Method for Analyzing Samples by Means of Hybridization

Abstract

The invention relates to a method of analysing samples by means of a ligand binding, in which duplexes or complexes are created and analysed.

Description

PRECISE DESCRIPTION OF THE INVENTION

The invention is explained in detail below with the aid of the figures and a number of embodiments. The figures show in:

FIG. 1 a a 362 bp long target molecule according to one of the embodiments, in schematic form

FIG. 1 b a table listing oligonucleotides as used in the embodiments

FIG. 1 c a table listing oligonucleotides as used in the embodiments as primers for amplification by means of PCR

FIG. 1 d the model system in schematic form

FIG. 2 a fluorescence signals of the hybridization of a Cy5-marked antisense strand with sense oligonucleotides

FIG. 2 b a schematic representation of the hybrid molecules

FIG. 2 c a graphical representation of determined signal intensities

FIG. 3 a fluorescence signals of the hybridization of a Cy5-marked sense strand with antisense oligonucleotides

FIG. 3 b a schematic representation of the hybrid molecules belonging to FIG. 3a

FIG. 3 c a graphical representation of the signal intensities of the fluorescence signals of FIG. 3a

FIG. 4 a fluorescence signals of a hybridization of a Cy3-marked sense strand with antisense nucleotides

FIG. 4 b a schematic representation of the hybrid molecules of FIG. 4a

FIG. 4 c a graphical representation of the signal intensities of the fluorescence signals of FIG. 4a

FIG. 5 a fluorescence signals of the hybridization of a Cy3-marked antisense strand with sense oligonucleotides

FIG. 5 b a schematic representation of the hybrid molecules which lead to the fluorescence signals in FIG. 5a

FIG. 5 c a graphical representation of the signal intensities of the fluorescence signals of FIG. 5a

FIG. 6 a fluorescence signals of a hybridization of a Cy3-marked sense strand with antisense nucleotides

FIG. 6 b a schematic representation of the hybrid molecules which lead to the fluorescence signals of FIG. 6a

FIG. 6 c a graphical representation of the signal intensities of the fluorescence signals of FIG. 6a

FIG. 7 a a schematic representation of 50 mer oligonucleotides according to the embodiments

FIG. 7 b a table of the 50 mer oligonucleotides of FIG. 7a

FIG. 8 a fluorescence signals of a hybridization of a Cy3-marked sense strand with 50 mer antisense oligonucleotides

FIG. 8 b a graphical representation of the signal intensities of the fluorescence signals of FIG. 8a

FIG. 9 a fluorescence signals of a hybridization of a Cy3-marked sense strand with 50 mer sense oligonucleotides

FIG 9b a graphical representation of the signal intensities of the fluorescence signals of FIG. 9a

FIG. 10 a fluorescence signals of a hybridization of a sense strand, marked with fluorescein-12-dUTP, with short antisense oligonucleotides, wherein the strands are not end-marked, but are uniformly marked internally through the incorporation of fluorescein-12-dUTP

FIG. 10 b a graphical representation of the signal intensities of the fluorescence signals of FIG. 10a

FIG. 11 a fluorescence signals of the hybridization of a Cy5-end-marked sense strand with short antisense oligonucleotides as in FIG. 3

FIG. 11 b a graphical representation of the signal intensities of the fluorescence signals of FIG. 11a

FIG. 12 a fluorescence signals of the hybridization of a Cy5-end-marked sense strand, shortened at the 5′ end, with short antisense oligonucleotides as in FIG. 11a, and

FIG. 12 b a graphical representation of the signal intensities of the fluorescence signals of FIG. 12a.

FIG. 13 shows the specificities of the catcher molecules of Table 1 which cluster with nitrogenase genes from bacteria of the alpha and beta sub-group of the proteobacteria. The names of the catcher molecules are shown next to the lines which indicate the sequence coverage. The precise sequence coverage is shown by symbols of various types. The nitrogenase genes (nifH, anfH, vnfH) from data banks are identified by their file number.

FIG. 14 shows the specificities of the catcher molecules of Table 1 which cluster with nitrogenase genes from bacteria of the beta and gamma sub-group of the proteobacteria. The names of the catcher molecules and the sequence coverage are as shown in FIG. 13.

FIG. 15 shows the specificities of the catcher molecules of Table 1 which cluster with nitrogenase genes from bacteria of the omega sub-group of the proteobacteria. The names of the catcher molecules and the sequence coverage are as shown in FIG. 13.

FIG. 16 shows the specificities of the catcher molecules of Table 1 which cluster with nitrogenase genes from frankia, cyanobacteria and similar bacteria. The names of the catcher molecules and the sequence coverage are as shown in FIG. 13.

FIG. 17 shows the specificities of the catcher molecules of Table 1 which cluster with nitrogenase genes of clusters II and IV. The names of the catcher molecules and the sequence coverage are as shown in FIG. 13.

FIG. 18 shows the specificities of the catcher molecules of Table 1 which cluster with nitrogenase genes of cluster III. The names of the catcher molecules and the sequence coverage are as shown in FIG. 13.

The invention is based on the surprising finding that the signal yield from fluorescent marked target molecules forming hybrids or duplexes with catcher sequences in a partial section is greater when the fluorescent marking lies close to the hybrid formed. Unexpectedly this effect is independent of strand and therefore of sequence.

Surprisingly the observed effect is also independent of the chemical nature of the fluorescent marking. The effect occurs with the use of both long (e.g. 50 mer) and short catcher oligonucleotides (e.g. 16-17 mer). Surprisingly this effect is also independent of the glass micro-array surface or coating used to immobilise the catcher oligonucleotides.

The invention may now be better explained with the aid of the following embodiments. The embodiments make it clear that the invention leads to a dramatic improvement in signal yield and in the informative value of micro-array hybridization experiments.

FIG. 1D shows schematically the structure of a duplex or hybrid complex A created by a method according to the invention: at the surface B of a DNA array, for example a glass surface, a catcher sequence or a catcher oligonucleotide D is bound via a spacer C, for example a poly-adenin section of an oligonucleotide. Complexed to the former via a target sequence E is a target molecule F. As may be inferred from FIG. 1D, the target sequence E is only a section or a partial sequence of the target molecule F. In the case of such target molecules with an overhang formed at the duplex, the markings may in principle be provided at any desired point and may also be positioned away from the duplex. Only in the case of such duplexes does the problem on which the invention is based occur, namely that the signal intensities measured, in particular with small sample quantities, are so unstable that no quantitative statement can be made.

