use of detergent lysates, sonification and vortexing with glass beads. Once the nucleic acids have been extracted the genomic double stranded DNA is used in the analysis.
In a preferred embodiment the DNA may be cleaved prior to the next step of the method, this may be by any means standard in the state of the art, in particular, but not limited to, with restriction endonucleases.
In the second step of the method, the genomic DNA sample is treated in such a manner that cytosine bases which are unmethylated at the 5′-position are converted to uracil, thymine, or another base which is dissimilar to cytosine in terms of hybridisation behaviour. This will be understood as ‘pretreatment’ hereinafter.
The above described treatment of genomic DNA is preferably carried out with bisulfite (sulfite, disulfite) and subsequent alkaline hydrolysis which results in a conversion of non-methylated cytosine nucleobases to uracil or to another base which is dissimilar to cytosine in terms of base pairing behaviour. If bisulfite solution is used for the reaction, then an addition takes place at the non-methylated cytosine bases. Moreover, a denaturating reagent or solvent as well as a radical interceptor must be present. A subsequent alkaline hydrolysis then gives rise to the conversion of non-methylated cytosine nucleobases to uracil. The chemically converted DNA is then used for the detection of methylated cytosines.
Fragments of the pretreated DNA are amplified, using sets of primer oligonucleotides according to SEQ ID NO: 389 to SEQ ID NO: 518, and a, preferably heat-stable, polymerase. Because of statistical and practical considerations, preferably more than ten different fragments having a length of 100-2000 base pairs are amplified. The amplification of several DNA segments can be carried out simultaneously in one and the same reaction vessel. Usually, the amplification is carried out by means of a polymerase chain reaction (PCR).
The method may also be enabled by the use of alternative primers, the design of such primers is obvious to one skilled in the art. These should include at least two oligonucleotides whose sequences are each reverse complementary or identical to an at least 18 base-pair long segment of the base sequences specified in the appendix (SEQ ID NO: 133 to SEQ ID NO: 388). Said primer oligonucleotides are preferably characterised in that they do not contain any CpG dinucleotides. In a particularly preferred embodiment of the method, the sequence of said primer oligonucleotides are designed so as to selectively anneal to and amplify, only the colon tissue specific DNA of interest, thereby minimising the amplification of background or non relevant DNA. In the context of the present invention, background DNA is taken to mean genomic DNA which does not have a relevant tissue specific methylation pattern, in this case, the relevant tissue being colon, both healthy and diseased.
According to the present invention, it is preferred that at least one primer oligonucleotide is bound to a solid phase during amplification. The different oligonucleotide and/or PNA-oligomer sequences can be arranged on a plane solid phase in the form of a rectangular or hexagonal lattice, the solid phase surface preferably being composed of silicon, glass, polystyrene, aluminium, steel, iron, copper, nickel, silver, or gold, it being possible for other materials such as nitrocellulose or plastics to be used as well.
The fragments obtained by means of the amplification can carry a directly or indirectly detectable label. Preferred are labels in the form of fluorescence labels, radionuclides, or detachable molecule fragments having a typical mass which can be detected in a mass spectrometer, it being preferred that the fragments that are produced have a single positive or negative net charge for better detectability in the mass spectrometer. The detection may be carried out and visualised by means of matrix assisted laser desorption/ionisation mass spectrometry (MALDI) or using electron spray mass spectrometry (ESI).
The amplificates obtained in the second step of the method are subsequently hybridised to an array or a set of oligonucleotides and/or PNA probes. In this context, the hybridisation preferably takes place in the manner described as follows. The set of probes used during the hybridisation is preferably composed of at least 10 oligonucleotides or PNA-oligomers. However, it is understood and as well claimed, that the process can be conducted using only one Oligonucleotide or PNA probe. In the process, the amplificates hybridise to oligonucleotides previously bonded to a solid phase. In a particularly preferred embodiment, the oligonucleotides are taken from the group comprising SEQ ID NO: 519 to SEQ ID NO: 1030. In a further preferred embodiment the oligonucleotides are taken from the group comprising SEQ ID NO: 895 to SEQ ID NO: 1030. The non-hybridised fragments are subsequently removed. Said oligonucleotides contain at least one base sequence having a length of 10 nucleotides which is reverse complementary or identical to a segment of the base sequences specified in the appendix, the segment containing at least one CpG or TpG dinucleotide. In a further preferred embodiment the cytosine of the CpG dinucleotide, or in the case of TpG, the thiamine, is the 5th to 9th nucleotide from the 5′-end of the 10-mer. One oligonucleotide exists for each CpG or TpG dinucleotide.
