The present invention relates to the field of molecular biology, particularly to a method and a reagent for constructing a library of single-stranded cyclic nucleic acid fragments having double adaptors.
Ever since AB corporation launched the capillary electrophoresis sequencer and the human genome project started in the 1990's, DNA (deoxyribonucleic acid) sequencing technologies have been developing fast at unimaginable speeds. The second and third generations of sequencers were successively launched on the market. Among the second-generation sequencing platforms, the Blackbird sequencing platform from Complete Genomics Corporation (hereinbelow abbreviated as CG) occupies a large market share in clinical research areas such as molecular diagnosis by virtue of its higher sequencing accuracy than other platforms (99.9998%) and greater advantage in sequencing throughput compared to other platforms. However, due to the limitation of sample treatment methods, the library insert fragments of the CG sequencing platform are too small (2×19-35 bp). This results in difficulty in subsequent genomic assembling operations, limiting the application of the platform in genomic de novo sequencing. Moreover, the period of library construction is too long, which would badly retard the progress of scientific research and project operation. The rapid emergence of various next-generation sequencing technologies also poses a challenge. Therefore, it is an urgent and important R&D task to increase the size of library insert fragments, simplify the procedure of library construction, shorten the time required for library construction through technological improvement and innovation, in order to expand the application scope and efficiency of CG sequencing platforms.
The insert fragment introduction process in CG platform's existing construction procedure of a library of single-stranded cyclic nucleic acid fragments having double adaptors considerably restricts the length of library insert fragments. The NT (nick translation) technique used in the SOLiD (Sequencing by Oligonucleotide Ligation and Detection) platform improves the length of library insert fragments to some extent, but has the drawback that the spanning of the insert fragments is very wide. The fragments need to be selected by means of gel recovery, which increases the tediousness of the operation. Moreover, gel recovery would affect the efficiency of recovering the insert fragments.
Additionally, in CG platform's existing construction process of a library of single-stranded cyclic nucleic acid fragments having double adaptors, a plurality of steps of enzymatic reaction and purification are required in order for the sequencing adaptors to be ligated to the genomic DNA fragments to be detected. This takes much time, consumes many reagents and wastes many samples, limiting the speed of sample treatment. Further, the initial sample amount (3 μg) is a disadvantage over other sequencing platforms.
The present invention provides a method and a reagent for constructing a library of single-stranded cyclic nucleic acid fragments having double adaptors. The method enables to increase the length of library insert fragments without the need for gel recovery; and the single-stranded nucleic acid molecules can be directly cyclized following denaturation by heat.
In a first aspect of the present invention, there is provided a method for constructing a library of single-stranded cyclic nucleic acid fragments having double adaptors, comprising the following steps:
disrupting a nucleic acid into nucleic acid fragments for library construction;
ligating a first adaptor sequence to both ends of the nucleic acid fragments;
performing a first PCR amplification to obtain first products having the first adaptor sequence at both ends, wherein the primer sequences used in the first PCR have a U base site;
digesting the first products with a USER enzyme to form sticky ends, followed by cyclization to generate a gap; or alternatively, in the case that the primer sequences used in the first PCR also have a nickase recognition sequence, digesting the first products with a USER enzyme to form sticky ends, followed by cyclization, and then followed by digestion of the cyclized products with a nickase to generate a nick;
initiating controlled nick/gap translation reaction from the nick or gap by using the cyclic nucleic acid molecules as template;
digesting and removing the portion of the respective cyclic nucleic acid molecules that does not undergo the controlled nick/gap translation reaction to obtain linear nucleic acid molecules;
ligating a second adaptor sequence to both ends of the linear nucleic acid molecules;
performing a second PCR amplification to obtain second products having the second adaptor sequence at both ends; and
denaturing the second products to obtain single-stranded nucleic acid molecules, and cyclizing one of the single-stranded nucleic acid molecules with a mediating sequence complementary to both ends of the single-stranded nucleic acid molecule to obtain the library of single-stranded cyclic nucleic acid fragments having double adaptors.