A position 1 of the hybrid complex is designated G in FIG. 1D. This is the first base of the hybrid complex A from catcher sequence D and target sequence E. At this point there is a fluorescent marking H. The schematically depicted hybrid complex thus represents an embodiment of the invention, in which the marking H is incorporated within the target sequence F of the target molecule E.

The invention may be better explained with the aid of the following embodiments.

The embodiments which follow show that the invention considerably improves signal intensity in micro-array experiments. This is shown with the aid of specific fluorescent markings. The embodiments demonstrate that the important factor is the position of the marking agent relative to the hybrid to be detected. Here it is completely irrelevant, what specific kind of marking agent is involved. All that matters is the position of the marking agent relative to the hybrid or duplex to be detected, while of course mixed effects involving other factors which may influence the efficiency of the hybridization (e.g. length of the oligonucleotide spacer, steric effects, effects of the secondary structure) occur. The following embodiments should therefore be understood only as explanatory examples; in particular the following embodiments and the experiment also explained do not restrict the teaching of the invention in respect of sequences to be detected, and markings or similar to be used.

Embodiments

The embodiments are parts of a typical experiment, which was set out as follows:

The target molecule in the typical experiment is a single-stranded DNA, 5′-end-marked or marked with fluorescein-12-dUTP by random labelling, and specifically in the fragment of the nitrogenase gene nifH (Hurek et al., 1995) from the bacterium Azoarcus sp. strain BH72. The fragment was amplified by means of PCR by the primers Zehr-nifH from chromosomal DNA of the strain BH72 (Hurek et al., 2002), with one of the primers being marked with Cy3/Cy5, and the other with biotin. Fluorescent marked single-stranded DNA could thus be isolated from the PCR-product. In connection with the use of fluorescein-12-dUTP for random labelling, only biotinylated primer was used. For all experiments, the primers had the sequences listed in FIG. 1C, primers Z-nifH-f and Z-nifH-r (Zehr and McReynolds, 1989), up to experiments in connection with sequences (Zehr and McReynolds, 1989) following FIG. 11 (primers Z-nifH-f-BH72-Cy5 and Z307-nifH-r-BH72-biotin) and FIG. 12 (primer Z114-nifH-f-BH72-Cy5 and Z307-nifH-r-BH72-biotin):

Biotin-marked strands were separated (Niemayer et al., 1999) by means of streptavadin-coated paramagnetic spheres (Roche). The concentration of the remaining single-stranded DNA was determined by spectral photometry. Before each hybridization, the single-stranded DNA was denatured for 10 minutes at 95° C. and then incubated on ice for at least three minutes.

The oligonucleotides used in this experiment and acting as catcher molecules all bind to the nifH gene fragment of the strain BH72 referred to above. The relevant sequences and their characteristics are set out in table 1, FIG. 1b and table 2, FIG. 7b. A schematic representation of a possible duplex after hybridization is shown in FIG. 1D. Oligonucleotides with either 5′ amino-modifications (amino link c6) or 3′ modifications, some with poly-A spacers of 6-12 nucleotides, were synthesised by the company Thermoelectron (Ulm, Germany).

To conduct hybridization experiments, DNA micro-arrays were created on standard microscopic glass slides made by Menzel of Braunschweig, Germany. Chemicals and solvents came from the company Fluka (Neu-Ulm, Germany). To create the micro-arrays, the glass substrates were cleaned, silylated and activated, as described by Bentas et al (2002). The activated surfaces were used directly for the immobilisation of either 5′ or 3′ amino-modified catcher oligonucleotides by means of covalent binding.

The application of the probes to slide surfaces activated in this way was made using a piezo-driven Spotter Robodrop BIAS, Bremen, Germany) or else a MicroGrid II Compact 400 from the firm of BioRobotics, United Kingdom. The concentration of the oligonucleotides was around 10 μm per ml water. The water used contained 1% glycerol. In each spot of the micro-array approx. 250 pl was applied, corresponding to a spot diameter of around 200 μm.

The slides were incubated overnight at room temperature in a water-saturated atmosphere, in order to effect the covalent binding. Blocking of the micro-arrays was effected by means of 6-amino-1-hexanol (50 mM) and diisopropylethylamine (150 mM) in dimethyl formit after Beier et al (1999). The slides were then washed with deionised, particle-free water, air-dried and stored under N₂ at 4° C.

The hybridization of the target molecules to the probe of the micro-arrays, and washing, took place in a Personal Hyb oven of the company Stratagene, United States of America. Hybridization lasted for 1-16 hours. Unless otherwise stated, hybridization took place at room temperature with 50% formamide, at 46° C. with 50% formamide, and 10 nM single-stranded DNA was used in the process. The hybridization buffer used contained 4×SET, 10×Denhardt's. During hybridization, the slide was covered by a cover glass. After hybridization, washing took place with 2×SET (0.1% SDS) for 5 min. and 1×SET (0.1% SDS) for 10 min. at room temperature, or with 1×(0.1% SDS) for 5 min. and 0.1×SET (0.1% SDS) for 10 min. at 46° C. The dried micro-arrays were analysed at a resolution of 10 μm by a GenePix 4000 Micro-array Scanner from Avon, Union City, Calif., at constant laser strength and constant photomultiplier sensitivity. For this reason the signal intensities determined in the respective embodiments may be compared.