In the fifth step of the method, the non-hybridised amplificates are removed.
In the final step of the method, the hybridised amplificates are detected. In this context, it is preferred that labels attached to the amplificates are identifiable at each position of the solid phase at which an oligonucleotide sequence is located.
According to the present invention, it is preferred that the labels of the amplificates are fluorescence labels, radionuclides, or detachable molecule fragments having a typical mass which can be detected in a mass spectrometer. The mass spectrometer is preferred for the detection of the amplificates, fragments of the amplificates or of probes which are complementary to the amplificates, it being possible for the detection to be carried out and visualised by means of matrix assisted laser desorption/ionisation mass spectrometry (MALDI) or using electron spray mass spectrometry (ESI). The produced fragments may have a single positive or negative net charge for better detectability in the mass spectrometer.
The aforementioned method is preferably used for ascertaining genetic and/or epigenetic parameters of genomic DNA.
In order to enable this method, the invention further provides the modified DNA of genes MDR1, APOC2, CACNA1G, EGR4, AR, RB1, GPIb beta, MYOD1, WT1, HLA-F, ELK1, APC, BCL2, CALCA, CDH1, CDKN1A, CDKN1B (p27 Kip1), CDKN2a, CDKN2B, CD44, CSPG2, DAPK1, EGFR, EYA4, GSTP1, GTBP/MSH6, HIC-1, HRAS, IGF2, LKB1, MGMT, MLH1, MNCA9, MSH3, MYC, N33, PAX6, PGR, PTEN, RARB, SFN, S100A2, TGFBR2, TIMP3, TP53, TP73, VHL, CDKN1C, CAV1, CDH13, DRG1, PTGS2, THBS1, TPEF (=TMEFF2; =HPP1), DNMT1, CEA, MB, PCNA, CDC2, ESR1, CASP8, RASSF1, MSH4, MSH5 as well as oligonucleotides and/or PNA-oligomers for detecting cytosine methylations within said genes. The present invention is based on the discovery that genetic and epigenetic parameters and, in particular, the cytosine methylation patterns of genomic DNA are particularly suitable for improved diagnosis, treatment and monitoring of colon cell proliferative disorders. Furthermore, the invention enables the differentiation between different subclasses of colon cell proliferative disorders or detection of a predisposition to colon cell proliferative disorders.
The nucleic acids according to the present invention can be used for the analysis of genetic and/or epigenetic parameters of genomic DNA.
This objective is achieved according to the present invention using a nucleic acid containing a sequence of at least 18 bases in length of the pretreated genomic DNA according to one of SEQ ID NO: 133 to SEQ ID NO: 388 and sequences complementary thereto.
The modified nucleic acid could heretofore not be connected with the ascertainment of disease relevant genetic and epigenetic parameters.
The object of the present invention is further achieved by an oligonucleotide or oligomer for the analysis of pretreated DNA, for detecting the genomic cytosine methylation state, said oligonucleotide containing at least one base sequence having a length of at least 10 nucleotides which hybridises to a pretreated genomic DNA according to SEQ ID NO: 133 through to SEQ ID NO: 388. The oligomer probes according to the present invention constitute important and effective tools which, for the first time, make it possible to ascertain specific genetic and epigenetic parameters during the analysis of biological samples for features associated with the development of colon cell proliferative disorders. Said oligonucleotides allow the improved diagnosis, treatment and monitoring of colon cell proliferative disorders and detection of the predisposition to said disorders. Furthermore, they allow the differentiation of different subclasses of colon cell proliferative disorders. The base sequence of the oligomers preferably contains at least one CpG or TpG dinucleotide. The probes may also exist in the form of a PNA (peptide nucleic acid) which has particularly preferred pairing properties. Particularly preferred are oligonucleotides according to the present invention in which the cytosine of the CpG dinucleotide is the 5th-9th nucleotide from the 5′-end of the 13-mer; in the case of PNA-oligomers, it is preferred for the cytosine of the CpG dinucleotide to be the 4th-6th nucleotide from the 5′-end of the 9-mer.