In a preferred embodiment of the present invention, the first adaptor sequence comprises a first 5′ adaptor sequence and a first 3′ L-type adaptor sequence that respectively ligate to the 3′ end and the 5′ end of each strand of the fragments; the first 5′ adaptor sequence comprises a 5′-end-phosphorylated long strand and a complementary short strand, the long strand having a tag sequence in the middle, the short strand having dideoxy modification at the 3′ end, and the short strand comprising a U base site; and a portion of the first 3′ L-type adaptor sequence which is adjacent to the ligated fragment is complementary to part of the bases of the first 5′ adaptor sequence; and
said ligating a first adaptor sequence to both ends of the nucleic acid fragments specifically comprises:
dephosphorylating the nucleic acid fragments;
subjecting the dephosphorylated nucleic acid fragments to end repairing;
ligating the first 5′ adaptor sequence to the 3′ end of each strand of the nucleic acid fragments;
digesting the U base site of the short strand of the first 5′ adaptor sequence with a USER enzyme;
phosphorylating the USER enzyme-digested nucleic acid fragments; and
ligating the first 3′ L-type adaptor sequence to the 5′ end of each strand of the phosphorylated nucleic acid fragments.
In a preferred embodiment of the present invention, each of the primer sequences used in the first PCR has a nickase recognition sequence and a U base site; and after digesting the U base site with the USER enzyme, sticky ends are formed at both ends of the nucleic acid fragments, and cyclization occurs due to the complementarity of the sticky ends, generating cyclized nucleic acid molecules.
In a preferred embodiment of the present invention, one of the primer sequences used in the first PCR has two U base sites, while the other primer sequence has a U base site; and after digesting the U base sites with the USER enzyme, sticky ends are formed at both ends of the nucleic acid fragments, and cyclization occurs due to the complementarity of the sticky ends, generating cyclized nucleic acid molecules.
In a preferred embodiment of the present invention, following cyclizing the digested first products, the method further comprises: digesting the nucleic acid molecules that are not cyclized.
In a preferred embodiment of the present invention, one of the primer sequences used in the first PCR harbors a biotin label; and prior to the controlled nick/gap translation reaction, streptavidin-labeled magnetic beads are used to bind the products from the first PCR, such that subsequent reactions are performed on the magnetic beads.
In a preferred embodiment of the present invention, in the controlled nick/gap translation reaction, the length of the gap translation fragments generated is controlled by controlling at least one factor selected from the group consisting of the molar ratio of dNTPs to the nucleic acid molecules as template, the enzymatic reaction temperature and the enzymatic reaction time.
In a preferred embodiment of the present invention, said digesting and removing the portion of the respective cyclic nucleic acid molecules that does not undergo the controlled nick/gap translation reaction specifically comprises: first degrading the cyclic nucleic acid molecules with an enzyme having 5′-3′ exonuclease activity until the gaps at both ends meet; and then degrading the resulting single strands with an enzyme having 3′-5′ exonuclease activity or a single strand exonuclease.
In a preferred embodiment of the present invention, the second adaptor sequence comprises a second 5′ adaptor sequence and a second 3′ L-type adaptor sequence that respectively ligate to the 3′ end and the 5′ end of each strand of the linear nucleic acid molecules; the second 5′ adaptor sequence comprises a 5-end-phosphorylated long strand and a complementary short strand, the short strand having dideoxy modification at the 3′ end, and the short strand comprising a U base site; and a portion of the second 3′ L-type adaptor sequence which is adjacent to the ligated fragment is complementary to part of the bases of the second 5′ adaptor sequence; and
said ligating a second adaptor sequence to both ends of the linear nucleic acid molecules specifically comprises:
dephosphorylating the linear nucleic acid molecules;
subjecting the dephosphorylated linear nucleic acid molecules to end repairing;
ligating the second 5′ adaptor sequence to the 3′ end of each strand of the linear nucleic acid molecules;
digesting the U base site of the short strand of the second 5′ adaptor sequence with a USER enzyme;
phosphorylating the USER-enzyme digested fragments; and
ligating the second 3′ L-type adaptor sequence to the 5′ end of each strand of the phosphorylated linear nucleic acid molecules.
In a preferred embodiment of the present invention, following cyclizing the single-stranded nucleic acid molecules, the method further comprises: digesting the single-stranded nucleic acid molecules that are not cyclized.