Embodiment 1

The reverse complementary strand or antisense strand of the nifH gene fragment of strain BH72 referred to above was hybridised with the sense oligonucleotides (catcher molecules) S307 (6A), S114 (6A) and S20 (6A). The antisense strand is shown schematically in FIG. 1A. The Cy5-marking was introduced into the strand by using a Cy5-marked primer to generate the strand. Shown schematically in FIG. 1A are the binding points of the sense oligonucleotide to the antisense strand, with the respective distance of these binding points from the 3′ and 5′ end respectively of the antisense strand also being shown. The antisense strand represents the target molecule, and the sense oligonucleotides represent the catcher oligonucleotides and the catcher sequences, which have been applied to a micro-arrays in the form of probes. The hybridization of these probes by the target molecule leads to different signal intensities in the respective spots on the micro-array, as shown in FIG. 2A. From left to right these spots contain, in each case in pairs, catcher oligonucleotides with the sequence S307 (6A), S114 (6A) and S20 (6A). The antisense strand target molecule is marked only at the 5′ end. Closest to the 5′ end is the binding point and target sequence S307(6A). Hybrids formed at this point are detected in the first two spots shown in FIG. 2A. There the signal intensity is highest. Further removed from the marking is the sequence section S114(6A), which is detected in the next two spots in FIG. 2A. Here the signal is noticeably weaker. Somewhat stronger, but still weak, is the signal given by hybrids into which the binding point S20(6A) enters.

Shown schematically in FIG. 2B are the catcher oligonucleotides 1, 2 and 3, together with the target molecule 4 in the form of hybrid molecules comprised of 1 and 4, 2 and 4, and 3 and 4, and the resultant position of the marking 5 on the target molecule 4 in the respective hybrid. In this case catcher oligonucleotide 1 corresponds to S307(6A), catcher molecule 2 to S114 (6A) and catcher molecule 3 to S20(6A).

The corresponding signal intensities are shown graphically in FIG. 2C. It may be clearly seen that the use of the catcher oligonucleotide S307(6A) or 1 leads to hybrids in which the marking is in close proximity to the hybrid, so that a 3 to 7 times greater signal intensity is obtained as compared to the other hybrids represented. It is also evident that there is an especially large reduction in signal yield when the fragment to be hybridised is bound to the catcher nucleic acid (S114(6A))at a great distance from the marked primer.

Embodiment 2

This embodiment shows that the effect described in embodiment 1 is independent of strand and therefore of sequence. Cy5-marked counter-strands (sense strand) were hybridised with the corresponding antisense oligonucleotides. The same effect was observed as in example 1 (cf. FIGS. 3A-3C). Shown in FIG. 3A from left to right in each case are four spots with identical catcher oligonucleotides, namely from left to right spots with the catcher oligonucleotides A20(12A), A20(6A), R20(6a)3′, A307, A307(12A), A307(6A), A307(6A)3′, and A114(6A). Shown schematically in FIG. 3B in the same sequence is how the target molecule 7, which has a marking 8 at its end, binds to the relevant oligonucleotide, and the resultant location of the marking relative to the hybrid 9 formed is discernible in FIG. 3B.

As may be seen with the aid of the graphical representation of the signal intensities in FIG. 3C, but is also evident from the brightness of the spots in FIG. 3A, the signal intensities are always at their highest when the marking is in proximity to the respective hybrid formed, and specifically in comparison with the other hybrids by twice to around 4.5 times, in extreme cases well above this level (cf. the values for A307(6A)3′ in FIG. 3C). The designation 6A or 12A (of the catcher oligonucleotides) denotes the length of the respective spacer. This embodiment shows that the difference in length of the spacer, i.e. the spacer between the glass surface of a micro-array and the binding zone of the catcher oligonucleotide, has a comparatively limited effect on signal intensity. Consequently the difference between A20(6A) and A20(12A) is not especially marked, while between A307(12A) and A307(6A) there is virtually no difference at all. A slight reduction of the signal for A20(6A)3′ in comparison with A20(6A) could be due to quenching effects from the close proximity of the fluorescent dye to the glass surface.

In this connection it should be noted that, in micro-array hybridization experiments, false negative results may occur due to a marking lying in an unfavourable position leading to an excessively low signal intensity, as for example in the case of the catcher oligonucleotide A307(6A)3′. Similar steric effects of hybridization have been described by Peplies et al. (2003). This oligonucleotide supplies a signal intensity which is 48 times less than that of A20(6A). The adverse position is far removed from the target sequence.

Embodiment 3

This embodiment shows that the effect observed in the preceding embodiments may be even further strengthened by greater proximity of the marking to the target sequence. For this purpose an antisense catcher oligonucleotide was used, A1 (6A) in FIG. 11, which is complementary to the primer oligonucleotide with which the end-marked probe was generated by means of PCR. As a result, the fluorescent marking is already positioned at the first nucleotide of the heteroduplex which is formed in hybridization. In this embodiment the fluorescence signal is increased by a factor of 2.3 as compared with a catcher oligonucleotide, A20 (6A), which is shifted by 20 nucleotides. As is evident from FIGS. 11A and 11B, for the intermediate positions (A4 (6A)-A14 (6A)), the signal strengths are progressively weaker than for A1 (6A). In comparison with the most unfavourable position from embodiment 2, A114 (6A), a signal which is as much as 146 times stronger is observed for the most advantageous position A1 (6A). An even further removed but still relatively central position A188 (6A) leads to an even lower signal intensity (factor 357). The embodiment confirms that relatively high signal yields may be obtained when the marking is less than 64 nucleotides from the target sequence forming the heteroduplex; in this embodiment the signal is 15 times weaker.

The positive effect of position is also made clear in FIG. 12. If a shortened marked probe is used (here by 113 nucleotides, so that the primer used for the PCR is complementary to the catcher oligonucleotide A114), a similar position effect is revealed for other catcher oligonucleotides. Oligonucleotide A114 (6A), which in FIG. 11 with a central position gave only low signal strength levels (130 rel. intensity), shows in FIG. 12 as end-placed catcher oligonucleotide high signal strength (11,800 rel. intensity). In this example too, a sharp drop in signal intensity (factor 5.2) is to be observed when the marking is at a greater distance (e.g. 74 nucleotides for A 188 (A6), FIG. 12A, B) from the formed hybrid.

Embodiment 4

This embodiment shows that the effect observed in the preceding embodiments is independent of the chemical nature of the marking. The same experiments as in embodiment 2 were conducted with a Cy3-marked sense strand instead of a Cy5-marked sense strand, and supplied substantially the same results as described in example 2. These results are set out in FIGS. 4A-4C, in which the markings in FIG. 4B are provided with reference number 10, and the accordingly marked target molecule with reference number 11. Shown from left to right in FIG. 4A in each case are four spots in which catcher oligonucleotides as described in embodiment 2 are present. FIG. 4B shows from left to right in each case schematically how the respective catcher oligonucleotide is hybridised with the target molecule, and in which position the marking is to be found in each case, relative to the hybrid formed. FIG. 4C shows the signal intensities of the spots shown in FIG. 4A, in the same sequence.

