Patent Application
20100021918
1. Field of the Invention
The present invention relates to a method for assaying an action of an antitumor agent using splicing defect as an index, more particularly, a method for assaying an action of an antitumor agent using an increase in the expression level of pre-mRNA or abnormal protein as an index.
2. Background Art
Pladienolide derivatives are derivatives of natural pladienolide. Since pladienolide exhibits an excellent antitumor activity (Mizui et al., 2004, J. Antibiotics 577:188-196), search for a compound with higher antitumor activities has been performed to find the pladienolide derivatives (WO2002/060890 and WO2003/099813).
The present inventors have found that pre-mRNA of a certain group of genes and abnormal proteins increase when a pladienolide derivative is contacted with a sample obtained from living cells including cancerous cells, and peripheral blood (PBMC) and whole blood (PBC) of a subject. Without wishing to be bound by any theory, administration of the pladienolide derivative may cause an introduction of a mutation in pre-mRNA of a certain group of genes thereby inducing splicing defect. The present invention was made based on such findings.
It is an object of the present invention to provide a method, a probe, a primer, an antibody, a reagent and a kit for assaying an action of the pladienolide derivative on a living subject.
According to the present invention, there are provided inventions (1) to (19) as follows.
(1) A method for assaying an action of a compound represented by formula (I), a pharmaceutically acceptable salt thereof, or a solvate of them to a mammal, which comprises detecting splicing defect caused by the compound represented by formula (I), the pharmaceutically acceptable salt thereof, or the solvate of them:
wherein R3, R6, R7 and R21, the same or different, each represents
1) a hydroxyl group or an oxo group formed together with the carbon atom to which it is bound, provided that R6 is limited to a hydroxyl group,
2) an optionally substituted C1-22 alkoxy group,
3) an optionally substituted unsaturated C2-22 alkoxy group,
4) an optionally substituted C7-22 aralkyloxy group,
5) an optionally substituted 5- to 14-membered heteroaralkyloxy group,
6) RCO—O— wherein R represents
a) a hydrogen atom,
b) an optionally substituted C1-22 alkyl group,
c) an optionally substituted unsaturated C2-22 alkyl group,
d) an optionally substituted C6-14 aryl group,
e) an optionally substituted 5- to 14-membered heteroaryl group,
f) an optionally substituted C7-22 aralkyl group,
g) an optionally substituted 5- to 14-membered heteroaralkyl group,
h) an optionally substituted C1-22 alkoxy group,
i) an optionally substituted unsaturated C2-22 alkoxy group,
j) an optionally substituted C6-14 aryloxy group or
k) an optionally substituted 5- to 14-membered heteroaryloxy group,
7) RSIRS2RS3SiO— wherein RSI, RS2, and RS3, the same or different, each represents
a) a C1-6 alkyl group or
b) a C6-14 aryl group,
8) a halogen atom,
9) RN1RN2N—RM— wherein RM represents
a) a single bond,
b) —CO—O—,
c) —SO2—O—,
d) —CS—O— or
e) —CO—NRN3— wherein RN3 represents a hydrogen atom or an optionally substituted C1-6 alkyl group, provided that each of the leftmost bond in b) to e) is bound to the nitrogen atom; and RN1 and RN2, the same or different from each other and each represents
a) a hydrogen atom,
b) an optionally substituted C1-22 alkyl group,
c) an optionally substituted unsaturated C2-22 alkyl group,
d) an optionally substituted aliphatic C2-22 acyl group,
e) an optionally substituted aromatic C7-15 acyl group,
f) an optionally substituted C6-14 aryl group,
g) an optionally substituted 5- to 14-membered heteroaryl group,
h) an optionally substituted C7-22 aralkyl group,
i) an optionally substituted C1-22 alkylsulfonyl group,
j) an optionally substituted C6-14 arylsulfonyl group,
k) an optionally substituted 3- to 14-membered non-aromatic heterocyclic group formed by RNI and RN2 together with the nitrogen atom to which RNI and RN2 are bound, and the non-aromatic heterocyclic group optionally has substituent(s),
l) an optionally substituted 5- to 14-membered heteroaralkyl group,
m) an optionally substituted C3-14 cycloalkyl group or
n) an optionally substituted 3- to 14-membered non-aromatic heterocyclic group,
10) RN4SO2— wherein RN4 represents
a) an optionally substituted C1-22 alkyl group,
b) an optionally substituted C6-14 aryl group,
c) an optionally substituted C1-22 alkoxy group,
d) an optionally substituted unsaturated C2-22 alkoxy group,
e) an optionally substituted C6-14 aryloxy group,
f) an optionally substituted 5- to 14-membered heteroaryloxy group,
g) an optionally substituted C7-22 aralkyloxy group or
h) an optionally substituted 5- to 14-membered heteroaralkyloxy group,
11) (RN5O)2PO—O— wherein RN5 represents
a) an optionally substituted C1-22 alkyl group,
b) an optionally substituted unsaturated C2-22 alkyl group,
c) an optionally substituted C6-14 aryl group,
d) an optionally substituted 5- to 14-membered heteroaryl group,
e) an optionally substituted C7-22 aralkyl group or
f) an optionally substituted 5- to 14-membered heteroaralkyl group,
12) (RN1RN2N)2PO—O— wherein RNI and RN2 have the same meanings as defined above or
13) (RN1RN2N)(RN5O)PO—O— wherein RN1, RN2 and RN5 have the same meanings as defined above, provided that a compound in which R3, R6, R7 and R21 are all hydroxyl groups, and a compound in which R3, R6 and R21 are all hydroxyl groups and R7 is an acetoxy group are excluded,
R15 represents a hydrogen atom or hydroxyl group.
(2) The method according to (1), wherein the compound represented by formula (I) is selected from the group consisting of:
(a) measuring the expression level of pre-mRNA before and after administration of the compound represented by formula (I), the pharmaceutically acceptable salt thereof, or the solvate of them to a mammal;
(b) comparing, based on the expression level measured in (a), the expression level of pre-mRNA before and after administration of the compound represented by formula (I), the pharmaceutically acceptable salt thereof, or the solvate of them, to determine that the compound represented by formula (I), the pharmaceutically acceptable salt thereof, or the solvate of them exerts an action to the mammal when the expression level of pre-mRNA after the administration increases.
(4) The method according to (3), wherein the pre-mRNA of which expression level is measured is pre-mRNA of at least one gene selected from the genes listed in Table 1, Table 2, Table 3, Table 4, and Table 5, or a homologous gene thereof.
(5) The method according to (4), wherein the gene(s) are selected from DNAJB1, BZW1, NUP54, RIOK3, CDKN1B, STK17B, EIF4A1, and ID1.
(6) The method according to (3), wherein in step (a), the expression level of pre-mRNA in samples obtained from a subject before and after administration of the compound represented by formula (I), the pharmaceutically acceptable salt thereof, or the solvate of them, is measured.
(7) The method according to (6), wherein the samples obtained from the subject are selected from hemocytes in peripheral blood, plasma, and serum.
(8) A probe or primer for assaying an action of a compound represented by formula (I), a pharmaceutically acceptable salt thereof, or a solvate of them to a mammal, which consists of a polynucleotide capable of hybridizing with a polynucleotide consisting of a nucleotide sequence of at least one gene selected from the genes listed in Table 1, Table 2, Table 3, Table 4, and Table 5, or a homologous gene thereof, or a complementary sequence thereof.
(9) The probe or primer according to (8), which is capable of detecting a genomic intron region or a part thereof in a gene listed in Table 1, Table 2, Table 3, Table 4 and Table 5, or which is capable of detecting a polynucleotide lacking a part of a genomic exon region in a gene listed in Table 1, Table 2, Table 3, Table 4 and Table 5.
(10) A reagent or kit for assaying an action of a compound represented by formula (I), a pharmaceutically acceptable salt thereof, or a solvate of them to a mammal, which comprises the probe or the primer according to (8).
(11) The method according to (1), wherein the detection of splicing defect comprises the steps of:
(f) measuring the expression level of an abnormal protein before and after administration of the compound represented by formula (I), the pharmaceutically acceptable salt thereof, or the solvate of them to a mammal;
(g) comparing, based on the expression level measured in (f), the expression level of the abnormal protein before and after administration of the compound represented by formula (I), the pharmaceutically acceptable salt thereof or the solvate of them, to determine that the compound represented by formula (I), the pharmaceutically acceptable salt thereof, or the solvate of them exerts an action to the mammal when the expression level of the abnormal protein after administration increases.
(12) The method according to (11), wherein the abnormal protein of which expression level is measured is a protein consisting of amino acids encoded by a polynucleotide of at least one gene selected from the genes listed in Table 1 and Table 3, or a homologous gene thereof where splicing defect has been caused in the polynucleotide, or a protein consisting of amino acids encoded by a polynucleotide of at least one gene selected from the genes listed in Table 2, Table 4 and Table 5 or a homologous gene thereof where splicing defect has been caused in the polynucleotide.
(13) The method according to (11), wherein the abnormal protein of which expression level is measured is a protein consisting of amino acids encoded by a polynucleotide of at least one gene selected from DNAJB1, BZW1, NUP54, RIOK3, CDKN1B, STK17B, EIF4A1 and ID1 where splicing defect has been caused in the polynucleotide.
(14) The method according to (11), wherein in step (f), the expression level of the abnormal protein in the samples obtained from a subject before and after administration of the compound represented by formula (I) or the pharmaceutically acceptable salt thereof or the solvate of them, is measured.
(15) The method according to (14), wherein the samples obtained from the subject are selected from hemocytes in peripheral blood, plasma, and serum.
(16) An antibody against an abnormal protein consisting of amino acids encoded by a polynucleotide of at least one gene selected from the genes listed in Table 1, Table 2, Table 3, Table 4 and Table 5 where splicing defect has been caused in the polynucleotide, or a fragment thereof.
(17) A reagent or kit for assaying an action of a compound represented by formula (I), a pharmaceutically acceptable salt thereof, or a solvate of them to a mammal, comprising the antibody or the fragment thereof according to (16).
(18) Use of a probe or primer consisting of a polynucleotide capable of hybridizing with a polynucleotide consisting of a nucleotide sequence of at least one gene selected from the genes listed in Table 1, Table 2, Table 3, Table 4, and Table 5, and homologous genes thereof, or complementary sequences thereof, for assaying an action of a compound represented by formula (I), a pharmaceutically acceptable salt thereof, or a solvate of them to a mammal.
(19) Use of an antibody against a protein consisting of amino acids encoded by a polynucleotide of at least one gene selected from the genes listed in Table 1, Table 2, Table 3, Table 4 and Table 5, or a fragment of the antibody, for assaying an action of a compound represented by formula (I), a pharmaceutically acceptable salt thereof, or a solvate of them to a mammal.
According to the present invention, an action of the compound represented by formula (I) to a living body can be confirmed using splicing defect in a cancerous or normal tissue of a cancer patient or normal tissue of a healthy individual, more specifically, the expression level of pre-mRNA or an abnormal protein as an index. For instance, when splicing defect is found in the cancerous or normal tissue of the cancer patient, more specifically, the expression level of pre-mRNA or the abnormal protein increases, it can be determined that the compound represented by formula (I) exerts the action in the body and that thus administration of the drug is no longer required or less amount of the drug should be administrated. Further, when splicing defect is not found in the cancerous or normal tissue of the cancer patient, more specifically, the expression level of pre-mRNA or the abnormal protein exhibits the same amount as before the administration, it can be determined that the compound represented by formula (I) does not exert the action and further administration of the drug is required. Hence, according to the invention, by monitoring periodically the expression of pre-mRNA or the abnormal protein, the antitumor agent can be administered more effectively to the patient and a minimally required amount of the drug can be administered to the patient. In particular, since the action of the compound represented by formula (I) can be judged by monitoring the expression level of pre-mRNA or the abnormal protein in samples obtained from normal tissue such as blood of the patient, it is an advantage that the action of the compound represented by formula (I) to the living body can be readily and reliably assessed.