The oligomers according to the present invention are normally used in so called “sets” which contain at least one oligomer for each of the CpG dinucleotides within SEQ ID NO: 133 through SEQ ID NO: 388. Preferred is a set which contains at least one oligomer for each of the CpG dinucleotides, from SEQ ID NO: 519 to SEQ ID NO: 1030. Further preferred is a set comprising SEQ ID NO: 895 to SEQ ID NO: 1030.
In the case of the sets of oligonucleotides according to the present invention, it is preferred that at least one oligonucleotide is bound to a solid phase. It is further preferred that all the oligonucleotides of one set are bound to a solid phase.
The present invention moreover relates to a set of preferably at least 10 n (oligonucleotides and/or PNA-oligomers) used for detecting the cytosine methylation state of genomic DNA using treated versions of said genomic DNA (according to SEQ ID NO: 133 to SEQ ID NO: 388 and sequences complementary thereto). However, it is understood and as well claimed, that the process can be conducted using only one Oligonucleotide or PNA oligomer. These probes enable improved diagnosis, treatment and monitoring of colon cell proliferative disorders. In particular they enable the differentiation between different sub classes of colon cell proliferative disorders and the detection of a predisposition to said disorders. In a particularly preferred embodiment the set comprises SEQ ID NO: 519 to SEQ ID NO: 1030.
The set of oligomers may also be used for detecting single nucleotide polymorphisms (SNPs) using pretreated genomic DNA according to one of SEQ ID NO: 133 to SEQ ID NO: 388.
According to the present invention, it is preferred that an arrangement of different oligonucleotides and/or PNA-oligomers (a so-called “array”) made available by the present invention is present in a manner that it is likewise bound to a solid phase. This array of different oligonucleotide- and/or PNA-oligomer sequences can be characterised in that it is arranged on the solid phase in the form of a rectangular or hexagonal lattice. The solid phase surface is preferably composed of silicon, glass, polystyrene, aluminium, steel, iron, copper, nickel, silver, or gold. However, nitrocellulose as well as plastics such as nylon which can exist in the form of pellets or also as resin matrices are suitable alternatives.
Therefore, a further subject matter of the present invention is a method for manufacturing an array fixed to a carrier material for the improved diagnosis, treatment and monitoring of colon cell proliferative disorders, the differentiation between different subclasses of colon cell proliferative disorders and/or detection of the predisposition to colon cell proliferative disorders. In said method at least one oligomer according to the present invention is coupled to a solid phase. Methods for manufacturing such arrays are known, for example, from patent U.S. Pat. No. 5,744,305 by means of solid-phase chemistry and photolabile protecting groups.
A further subject matter of the present invention relates to a DNA chip for the improved diagnosis, treatment and monitoring of colon cell proliferative disorders. Furthermore the DNA chip enables detection of the predisposition to colon cell proliferative disorders and the differentiation between different subclasses of colon cell proliferative disorders. The DNA chip contains at least one nucleic acid according to the present invention. DNA chips are known, for example, in patent U.S. Pat. No. 5,837,832.
Moreover, a subject matter of the present invention is a kit which may be composed, for example, of a bisulfite-containing reagent, a set of primer oligonucleotides containing at least two oligonucleotides whose sequences in each case correspond or are complementary to a 18 base long segment of the base sequences specified in the appendix (SEQ ID NO: 133 to SEQ ID NO: 388), oligonucleotides and/or PNA-oligomers as well as instructions for carrying out and evaluating the described method. However, a kit along the lines of the present invention can also contain only part of the aforementioned components.
The oligomers according to the present invention or arrays thereof as well as a kit according to the present invention are intended to be used for the improved diagnosis, treatment and monitoring of colon cell proliferative disorders. Furthermore the use of said inventions extends to the differentiation between different subclasses of colon cell proliferative disorders and detection of the predisposition to colon cell proliferative disorders. According to the present invention, the method is preferably used for the analysis of important genetic and/or epigenetic parameters within genomic DNA, in particular for use in improved diagnosis, treatment and monitoring of colon cell proliferative disorders, detection of the predisposition to said disorders and the differentiation between subclasses of said disorders.