As already indicated, the results correspond substantially to those discussed in embodiment 2. The fact that a different marking leads to substantially the same results confirms that it does not matter what type of fluorescent marking is used in implementing the invention.

Embodiment 5

The experiment described in embodiment 1 was repeated with Cy3-marked sense strand and Cy3-marked antisense strand. The results in the case of the Cy3-marked sense strand are shown in FIGS. 5A-5C. The results of the experiment conducted with the Cy3-marked antisense strand are depicted in FIGS. 6A-6C. In each case the signal intensity is greatest where the marking 8 is in direct proximity to the respectively formed hybrid 9. When the Cy3-marked sense strand is used as target molecule this is the case in the spot with the catcher sequence for S307 (6A), and for the Cy3-marked antisense strand it is in the spot with the catcher sequence for A20(6A) (see FIGS. 5A-5C, FIGS. 6A-6C).

These experiments comparable with embodiment 1 confirm that both the Cy3-marked sense strand and also the Cy3-marked antisense strand are detectable with high signal yields when the hybrids formed with catcher sequences have the marking in direct proximity. In the case of probes A20(6A) or S307(6A), signal intensity is increased by a factor of 22 as compared with other hybrids.

Embodiment 6

This embodiment confirms that the invention also functions when longer oligonucleotides are used as catcher molecules. In this case 50 mer oligonucleotides were used, binding in each case at the outer ends of the target molecule. Cy3-marked sense strand shows the stronger signal when the marking lies close to the duplex (A19-68). In this case signal intensity was increased by a factor of 2 over the other signals.

The designation and sequences of the 50 mer oligonucleotide catchers and target sequences used may be taken from table 2 in FIG. 7B. The position of the relevant binding points on the sense or antisense strand of the 362 bp long nifH gene fragment are shown schematically in FIG. 7A.

Shown in FIG. 8A are the spots of a corresponding micro-array, with in each case six identical spots in one row. The target sequences or catcher sequences detectable in the respective spots are plotted on the right-hand side of the represented micro-array surface in the representation of FIG. 8A. In FIG. 8B, the correspondingly determined signal intensities are shown in the form of a graphical presentation.

The same experiment was conducted with Cy3-marked antisense strand. In this case too, the strongest signal is obtained when the marking is close to the duplex (S289-338), see FIGS. 9A, 9B. Here too the signal intensity with use of a method according to the invention was increased by a factor of 2 over other signal intensities, at any rate distinctly improved, as shown by FIG. 9b for the sequence S289-338.

Embodiment 7

This embodiment confirms that other marking strategies may also be used to produce target molecules. Using unmarked PCR primer and the random incorporation of fluorescein-12-dUTP (“random labelling”), a suitably marked sense strand was created, and hybridised with short antisense oligonucleotides. On the left of FIG. 10A, in a grid comprised of rows and columns, in each case four probe spots or spots are shown. The rows are numbered consecutively from I to IV, and the columns are designated a-e. Next to this on the right is a schematic reproduction of the same grid, with the designation of the catcher oligonucleotides located in the respective spots entered in the corresponding grid areas. Thus for example field IIa contains spots with the catcher oligonucleotides A307(6A) etc. In FIG. 10E the signal intensities determined for the respective spots are presented graphically. The highest are the signal intensities in spot A20(6A)3′, followed by spot A20(6A) and A20(12A).

Table I in FIG. 1B discloses that the catcher oligonucleotide A20(6A)3′ binds at four positions to T and U respectively, whereas the catcher oligonucleotide 307 binds to T and U respectively at 0 positions, so that there is a higher incorporation rate of fluorescent marked nucleotides in the A20 target sequence. Through fluorescent marking on these bases there is in consequence a greater fluorescent intensity in the duplex A 20 than at A307, resulting in a noticeably higher signal intensity (see FIG. 10B).

In addition to the glass slides described above, commercial supports for micro-arrays were also used, for example aldehyde slides and amine slides, plus slides from the company Genetics, QMT® aldehyde slides from Peqlab, and Pan ® amine slides from MWG Biotech. With these micro-arrays the same results were obtained as described above with the aid of embodiments 1-7.

This confirms that the present invention may be used in conjunction with any type of micro-array.

It has been shown above, with the aid of target sequence marked according to the invention and applied to DNA arrays in solution, that the invention is independent of strand and therefore of sequence.

Within the scope of the invention, this procedure may easily be reversed, i.e. target molecules to be analysed may be provided on an array, to which catcher molecules in solution and marked according to the invention are added, so that duplexes or complexes with high signal intensities are created. In other words, the term “target molecule” is to be understood as being interchangeable with the term “catcher molecule” and vice-versa. At the same time the term “target sequence” should then be understood as being interchangeable with the term “catcher sequence” and vice-versa.

Also, within the scope of the invention, the entire ligand binding reaction may in principle be effected in solution.