All technical terms, scientific terms and terminologies used in the present specification have the same meanings as those that are generally understood by those ordinary skilled in the art in the technical fields to which the present invention belongs, and are used merely for the purpose of explaining a specific embodiment but are not intended to make limitation. The present invention can be carried out in various embodiments as long as not departing from the spirit thereof. All the prior art documents, published publications, patent publications and other patent documents cited in the present specification are incorporated into the present specification as references, and can be used for carrying out the present invention.
The “halogen atom” used in the specification of the present application means a fluorine atom, a chlorine atom, a bromine atom and an iodine atom. Among them, for example, a fluorine atom, a chlorine atom or a bromine atom is preferred, of which a fluorine atom or a chlorine atom is preferred.
The “C1-22 alkyl group” used in the specification of the present application indicates a linear or branched alkyl group having 1 to 22 carbon atoms, such as methyl group, ethyl group, n-propyl group, iso-propyl group, n-butyl group, iso-butyl group, sec-butyl group, tert-butyl group, n-pentyl group, 1,1-dimethylpropyl group, 1,2-dimethylpropyl group, 2,2-dimethylpropyl group, 1-ethylpropyl group, n-hexyl group, 1-ethyl-2-methylpropyl group, 1,1,2-trimethylpropyl group, 1-propylpropyl group, 1-methylbutyl group, 2-methylbutyl group, 1,1-dimethylbutyl group, 1,2-dimethylbutyl group, 2,2-dimethylbutyl group, 1,3-dimethylbutyl group, 2,3-dimethylbutyl group, 2-ethylbutyl group, 2-methylpentyl group, 3-methylpentyl group, n-heptyl group, n-octyl group, n-nonyl group or n-decyl group; preferably a linear or branched alkyl group having 1 to 6 carbon atoms, such as methyl group, ethyl group, n-propyl group, iso-propyl group, n-butyl group, iso-butyl group, sec-butyl group, tert-butyl group or n-pentyl group; and more preferably, for example, methyl group, ethyl group, propyl group, iso-propyl group, n-butyl group, iso-butyl group or tert-butyl group.
The “unsaturated C2-22 alkyl group” used in the specification of the present application indicates a linear or branched alkenyl group having 2 to 22 carbon atoms or a linear or branched alkynyl group having 2 to 22 carbon atoms, such as vinyl group, allyl group, 1-propenyl group, isopropenyl group, 2-methyl-1-propenyl group, 2-methyl-2-propenyl group, 1-butenyl group, 2-butenyl group, 3-butenyl group, 1-pentenyl group, 1-hexenyl group, 1,3-hexadienyl group, 1,5-hexadienyl group, ethynyl group, 1-propynyl group, 2-propynyl group, 1-butynyl group, 2-butynyl group, 3-butynyl group, 1-ethynyl-2-propynyl group, 2-methyl-3-butynyl group, 1-pentynyl group, 1-hexynyl group, 1,3-hexanediynyl group or 1,5-hexanediynyl group. It preferably indicates a linear or branched alkenyl group having 2 to 10 carbon atoms or a linear or branched alkynyl group having 2 to 10 carbon atoms, such as vinyl group, allyl group, 1-propenyl group, 2-propenyl group, isopropenyl group, 3-methyl-2-butenyl group, 3,7-dimethyl-2,6-octadienyl group, ethynyl group, 1-propynyl group, 2-propynyl group, 1-butynyl group, 2-butynyl group, 3-butynyl group or 3-methyl-1-propynyl group.
The “C6-14 aryl group” used in the specification of the present application means an aromatic cyclic hydrocarbon group having 6 to 14 carbon atoms, and a monocyclic group and condensed rings such as a bicyclic group and a tricyclic group are included. Examples thereof include phenyl group, indenyl group, 1-naphthyl group, 2-naphthyl group, azulenyl group, heptalenyl group, indacenyl group, acenaphthyl group, fluorenyl group, phenalenyl group, phenanthrenyl group and anthracenyl group; and preferred examples include phenyl group, 1-naphthyl group and 2-naphthyl group.
The “5- to 14-membered heteroaryl group” used in the specification of the present application means a monocyclic, bicyclic or tricyclic 5- to 14-membered aromatic heterocyclic group which contains one or more of hetero atoms selected from the group consisting of nitrogen atom, sulfur atom and oxygen atom. Preferred examples thereof include nitrogen-containing aromatic heterocyclic groups such as pyrrolyl group, pyridyl group, pyridazinyl group, pyrimidinyl group, pyrazinyl group, triazolyl group, tetrazolyl group, benzotriazolyl group, pyrazolyl group, imidazolyl group, benzimidazolyl group, indolyl group, isoindolyl group, indolizinyl group, purinyl group, indazolyl group, quinolyl group, isoquinolyl group, quinolizinyl group, phthalazinyl group, naphthyridinyl group, quinoxalinyl group, quinazolinyl group, cinnolinyl group, pteridinyl group, imidazotriazinyl group, pyrazinopyridazinyl group, acridinyl group, phenanthridinyl group, carbazolyl group, carbazolinyl group, perimidinyl group, phenanthrolinyl group, phenazinyl group, imidazopyridinyl group, imidazopyrimidinyl group, pyrazolopyridinyl group and pyrazolopyridinyl group; sulfur-containing aromatic heterocyclic groups such as thienyl group and benzothienyl group; and oxygen-containing aromatic heterocyclic groups such as furyl group, pyranyl group, cyclopentapyranyl group, benzofuryl group and isobenzofuryl group; aromatic heterocyclic groups containing two or more different hetero atoms, such as thiazolyl group, isothiazolyl group, benzothiazolyl group, benzthiadiazolyl group, phenothiazinyl group, isoxazolyl group, furazanyl group, phenoxazinyl group, oxazolyl group, isoxazoyl group, benzoxazolyl group, oxadiazolyl group, pyrazolooxazolyl group, imidazothiazolyl group, thienofuranyl group, furopyrrolyl group and pyridoxazinyl group; and preferred examples include thienyl group, furyl group, pyridyl group, pyridazyl group, pyrimidyl group and pyrazyl group.
The “3- to 14-membered non-aromatic heterocyclic group” used in the specification of the present application indicates a monocyclic, bicyclic or tricyclic 3- to 14-membered non-aromatic heterocyclic group which may contain one or more hetero atoms selected from the group consisting of nitrogen atom, sulfur atom and oxygen atom. Preferred examples thereof include aziridinyl group, azetidinyl group, pyrrolidinyl group, pyrrolyl group, piperidinyl group, piperazinyl group, homopiperidinyl group, homopiperazinyl group, imidazolyl group, pyrazolidyl group, imidazolidyl group, morpholyl group, thiomorpholyl group, imidazolinyl group, oxazolinyl group, 2,5-diazabicyclo[2.2.1]heptyl group, 2,5-diazabicyclo[2.2.2]octyl group, 3,8-diazabicyclo[3.2.1]octyl group, 1,4-diazabicyclo[4.3.0]nonyl group, quinuclidyl group, tetrahydrofuran-yl group and tetrahydrothiophen-yl group. The non-aromatic heterocyclic groups also include groups derived from pyridone ring, and non-aromatic fused rings (e.g., a group derived from, for example, phthalimide ring or succinimide ring).
The “C7-22 aralkyl group” used in the specification of the present application means a group corresponding to the above-defined “C1-22 alkyl group” of which substitutable moiety is replaced by the above-defined “C6-14 aryl group”. Specific examples thereof include benzyl group, phenethyl group, 3-phenylpropyl group, 4-phenylbutyl group, 1-naphthylmethyl group and 2-naphthylmethyl group; and preferred examples include aralkyl groups having 7 to 10 carbon atoms such as benzyl group and phenethyl group.
The “5- to 14-membered heteroaralkyl group” used in the specification of the present application means a group corresponding to the above-defined “C1-22 alkyl group” of which substitutable moiety is replaced by the above-defined “5- to 14-membered heteroaryl group”. Specific examples thereof include thienylmethyl group, furylmethyl group, pyridylmethyl group, pyridazylmethyl group, pyrimidylmethyl group and pyrazylmethyl group; and preferred examples include thienylmethyl group, furylmethyl group and pyridylmethyl group.
The “C3-14 cycloalkyl group” used in the specification of the present application indicates a cycloalkyl group having 3 to 14 carbon atoms, and suitable examples thereof include cyclopropyl group, cyclobutyl group, cyclopentyl group, cyclohexyl group, cycloheptyl group and cyclooctyl group; and preferred examples include cyclopentyl group, cyclohexyl group, cycloheptyl group and cyclooctyl group.
The “C4-9 cycloalkyl alkyl group” used in the specification of the present application means a group corresponding to the above-defined “C1-22 alkyl group” of which substitutable moiety is replaced by the above-defined “C3-14 cycloalkyl group”. Specific examples thereof include cyclopropylmethyl group, cyclobutylmethyl group, cyclopentylmethyl group, cyclohexylmethyl group, cycloheptylmethyl group and cyclooctylmethyl group; and preferred example include cyclopropylmethyl group, cyclobutylmethyl group and cyclopentylmethyl group.
The “C1-22 alkoxy group” used in the specification of the present application means a group corresponding to the above-defined “C1-22 alkyl group” to which end an oxygen atom is bonded. Suitable examples thereof include methoxy group, ethoxy group, n-propoxy group, iso-propoxy group, n-butoxy group, iso-butoxy group, sec-butoxy group, tert-butoxy group, n-pentyloxy group, iso-pentyloxy group, sec-pentyloxy group, n-hexoxy group, iso-hexoxy group, 1,1-dimethylpropyloxy group, 1,2-dimethylpropyloxy group, 2,2-dimethylpropoxy group, 1-methyl-2-ethylpropoxy group, 1-ethyl-2-methylpropoxy group, 1,1,2-trimethylpropoxy group, 1,2,2-trimethylpropoxy group, 1,1-dimethylbutoxy group, 1,2-dimethylbutoxy group, 2,2-dimethylbutoxy group, 2,3-dimethylbutyloxy group, 1,3-dimethylbutoxy group, 2-ethylbutoxy group, 2-methylpentoxy group, 3-methylpentyloxy group and hexyloxy group; and preferred examples include methoxy group, ethoxy group, n-propoxy group, iso-propoxy group, iso-butoxy group and 2,2-dimethylpropyloxy group.
The “unsaturated C2-22 alkoxy group” used in the specification of the present application means a group corresponding to the above-defined “unsaturated C2-22 alkyl group” to which end an oxygen atom is bonded. Suitable examples thereof include vinyloxy group, allyloxy group, 1-propenyloxy group, 2-propenyloxy group, isopropenyloxy group, 2-methyl-1-propenyloxy group, 2-methyl-2-propenyloxy group, 1-butenyloxy group, 2-butenyloxy group, 3-butenyloxy group, 1-pentenyloxy group, 1-hexenyloxy group, 1,3-hexadienyloxy group, 1,5-hexadienyloxy group, propargyloxy group and 2-butynyloxy group; and preferred examples include allyloxy group, propargyloxy group and 2-butynyloxy group.