The methods according to the present invention are used, for example, for improved diagnosis, treatment and monitoring of colon cell proliferative disorders progression, detection of the predisposition to said disorders and the differentiation between subclasses of said disorders. A further embodiment of the invention is a method for the analysis of the methylation status of genomic DNA without the need for pretreatment. In the first step of the method the genomic DNA sample must be isolated from tissue or cellular sources. Such sources may include cell lines, histological slides, body fluids, or tissue embedded in paraffin. Extraction may be by means that are standard to one skilled in the art, these include the use of detergent lysates, sonification and vortexing with glass beads. Once the nucleic acids have been extracted the genomic double stranded DNA is used in the analysis.
In a preferred embodiment the DNA may be cleaved prior to the treatment, this may be any means standard in the state of the art, in particular with restriction endonucleases. In the second step, the DNA is then digested with one or more methylation sensitive restriction enzymes. The digestion is carried out such that hydrolysis of the DNA at the restriction site is informative of the methylation status of a specific CpG dinucleotide.
In the third step the restriction fragments are amplified. In a preferred embodiment this is carried out using a polymerase chain reaction.
In the final step the amplificates are detected. The detection may be by any means standard in the art, for example, but not limited to, gel electrophoresis analysis, hybridisation analysis, incorporation of detectable tags within the PCR products, DNA array analysis, MALDI or ESI analysis.
The present invention moreover relates to the diagnosis and/or prognosis of events which are disadvantageous or relevant to patients or individuals in which important genetic and/or epigenetic parameters within genomic DNA, said parameters obtained by means of the present invention may be compared to another set of genetic and/or epigenetic parameters, the differences serving as the basis for the diagnosis and/or prognosis of events which are disadvantageous or relevant to patients or individuals.
In the context of the present invention the term “hybridisation” is to be understood as a bond of an oligonucleotide to a completely complementary sequence along the lines of the Watson-Crick base pairings in the sample DNA, forming a duplex structure.
In the context of the present invention, “genetic parameters” are mutations and polymorphisms of genomic DNA and sequences further required for their regulation. To be designated as mutations are, in particular, insertions, deletions, point mutations, inversions and polymorphisms and, particularly preferred, SNPs (single nucleotide polymorphisms).
In the context of the present invention “methylation state analysis” is taken to mean the analysis of cytosines within a nucleic acid in order to ascertain whether they are methylated or not. In the context of the present invention, “epigenetic parameters” are, in particular, cytosine methylations and further modifications of DNA bases of genomic DNA and sequences further required for their regulation. Further epigenetic parameters include, for example, the acetylation of histones which, cannot be directly analysed using the described method but which, in turn, correlates with the DNA methylation.
In the following, the present invention will be explained in greater detail on the basis of the sequences and examples without being limited thereto.
SEQ ID NO: 1 to SEQ ID NO: 64 represent 5′ and/or regulatory regions of the genomic DNA of genes MDR1, APOC2, CACNA1G, EGR4, AR, RB1, GPIb beta, MYOD1, WT1, HLA-F, ELK1, APC, BCL2, CALCA, CDH1, CDKN1A, CDKN1B (p27 Kip1), CDKN2a, CDKN2B, CD44, CSPG2, DAPK1, EGFR, EYA4, GSTP1, GTBP/MSH6, HIC-1, HRAS, IGF2, LKB1, MGMT, MLH1, MNCA9, MSH3, MYC, N33, PAX6, PGR, PTEN, RARB, SFN, S100A2, TGFBR2, TIMP3, TP53, TP73, VHL, CDKN1C, CAV1, CDH13, DRG1, PTGS2, THBS1, TPEF (=TMEFF2; =HPP1), DNMT1, CEA, MB, PCNA, CDC2, ESR1, CASP8, RASSF1, MSH4, MSH5. These sequences are derived from the ensembl database (date 01.10.2001) (http://www.ensembl.org) and will be taken to include all minor variations of the sequence material which are currently unforeseen, for example, but not limited to, minor deletions and SNPs.