According to a second aspect of the present invention, there is provided a reagent for constructing a library of single-stranded cyclic nucleic acid fragments having double adaptors, comprising the following components:
a first adaptor sequence, which comprises a first 5′ adaptor sequence and a first 3′ L-type adaptor sequence that respectively ligate to the 3′ end and the 5′ end of each strand of the fragments, wherein the first 5′ adaptor sequence comprises a 5′-end-phosphorylated long strand and a complementary short strand, the long strand having a tag sequence in the middle, the short strand having di deoxy modification at the 3′ end, and the short strand comprising a U base site; and a portion of the first 3′ L-type adaptor sequence which is adjacent to the ligated fragment is complementary to part of the bases of the first 5′ adaptor sequence;
primers for a first PCR, which have U base sites or have a nickase recognition sequence and a U base site, and which are used to obtain first products having the first adaptor sequence at both ends by the first PCR amplification;
a nickase, which is used for digesting the first products to generate a nick;
a USER enzyme, which is used for digesting the first products to generate sticky ends and gaps for cyclization;
components for gap translation reaction, which are used for initiating controlled nick/gap translation reaction from the nick or gap by using the cyclic nucleic acid molecules as template;
a digestive enzyme, which is used for digesting and removing the portion of the respective cyclic nucleic acid molecules that does not undergo the controlled nick/gap translation reaction to obtain linear nucleic acid molecules;
a second adaptor sequence, which comprises a second 5′ adaptor sequence and a second 3′ L-type adaptor sequence that respectively ligate to the 3′ end and the 5′ end of each strand of the linear nucleic acid molecules; wherein the second 5′ adaptor sequence comprises a 5-end-phosphorylated long strand and a complementary short strand, the short strand having dideoxy modification at the 3′ end, and the short strand comprising a U base site; and a portion of the second 3′ L-type adaptor sequence which is adjacent to the ligated fragment is complementary to part of the bases of the second 5′ adaptor sequence;
primers for a second PCR, which are used for performing a second PCR amplification to obtain second products having the second adaptor sequence at both ends; and
a mediating sequence, which is complementary to both ends of one of the single-stranded nucleic acid molecules obtained following denaturation of the second products, and which is used for cyclizing the single-stranded nucleic acid molecule to obtain the library of single-stranded cyclic nucleic acid fragments having double adaptors.
In the method for constructing a library of single-stranded cyclic nucleic acid fragments having double adaptors according to the present invention, fragments of particular lengths are generated by means of introduction of a nickase recognition sequence and/or a U base site in the primer sequences for the first PCR, followed by digestion to generate nicks or gaps, and followed by controlled nick/gap translation reaction. This can control the length of the fragments in a certain range while increasing the length of the library insert fragments. Thus, the fragments do not need to be selected by gel recovery. The finally formed single-stranded nucleic acid molecules can be directly cyclized following denaturation by heat without the need for a screening operation, which simplifies the process of library construction. Moreover, the use of the special L-type adaptor sequences for ligation allows for simplifying the steps and shortening the period of operation.
The present invention is described in further detail below by reference to particular embodiments. Unless otherwise stated, the techniques used in the following embodiments are all conventional techniques known to a person skilled in the art, and the instruments, equipments and reagents used are all publicly available, e.g. commercially available, to a person skilled in the art.
In the present invention, the concepts of “first” and “second” used in any cases should not be construed as conveying the meaning of order or technique, and they serve only to distinguish the objects to which they refer from other objects.
Reference is made to
In the method according to the present invention for constructing a library of single-stranded cyclic nucleic acid fragments having double adaptors, as shown in
In the present invention, nicks can also be generated by employing the principle as shown in
In the present invention, the reaction initiated from the nick or gap is referred to as “controlled nick/gap translation reaction”, because the length of the target fragments generated by the reaction can be controlled in a certain range by controlling the usage amount of dNTPs, the usage amount of the nucleic acid molecules as template, the enzyme reaction temperature and time, among other factors. Nucleic acid fragments having a length in a certain range are suitable for a particular sequencing platform. In general, the length of the target fragments in the present invention is preferably controlled in the range of 50-250 bp. Such a length is several times longer than the length of the target fragments obtained by a conventional library construction protocol for a CG sequencing platform. Moreover, the CNT technique of the present application allows for controlling the library insert fragments in a very narrow range without performing gel recovery, which effectively enhances the operability of the gap translation technique.