TABLE 1
Sequences of catcher oligonucleotides for nitrogenase
gene detection. Proximity to the hybrid is shown in
the table (”Position“ column).
	SEQ
	ID			Length
Samplea	NO	Sequence (5′-3′)b	Tmc	(nt)	GC%	Positiond
Proteo-1	1	GACAAGATGGTGTCCTGAG	67	19	52	29-47
Proteo-2	2	GACAGGATGGTGTCCTG	66	17	58	31-47
Proteo-3	3	GGCTCAGGATGGTGTCC	68	17	64	33-49
Proteo-4	4	AGGACGGTGTCCTGGG	68	16	68	29-44
Proteo-5	5	TTCCGCGGCAAGGGAGA	68	17	64	44-60
Proteo-6	6	GTGTCCTGCAGCTTGGT	66	17	58	22-38
Proteo-7	7	AGCCGATCTTGAGAACGTC	67	19	52	91-109
Proteo-8	8	AGCCGATCTGCAGCACGT	69	18	61	92-109
Proteo-9	9	CAGTTCCATCACGGAGTTC	67	19	52	33-51
Proteo-10	10	TGCATGACGCTGGTTTGC	67	18	55	30-47
Proteo-11	11	TACCCGATGGCCAGCACAT	69	19	57	92-110
Proteo-12	12	ATGACGGTGTTCTGCATCTT	66	20	45	25-44
Proteo-13	13	CACGGTCGTTTGCGCCTT	69	18	61	25-42
Proteo-14	14	TCTGAGCCTTTGAGTGCAG	67	19	52	16-34
Proteo-15	15	TTGATGTCGCCGTAGCCG	69	18	61	105-122
Proteo-16	16	TTTAATGCCGCTGTAACCAGT	66	21	42	103-123
Proteo-17	17	CCAGTCAGTAGTACATCTTCTA	66	22	40	86-107
Proteo-18	18	TTTTGCGCTTTCGCATGCAG	68	20	50	16-35
Proteo-19	19	CTTGCTGTGGAGGATCAG	67	18	55	10-27
Proteo-20	20	CTCCATTATTGTGTTTTGCGC	66	21	42	28-48
Proteo-21	21	GTGTTTTGCGCTTTAGAGTG	66	20	45	19-38
Proteo-22	22	GGAAGTTAATCGCTGTGATAAC	66	20	40	175-196
Proteo-23	23	ATGGTCTCCTGGGCCTT	66	17	58	25-41
Proteo-24	24	CACTTGACGTCGCCGTA	66	17	58	109-125
Proteo-25	25	TTCCAAATCTTCAACGCTACC	66	21	42	64-84
Proteo-26	26	GTGACAGCACCGACGTC	67	18	64	33-49
Proteo-27	27	ACGGTCTGCTGGGCTTT	66	17	58	25-41
Proteo-28	28	ATGCAGGACCGTGTCCTG	69	18	61	31-48
Proteo-29	29	AGATGCAGAACCGTGTCCT	67	19	52	32-50
Proteo-30	30	GAACCTTCGGTTGCCGC	68	17	64	52-68
Proteo-31	31	GCGGCGAGATGCAGAAC	68	17	64	40-56
Proteo-32	32	ATCCAGGACGGTATCCTG	67	18	55	31-48
Proteo-33	33	GATGTCCTGATAGCCGAC	67	18	55	103-120
Proteo-34	34	TTGATGTCCTTGAAGCCGA	65	19	47	104-122
Proteo-35	35	GCCTGATTCAACACAACGAAC	68	21	47	118-138
Proteo-36	36	CCAGCGAAAGGACGGTG	68	17	64	36-52
Proteo-37	37	AATATCTTTAAAACCGGCTTTCAG	66	24	33	97-120
Proteo-38	38	GTGTCCTGCATCTTGGTG	67	18	55	21-38
Proteo-39	39	GGTGTTTTGCATTTTAGTGTG	64	21	38	19-39
Proteo-40	40	CCAGCGAGAGGATGGTG	68	17	64	36-52
Proteo-41	41	CTTGGCATGCAGCATCAG	67	18	55	10-27
Proteo-42	42	ATGCAGAATCAGTCGAGTAGA	66	21	42	1-21
Proteo-43	43	GTGTTCTGTGCTTTAGAGTGAAG	69	23	43	16-38
Proteo-44	44	GTGCATTACAGTAGTCTG	62	18	44	31-48
Proteo-45	45	GTAGCCAGCCTTCAGCAC	69	18	61	94-111
Proteo-46	46	AGGCTGAGGATCGTGTCC	69	18	61	33-50
Proteo-47	47	CAGCAGCAAGGTGCAGC	68	17	64	42-58
Proteo-48	48	GCCATCTCCATAATGGTGT	65	19	47	35-53
Proteo-49	49	CCTTGCAGCCGAGGATC	68	17	64	12-28
Proteo-50	50	AGGCTGAGGATGGTGTC	66	17	58	34-50
Proteo-51	51	CTCGAGGTCTTCGACGCT	69	18	61	67-84
Proteo-52	52	CTCGCGGCAAGACTCAAA	67	18	55	42-59
Proteo-53	53	CTCGCTGCAAGGCTCAAA	67	18	55	42-59
Proteo-54	54	CGTGTAGGATCAGCCGTGT	69	19	57	4-22
Proteo-55	55	AGACTAAGCACGGTGTCTTG	68	20	50	31-50
Omega-1	56	TGTCTGAGCCTTGGCATGA	67	19	52	18-36
Omega-2	57	CTTCATAACGTCCTTCAGTTC	66	21	42	79-99
Omega-3	58	GGTCCATAACCGTTGACTG	67	19	52	31-49
Omega-4	59	CCATTACCGTGTTCTGTGC	67	19	52	28-46
Omega-5	60	GGTGTCGCCATAGCCGA	68	17	64	104-120
Omega-6	61	CAACCTTCATCACGGATTCG	68	20	50	87-106
Omega-7	62	CGGATGAGGTCCATCAC	66	17	58	40-56
Omega-8	63	GAACCTTGTCCATAACCGT	64	19	47	37-55
Omega-9	64	CTCGCGGATCAGGTCCAT	69	18	61	43-60
Omega-10	65	GACCTTCATGACATCTTCCAG	68	21	47	85-105
omega-11	66	ACGTCCGAGAGCTCCAGA	69	18	61	78-95
Cyano-1	67	CAGTGGTTTGTGCTTTACA	63	19	42	22-40
Cyano-2	68	AGTGAAGAACTGTTACCTGTGC	68	22	45	28-49