The “C6-14 aryloxy group” used in the specification of the present application means a group corresponding to the above-defined “C6-14 aryl group” to which end an oxygen atom is bonded. Specific examples thereof include phenyloxy group, indenyloxy group, 1-naphthyloxy group, 2-naphthyloxy group, azulenyloxy group, heptalenyloxy group, indacenyloxy group, acenaphthyloxy group, fluorenyloxy group, phenalenyloxy group, phenanthrenyloxy group and anthracenyloxy group; and preferred examples include phenyloxy group, 1-naphthyloxy group and 2-naphthyloxy group.
The “C7-22 aralkyloxy group” used in the specification of the present application means a group corresponding to the above-defined “C7-22 aralkyl group” to which end an oxygen atom is bonded. Specific examples thereof include benzyloxy group, phenethyloxy group, 3-phenylpropyloxy group, 4-phenylbutyloxy group, 1-naphthylmethyloxy group and 2-naphthylmethyloxy group; and preferred examples include benzyloxy group.
The “5- to 14-membered heteroaralkyloxy group” used in the specification of the present application means a group corresponding to the above-defined “5- to 14-membered heteroaralkyl group” to which end an oxygen atom is bonded. Specific examples thereof include thienylmethyloxy group, furylmethyloxy group, pyridylmethyloxy group, pyridazylmethyloxy group, pyrimidylmethyloxy group and pyrazylmethyloxy group; and preferred examples include thienylmethyloxy group, furylmethyloxy group and pyridinylmethyloxy group.
The “5- to 14-membered heteroaryloxy group” used in the specification of the present application means a group corresponding to the above-defined “5- to 14-membered heteroaryl group” to which end an oxygen atom is bonded. Specific examples thereof include pyrrolyloxy group, pyridyloxy group, pyridazinyloxy group, pyrimidinyloxy group, pyrazinyloxy group, triazolyloxy group, tetrazolyloxy group, benzotriazolyloxy group, pyrazolyloxy group, imidazolyloxy group, benzimidazolyloxy group, indolyloxy group, isoindolyloxy group, indolizinyloxy group, purinyloxy group, indazolyloxy group, quinolyloxy group, isoquinolyloxy group, quinolizyloxy group, phthalazyloxy group, naphthyridinyloxy group, quinoxalyloxy group, quinazolinyloxy group, cinnolinyloxy group, pteridinyloxy group, imidazotriazinyloxy group, pyrazinopyridazinyloxy group, acridinyloxy group, phenanthridinyloxy group, carbazolyloxy group, carbazolinyloxy group, perimidinyloxy group, phenanthrolinyloxy group, phenazinyloxy group, imidazopyridinyloxy group, imidazopyrimidinyloxy group, pyrazolopyridinyloxy group, pyrazolopyridinyloxy group, thienyloxy group, benzothienyloxy group, furyloxy group, pyranyloxy group, cyclopentapyranyloxy group, benzofuryloxy group, isobenzofuryloxy group, thiazolyloxy group, isothiazolyloxy group, benzothiazolyloxy group, benzothiadiazolyloxy group, phenothiazinyloxy group, isoxazoyloxy group, furazanyloxy group, phenoxazinyloxy group, oxazolyloxy group, isoxazolyloxy group, benzoxazolyloxy group, oxadiazolyloxy group, pyrazolooxazolyloxy group, imidazothiazolyloxy group, thienofuranyloxy group, furopyrrolyloxy group and pyridoxazinyloxy group; and preferred examples include thienyloxy group, pyridyloxy group, pyrimidyloxy group and pyrazyloxy group.
The “aliphatic C2-22 acyl group” used in the specification of the present application means a group corresponding to the above-defined “C1-22 alkyl group” or “unsaturated C2-22 alkyl group” to which end a carbonyl group is bonded. Examples thereof include acetyl group, propionyl group, butyryl group, iso-butyryl group, valeryl group, iso-valeryl group, pivaloyl group, caproyl group, decanoyl group, lauroyl group, myristoyl group, palmitoyl group, stearoyl group, arachidoyl group, acryloyl group, propiol group, crotonyl group, iso-crotonyl group, olenoyl group and linolenoyl group; and preferred examples include aliphatic acyl groups having 2 to 6 carbon atoms, such as acetyl group, propionyl group, butyryl group, iso-butyryl group and acryloyl group.
The “aromatic C7-15 acyl group” used in the specification of the present application means a group corresponding to the above-defined “C6-14 aryl group” or “5- to 14-membered heteroaryl group” to which end a carbonyl group is bonded. Examples thereof include benzoyl group, 1-naphthoyl group, 2-naphthoyl group, picolinoyl group, nicotinoyl group, isonicotinoyl group, furoyl group and thiophenecarbonyl group; and preferred examples include benzoyl group, picolinoyl group, nicotinoyl group and isonicotinoyl group.
The “C1-22 alkylsulfonyl group” used in the specification of the present application means a group corresponding to the above-defined “C1-22 alkyl group” to which a sulfonyl group is bound. Specific examples thereof include methylsulfonyl group, ethylsulfonyl group, n-propylsulfonyl group and iso-propylsulfonyl group; and preferred examples include methylsulfonyl group.
The “C6-14 arylsulfonyl group” used in the specification of the present application means a group corresponding to the above-defined “C6-14 aryl group” to which a sulfonyl group is bound. Specific examples thereof include benzenesulfonyl group, 1-naphthalenesulfonyl group and 2-naphthalenesulfonyl group; and preferred examples include benzenesulfonyl group.
The “aliphatic C2-22 acyloxy group” used in the specification of the present application means a group corresponding to the above-defined “aliphatic C2-22 acyl group” to which end an oxygen atom is bonded. Specific examples thereof include acetoxy group, propionyloxy group and acryloxy group; and preferred examples include acetoxy group and propionyloxy group.
The “C2-22 alkoxycarbonyl group” used in the specification of the present application means a group corresponding to the above-defined “C1-22 alkoxy group” to which end a carbonyl group is bonded. Examples thereof include methoxycarbonyl group, ethoxycarbonyl group, n-propoxycarbonyl group, iso-propoxycarbonyl group, n-butoxycarbonyl group, iso-butoxycarbonyl group, sec-butoxycarbonyl group and tert-butoxycarbonyl group; and preferred examples include ethoxycarbonyl group, iso-propoxycarbonyl group and tert-butoxycarbonyl group.
The “unsaturated C3-22 alkoxycarbonyl group” used in the specification of the present application means a group corresponding to the above-defined “unsaturated C2-22 alkoxy group” to which end a carbonyl group is bonded. Examples thereof include vinyloxycarbonyl group, allyloxycarbonyl group, 1-propenyloxycarbonyl group, isopropenyloxycarbonyl group, propargyloxycarbonyl group and 2-butynyloxycarbonyl group; and preferred examples include allyloxycarbonyl group.
The “C1-22 alkylthio group” used in the specification of the present application means a group corresponding to the above-defined “C1-22 alkyl group” to which end a sulfur atom is bonded. Examples thereof include methylthio group, ethylthio group, n-propylthio group and iso-propylthio group; and preferred examples include methylthio group or ethylthio group.
The “C1-22 alkylsulfinyl group” used in the specification of the present application means a group corresponding to the above-defined “C1-22 alkyl group” to which end a sulfinyl group is bonded. Examples thereof include methylsulfinyl group, ethylsulfinyl group, n-propylsulfinyl group and iso-propylsulfinyl group; and preferred examples include methanesulfinyl group or ethanesulfinyl group.
The “C1-22 alkylsulfonyloxy group” used in the specification of the present application means a group corresponding to the above-defined “C1-22 alkylsulfonyl group” to which end an oxygen atom is bonded. Examples thereof include methylsulfonyloxy group, ethylsulfonyloxy group, n-propylsulfonyloxy group and iso-propylsulfonyloxy group; and preferred examples include methylsulfonyloxy group.
The substituent of the phrase “an optionally substituted” used in the specification of the present application may be one or more groups selected from:
(1) a halogen atom,
(2) a hydroxyl group,
(3) a thiol group,
(4) a nitro group,
(5) a nitroso group,
(6) a cyano group,
(7) a carboxyl group,
(8) a hydroxysulfonyl group,
(9) a amino group,
(10) a C1-22 alkyl group (for example, methyl group, ethyl group, n-propyl group, iso-propyl group, n-butyl group, iso-butyl group, sec-butyl group and tert-butyl group),
(11) an unsaturated C2-22 alkyl group (for example, vinyl group, allyl group, 1-propenyl group, 2-propenyl group, isopropenyl group, ethynyl group, 1-propynyl group, 2-propynyl group, 1-butynyl group, 2-butynyl group and 3-butynyl group),
(12) a C6-14 aryl group (for example, phenyl group, 1-naphthyl group and 2-naphthyl group),
(13) a 5- to 14-membered heteroaryl group (for example, thienyl group, furyl group, pyridyl group, pyridazyl group, pyrimidyl group and pyrazyl group),
(14) a 3- to 14-membered non-aromatic heterocyclic group (for example, aziridinyl group, azetidyl group, pyrrolidinyl group, pyrrolyl group, piperidinyl group, piperazinyl group, homopiperidinyl group, homopiperazinyl group, imidazolyl group, pyrazolidyl group, imidazolidyl group, morpholyl group, thiomorpholyl group, imidazolinyl group, oxazolinyl group and quinuclidyl group),
(15) a C3-14 cycloalkyl group (for example, cyclopropyl group, cyclobutyl group, cyclopentyl group, cyclohexyl group, cycloheptyl group and cyclooctyl group),
(16) a C1-22 alkoxy group (for example, methoxy group, ethoxy group, n-propoxy group, iso-propoxy group, sec-propoxy group, n-butoxy group, iso-butoxy group and tert-butoxy group),
(17) an unsaturated C2-22 alkoxy group (for example, vinyloxy group, allyloxy group, 1-propenyloxy group, 2-propenyloxy group, isopropenyloxy group, ethynyloxy group, 1-propynyloxy group, 2-propynyloxy group, 1-butynyloxy group and 2-butynyloxy group),
(18) a C6-14 aryloxy group (for example, phenyloxy group, 1-naphthyloxy group and 2-naphthyloxy group),
(19) a C7-22 aralkyloxy group (for example, benzyloxy group, phenethyloxy group, 3-phenylpropyloxy group, 4-phenylbutyloxy group, 1-naphthylmethyloxy group and 2-naphthylmethyloxy group),
(20) a 5- to 14-membered heteroaralkyloxy group (for example, thienylmethyloxy group, furylmethyloxy group, pyridylmethyloxy group, pyridazylmethyloxy group, pyrimidylmethyloxy group and pyrazylmethyloxy group),
(21) a 5- to 14-membered heteroaryloxy group (for example, thienyloxy group, furyloxy group, pyridyloxy group, pyridazyloxy group, pyrimidyloxy group and pyrazyloxy group),
(22) an aliphatic C2-22 acyl group (for example, acetyl group, propionyl group, butyryl group, iso-butyryl group, valeryl group, iso-valeryl group, pivalyl group, caproyl group, decanoyl group, lauroyl group, myristoyl group, palmitoyl group, stearoyl group, arachidoyl group, acryl group, propiol group, crotonyl group, iso-crotonyl group, olenoyl group and linolenoyl group),
(23) an aromatic C7-15 acyl group (for example, benzoyl group, 1-naphthoyl group and 2-naphthoyl group),
(24) an aliphatic C2-22 acyloxy group (for example, acetoxy group, propionyloxy group and acryloxy group),
(25) a C2-22 alkoxycarbonyl group (for example, methoxycarbonyl group, ethoxycarbonyl group, n-propoxycarbonyl group, iso-propoxycarbonyl group, n-butoxycarbonyl group, iso-butoxycarbonyl group, sec-butoxycarbonyl group and tert-butoxycarbonyl group),
(26) an unsaturated C3-22 alkoxycarbonyl group (for example, vinyloxycarbonyl group, allyloxycarbonyl group, 1-propenyloxycarbonyl group, 2-propenyloxycarbonyl group, isopropenyloxycarbonyl group, propargyloxycarbonyl group and 2-butynyloxycarbonyl group),
(27) a C1-22 alkylthio group (for example, methylthio group, ethylthio group, n-propylthio group and iso-propylthio group),
(28) a C1-22 alkylsulfinyl group (for example, methylsulfinyl group, ethylsulfinyl group, n-propylsulfinyl group and iso-propylsulfinyl group),
(29) a C1-22 alkylsulfonyl group (for example, methylsulfonyl group, ethylsulfonyl group, n-propanesulfonyl group and iso-propanesulfonyl group),
(30) a C6-14 arylsulfonyl group (for example, benzenesulfonyl group, 1-naphthalenesulfonyl group and 2-naphthalenesulfonyl group),
(31) a C1-22 alkylsulfonyloxy group (for example, methylsulfonyloxy group, ethylsulfonyloxy group, n-propylsulfonyloxy group and iso-propanesulfonyloxy group),
(32) carbamoyl group, and
(33) formyl group.