Reference is now made to
In a preferred embodiment of the present invention, ligation is performed using an L-type adaptor instead of a conventional adaptor. Reference is now made to
In a preferred embodiment of the present invention, one of the primer sequences used in the first PCR amplification harbors a biotin label. Prior to the controlled nick/gap translation reaction, streptavidin-labeled magnetic beads are used to bind the products from the first PCR amplification, such that subsequent reactions are performed on the magnetic beads. Reference is now made to
The above analysis shows that, in a preferred embodiment of the present invention, by using the unique CNT technique, L-type adaptor ligation technique, and direct single strand cyclization technique following simple thermal denaturation, improvement and optimization are successfully achieved on the library contruction procedure of the double adaptor library construction process with a CG sequencing platform, such that the size of the library insert fragments is increased 2-10 fold compared with the original size, the whole library construction period and cost are decreased by about 40%, and the initial amount required for library construction is decreased from 3 μg to 500 ng.
The present invention is illustrated in detail with reference to the following example.
1. Disruption of genomic DNA:Genomic DNA can be disrupted in a number of methods, and no matter they are a physical ultrasonic method or an enzymatic reaction method, well-established protocols are commercially available. In this example, the physical ultrasonic method was employed for disruption.
A 96-well PCR plate was added with a polytetrafluoroethylene line. 1 μg of genomic DNA was added, then TE buffer solution or enzyme-free pure water was added to make up to 100 μL. The plate was sealed with a membrane and then placed in an E220 ultrasonic disruptor to conduct ultrasonic disruption. The conditions for disruption were shown in Table 1.
2. Selection of fragments following disruption: A magnetic bead purification method or gel recovery method can be employed. In this example, the magnetic bead purification method was used.
The disrupted DNA was added with 45 μL of Ampure XP magnetic beads, and the mixture was mixed well and stood for 7-15 min. The resulting mixture was placed on a magnetic rack, and supernatant was collected. The supernatant was added with 18 μL of Ampure XP magnetic beads, and the mixture was mixed well and stood for 7-15 min. The resulting mixture was placed on a magnetic rack, and supernatant was aspirated off. The magnetic beads were washed twice with 75% ethanol and air dried. Then 30 μL of TE solution was added, and the mixture was mixed well and stood for 7-15 min to allow the recovered products to dissolve.
3. Dephosphorylation reaction of the fragments: The recovered products from the previous step were used, and a system was formulated according to Table 2.
7.2 μL of the reaction solution was added to the recovered products from the previous step. The mixture was mixed well and incubated at 37° C. for 45 min and at 65° C. for 10 min. Then the temperature was ramped down to 4° C. at a rate of 0.1° C. per second.
4. End repairing of the fragments. A system was formulated according to Table 3.
The system was mixed well and the products from the previous step were added. The mixture was mixed well and incubated at 12° C. for 20 min. The reaction was purified with 48 μL of Ampure XP magnetic beads, and the recovered products were dissolved using 40 μL of TE buffer solution.
5. Ligation of 5′ adaptor A sequence : The 5′ adaptor A sequence used in this example was as follows (in this example, the sequences are shown in the direction of from 5′ end to 3′ end from left to right, “//” represents modification group, “phos” represents phosphorylation, “dd” represents dideoxy, “bio” represents biotin, and the characters in bold represent a tag sequence).
A mixed solution of 5′ adaptor A (10 μM) was formulated according to Table 4.
4.5 μL of the mixed solution of 5′ adaptor A formulated (10 μM) was added into the products of the previous step, and the mixture was sufficiently mixed.
A ligation reaction system was formulated according to Table 5.
The 2× ligation buffer 1 used in this example was formulated according to Table 6.
A mixed solution of the ligation reaction system with the adaptor and the products was mixed well, and the mixture was incubated at 25° C. for 30 min and at 65° C. for 10 min, followed by decreasing the temperature to 4° C.