Cyano-3	69	GTTTGAGCTTTAGCGTTTAAGATTA	66	25	32	11-35
Cyano-4	70	AAACCGGTCAACATTACTTCGTG	69	23	43	88-110
Cyano-5	71	GCACCTGGTTTACATACATC	66	20	45	91-110
Cyano-6	72	GCTTAGTACGGTTGTTTGTG	66	20	45	29-48
Cyano-7	73	TCTACACATCGGATACCTTTGTA	67	23	39	109-131
Cyano-8	74	CTGCACCTTTTTCAGCAGC	67	19	52	52-70
Cyano-9	75	TACAGTGGAGCATTAAGCGAG	68	21	47	5-25
Cyano-10	76	CAGCCAAGTGAAGAACGGT	67	19	52	37-55
Cyano-11	77	CACTTAACGCCGCGATAGC	69	19	57	107-125
Cyano-12	78	ATTACTTCTTCGAGTTCAATATCTT	65	25	28	74-98
Cyano-13	79	ACGAACGTTACGGAAACC	64	18	50	106-123
Cyano-14	80	CTAAGTGGAGAATGGTAGTTTG	66	22	40	31-52
Cyano-15	81	GGTGAAGAATCGTGGTTTG	65	19	47	31-49
Cyano-16	82	GGTGTAGAATTGTGGTTTGG	66	20	45	30-49
Cyano-17	83	AGCTAGGTGCAGAACTGTG	67	19	52	36-54
Cyano-18	84	GCAGCCAAGGAAAGAACG	67	18	55	39-56
Cyano-19	85	CTTCACACCACGGAAGCC	69	18	61	106-123
Cyano-20	86	CGAGCAATACTTCCGAGAGT	68	20	50	84-103
Cyano-21	87	ACGTTGTTATAGCCAGTGAGTA	66	22	40	98-119
Cyano-22	88	GTGCAGAATGGTGGTTTG	64	18	50	31-48
Cyano-23	89	CAGCAGCCAATTGGAGAAC	67	19	52	40-58
Cyano-24	90	CTTTTCTGCTGCCAGGTG	67	18	55	46-63
Cyano-25	91	AGCTTTACAGTGAAGAATCAAGC	67	23	39	8-30
Cyano-26	92	GAGCTTCATCAAGTTCCAC	65	19	47	79-97
Cyano-27	93	CTGGATGCCAGCGTAGC	68	17	64	107-123
Frankia-1	94	ATGCCCCACTGGCCCTC	71	17	70	103-119
Frankia-2	95	GCCTTCTCGATGACGGTG	69	18	61	36-53
ClusterII-1	96	CCCAGAATCATGCGGGTA	67	18	55	3-20
ClusterII-2	97	GTTCATTCCGCCTAAAATCATAC	67	23	39	8-30
ClusterII-3	98	GTTTTGATGACCTTCTCGTTG	66	21	42	81-101
ClusterII-4	99	ACATCCATCAGGGTTTCCTG	68	20	50	31-50
ClusterII-5	100	TTGATTCATCCCTCCCAAAA	64	20	40	14-33
ClusterII-6	101	TATCCATCAATGTTTCTTGCGG	66	22	40	28-49
ClusterII-7	102	CCATCATGGTGGTCTGCA	67	18	55	29-46
ClusterII-8	103	GCATTTTACCTCTAAGAATCATAC	66	24	33	8-31
ClusterII-9	104	GTTTTCCGTGGAGAATCATTC	66	21	42	8-28
ClusterII-10	105	CCGTGCAAGATTAACCTTG	65	19	47	5-23
ClusterII-11	106	GTTGTCTGCATTTTACCGC	65	19	47	20-38
ClusterII-12	107	GGTCTCCTCAGGTTTGC	66	17	58	23-39
ClusterII-13	108	ATCACCGTCTGCTGCGG	68	17	64	28-44
ClusterII-14	109	CCAGGATCAGCCGATTTGA	67	19	52	1-19
ClusterII-15	110	CACCAAGGATAAGACGAGTT	66	20	45	3-22
ClusterII-16	111	CGAGCACAAGACGAGTACA	67	19	52	1-19
ClusterIII-1	112	CCTTCTTCGCGGAGCGT	68	17	64	49-65
ClusterIII-2	113	ACTCGGTGCACCGGCAA	68	17	64	111-127
ClusterIII-3	114	CCTTCCTCGCGGAGTGT	68	17	64	49-65
ClusterIII-4	115	GAAGTGATTATTCCTCTTCC	64	20	40	160-179
ClusterIII-5	116	CGCCTAAGAGAAGACGAGT	67	19	52	4-22
ClusterIII-6	117	TCGTCGCGAAGGGTATCCA	69	19	57	44-62
ClusterIII-7	118	CCGCCTTTACGGATATC	63	17	52	85-101
ClusterIII-8	119	CCGCAAGGTCCACGTC	68	16	68	70-85
ClusterIII-9′	120	CTTCCCGGCGGATGTC	68	16	68	85-100
ClusterIII-10	121	GCAGCGTATCCAATACGGT	67	19	52	37-55
ClusterIII-11	122	GTCTTCCCCTTCCGACC	68	17	64	56-72
ClusterIII-12	123	TCTTCCAGATCCACGTCTTC	68	20	50	67-86
ClusterIII-13′	124	CTTTTCTGCGCAAGACCAC	67	19	52	20-38
ClusterIII-14	125	ACCCTGTCCGGCGGATA	68	17	64	87-103
ClusterIII-15	126	GGGTATCCAGAACGGACTT	67	19	52	34-52
ClusterIII-16	127	ACGGTCCGTTGACTCAAAC	67	19	52	23-41
ClusterIII-17	128	GAGCCAAGCCATGCAACA	67	18	55	14-31
ClusterIII-18	129	GTATCTAACACACTCTTTTGGT	65	22	36	29-50
ClusterIII-19	130	GTTCTGAGTGTATCCAACAC	66	20	45	40-59
ClusterIII-20	131	CCAAGGAGAAGACGGGTG	69	18	61	3-20
ClusterIII-21	132	GTCCAAGACGGTGCTTTG	67	18	55	31-48
ClusterIII-22	133	TCGAGAAGATTGATGGAGG	65	19	47	176-194
ClusterIII-23	134	TATCCAGGACAGTGCGCT	67	18	55	32-49
ClusterIII-24	135	TCCAAAACGGTCCGCTG	66	17	58	31-47
ClusterIII-25	136	CCGAAGCCCTGTTTGCG	68	17	64	91-107