Among them, a preferred example is an amino group, a C1-22 alkyl group, an unsaturated C2-22 alkyl group, a C6-14 aryl group, a 5- to 14-membered heteroaryl group, a 3- to 14-membered non-aromatic heterocyclic group and a C3-14 cycloalkyl group, and a more preferred example is an amino group, a C1-22 alkyl group, a 3- to 14-membered nonaromatic heterocyclic group and a C3-14 cycloalkyl group. The above-mentioned (9) amino group and (31) carbamoyl group as the substituent in “an optionally substituted” may each be further substituted with one or two of a C1-22 alkyl group, an unsaturated C2-22 alkyl group or a C6-14 aryl group.
In the present specification, the chemical formula of the compound according to the present invention is illustrated as a planimetric chemical formula for convenience but the compound can include certain isomers drawn from the chemical formula. The present invention can include all isomers and mixtures of the isomers such as a geometric isomer which is generated from the configuration of the compound, an optical isomer based on an asymmetric carbon, a rotamer, a stereoisomer and a tautomer. The present invention is not limited to the expediential description of the chemical formula, and can include either of isomers or a mixture thereof. Accordingly, when the compound according to the present invention has an asymmetric carbon in the molecule, and its optically active substance and racemate exist, any one is included. Further, when polymorphic crystals exist, the crystal form according to the present invention is not specifically limited to one form, and any one of the crystal forms may be single or a mixture of the crystal forms.
The “pharmaceutically acceptable salt” used in the present invention is not particularly restricted as long as it can form a salt with the compound represented by formula (I), and is pharmaceutically acceptable. Preferred examples thereof include halide hydroacid salt such as hydrochloric acid salt, hydrobromic acid salt, hydrolodic acid salt; inorganic acid salt such as sulphic acid salt, nitric acid salt, perchloric acid salt, phosphoric acid salt, carbonic acid salt, bicarbonic acid salt; organic carboxylic acid salt such as acetic acid salt, trifluoroacetic acid salt, maleic acid salt, tartaric acid salt, fumaric acid salt, citric acid salt; organic sulfonic acid salt such as methanesulfonic acid salt, trifluoro methanesulfonic acid salt, ethanesulfonic acid salt, benzenesulfonic acid salt, toluenesulfonic acid salt, camphorsulfonic acid salt; amino acid salt such as aspartic acid salt, glutamic acid salt; quaternary amine salt; alkaline metal salt such as sodium salt, potassium salt; and alkaline earth metal salt such as magnesium salt, calcium salt.
The “solvate” used in the present invention is not particularly restricted as long as it can form a solvate with the compound represented by formula (I) or the salt thereof, and is pharmaceutically acceptable. Preferred examples include hydrate, alcoholate such as ethanolate, and etherate.
The present invention also includes a metabolite generated by degradation of the compound represented by formula (I) within a living body, as well as a prodrug of the compound represented by formula (I) and the salt thereof. The “prodrug” used herein means an inert substance to which “an active moiety of a drug” (meaning “drug” corresponding to a prodrug) has been chemically modified, for the purpose of improvement of bioavailability and reduction of a side effect. After absorbed, it is metabolized into the active moiety in vivo and exerts an action. Accordingly, the term “prodrug” refers to any compound having a lower intrinsic activity than the corresponding “drug”, which is, once administrated to a biological system, converted into the “drug” substance via a spontaneous chemical reaction, enzyme catalyzed reaction or metabolic reaction. Examples of such prodrugs include various prodrugs, for example, compounds produced by acylation, alkylation, phosphorylation, boration, carbonation, esterification, amidation, or urethanation of a functional group such as an amino, hydroxyl, or carboxyl group in the compound represented by formula (I). However, it should be noted that the exemplified prodrugs are not comprehensive but are merely typical, and other conventional various prodrugs can be prepared by a conventional method by a person having ordinary skill in the art from the compound represented by formula (I).
When the compound represented by formula (I) is administrated to a mammal in the method according to the present invention, the compound represented by formula (I) may be formulated by known methods. Conventional carriers are used for formulation, and the pharmaceutical products are prepared by conventional methods. Namely, when a solid formulation for oral use is prepared, a filler is added to the main drug, and if necessary, a binder, a disintegrant, a lubricant, a colorant, a flavoring agent and the like are added thereto, and then tablets, coated tablets, granules, powders, capsules and the like are prepared by conventional methods. It is needless to say that sugar coating, gelatin coating or suitable coating may be conducted on the tablet and granule, if necessary. When the compounds are formulated as an injection, a pH regulator, a buffer, a stabilizer, a solubilizer and the like are added to the main drug, if necessary, to prepare an subcutaneous, intramuscular, intra-articular or intravenous injection according to conventional procedures. When the compound represented by formula (I) is administered as a therapeutic or preventive agent for various diseases, it may be orally administered as tablets, powders, granules, capsules, syrups and the like, and may be parenterally administered as a spray, a suppository, an injection, a topical preparation or an infusion. Although the dose remarkably varies according to the severity of symptom, age, the kind of disease etc., approximately 1 mg to 100 mg per day for an adult is administered in general at one time or several times per day.
When the expression level of pre-mRNA of the genes listed in Table 1, Table 2, Table 3, Table 4, and Table 5 or homologous genes thereof, preferably the genes listed in Table 1 and Table 2 or homologous genes thereof as well as an abnormal protein generated by splicing defect of the gene is monitored in the method according to the present invention, the expression level may be preferably monitored before administration of the compound represented by formula (I), followed by another monitoring at 3, 6, 8, 24, or 48 hours after the administration. In a preferred embodiment, follow-up monitoring of the expression level is carried out at the earliest three hours after the administration of the compound represented by formula (I).
Upon implementing the method according to the present invention the splicing defect can be detected using an increase in the expression level of pre-mRNA or the abnormal protein caused by the splicing defect as an index.
According to a first aspect of the invention, a method for assaying the action of the compound represented by formula (I), using the increase in the expression level of pre-mRNA as an index (invention (3)) is provided.
In step (a), cancer tissue or normal tissue such as hemocytes in peripheral blood, platelets, and serum can be taken from the mammal subjected to the assay and pre-mRNA samples can be prepared from the obtained samples to quantify the expression level of pre-mRNA. Preparation of pre-mRNA is well known (for example, “Molecular Cloning, A Laboratory Manual 3d ed.” (Cold Spring Harbor Press (2001)), and required devices, instruments, and reagents therefor are commercially available. Hence those skilled in the art may prepare pre-mRNA with no difficulties using the devices, apparatuses, and reagents as needed.
Measurement of the expression level of pre-mRNA in step (a) can be performed with any method selected from a Northern blot method, a dot blot method, an RT-PCR method, and a microarray (preferably, Human Exon 1.0 ST Array). The principles of these methods and how to carry out these methods are well-known, and the required devices and apparatuses therefor are commercially available. Moreover, in Examples below, an example in which the expression level of pre-mRNA is measured with these methods will be described. Those skilled in the art can measure the expression level of pre-mRNA with no difficulties using the Northern blot method, the dot blot method, the RT-PCR method, and the microarray. In the measurement of the expression level of pre-mRNA in step (a), preferably, the microarray can be used.
For the measurement of the expression level of pre-mRNA in step (a), a probe and a primer which consist of a polynucleotide capable of hybridizing with nucleotide sequences of genes listed in Table 1, Table 2, Table 3, Table 4, and Table 5 and homologous genes thereof, preferably genes listed in Table 1 and Table 2 or homologous genes thereof, or their complementary sequences can be employed as a detection marker.
Any probe and primer according to the present invention may be employed as long as it can detect the expression of pre-mRNA (including a part thereof) of the genes listed in Table 1, Table 2, Table 3, Table 4, and Table 5 and homologous genes thereof, preferably the genes listed in Table 1 and Table 2 or homologous genes thereof. The probe and the primer according to the present invention refers to a polymer consisting of bases or base pairs such as deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). It has been known that double stranded cDNA can be used in tissue in situ hybridization, and the probe and the primer according to the present invention include such double stranded cDNA. Particularly preferred RNA probe and primer for detecting RNA in tissue include RNA probes (riboprobe).
The probe and the primer according to the present invention includes a probe or a primer which consists of a polynucleotide comprising a nucleotide sequence of at least 10, preferably at least 15, more preferably at least 20, further preferably at least 25 continuous nucleotides of the genes listed in Table 1, Table 2, Table 3, Table 4 and Table 5, and homologous genes thereof, preferably genes listed in Table 1 and Table 2 or homologous genes thereof, or complementary sequences thereof as well as all mutated polynucleotide sequences thereof. The probe and the primer according to the present invention include a probe or a primer which consists of a polynucleotide comprising a nucleotide sequence of 10 to 50 or 10 to 30 continuous nucleotides, 15 to 50 or 15 to 30 continuous nucleotides, 20 to 50 or 20 to 30 continuous nucleotides, 25 to 50 or 25 to 30 continuous nucleotides, of the genes listed in Table 1, Table 2, Table 3, Table 4 and Table 5, and homologous genes thereof, preferably the genes listed in Table 1 and Table 2 or homologous genes thereof or mutated polynucleotide sequences thereof.
The probe and the primer according to the present invention may be at least 10 bases in length, preferably at least 15 bases in length, more preferably at least 20 bases in length, further preferably at least 25 bases in length. The probe and the primer according to the present invention may also be 10 to 50 bases or 10 to 30 bases in length, 15 to 50 bases or 15 to 30 bases in length, 20 to 50 bases or 20 to 30 bases in length, 25 to 50 bases or 25 to 30 bases in length.
According to the preferred embodiment of the probe and the primer according to the present invention, there are provided the probe and the primer having 15 to 30 bases in length for assaying the action of the compound represented by formula (I) to the mammals, which consist of a polynucleotide comprising at least 10, preferably at least 15, more preferably at least 20, further preferably at least 25 continuous nucleotides of a polynucleotide sequence of the genes listed in Table 1, Table 2, Table 3, Table 4, and Table 5 or homologous genes thereof, preferably the genes listed in Table 1 and Table 2 or homologous genes thereof, as well as all mutated sequences thereof, and which are capable of hybridizing with a polynucleotide sequence of the genes listed in Table 1, Table 2, Table 3, Table 4, and Table 5 or homologous genes thereof, preferably the genes listed in Table 1 and Table 2 or homologous genes thereof.