6. One-step reaction of USER enzyme digestion and phosphorylation: Into the reaction solution from the previous step were added 1.2 μL of USER enzyme (1 U/μL) and 1.2 μL of T4 polynueleotide kinase (10 U/μL). The mixture was mixed well and incubated at 37° C. for 20 min. The reaction was purified with 108 μL of Ampure XP magnetic beads. The beads were rinsed with 70% ethanol twice, and with the rinsing liquid having been blot up, were air dried at room temperature for 2 min. Then the beads were resuspended in 48 μL of a 3′ L-type adaptor reaction system.
7. Ligation of 3′ L-type adaptor A sequence:The 3′ L-type adaptor A sequence used in this example was as shown below: CGTTCTCGACUCAGCAGT (SEQ ID NO: 3).
The 3′ L-type adaptor reaction system was formulated according to Table 7:
The Ampure XP magnetic beads resuspended in 48 μL of the 3′ L-type adaptor reaction system was incubated in an incubator at a rotation speed of 300 rpm at 25° C. for 30 min. After reaction was complete, 43.2 μL of Ampure XP magnetic bead binding buffer was added to conduct incubation at room temperature for 10 min. The supernatant was removed and the beads were washed with 70% ethanol twice, followed by air dried at room temperature for 5-10 min. The recovered products were dissolved with 30 μL of TE buffer solution.
This step achieved the ligation of the target nucleic acid fragments with the adaptor A. The total amount and yield of the products before and after ligation were as shown in Table 8.
8. Polymerase chain reaction:
The sequence of primer 1 was as follows:
The sequence of primer 2 was as follows:
A PCR system was formulated according to Table 9.
Into the above system was added 50 μL (180 ng) of the recovered products from the previous step. The mixture was mixed well and reaction was allowed under the conditions set out in Table 10.
After reaction was complete, purification was conducted using 550 μL of Ampure XP magnetic beads, and the recovered products were dissolved with 80 μL of TE buffer. 1 μL of the recovered products was assayed with a Qubit dsDNA HS assay kit (Invitrogen Corp.) to quantitate the concentration of the products (Table 11). 2 μL of the products was used for reaction at the next step.
9. Removal of uracil: A reaction solution as shown in Table 12 below was formulated.
U/μL)
indicates data missing or illegible when filed
The above reaction solution was added into 60 μL (2 μg) of the reaction products from the previous step, and the mixture was mixed well and incubated at 37° C. for 1 h.
10. Double strand cyclization:Reaction system 1 as shown in Table 13 below was formulated.
The reaction products from the previous step were added into reaction system 1. The mixture was mixed well and evenly dispensed into 4 tubes. The tubes were placed in a water bath at 50° C. for reaction for 15 min. After the reaction was complete, the tubes were placed in a water bath at ambient temperature for reaction for 15 min.
Reaction system 2 as shown in Table 14 below was formulated.
Into each of the 4 tubes of reaction system 1 was added 50 μL of reaction system 2, and the tubes were incubated at room temperature for 1 h.
330 μL of Ampure XP magnetic beads was added into the reaction products of each tube (500 μL). The mixture in each tube was mixed well and stood for 7-15 min. After placing the tubes on a magnetic rack, supernatant was collected. The supernatant was added with 170 μL of Ampure XP magnetic beads, and the mixture was mixed well and stood for 7-15 min. After placing the tubes on a magnetic rack, supernatant was aspirated off, and the magnetic beads were washed with 75% ethanol twice. After air drying the magnetic beads, 65 μL of TE buffer was added to each of the 4 tubes to dissolve the purified products.
11. Linear digestion: A reaction system as shown in Table 15 below was formulated.
The products from the previous step were added into the reaction system, and the mixture was mixed well and incubated at 37° C. for 1 h.
Purification was conducted using 80 μL of Ampure XP magnetic beads, and the recovered products were dissolved using 82 μL of TE buffer. 1 μL of the recovered products were assayed with a Qubit dsDNA HS assay kit (Invitrogen Corp.) to quantitate the concentration of the products. 700 ng of the products was used for reaction at the next step. The initiation site for CNT reaction on the double-strand cyclized DNA formed in this example is in the form of gap.
12. Dephosphorylation:A reaction system as shown in Table 16 below was formulated.
80 μL (700 ng) of the products from the previous step was added into the reaction system, and the mixture was mixed well and incubated at 37° C. for 1 h.