ClusterIII-26	137	AACCGGGTTTACGGATATC	65	19	47	85-103
ClusterIII-27	138	AAAGCCGGGCGACACGA	68	17	64	89-105
ClusterIII-28	139	CACCTAAAAGTAGACGTGTTGA	66	22	40	1-22
ClusterIII-29	140	CCAACAACAATCGGGTTGA	65	15	47	1-19
ClusterIII-30	141	CACAGCGAACACCTTTAAAAC	66	21	42	101-121
ClusterIII-31	142	CGGTTTTCTGCTGAAGACC	67	19	52	22-40
ClusterIII-32	143	GTCTTTTGTGCTAAACCACC	66	20	45	19-38
ClusterIII-33	144	CACCTTCCGCGAGTGTAT	67	18	55	47-64
ClusterIII-34	145	AGTACGGTTTTCTGGGCTAA	66	20	45	25-44
ClusterIII-35	146	CTCCCAATAAGAGACGGG	67	18	55	5-22
ClusterIII-36	147	GTATCCTACCTTCAGAACCG	68	20	50	86-105
ClusterIII-37	148	TCAATGTCATCGCCTTCTTC	66	20	45	58-77
ClusterIII-38	149	ATGCCGGAAAAGCCGGG	68	17	64	97-113
ClusterIII-39	150	CCAGCTCTATGTCGTCGC	69	18	61	65-82
ClusterIII-40	151	GTCTTCTGGTTCAGGCC	66	17	58	22-38
ClusterIII-41	152	CGTATCAAGCACCGTTTTC	65	19	47	33-51
ClusterIII-42	153	CAAAATGGCATCCAATTCAATTTC	66	24	33	70-93
ClusterIII-43	154	CATGATACGGTCGAGTTCAAC	68	21	47	73-93
ClusterIII-44	155	CTGAGCTAATCCTCCTAAAAG	66	21	42	13-33
ClusterIII-45	156	GGTGAAGACCACCAAGAAG	67	19	52	13-31
ClusterIII-46	157	TGCTGGAGTCCTCCCAAC	69	18	61	15-32
ClusterIII-47	158	CAAGTTTTCGCACATCATCCAG	68	22	45	79-99
ClusterIII-48	159	GCCGAGCTTGATGATGTC	67	18	55	85-102
ClusterIII-49	160	CGACTTTTCTAACGTCTTCAAG	66	22	40	79-100
ClusterIII-50	161	GTACGGTCTTTTGGCTCAAAC	68	21	47	23-43
ClusterIII-51	162	CGGTTCGCAATGTATCCAG	67	19	52	43-61
ClusterIII-52	163	CAGGCCGTTCAGCAAAAG	67	18	55	10-27
ClusterIII-53	164	GCCTCCCAGAAGCAAAC	66	17	58	8-24
ClusterIV-1	165	CCCTGATGGCGTCAAGC	68	17	64	42-58
ClusterIV-2	166	AGTACCGTTTCCTGGTGCA	67	19	52	26-44
ClusterIV-3	167	CGGTTCGGTTTTGCCGTC	69	18	61	58-75
ClusterIV-4	168	CCTCTGAGAAGGGTTAT	61	17	47	7-23
ClusterIV-5	169	GATGCCTTTGTAGCCGGT	67	18	55	109-126
ClusterIV-6	170	CTGCGTGTTGTCCCGTAT	67	18	55	52-69
ClusterIV-7	171	TTCTGCAAGGATCCGCGT	67	18	55	4-21
ClusterIV-8	172	CACCGCGGTGATGATCC	68	17	64	164-180
ClusterIV-9	173	TCATGGGCATTGACCG	63	16	56	68-83
ClusterIV-10	174	CCGTCCCTCATGCTGTC	68	17	64	46-62
ClusterIV-11	175	TTGCCGCCTGTCAGGTT	66	17	58	10-26
ClusterIV-12	176	CCTCCGCTTTCAACACAT	64	18	50	114-131
ClusterIV-13	177	GCCTCTCACCATAGAGTG	67	18	55	14-31
ClusterIV-14	178	CAATATCAAGGATAGTAGGCAATC	67	24	37	29-52
ClusterIV-15	179	CTTTCCGTGCATTAATGTCC	66	20	45	8-27
ClusterIV-16	180	AATCCTACGTCCAGCGAG	67	18	55	13-30
ClusterIV-17	181	CTGTATTTTGTGTCCGCATAC	66	21	42	13-33
ClusterIV-18	182	ACCGTGGGGATCTTCCTC	69	18	61	24-41
ClusterIV-19	183	ACTGTGGGAATGTCAGCC	67	18	55	24-41
ClusterIV-20	184	TAATATCCTGACCCTTTTGC	64	20	40	57-76
ClusterIV-21	185	AGGTAATCCAGTACCGT	61	17	47	37-53
ClusterIV-22	186	CCGTGCAACAACAGTTTC	64	18	50	6-23
ClusterIV-23	187	GCCAAGGCTTTCCAGCAT	67	18	55	187-204
ClusterIV-24	188	TGACCTCCTGGACGTTATC	67	19	52	58-76
ClusterIV-25	189	CCGCCCCTTAAATTTGAAG	65	19	47	5-23
a.catcher oligonucleotides have been denoted with the aid of distribution in the clusters. The number of catcher oligonucleotides in the clusters does not represent their importance.
boligonucleotide sequences shown have reverse complementarity to the relevant sequences of the sense nifH/anfH/vnfH strands. All oligonucleotides are bound to the micro-arrays by the 5′end.
cTm values were calculated using the program MELT 1.1.0 (Jo P. Sanders).
dthe position of the oligonucleotides represents the position at which the target sequence is bound [Here, other than as shown in the other figures, the region of the PCR primer (18 nt) has not been included].