According to a preferred aspect of the probe and the primer according to the present invention, there are provided a probe and a primer which are capable of hybridizing with a more distinct region within a nucleotide sequence of the genes listed in Table 1, Table 2, Table 3, Table 4, and Table 5 or homologous genes thereof, preferably the genes listed in Table 1 and Table 2 or homologous genes thereof. The above probe and primer allow more precise detection of the action of the compound represented by formula (I) to the mammal.
The probe according to the present invention can be chemically synthesized based on the nucleotide sequence of the gene subjected to be detected. Preparation of the probes is well known and can be carried out in accordance with, for example, “Molecular Cloning, A Laboratory Manual 2nd ed.” (Cold Spring Harbor Press (1989)), “Current Protocols in Molecular Biology” (John Wiley & Sons (1987-1997)).
The primers according to the present invention can be used as a primer set comprising of two or more types of the primers.
The primer and the primer set according to the present invention can be used as a primer and a primer set in accordance with a conventional method in a known method for detecting the target gene using a nucleic acid amplification method such as a PCR method, a RT-PCR method, a real-time PCR method, and an in situ PCR method.
The primer set according to the present invention can be selected such that the nucleotide sequence of the target gene can be amplified with the nucleic acid amplification method such as the PCR method. The nucleic acid amplification method is well known and selection of the primer pair therein is obvious for those skilled in the art. For example, in the PCR method, the primers can be selected such that one of two primers (a primer pair) undergoes base pairing with the plus strand of the double stranded DNA of the gene subjected to be detected whereas the other of the primers undergoes base pairing with the minus strand of the double stranded DNA, as well as an extending strand extended with one primer can be paired with the other primer. In a LAMP method (WO00/28082), three regions from the 3′ terminus termed F3c, F2c and F1c, and three regions from the 5′ terminus termed B1, B2 and B3 are respectively defined for the gene subjected to be detected. Four types of primers can be designed using these six regions.
The primer according to the present invention may be chemically synthesized based on the nucleotide sequence of the gene subjected to be detected. Preparation of the primer is well known and can be carried out in accordance with, for example, “Molecular Cloning, A Laboratory Manual 2nd ed.” (Cold Spring Harbor Press (1989)), “Current Protocols in Molecular Biology” (John Wiley & Sons (1987-1997)).
Table 1, Table 2, Table 3, Table 4, and Table 5 describe information specifying the genes and homologous genes thereof listed in these tables. Accordingly those skilled in the art can obtain information on the nucleotide sequence of the subject gene to be detected based on the information described in Table 1, Table 2, Table 3, Table 4, and Table 5 to design the probe and primer based thereon.
In addition, the genes listed in Table 1, Table 2, Table 3, Table 4, and Table 5 are known genes and probes and primers for detecting them are commercially available individually or as a detection kit or detection array.
The term “to hybridize” used in the specification of the present application means to hybridize with a target polynucleotide under stringent conditions. A specific example of the polynucleotide which hybridizes under stringent conditions includes a polynucleotide having at least 70% or more, preferably 80% or more, more preferably 85% or more, further preferably 90% or more, further more preferably 95% or more, particularly preferably 98% or more, and most preferably 99% or more homology to the target polynucleotide when the homology is calculated by a homology search software, such as FASTA, BLAST, Smith-Waterman (Meth. Enzym., 164, 765, (1988)), using default parameters. Further, hybridization “under stringent conditions” can be performed, for example, by a method of carrying out the reaction at a temperature of 40° C. to 70° C., preferably at a temperature of 60° C. to 65° C., in a hybridization buffer solution generally used by those skilled in the art, and carrying out washing in a washing solution at a salt concentration of 15 to 300 mmol/L, preferably at 15 to 60 mmol/L. The temperature and salt concentration can be appropriately adjusted depending on the length of the probe to be used. Further the hybridized product can be washed under conditions in 0.2× or 2×SSC and 0.1% SDS at a temperature of 20° C. to 68° C. Whether stringent (high stringency) or mild (low stringency) conditions is used depends on a difference in salt concentrations and temperatures while the washing process. In cases where the difference in hybridizing depends on the salt concentration, the washing process can be carried out in 0.2×SSC and 0.1% SDS as a stringent washing buffer (high stringency wash buffer) and 2×SSC and 0.1% SDS as a mild washing buffer (low stringency wash buffer). Also, in cases where the difference in hybridizing depends on the temperature, the washing process may be carried out at 68° C. for stringent conditions, at 42° C. for medium (moderate stringency) conditions, or at room temperature (20-25° C.) for mild conditions, but 0.2×SSC and 0.1% SDS are used in all the cases.
When pre-hybridization is carried out, it is carried out under the same condition as in hybridization, but pre (preliminary)-washing is not necessarily carried out under the same condition as in hybridization.
The “homologous gene” used in the specification of the present application means a gene encoding a protein functionally equivalent to a protein encoded by a certain gene. Whether it is “functionally equivalent” or not can be determined by evaluating if the protein has functions equivalent to biological phenomena or functions related to the expression of the gene. Such a gene encoding the functionally equivalent protein includes not only the so-called homologous gene but also a gene with polymorphism and a gene having a mutation without affecting the function.
Examples of the homologous gene include genes which have a nucleotide sequence of a certain gene wherein one or more (preferably one to several, or 1, 2, 3 or 4) nucleotides are inserted, substituted or deleted, or added to one or both termini, and which encode the functionally equivalent protein.
Examples of the homologous gene also include genes which encode an amino acid sequence encoded by a certain gene wherein one or more amino acids are inserted, substituted, or deleted, or added to one or both termini (modified amino acid sequence), and which encode the functionally equivalent protein.
“One or more amino acids are inserted, substituted, or deleted, or added to one or both termini” used in the specification of the present application means that a modification is made by a known technical method such as a site specific mutagenesis method or by substitution of several amino acids as in naturally occurring mutation.
The “modified amino acid sequence” used in the specification of the present application can be an amino acid sequence wherein, for example, 1 to 30 amino acids, preferably 1 to 20 amino acids, more preferably 1 to 9 amino acids, further preferably 1 to 5 amino acids, particularly preferably 1 to 2 amino acids have been inserted, substituted, or deleted, or added to one or both termini. Preferably, the modified amino acid sequence may be an amino acid sequence having one or more (preferably one or several or 1, 2, 3, or 4) conservative substitutions.
The term “conservative substitution” is used herein to mean that one or more amino acid residues are substituted with other chemically similar amino acid residues, so as not to substantially modify the functions of a protein. Examples of such conservative substitution include a case where a certain hydrophobic residue is substituted with another hydrophobic residue and a case where a certain polar residue is substituted with another polar residue having the same electric charge. Such functionally similar amino acids that can be used in such substitution are known as every amino acid types in the present technical field. Specific examples of a nonpolar (hydrophobic) amino acid include alanine, valine, isoleucine, leucine, proline, tryptophan, phenylalanine, and methionine. Examples of a polar (neutral) amino acid include glycine, serine, threonine, tyrosine, glutamine, asparagine, and cysteine. Examples of a (basic) amino acid having a positive charge include arginine, histidine, and lysine. Examples of an (acidic) amino acid having a negative charge include aspartic acid and glutamic acid.
In cases where the first aspect of the present invention is carried out using a cancer tissue and its surrounding tissue as assay samples, the action of the compound represented by formula (I) can be assayed preferably by using the expression level of pre-mRNA of the genes listed in Table 1 and Table 3 or homologous genes thereof as an index. Measurement of the expression level of the pre-mRNA in cases where the cancer tissue and the surrounding tissue are used as the samples, the microarray can be preferably used.
In cases where the first aspect of the present invention is carried out using a normal tissue, in particular peripheral blood and whole blood as the assay samples, the action of the compound represented by formula (I) can be assayed preferably by using the expression level of pre-mRNA of the genes listed in Table 2, Table 4, and Table 5, or homologous genes thereof as an index. Measurement of the expression level of the pre-mRNA in cases where the peripheral blood and whole blood are used as the samples, the microarray can be preferably used.
According to a second aspect of the present invention, a method for assaying the action of the compound represented by formula (I), using an increase in the expression level of an abnormal protein expressed resulting from splicing defect of pre mRNA (invention (11)) is provided.
The abnormal protein measured in step (f) is an abnormal protein resulting from splicing defect of the genes listed Table 1, Table 2, Table 3, Table 4, and Table 5, or homologous genes thereof. Table 1, Table 2, Table 3, Table 4, and Table 5 describe information specifying the genes listed in these tables and homologous genes thereof.
In step (f), samples are taken from a cancer tissue or normal tissue such as hemocytes in peripheral blood, plasma, and serum from a mammal subjected to the assay. Measurement of the expression level of the abnormal protein may be carried out with the collected samples as they are or a protein extracted therefrom. Extraction of the protein is well known (for example, Campa, M. J. et al. Cancer Res. 63, 1652-1656, 2003), and devices, instruments, and reagents necessary for carrying out the extraction are commercially available. Hence those skilled in the art may extract the protein with no difficulties using such the commercially available devices, apparatuses, and reagents as needed.
The measurement of the expression level of the abnormal protein in step (f) can be carried out with a method selected from a fluorescent antibody method, an enzyme immunoassay (ELISA) method, a radioimmunoassay (RIA) method, a Western blot method and an immunostaining (immunohistochemistry) method. The principle and implementation procedures of these methods are well known and devices and instruments necessary for carrying out the methods are commercially available. Furthermore, in Examples below, an example in which the expression level of pre-mRNA is measured with those methods will be described. Those skilled in the art may measure the expression level of pre-mRNA with no difficulties using the fluorescent antibody method, the enzyme immunoassay (ELISA) method, the radioimmunoassay (RIA) method, the Western blot method and the immunostaining (immunohistochemistry) method. In the measurement of the expression level of the abnormal protein in step (f), the enzyme immunoassay (ELISA) method, the Western blot method, the immunostaining (immunohistochemistry) method and a mass spectrometry method can be used.
In the measurement of the abnormal protein in step (f), an antibody against the abnormal protein generated from the splicing defect of the genes listed Table 1, Table 2, Table 3, Table 4, and Table 5 and a fragment thereof can be used as a detection marker.
Any abnormal protein may be employed for obtaining the antibody according to the present invention as long as it has antigenicity. A protein having an amino acid sequence of the abnormal protein wherein one or more amino acids are deleted, inserted, substituted or added can be used as the antigen for the abnormal protein. It is known that such a protein maintains the same biological activity as the original protein (Mark et al. (1984) Proc. Natl. Acad. Sci. USA 81:5662-6; Zoller and Smith (1982) Nucleic Acids Res. 10:6487-500; Wang et al. (1984) Science 224:1431-3; Dalbadie-McFarland et al. (1982) Proc. Natl. Acad. Sci. USA 79:6409-13). A technique to delete, insert, substitute or add one or more amino acids while maintaining the antigenicity of the original protein is known. For example, such a protein may be obtained by preparing and properly expressing a polynucleotide encoding an abnormal protein by site directed mutagenesis technique (Molecular Cloning, A Laboratory Manual 2nd ed., Cold Spring Harbor Press (1989); Current Protocols in Molecular Biology, John Wiley & Sons, (1987-1997), Section 8.1-8.5; Hashimoto-Goto et al. (1995) Gene 152:271-5; Kinkel (1985) Proc. Natl. Acad. Sci. USA 82:488-92; Kramer and Fritz (1987) Method. Enzymol. 154:350-67; Kunkel (1988) Method. Enzymol. 85:2763-6).