Purification was conducted using 210 μL of Ampure XP magnetic beads, and the recovered products were dissolved using 55 μL of TE buffer. The concentration of the products was quantitated using a Qubit dsDNA HS assay kit (Invitrogen Corp.). 500 ng of the products were used for reaction at the next step.
13. Binding to streptavidin magnetic beads:Magnetic bead binding buffer and rinsing buffers were formulated according to the systems as shown in Tables 17-19.
75 μL of MyOne Streptavidin C1 magnetic beads was used, and the supernatant was aspirated off. The beads were rinsed with 350 μL of 1×LSBB, then resuspended in 100 μL of 2×LSBB. 100 μL of dephosphorylated cyclized DNA (570 ng) diluted with enzyme-free pure water was added. The mixed solution of the beads and the DNA was incubated at 30 rpm at room temperature for 1 h.
The beads were rinsed with 350 μL of HSWB and 350 μL of LSWB respectively once, and equilibrated with 200 μL of 1×NEBuffer2 (containing 0.025% Tween-20). After each rinsing, the supernatant should be aspirated off, and after the last equilibration, the supernatant should be aspirated off thoroughly. The beads were placed on ice to precool for at least 10 min.
14. On-beads reaction for CNT: A reaction system as shown in Table 20 below was formulated.
60 μL of the reaction system was quickly added into the precooled magnetic beads, and the mixture was rapidly mixed well and incubated at 8° C. for 15 min.
1.5 μL of 0.5 M EDTA was added, and the mixture was mixed well. The beads were rinsed with 350 μL of HSWB and 350 μL of LSWB respectively once, and equilibrated with 200 μL of 1×NEBuffer4 (containing 0.025% Tween-20). The supernatant was aspirated off thoroughly.
15. On-beads reaction for 3′-5′ exonuclease digestion:A reaction system as shown in Table 21 below was formulated.
80 μL of the reaction system was quickly added into the magnetic beads from the previous step, and the mixture was rapidly mixed well and incubated at 25° C. for 1 h. 2 μL of 0.5 M EDTA was added, and the mixture was mixed well. The beads were rinsed with 350 μL of HSWB and 350 μL of LSWB respectively once, and equilibrated with 200 μL of 1×Exo VII reaction buffer (containing 0.025% Tween-20). The supernatant was aspirated off thoroughly.
16. On-beads reaction for single strand digestion:A reaction system as shown in Table 22 below was formulated.
35 μL of the reaction system was quickly added into the magnetic beads from the previous step, and the mixture was rapidly mixed well and incubated at 37° C. for 30 min. 0.8 μL of 0.5 M EDTA was added, and the mixture was mixed well. The beads were rinsed with 350 μL of HSWB and 350 μL of LSWB respectively once, and equilibrated with 200 μL of 1×Exo VII reaction buffer (containing 0.025% Tween-20). The supernatant was aspirated off thoroughly.
17. On-beads reaction for end repairing:A reaction system as shown in Table 23 below was formulated.
80 μL of the reaction system was quickly added into the magnetic beads from the previous step, and the mixture was rapidly mixed well and incubated at 12° C. for 20 min. 2 μL of 0.5 M EDTA was added, and the mixture was mixed well. The beads were rinsed with 350 μL of HSWB and 350 μL of LSWB respectively once, and equilibrated with 200 μL of 1×NEBuffer2 reaction buffer (containing 0.025% Tween-20). The supernatant was aspirated off thoroughly.
18. On-beads reaction for dephosphorylation: A reaction system as shown in Table 24 below was formulated.
60 μL of the reaction system was quickly added into the magnetic beads from the previous step, and the mixture was rapidly mixed well and incubated at 37° C. for 45 min. 1.5 μL of 0.5 M EDTA was added, and the mixture was mixed well. The beads were rinsed with 350 μL of HSWB and 350 μL of LSWB respectively once, and equilibrated with 200 μL of 1×NEBuffer2 reaction buffer (containing 0.025% Tween-20). The supernatant was aspirated off thoroughly.
19. On-beads reaction for ligation of 5′ adaptor B sequence:The adaptor B sequence used in this example was as follows:
A mixed solution of 5′ adaptor B (10 μM) was formulated according to the system as shown in Table 25.
A ligation reaction system was formulated according to the system as shown in Table 26.