REFERENCES

• Beier, M., and D. Hoheisel Jörg. 1999, Versatile Derivatisation of solid support media for covalent bonding on DNA-microchips. Nucleic Acids Res. 27:1970-1977.
• Benters, R., C. M. Niemeyer, D. Drutschmann, D. Blohm, and D. Wöhrle. 2002. DNA microarrays with PAMAM dendritic linker systems. Nucleic Acids Res. 30: e10.
• Hurek, T., Van Montagu, M., Kellenberger, E., and Reinhold-Hurek, B. (1995) Induction of complex intracytoplasmic membranes related to nitrogen fixation in Azoarcus sp. BH72. Mol Microbiol 18: 225-236.
• Hurek, T., Handley, L., Reinhold-Hurek, B., and Piché, Y. (2002) Azoarcus grass endophytes contribute fixed nitrogen to the plant in an unculturable state. Mol Plant-Microb Interact 15: 233-242.
• Niemeyer, C., Boldt, L., Ceyhan, B. and Blohm, D. 1999. Evaluation of single-stranded nucleic acids as carriers in the DNA-directed assembly of macromolecules. J. Biomol. Struct. Dyn., 17, 527-538.
• Peplies, J., Glöckner, F. O., and Amann, R. 2003. Optimization strategies for DNA microarray-based detection of bacteria with 16S rRNA-targeting oligonucleotide probes. Appl. Environ. Microbiol. 69: 1397-1407.
• Southern, E., Mir, K., and Shchepinov, M. 1999. Molecular interactions on microarrays. Nature Genet. Suppl. 21: 5-9.
• Zehr, J. P., and McReynolds, L. A. (1989) Use of degenerate oligonucleotides for amplification of the nifH gene from the marine cyanobacterium Trichodesmium thiebautii. Appl Environ Microbiol 55: 2522-2526.
• Galloway, J. N., Schlesinger, W. H., Levy, H. I., Michaels, A. F., and Schnoor, J. L. (1995) Nitrogen fixation: Anthropogenic enhancement-environmental response. Global Biogeochem. Cycles 9: 235-252.
• Hurek, T., Egener, T., and Reinhold-Hurek, B. (1997) Divergence in nitrogenases of Azoarcus spp., Proteobacteria of the β-subclass. J. Bacteriol. 179: 4172-4178.
• Hurek, T., Handley, L., Reinhold-Hurek, B., and Piché, Y. (2002) Azoarcus grass endophytes contribute fixed nitrogen to the plant in an unculturable state. Mol. Plant-Microbe In. 15: 233-242.
• Karl, D., Bergman, B., Capone, D., Carpenter, E., Letelier, R., Lipschultz, F. et al. (2002) Dinitrogen fixation in the world's oceans. Biogechem. 57/58.
• Tan Z, Hurek T, Reinhold-Hurek B. (2003) Effect of N-fertilization, plant genotype and environmental conditions on nifH gene pools in roots of rice. Environ Microbiol. 5(10):1009-15

Claims

1. Method of analyzing samples by means of a ligand binding method with a high phylogenetic resolution in which, through the binding of target sequences of target molecules to catcher sequences of probes, duplexes or complexes are generated and/or duplexes or complexes thus generated are analyzed, wherein the target sequences are partial sequences of the target molecule concerned, and the catcher sequences have a length of 17 mer to 25 mer, and the length of the target molecules is at least four times the length of the target sequence, wherein within the target sequence, the duplexes or complexes have at least one detectable marking or an accumulation of markings, and at least ten samples are analyzed simultaneously.

2-4. (canceled)

5. Method according to claim 1, wherein all target molecules have the same number of markings.

6. Method according to claim 1, wherein at least one hundred samples are analyzed simultaneously.

7. Method according to claim 1, wherein the marking is a fluorescent marking.

8. Method according to claim 7, wherein the fluorescent marking is obtained by means of one or more of the following marking agents:Cy3, Cy5, fluorescein, Texas red, Alexa fluor dyes and other fluorescent dyes.

9-23. (canceled)

24. Method for the determination of catcher sequences, in each case determined for the development of ligand bonds with target sequences each forming a partial sequence of a longer target molecule in such a way that they are complementary to the relevant sections of the target sequences which are to be found in proximity to a marking or an accumulation of markings.

25. Method according to claim 24, wherein the catcher sequences are determined in such a way that the marking or accumulation of markings is located less than 100 bases from the target sequence or is within the target sequence.

26. Method according to claim 25, wherein the catcher sequences are calculated by means of a computer program.

27. Set of catcher molecules wherein the catcher molecules have the specificity of that catcher molecule which in each case comprises a sequence selected from SEQ ID NO: 1-189.

28-29. (canceled)

30. Method according to claim 1, wherein the target molecules are 5′-end-marked.

31. Method of analyzing samples by means of a ligand binding method with a high phylogenetic resolution in which, through the binding of target sequences of target molecules to catcher sequences of probes, duplexes or complexes are generated and/or duplexes or complexes thus generated are analyzed, wherein the target sequences are partial sequences of the target molecule concerned, and the length of the target molecules is at least two times the length of the target sequence, wherein within the target sequence, the duplexes or complexes have at least one detectable marking or an accumulation of markings, and at least ten samples are analyzed simultaneously.

32. Method according to claim 31, wherein the target molecules are 5′-end-marked.

33. Method according to claim 31, wherein the catcher sequences have a length of up to 35 mer and constituents of the probes of a DNA array, and the length of the target molecules are at least four times the length of the target sequence.

34. Method according to claim 33, wherein said at least one detectable marking is no further than 0-20 bases distant from the target sequence.

35. Method according to claim 34, wherein the target molecules are 5′-end-marked.

36. Method according to claim 1 in which target molecules are used having a marking in proximity to or within a target sequence which is a partial sequence of the relevant target molecule, wherein the target molecules are produced by means of a PCR method in which at least one type of dNTP provided with a marking agent is used, and in which the marked dNTPs are incorporated in direct proximity to the target sequence and/or in the target sequence itself, and in which one or more primers is provided with the same or other marking agents.

37. Set according to claim 19, wherein the catcher molecules are oglionucleotides.

38. Set according to claim 37, wherein it has at least 10 different catcher sequences.

39. Method according to claim 1, wherein the catcher molecules are at least in part catcher molecules which in each case have the specificity of a catcher molecule comprising a sequence selected from SEQ ID NO: 1-189.

40. Method of analyzing variations of a gene by means of a ligand binding method with a high phylogenetic resolution in which, through the binding of target sequences of target molecules to catcher sequences of probes, duplexes or complexes are generated and/or duplexes or complexes thus generated are analyzed, wherein each target sequence is specific for a certain variation of said gene, and, wherein in the proximity to and/or within the target sequence, the duplexes or complexes have at least one detectable marking or an accumulation of markings.

41. Method according to claim 40, wherein at least ten variations are analyzed simultaneously.