The antibody according to the present invention includes an antibody having specificity against a part of the abnormal protein. That is, the abnormal protein for obtaining the antibody according to the present invention includes a polypeptide having the full length amino acid sequence of the abnormal protein as well as a fragment thereof having at least six amino acid residues (for example, not less than 6, 8, 10, 12 or 15 amino acid residues). A preferred fragment is a polypeptide fragment such as an amino terminus and a carboxyl terminus of the abnormal protein. An antigen determination site of the polypeptide can be predicted by a method analyzing the hydrophobicity/hydrophilicity of the amino acid sequence of the protein (Kyte-Doolittle (1982) J. Mol. Biol. 157:105-22), and a method analyzing a secondary structure (Chou-Fasman (1978) Ann. Rev. Biochem. 47:251-76) and further confirmed by a computer program (Anal. Biochem. 151:540-6 (1985)) or a technique such as PEPSCAN analysis (patent application publication JP60500684T) involving the synthesis of a short peptide to confirm the antigenicity.
Table 1, Table 2, Table 3, Table 4 and Table 5 describe information specifying the genes listed in these Tables and homologous genes thereof. Accordingly, those skilled in the art can obtain information on an amino acid encoded by the subject gene to be detected based on the information described in Table 1, Table 2, Table 3, Table 4 and Table 5, and can design and obtain an antibody based thereon.
In addition, the genes listed in Table 1, Table 2, Table 3, Table 4 and Table 5 are known genes and an antibody for detecting a protein encoded thereby is commercially available individually or as a detection kit or detection array.
The antibody according to the present invention may be obtained with a method known those skilled in the art (for example, “Current Protocols in Molecular Biology” (John Wiley & Sons (1987), Antibodies: A Laboratory Manual, Ed. Harlow and David Lane, Cold Spring Harbor Laboratory (1988)).
The antibody according to the present invention includes a polyclonal antibody, a monoclonal antibody, a chimeric antibody, a single chain antibody (scFv), a humanized antibody and a multispecific antibody. Also, the fragment of the antibody according to the present invention includes an antibody fragment such as Fab, Fab′, F(ab′)2, Fc, and Fv.
For a polyclonal antibody, blood can be taken from a mammal sensitized with an antigen and blood serum can be isolated with known procedures from the blood to yield blood serum containing the polyclonal antibody. As needed, a fraction containing the polyclonal antibody can further be isolated from this blood serum.
For a monoclonal antibody, antibody-producing cells are taken from spleen or lympho node of a mammal sensitized with the above-mentioned antigen, and then undergo cell fusion with myeloma cell. The resultant hybridoma is subjected to cloning and the antibody was recovered from the culture thereof to yield the monoclonal antibody.
A fragment of the abnormal protein can be used as an immunogen. Alternatively, the synthesized one based on the amino acid sequence of the abnormal protein can be used. The antigen can be used as a complex with a carrier protein. A variety of condensing agents can be used for preparation of the complex between the antigen and the carrier protein, which condensing agents include glutaraldehyde, carbodiimide, and maleimide active ester. The carrier protein may be a usually used one such as bovine serum albumin, thyroglobulin, and hemocyanin. A procedure for coupling at a rate (volume) of 1 time to 5 times is usually employed.
Examples of the animal immunized include mice, rats, rabbits, guinea pigs, hamsters. An example of a method of inoculation is subcutaneous, intramuscular or intraperitoneal administration. The administration may be done in combination with Freund's complete adjuvant and Freund's incomplete adjuvant, and usually once every two to five weeks.
The antibody-producing cells obtained from the spleen or lymph node of the animal immunized undergo cell fusion with myeloma cells, and is isolated as hybridoma. As the myeloma cells, cells derived from mouse, rat, Homo sapiens and etc. are used. It is preferred that antibody-producing cell be derived from the same species. Yet there are cases where the cell fusion can be carried out between different species.
Procedures for the cell fusion may be carried out with a known method, in accordance with, for example, Nature, 256, 495, 1975. Examples of fusion accelerator include polyethylene glycols and Sendai virus. The cell fusion can be usually carried out by using about 20 to 50% of concentration of polyethylene glycols (average molecular weight 1000 to 4000); at a temperature of 20 to 40° C., preferably 30 to 37° C.; at a ratio in number of cells between antibody production cells and myeloma of usually about 1:1 to 10:1, and for about 1 to 10 minutes.
Various immunochemical methods can be employed for screening the antibody-producing hybridoma. Examples thereof include ELISA method using a microtiter plate coated with the abnormal protein, EIA method using a microtiter plate coated with an anti-immunoglobulin antibody, immune blot method using a nitrocellulose blotting membrane after electrophoresis of samples containing the abnormal protein.
Using such wells, cloning by, for example, a limiting dilution method can be further carried out to obtain a clone. Selection and breeding of the hybridoma is usually carried out culture medium for mammalian cells (such as RPMI1640) containing 10˜20% bovine fetus serum and supplemented with HAT (hypoxanthine, aminopterin, and thymidine). The clone obtained in such a way is intraperitoneally transplanted into a SCID mouse previously administrated with pristine. Ten to fourteen days later, ascites containing the monoclonal antibody at a high concentration is obtained, which ascites can be used as a raw material for antibody purification. Also the clone may be cultured and the obtained culture may be used as a raw material for antibody purification
Any purification method may be used for purifying the monoclonal antibody as long as it is a known method for purifying an immunoglobulin. The purification can be readily accomplished by, for example, an ammonium sulfate fractionation method, a PEG fractionation method, an ethanol fractionation method, and use of an anion exchanger, as well as means such as affinity chromatography using the abnormal protein.
Purification of the polyclonal antibody from serum can be carried out in the same manner.
In cases where the procedure in the second aspect according to the present invention is carried out by using the cancer tissue and its surrounding tissue as assay samples, the action of the compound represented by formula (I) can preferably be assayed by using the expression level of the abnormal protein(s) expressed resulting from splicing defect of the genes listed in Table 1 and Table 3 or homologous genes thereof as an index. In cases where the cancer tissue and the surrounding tissue are used as the samples, the measurement of the expression level of the abnormal proteins can preferably be employed with the enzyme immunoassay (ELISA) method, the Western blot technique, the immunostaining (immunohistochemistry) method and the mass spectrometry method.
In cases where the procedure in the second aspect of the present invention using peripheral blood or whole blood as assay samples, the action of the compound represented by formula (I) can preferably be assayed by using the expression level of the abnormal protein(s) expressed resulting from splicing defect of the genes listed in Table 2, Table 4, and Table 5 or homologous genes thereof as an index. In cases where peripheral blood or whole blood are used as the samples, the measurement of the expression level of the abnormal proteins can preferably be employed with the enzyme immunoassay (ELISA) method, the Western blot method, the immunostaining (immunohistochemistry) method and the mass spectrometry method.
The samples obtained from a subject refer to tissues, cells, body fluids, and the like which are obtained from the subject. Specific examples include biopsy, blood (including hemocytes, plasma, and serum), urine, tissue samples such as curettage tissue (buccal scrapes) of oral cavity, and tumor cells (cells from tumors of breast, lung, stomach, head and neck, colorectum, kidney, pancreas, uterus, liver, urinary bladder, endometrium, and prostate, as well as hemocytes of leukemia patients or of lymphocytes).
The present invention is described in more detail by the examples below. The followings are illustrative of the invention and by no means intended to limit the invention to the embodiments described herein.
Gene expression that affects the cell cycle was examined by Northern blotting analysis using RNA from HeLa cells treated with pladienolide B. As a result, it was discovered that CDKN1B (p27) gene caused pre-mRNA accumulation.
HeLa cells (5×105 cells/mL) were first seeded in a six-well plate and cultured overnight in RPMI1640 medium (containing 10% FCS, penicillin, and streptomycin). The cells were then treated with 10 μM of pladienolide B, 100 μM of DRB, or 1 μg/mL of Actinomycin D for 0, 1, 2, and 4 hours. Subsequently, total RNA was obtained using RNeay mini kit (Qiagen) and absorbance at 260 nm was measured to quantify an amount of RNA. Each total RNA sample (10 μg) was, after combined with RNA SAMPLE LOADING BUFFER (SIGMA), subjected to electrophoresis in 1% denatured agarose gel containing formaldehyde, followed by blotting to nylon membrane and cross-linking with UV to make a Northern membrane.
In order to make a probe for CDKN1B(p27) and CDKN1A(p21), the entire length of gene was amplified by PCR with the following primers using cDNA reverse-transcribed from total RNA prepared from U251 cells as a template.
The obtained fragment was separated by electrophoresis in agarose gel and purified. The fragment was labeled using Megaprime DNA labeling kit (Amersham) and Redivue 32P (Amersham) and purified with ProbeQuant G-50 Micro Columns (Amersham). Using PerfectHyb hybridization solution (TOYOBO), the labeled probe was hybridized onto the blotting membrane. The membrane was washed with a buffer containing 2×SSC and 0.05% SDS, followed by a buffer containing 0.1×SSC and 0.1% SDS. The membrane was exposed to Imaging Plate (FUJIFILM) to determine intensity of photosensitivity with BAS2000 (FUJIFILM). Accumulation of CDKN1B pre-mRNA was observed only when the cells were treated with pladienolide (
In order to check if any other gene accumulated its pre-mRNA, a cDNA library was constructed from HeLa cells treated with pladienolide and by randomly sequencing 42 clones, genes containing an intron were screened. Primers were designed within the introns surrounding an exon of those genes. RT-PCR was performed for the total RNA of HeLa cells treated with pladienolide. DNAJB1, BZW1, SPAG5, RIOK3, NUP54, and BRD2 were identified as pre-mRNA-accumulating genes.
Semi-confluent HeLa cells cultured in a 10 cm dish in DMEM high glucose medium (containing 10% FCS, penicillin, and streptomycin) were treated with 10 nM, 100 nM, and 10 μM of pladienolide B for 4 hours and 6 mL of TRIzol (Invitrogen) was added thereto so that the cells were dissolved. Total RNA was obtained in accordance with the protocol of TRIzol and absorbance at 260 nm was measured to quantify an amount of RNA.
Subsequently, mRNA was purified from total RNA collected from HeLa cells treated with 10 nM, 100 nM, 10μ of pladienolide B and without the treatment, using μMACS mRNA Isolation Kit (Miltenyi Biotec). mRNA was concentrated by ethanol precipitation and absorbance at 260 nm was measured to quantify an amount of RNA. For 1 μg of mRNA, single stranded cDNA synthesis, double stranded cDNA synthesis, adaptor ligation in order was carried out using SuperScript Plasmid System for cDNA Synthesis and Cloning (Invitrogen), and the resultant DNA fragment was ligated to pCLex, which is a retrovirus vector. The resultant vector construct was then transformed into XL10-Gold ultracompetent cells (STRATAGENE). The transformed cells were seeded on LB plates containing ampicillin and cultured overnight. From each plate of the sample treated with 10 nM, 100 nM, and 10 μM of pladienolide B and without the treatment, 42 clones were separately picked up. A total of 42 clones was individually cultured and the plasmid was purified.
A nucleotide sequence of the genes inserted in the plasmid of the 42 clones extracted from the cDNA library of the sample treated with 10 nM, 100 nM, and 10 μM of pladienolide B and without the treatment was obtained using BigDye Terminator (Applied Biosystems) and senseXIY primer (sequence: CCTCGATCCTCCCTTTATCCAGCCCTCACT) (SEQ ID NO: 5) with ABI PRISM3130 (Applied Biosystems). The obtained sequence was then compared with genome information with UCSC/BLAT to collect genes containing a sequence of an intron region. For the genes containing the sequence of the intron region, the following primers were designed within both-sided exon regions surrounding the intron region.