78 μL of the reaction system was added into the magnetic beads from the previous step, and the mixture was mixed well. 2 μL of T4 DNA ligase (fast) (600 U/μL) were added rapidly, and the mixture was mixed well and incubated at 25° C. for 60 min and at 65° C. for 10 min, followed by cooling to 4° C. 1.5 μL of T4 polynueleotide kinase (10 U/μL) was added, and the mixture was mixed well and incubated at 37° C. for 20 min. 2 μL of 0.5 M EDTA was added, and the mixture was mixed well. The beads were rinsed with 350 μL of HSWB and 350 μL of LSWB respectively once, and equilibrated with 200 μL of 1×NEBuffer2 reaction buffer (containing 0.025% Tween-20). The supernatant was aspirated off thoroughly.
20. On-beads reaction for ligation of 3′ L-type adaptor B sequence:The 3′ L-type adaptor B sequence used in this example was/5Phos/CATGTAGTGTACGATCCGACTT (SEQ ID NO: 8).
A 3′ L-type adaptor reaction system was formulated according to the system as shown in Table 27:
80 μL of the reaction system was added into the magnetic beads from the previous step, and the mixture was mixed well and incubated at 25° C. for 60 min, followed by decreasing the temperature to 14° C. at a rate of 0.1° C. per second. 2 μL of 0.5 M EDTA was added, and the mixture was mixed well. The beads were rinsed with 350 μL of HSWB and 350 μL of LSWB respectively twice. The supernatant was aspirated off thoroughly.
40 μL of 0.1 M sodium hydroxide was added, and the mixture was mixed well and incubated at room temperature for 10 min. The supernatant was aspirated, and 20 μL of 0.3 M acidic buffer was added to neutralize the single-strand products separated, the total volume of the products after neutralization being 60 μL. This step achieved the ligation of the target nucleic acid fragments with adaptor B and obtained the target single-stranded DNA through alkali denaturation and separation.
21. Polymerase chain reaction:
A PCR system was formulated according to the system as shown in Table 28.
Into the above system was added 30 μL of the recovered products from the previous step, and the mixture was mixed well and allowed to react under the conditions as shown in Table 29.
After reaction was complete, purification was conducted using 440 μL of Ampure XP magnetic beads, and the recovered product were dissolved with 80 μL of TE buffer. 1 μL of the recovered products was assayed with a Qubit dsDNA HS assay kit (Invitrogen Corp.) to quantitate the concentration of the products. 100 ng of the products was used for reaction at the next step. The size of the PCR product fragments was electrophoretically determined using an Agilent 2100 HS, the results being as shown in
22. Single strand cyclization:
The mediating fragment has corresponding complementary sequences for ligating both ends of the single strand, the sequence of the mediating fragment being as follows:
10 μL of the mediating fragment (10 μM) was added into 100 ng of the PCR products from the previous step. The mixture was mixed well and incubated at 95° C. for 3 min, followed by being rapidly placed on ice for cooling. A reaction system as shown in Table 30 below was formulated.
50 μL of the reaction system was added into a mixed solution of the PCR products and the mediating fragment. The mixture was mixed well and incubated at 37° C. for 60 min.
23. Digestion of linear DNA:A system as shown in Table 31 was formulated.
8 μL of the reaction system was added into the ligation reaction solution from the previous step. The mixture was mixed well and incubated at 37° C. for 60 min. 6 μL of 0.5 M EDTA was added and the mixture was mixed well. The products were purified and recovered using 170 μL of PEG32 magnetic beads, and redissolved in 55 μL of TE buffer.
The concentration and total amount of the final products in this example are as shown in Table 32.
The results indicated that the concentration and total amount of the respective products met the requirement for subsequent sequencing (molecular weight ≧0.12 pmol). The adaptor B ligation products after PCR and before cyclization were determined using an Agilent 2100 capillary electrophoresis apparatus, the results being as shown in
The disclosure set forth above is intended to describe the present invention in further detail by reference to particular embodiments, and is not to be construed as limiting the practical implementation of the present invention thereto. A number of simple deductions or substitutions could be made by a person of ordinary skill in the art to which the present invention pertains without departing from the concept of the present invention.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/CN2014/092297 | 11/26/2014 | WO | 00 |