SEQ ID 133 to 388 exhibit the pretreated sequences of DNA derived from genes MDR1, APOC2, CACNA1G, EGR4, AR, RB1, GPIb beta, MYOD1, WT1, HLA-F, ELK1, APC, BCL2, CALCA, CDH1, CDKN1A, CDKN1B (p27 Kip1), CDKN2a, CDKN2B, CD44, CSPG2, DAPK1, EGFR, EYA4, GSTP1, GTBP/MSH6, HIC-1, HRAS, IGF2, LKB1, MGMT, MLH1, MNCA9, MSH3, MYC, N33, PAX6, PGR, PTEN, RARB, SFN, S100A2, TGFBR2, TIMP3, TP53, TP73, VHL, CDKN1C, CAV1, CDH13, DRG1, PTGS2, THBS1, TPEF (=TMEFF2; =HPP1), DNMT1, CEA, MB, PCNA, CDC2, ESR1, CASP8, RASSF1, MSH4, MSH5. These sequences will be taken to include all minor variations of the sequence material which are currently unforeseen, for example, but not limited to, minor deletions and SNPs.
SEQ ID NO: 389 to SEQ ID NO: 518 exhibit the sequences of primer oligonucleotides for the amplification of pretreated DNA according to Sequence ID NO: 133 to SEQ ID NO: 388.
SEQ ID NO: 65 to SEQ ID NO: 132 exhibit the sequences of oligomers which are useful for the analysis of CpG positions within genomic DNA according to SEQ ID NO: 1 to SEQ ID NO: 64.
SEQ ID NO: 519 to SEQ ID NO: 1030 exhibit the sequences of oligomers which are useful for the analysis of the methylation status of CpG positions within genomic DNA according to SEQ ID NO: 1 to SEQ ID NO: 64 after treatment of said genomic DNA with bisulfite.
SEQ ID NO: 895 to SEQ ID NO: 1030 exhibit the sequences of oligomers which are particularly useful for the analysis of CpG positions within genomic DNA according to SEQ ID NO: 1 to SEQ ID NO: 64, after treatment of said with bisulfite and are subject to a preferred embodiment of this invention.
In the following examples, multiplex PCR was carried out upon tissue samples originating from colon adenomas or colon carcinoma. Multiplex PCR was also carried out upon healthy colon tissue. Each sample was treated in the manner described below in Example 1 in order to deduce the methylation status of CpG positions, the CpG methylation information for each sample was collated and then used in an analysis, as detailed in Example 2. An alternative method for the analysis of CpG methylation status is described in Example 3.
In the first step the genomic DNA was isolated from the cell samples using the Wizzard kit from (Promega).
The isolated genomic DNA from the samples are treated using a bisulfite solution hydrogen sulfite, disulfite). The treatment is such that all non methylated cytosines within the sample are converted to thiamidine, conversely 5-methylated cytosines within the sample remain unmodified.
The treated nucleic acids were then amplified using multiplex PCRs, amplifying 8 fragments per reaction with Cy5 fluorescently labelled primers. PCR primers used are described in Table 1. PCR conditions were as follows.
Reaction Solution:
10 ng bisulfite treated DNA
3,5 mM MgCl2
400 μM dNTPs
2 pmol each primer
1 U Hot Star Taq (Qiagen)
Forty cycles were carried out as follows. Denaturation at 95° C. for 15 min, followed by annealing at 55° C. for 45 sec., primer elongation at 65° C. for 2 min. A final elongation at 65° C. was carried out for 10 min.
All PCR products from each individual sample were then hybridised to glass slides carrying a pair of immobilised oligonucleotides for each CpG position under analysis. Each of these detection oligonucleotides was designed to hybridise to the bisulphite converted sequence around one CpG site which was either originally unmethylated (TG) or methylated (CG). See Table 2 for further details of all hybridisation oligonucleotides used (both informative and non-informative) Hybridisation conditions were selected to allow the detection of the single nucleotide differences between the TG and CG variants.
5 μl volume of each multiplex PCR product was diluted in 10×Ssarc buffer (10×Ssarc:230 ml 20×SSC, 180 ml sodium lauroyl sarcosinate solution 20%, dilute to 1000 ml with dH2O). The reaction mixture was then hybridised to the detection oligonucleotides as follows. Denaturation at 95° C., cooling down to 10° C., hybridisation at 42° C. overnight followed by washing with 10×Ssarc and dH2O at 42° C.
Fluorescent signals from each hybridised oligonucleotide were detected using genepix scanner and software. Ratios for the two signals (from the CG oligonucleotide and the TG oligonucleotide used to analyse each CpG position) were calculated based on comparison of intensity of the fluorescent signals.