Total RNA was collected from HeLa cells treated with 100 nM or 1 μM of Pladienolide B for 1, 2, or 4 hours or untreated. The total RNA was treated with DNase, and then subjected to reverse transcription reaction to yield cDNA. The obtained cDNA was then subjected to PCR using FastStart HiFi Polymerase (Roche Diagnostics) with the designed primers. Based on an electrophoresis pattern in agarose gel, a decrease in the expression of mature RNA and an increase in the expression of premature mRNA upon the Pladienolide B treatment was confirmed in DNAJB1, BZW1, SPAG5, RIOK3, NUP54, and BRD2 (
Using RNA purified from human colon carcinoma cell strain WiDr treated with 14 nM of (8E,12E,14E)-7-((4-cycloheptylpiperazin-1-yl)carbonyl)oxy-3,6,16,21-tetrahydroxy-6,10,12,16,20-pentamethyl-18,19-epoxytricosa-8,12,14-trien-11-olide (also referred to as “E7101”) for six hours, microarray analysis (Human Exon 1.0 ST Array: Affymetrix) was carried out. Not only does this array comprehensively cover the exons for all genes, but it is also designed to have probes for regions estimated as potential exons by a computer prediction program, which enables detection of the expression of the exons and introns of all genes in theory. As a result, genes of which mature mRNA was sufficiently expressed when untreated and of which intron exhibited not less than ten times increase upon the treatment with (8E,12E,14E)-7-((4-cycloheptylpiperazin-1-yl)carbonyl)oxy-3,6,16,21-tetrahydroxy-6,10,12,16,20-pentamethyl-18,19-epoxytricosa-8,12,14-trien-11-olide in at least two probe sets were identified.
WiDr cells were first suspended in RPMI1640 medium (containing 10% FBS, penicillin, and streptomycin) and seeded in a 10 cm dish (2×106 cells/dish). After an overnight culture in an incubator with 5% carbon dioxide gas at 37° C., the medium was changed with medium containing 14 nM of (8E,12E,14E)-7-((4-cycloheptylpiperazin-1-yl)carbonyl)oxy-3,6,16,21-tetrahydroxy-6,10,12,16,20-pentamethyl-18,19-epoxytricosa-8,12,14-trien-11-olide or containing vehicle alone. After cultured for additional six hours, TRI reagent (SIGMA) were added to the cells and the cells were harvested. RNA was purified in accordance with the protocol of TRI reagent, followed by further purification with RNeasy (QIAGEN). Absorbance at 260 nm was measured to quantify an amount of RNA. This experiment was repeated three times and RNA samples (n=3) were prepared.
Ribosomal RNA was removed from 1 μg of each total RNA of control cells (n=3) and cells with the treatment (n=3) by using RiboMinus Human/Mouse Transcriptome Isolation Kit (Invitrogen). Single stranded cDNA synthesis, double stranded cDNA synthesis, cRNA synthesis, second single stranded cDNA synthesis, cDNA fragmentation, and cDNA labeling in order were carried out for the total RNA from which ribosomal RNA was removed, by using GeneChip Whole Transcript Sense Target Labeling and Control Reagents (Affymetrix) to make a cDNA probe. The cDNA probe was used for hybridization with Human Exon 1.0 ST Array (Affymetrix). The array was washed and stained, and luminescence intensity was measured by a scanner.
The expression level of the probe set and the gene was quantified by using Expression Console Ver. 1.0 (Affymetrix) with Summarization Method and Normalization Method being set to “Median polish as used in RMA” and “None”, respectively. The expression level of the probe was normalized with that of the gene. Welch's t-test was conducted for the treated group and the control group to determine a p value, which was converted into a q value by controlling False Discovery Ratio to pick out a significant probe set.
Probe sets showing that the q value was less than 1%; the normalized change in the level expression of the probe set in the group with the treatment was more than 10 times; the expression level of the probe set and the gene in the group with the treatment was more than 100; and probe set annotation was “extended, full, free”, were picked out and further arranged by gene. A gene was, when more than one probe sets therefor were found, determined as a candidate gene with increased expression level of the intron regions (Table 1). In Table 1, for the gene evaluated, gene name (Gene Name), abbreviated name (Gene Symbol), accession number (Accession), alias name (Synonym), transcription number in Human Exon 1.0 ST Array (Human Exon 1.0 ST Array), chromosome number (Chromosome), type of strand (Strand), start region (Start), stop region (Stop), and change in expression level (Fold Change) were respectively shown.
Since it is not easy to obtain a cancer tissue clinically, the measurement of the marker in hemocytes readily obtainable in peripheral blood would be more useful. It was then examined whether the marker gene obtained in cancer cells could change in peripheral blood mononuclear cells in a similar manner as observed in the cancer cells. Specifically peripheral blood was taken from three normal individuals (volunteers) and peripheral blood mononuclear cells were purified and treated with (8E,12E,14E)-7-((4-cycloheptylpiperazin-1-yl)carbonyl)oxy-3,6,16,21-tetrahydroxy-6,10,12,16,20-pentamethyl-18,19-epoxytricosa-8,12,14-trien-11-olide for three hours, followed by measurement of change in expression of the precursor gene (pre-mRNA) by qPCR. In cases where an increase in the expression of pre-mRNA is used as a marker, the genes in Table 2 below, as a representative example, were found to be usable.
Ficoll-Paque PLUS solution (Amersham, 17-1440-02) was slowly added to the blood taken (with heparin added) from healthy individuals to form a layer underneath the blood (15 mL of Ficoll-Paque PLUS solution was added to 25 mL of blood). After the mixture was centrifuged at 1500 rpm for 30 min, the upper part containing platelets was removed and then a layer containing mononuclear cells was transferred to another tube. The cells were suspended in PBS and centrifuged at 1500 rpm for 5 min, followed by removal of the supernatant. After these steps were repeated twice, the PBMC was suspended in RPMI1640 (containing 10% FBS, penicillin, and streptomycin) and the number of the cells was then counted.
PBMC was suspended in RPMI1640 medium (containing 10% FBS, penicillin, and streptomycin) to 5×106 cells/ml and 1 ml of the suspension was plated per well of a 24-well plate. Immediately, 111 μl of 10 times-concentrated (8E,12E,14E)-7-((4-cycloheptylpiperazin-1-yl)carbonyl)oxy-3,6,16,21-tetrahydroxy-6,10,12,16,20-pentamethyl-18,19-epoxytricosa-8,12,14-trien-11-olide was added to the well (six wells per each concentration tested). The cells were then cultured in an incubator with 5% carbon dioxide gas at 37° C. Three hours later, the supernatant was collected and centrifuged at 1500 rpm for five minutes. TRI reagent (SIGMA) (1 ml) was added to each well of the plate from which the supernatant was removed to harvest the cells, which was added to the centrifuged pellet to dissolve. RNA was purified in accordance with the protocol of TRI reagent. RNA was further purified using RNeasy (QIAGEN) and, in accordance with the protocol, DNaseI was added to the samples during the procedure. Absorbance at 260 nm was measured to quantify an amount of RNA.
(3) Measurement of the Expression Level of a Precursor Gene (pre-mRNA)
RNA was prepared to 30 ng/μl and cDNA was synthesized using TaqMan Reverse Transcription Reagents (Applied Biosystems). For the expression level of pre-mRNA of ID1, amplification was carried out by using TaqMan Universal PCR Master Mix (Applied Biosystems) with TaqMan Gene Expression Assays (Hs00704053_s1, Applied Biosystems) as a probe. For the expression level of pre-mRNA of DNAJB1, BZW1, NUP54, RIOK3, CDKN1B, STK17B, ADRM1, EIF4A1, FOXK2, GNB2L1, HSPA9B, HSPH1, KLHL18 and VIL2, reagents were prepared in accordance with each protocol by using POWER SYBR GREEN PCR MASTER MIX (Applied Biosystems) and primers with the sequence below (Invitrogen), and the expression level was measured with ABI7900 (Applied Biosystems). 18S rRNA was measured by both the TaqMan and SYBR methods. The expression level of 18S r RNA was measured with Hs99999901_s1 (Applied Biosystems) as primers for TaqMan and with 18S primers included in TaqMan Ribosomal RNA control reagents (4308329: Applied Biosystems) as primers for SYBR. Measured values were corrected using the expression level of 18S rRNA as an internal control. The expression level of each gene was calculated with the expression level in the cells treated without (8E,12E,14E)-7-((4-cycloheptylpiperazin-1-yl)carbonyl)oxy-3,6,16,21-tetrahydroxy-6,10,12,16,20-pentamethyl-18,19-epoxytricosa-8,12,14-trien-11-olide as 1. Genes of which expression level in PBMC reached about 250% or more were shown in Table 2.
In Table 2, for the gene evaluated, abbreviated name (Gene Symbol), accession number (Accession), alias name (Synonym), gene name (Gene Name), chromosome number (Chromosome), type of strand (Strand), start region (Start), stop region (Stop), and the expression level at 0 hours, three hours, 10 hours and 30 hours after the E7107 treatment were respectively shown.
Since fractionation of hemocytes is required for employing PBMC, use of PBMC in a clinical test is complicated. If change of pre-mRNA can be confirmed in whole blood (PBC), such a test would be clinically more useful. However, since it is difficult to culture PBC, it is not easy to monitor the change of pre-mRNA in vitro. If expression of mRNA in PBC, like in PBMC, is confirmed, the change of pre-mRNA can be monitored. Accordingly, in regard to the genes of Table 2 confirmed for PBMC (DNAJB1, BZW1, NUP54, RIOK3, CDKN1B, STK17B, and ID1), it is examined whether mRNA can be detected for RNA obtained from PBC by the same RNA purification method as in the clinical setting (Tempus PAX gene).
(1) Preparation of RNA with Tempus Blood RNA Tube (Applied Biosystems)
Human peripheral blood was collected in the tube (3 ml/tube) and combined with Stabilizing Reagent. In accordance with the protocol of the Tube, RNA was purified by the RNA Blood-DNA Method in ABI 6100 PrepStation (Applied Biosystems). Absorbance at 260 nm was measured to quantify an amount of RNA.
(2) Preparation of RNA with PAXgene Blood RNA Tube (QIAGEN)
Human peripheral blood was collected in the tube (2.5 ml/tube), combined with Stabilizing Reagent, and left to stand overnight at room temperature. In accordance with the protocol of the Tube, RNA was purified with PAXgene Blood RNA Kit (QIAGEN). Absorbance at 260 nm was measured to quantify an amount of RNA.
(3) Quantification of the Expression Level of mRNA
RNA was prepared to 30 ng/μL and cDNA was synthesized by using High Capacity cDNA Reverse Transcription Kits (Applied Biosystems). A probe corresponding respectively to DNAJB1, BZW1, NUP54, RIOK3, CDKN1B, STK17B, ID1 and 18S rRNA was purchased from TaqMan Gene Expression Assays (Applied Biosystems). Reagents were prepared in accordance with the protocol of TaqMan Universal PCR Master Mix (Applied Biosystems) and the expression level of mRNA was measured with ABI7900 (Applied Biosystems). As shown in
Since pre-mRNA contains a part of the introns, a protein translated from such pre-mRNA is one which does not normally exist. Consequently the protein may serves as a protein marker to monitor the action of (8E,12E,14E)-7-((4-cycloheptylpiperazin-1-yl)carbonyl)oxy-3,6,16,21-tetrahydroxy-6,10,12,16,20-pentamethyl-18,19-epoxytricosa-8,12,14-trien-11-olide. Whether the pre-mRNA-dependent abnormal protein practically emerged upon the treatment of (8E,12E,14E)-7-((4-cycloheptylpiperazin-1-yl)carbonyl)oxy-3,6,16,21-tetrahydroxy-6,10,12,16,20-pentamethyl-18,19-epoxytricosa-8,12,14-trien-11-olide was examined by using cancer cells (HaLa). As a result, insertion of a intron sequence was found to introduce a termination codon, which led to generation of small-molecule p27 and SMN different from normal CDKN1B (p27) (
About 3×105 cells of HeLa cells were first seeded in a 24-well culture plate (bottom area: 2 cm2), and 18 hours later, the compound was added thereto at the indicated concentration, followed by additional 24-hour culturing. The cells were washed once with PBS(−), and then were lysed by treating with 0.2 ml of M-PER reagent (PIERCE) for 30 minutes. The collected lysate was filtered with a 0.45 μm filter to remove insoluble matters and then combined with an equal amount of 2×SDS-PAGE sample solution. The mixture was heated to be denatured at 95° C. for five minutes to yield a sample to be analyzed.
The analysis sample (15 μl each) was separated with 5-20% SDS-PAGE and transferred onto a PVDF membrane (Hybond-P: GE-Amersham). The membrane was treated to be blocked with Blockace (Dainippon Pharma Co., Ltd.) by one-hour incubation. The membrane was then incubated with a primary antibody for two hours, washed three times for 10 minutes each, incubated with a secondary antibody for one hour, washed (10 minutes each) three times followed by signal detection.
Detection of p27/Kip1 was carried out as follows. Specifically, a mouse anti-p27/Kip1 monoclonal antibody (BD Bioscience, #610242) was used as the primary antibody at a 1:1000 dilution rate. An HRP-labeled mouse anti-IgG antibody (GE-Amersham) was used as the secondary antibody at a 1:2500 dilution rate. An ECL-Plus reagent (GE-Amersham) was used for the signal detection.
Detection of SMN was carried out as follows. Specifically, a mouse anti-SMN monoclonal antibody (BD Bioscience, #610646) was used as the primary antibody at a 1:1000 dilution rate. An AP-labeled mouse anti-IgG antibody (CHEMICON) was used as the secondary antibody at a 1:2500 dilution rate. NBT/BCIP reagent (PIERCE) was used for signal detection.
As shown in
(1) Administration of the Pladienolide Derivative to Nude Mice Subcutaneously Transplanted with WiDr Human Colon Carcinoma Cells.
Nude mice (BALB/cAJcl-nu/nu, 6 weeks old, female) were purchased from CLEA Japan, Inc. After an acclimated period of a week, the mice were subcutaneously transplanted WiDr cells suspended in Hanks' Balanced Salt Solution (GIBCO) (5×106 cells per a mouse). Two weeks after the transplantation, when tumor volume was confirmed to grow to more than 200 mm3, the mice were administrated (8E,12E,14E)-7-((4-cycloheptylpiperazin-1-yl)carbonyl)oxy-3,6,16,21-tetrahydroxy-6,10,12,16,20-pentamethyl-18,19-epoxytricosa-8,12,14-trien-11-olide (30 mg/kg) in a single dose via tail vein injection.
(2) Blood Collection and Isolation of the Tumor
At the time point of 30 minutes, 1 hour, 2 hours, 4 hours, and 8 hours, after the administration of (8E,12E,14E)-7-((4-cycloheptylpiperazin-1-yl)carbonyl)oxy-3,6,16,21-tetrahydroxy-6,10,12,16,20-pentamethyl-18,19-epoxytricosa-8,12,14-trien-11-olide, two mice per each time point were put down by euthanasia with CO2. Whole blood (with heparin added) was taken from abdominal aorta of each mouse, TRIzol LS Reagent (Invitrogen) was added thereto, and the mixture was stored at −20° C. The tumor was removed, cut in shape of a about 0.5 cm×0.5 cm square, and stored −20° C. in RNAlater (Ambion).
(3) Preparation of RNA
RNA preparation from blood was carried out in accordance with the protocol of TRIzol LS Reagent (Invitrogen). The obtained RNA was further purified with RNeasy (QIAGEN). During the process, a treatment with DNase I was performed in accordance with the protocol. The tumor treated with RNA later (Ambion) was placed in TRI reagent (SIGMA) and grinded by a homogenizer, followed by the operations following the protocol of TRI reagent. The obtained RNA was then purified using RNeasy (QIAGEN). During the process, a treatment with DNase I was performed in accordance with the protocol. Absorbance at 260 nm was measured to quantify an amount of each RNA.
(4) Measurement of the Expression Level of the Precursor Gene (pre-mRNA) in Blood
RNA was prepared to 100 ng/μl and cDNA was synthesized by using TaqMan Reverse Transcription Reagents (Applied Biosystems). For the expression level of pre-mRNA of mouse DNAJB1 and mouse EIF4A, reagents were prepared in accordance with each protocol by using POWER SYBR GREEN PCR MASTER MIX (Applied Biosystems) and primers with the sequence below (Invitrogen), and the expression level was measured with ABI7900 (Applied Biosystems). The expression level of 18S rRNA was measured by using 18S primers included in TaqMan Ribosomal RNA control reagents (4308329: Applied Biosystems). Measured values were corrected using the expression level of 18S rRNA as an internal control. The expression level of each gene was calculated with the expression level in the group of mice treated without (8E,12E,14E)-7-((4-cycloheptylpiperazin-1-yl)carbonyl)oxy-3,6,16,21-tetrahydroxy-6,10,12,16,20-pentamethyl-18,19-epoxytricosa-8,12,14-trien-11-olide as 1. Results were shown in FIG. 5.
(5) Measurement of the expression level of the precursor gene (pre-mRNA) in tumor
RNA was prepared to 100 ng/μl and cDNA was synthesized by using TaqMan Reverse Transcription Reagents (Applied Biosystems). For the expression level of pre-mRNA of human DNAJB1 and human EIF4A, reagents were prepared in accordance with each protocol by using POWER SYBR GREEN PCR MASTER MIX (Applied Biosystems) and primers with the sequence below (Invitrogen), and the expression level was measured with ABI7900 (Applied Biosystems). The expression level of 18S rRNA was measured by using 18S primers included in TaqMan Ribosomal RNA control reagents (4308329: Applied Biosystems). Measured values were corrected using the expression level of 18S rRNA as an internal control. The expression level of each gene was calculated with the expression level in the group of mice treated without (8E,12E,14E)-7-((4-cycloheptylpiperazin-1-yl)carbonyl)oxy-3,6,16,21-tetrahydroxy-6,10,12,16,20-pentamethyl-18,19-epoxytricosa-8,12,14-trien-11-olide as 1. Results were shown in
Analysis conditions were reviewed in the data used in Example 3. Genes containing increased introns upon treatment with (8E,12E,14E)-7-((4-cycloheptylpiperazin-1-yl)carbonyl)oxy-3,6,16,21-tetrahydroxy-6,10,12,16,20-pentamethyl-18,19-epoxytricosa-8,12,14-trien-11-olide were identified.
In order to consider the analysis conditions, variations in the data from the samples with identical conditions were studied.
Probe sets showing that the normalized change in the level expression of the probe set in the group with the treatment was more than 5 times; the expression level of the probe set and the gene in the group with the treatment were more than 100; and probe set annotation was “extended, full, free”, were picked out. Welch's t-test was conducted with the probe sets extracted for the treated group and the control group to determine a p and q value. A gene containing the probe sets with the q value of less than 5% was determined as a candidate gene with increased expression level of the intron regions (Table 3).
In Table 3, for each gene evaluated, gene name (Gene Name), abbreviated name (Gene Symbol), accession number (Accession), alias name (Synonym), transcription cluster number in Human Exon 1.0 ST Array (Human Exon 1.0 ST Array Transcript Cluster ID), chromosome number (Chromosome), type of strand (Strand), start region (Start), stop region (Stop), and change in expression level (Fold Change) were respectively shown.
Drosophila)
Drosophila); translocated to, 4
Drosophila)
Drosophila)
Using the PBMC samples in Example 4(2), genes of which introns exhibited increased expression were identified. Ribosomal RNA was removed from 1 μg of each total RNA of control cells (n=3) and cells with the treatment (n=3) using RiboMinus Human/Mouse Transcriptome Isolation Kit (Invitrogen). Single stranded cDNA synthesis, double stranded cDNA synthesis, cRNA synthesis, second single stranded cDNA synthesis, cDNA fragmentation, and cDNA labeling in order were carried out for total RNA from which ribosomal RNA was removed, using GeneChip Whole Transcript Sense Target Labeling and Control Reagents (Affymetrix) to make a cDNA probe. Subsequently, the cDNA probe was used for hybridization with Human Exon 1.0 ST Array (Affymetrix). The array was washed and stained, and luminescence intensity was measured by a scanner.
The expression level of the probe set and the gene was quantified by using Expression Console Ver. 1.0 (Affymetrix) with Summarization Method and Normalization Method being set to “Median polish as used in RMA” and “None”, respectively. The expression level of the probe was normalized with that of the gene.
(1) Identification of a Gene of which Introns Exhibit Increased Expression in a Group with the Treatment at a Concentration of 3 nM
Probe sets showing that the normalized change in the level expression of the probe set in the group with the treatment at 3 nM was more than 5 times; the expression level of the probe set and the gene in the group with the treatment at 3 nM was more than 100; and probe set annotation was “extended, full, free”, were picked out. Welch's t-test was conducted with the probe sets extracted for the group with the treatment at 3 nM and the control group to determine a p value and a q value. A gene containing the probe sets with the q value of less than 5% was determined as a candidate gene with increased expression level of the intron regions (Table 4).
In Table 4, for the gene evaluated, gene name (Gene Name), abbreviated name (Gene Symbol), accession number (Accession), alias name (Synonym), transcription cluster number in Human Exon 1.0 ST Array (Human Exon 1.0 ST Array Transcript Cluster ID), chromosome number (Chromosome), type of strand (Strand), start region (Start), stop region (Stop), and change in expression level (Fold Change) were respectively shown.
(2) Identification of the Gene of which Introns Exhibit Increased Expression in a Dose-Dependent Fashion in Groups with the Treatment at a Concentration of 3 nM, 10 nM, and 30 nM.
Probe sets showing that the normalized change in the level expression of the probe set in the group with the treatment at 30 nM was more than 5 times; the expression level of the probe set and the gene in the group with the treatment at 30 nM was more than 100; and probe set annotation was “extended, full, free”, were picked out. Regression analysis was performed with the probe sets extracted for the control group, the group with the treatment at 3 nM, the group with the treatment at 10 nM, and the group with the treatment at 30 nM to determine a p and q value for the slope of regression formula. A gene containing the probe sets with the q value of less than 5% was determined as a candidate gene with increased expression level of the intron regions (Table 5).
In Table 5, for the gene evaluated, gene name (Gene Name), abbreviated name (Gene Symbol), accession number (Accession), alias name (Synonym), transcription cluster number in Human Exon 1.0 ST Array (Human Exon 1.0 ST Array Transcription Cluster ID), chromosome number (Chromosome), type of strand (Strand), start region (Start), stop region (Stop), and change in expression level per 1 nM (Fold Change/nM) were respectively shown.
Drosophila)
Drosophila)-like 1 (Hu antigen R) // translocase
Arabidopsis)
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/JP2008/053977 | 3/5/2008 | WO | 00 | 9/4/2009 |
| Number | Date | Country | |
|---|---|---|---|
| 60904774 | Mar 2007 | US | |
| 60960403 | Sep 2007 | US |