The data obtained according to Example 1 is then sorted into a ranked matrix (as shown in FIGS. 1 to 4) according to CpG methylation differences between the two classes of tissues, using an algorithm. The most significant CpG positions are at the bottom of the matrix with significance decreasing towards the top. Black indicates total methylation at a given CpG position, white represents no methylation at the particular position, with degrees of methylation represented in grey, from light (low proportion of methylation) to dark (high proportion of methylation). Each row represents one specific CpG position within a gene and each column shows the methylation profile for the different CpGs for one sample. On the left side a CpG and gene identifier is shown this may be cross referenced with the accompanying tables (Table 1 and 7) in order to ascertain the gene in question and the detection oligomer used. On the right side p values for the individual CpG positions are shown. The p values are the probabilities that the observed distribution occurred by chance in the data set.
For selected distinctions, we trained a learning algorithm (support vector machine, SVM). The SVM (as discussed by F. Model, P. Adorjan, A. Olek, C. Piepenbrock, Feature selection for DNA methylation based cancer classification. Bioinformatics. 2001 June;17 Suppl 1:S157-64) constructs an optimal discriminant between two classes of given training samples. In this case each sample is described by the methylation patterns (CG/TG ratios) at the investigated CpG sites. The SVM was trained on a subset of samples of each class, which were presented with the diagnosis attached. Independent test samples, which were not shown to the SVM before were then presented to evaluate, if the diagnosis can be predicted correctly based on the predictor created in the training round. This procedure was repeated several times using different partitions of the samples, a method called cross-validation. Please note that all rounds are performed without using any knowledge obtained in the previous runs. The number of correct classifications was averaged over all runs, which gives a good estimate of our test accuracy (percent of correct classified samples over all rounds).
Healthy Colon Tissue Compared to Non Healthy Colon Tissue (Colon Adenoma and Colon Carcinoma) (
Healthy Colon Tissue Compared to Colon Carcinoma Tissue (
Healthy Colon Tissue Compared to Colon Adenoma Tissue (
Colon Carcinoma Tissue Compared to Colon Adenoma Tissue (
A fragment of the bisulfite treated DNA of the gene CD44 (Seq ID NO: 20) was PCR amplified using primers GAAAGGAGAGGTTAAAGGTTG (Seq ID NO 429) and AACTCACTTAACTCCAATCCC (Seq ID NO 430). The resultant fragment (696 bp in length) contained an informative CpG at position 235. The amplificate DNA was digested with the restriction endonuclease Apa I, recognition site GGGCC. Hydrolysis by said endonuclease is blocked by methylation of the CpG at position 235 of the amplificate. The digest was used as a control.
Genomic DNA was isolated from sample using the DNA wizzard DNA isolation kit (Promega). Each sample was digested using Apa I according to manufacturer's recommendations (New England Biolabs).
10 ng of each genomic digest was then amplified using PCR primers GAAAGGAGAGGTTAAAGGTTG and AACTCACTTAACTCCAATCCC. The PCR reactions were performed using a thermocycler (Eppendorf GmbH) using 10 ng of DNA, 6 pmol of each primer, 200 μM of each dNTP, 1.5 mM MgCl2 and 1 U of HotstartTaq (Qiagen AG). The other conditions were as recommended by the Taq polymerase manufacturer. Using the above mentioned primers, gene fragments were amplified by PCR performing a first denaturation step for 14 min at 96° C., followed by 30-45 cycles (step 2: 60 sec at 96° C., step 3: 45 sec at 52° C., step 4: 75 sec at 72° C.) and a subsequent final elongation of 10 min at 72° C. The presence of PCR products was analysed by agarose gel electrophoresis.
PCR products were detectable with Apa I hydrolysed DNA isolated wherein the CpG position in question was up-methylated, when step 2 to step 4 of the cycle program were repeated 34, 37, 39, 42 and 45 fold. In contrast PCR products were only detectable with Apa I hydrolysed DNA isolated from down-methylated DNA (and control DNA) when step 2 to step 4 of the cycle program were repeated 42 and 45 fold. These results were incorporated into a CpG methylation matrix analysis as described in Example 2.
Tables
Number | Date | Country | Kind |
---|---|---|---|
02002551.4 | Feb 2002 | EP | regional |
Filing Document | Filing Date | Country | Kind | 371c Date |
---|---|---|---|---|
PCT/EP03/02035 | 2/27/2003 | WO | 9/16/2005 |