Method for attachment of silylated molecules to glass surfaces

Information

  • Patent Grant
  • 7485469
  • Patent Number
    7,485,469
  • Date Filed
    Friday, January 19, 2007
    18 years ago
  • Date Issued
    Tuesday, February 3, 2009
    15 years ago
Abstract
A method for the efficient immobilization of silylated molecules such as silylated oligonucleotides or proteins onto unmodified surfaces such as a glass surface is provided. Also provided are compounds, devices, and kits for modifying surfaces such as glass surfaces.
Description
BACKGROUND OF THE INVENTION

Surface modification plays an important role in micro-array biomolecule detection technology for controlling backgrounds and spot morphology. Several modifications were developed using different type of commercially available silanes such as silyl amines, aldehydes, thiols etc. for immobilization of biomolecules such as oligonucleotides. After coating the surface with reactive silanes, the next challenge is immobilization of required biomolecules on the modified surface. The surface loadings always vary with different silanes and even same silane may not give reproducible results. Reproducibility of optimum surface loading has always been a great challenge in this field since surface loading dictates the performance of the assay. Even with simple linear molecules for immobilization, the optimum loading on the surface is difficult to achieve.


Attaching DNA to a modified glass surface is a central step for many applications in DNA diagnostics industry including gene expression analysis. In general, DNA can be attached to a glass surface either through non-covalent, ionic interactions, or through multi-step processes or simple coupling reactions. Several methods have been reported in the literature using glass surface modified with different types of silylating agents1-6. All these reported methods involve silylating step which uses expensive reagents and analytical tools. Also, these methods are also multi-step processes that are labor intensive and expensive8-9. Earlier reported methods have involved a laborious synthesis and time consuming procedure7. Indeed, many of the current immobilization methods suffer from one or more of a number of disadvantages. Some of these are, complex and expensive reaction schemes with low oligonucleotide loading yields, reactive unstable intermediates prone to side reactions and unfavorable hybridization kinetics of the immobilized oligonucleotide. The efficient immobilization of oligonucleotides or other molecules on glass surface in arrays requires a) simple reliable reactions giving reproducible loading for different batches, b) stable reaction intermediates, c) arrays with high loading and fast hybridization rates, d) high temperature stability, e) low cost, f) specific attachment at either the 5′- or 3′-end or at an internal nucleotide and g) low background.


The present invention represents a significant step in the direction of meeting or approaching several of these objectives.


SUMMARY OF THE INVENTION

The present invention fulfills the need in the art for methods for the attachment of molecules such as oligonucleotides onto unmodified surfaces such as a glass surface without the need for laborious synthetic steps, with increase surface loading densities, and with greater reproducibility and which avoids the need for pre-surface modifications. Molecules such as DNA can be silylated at either the 3′ or 5′ ends as discussed below and the 3′ or 5′-silylated DNA may then be covalently attached directly to a surface such as a pre-cleaned glass surface (Scheme) for use in hybridization assays. Furthermore, thorough the use of certain silylating reagents, it is now possible to further enhance surface loading densities by using modified silylating agents having multiple molecules attached thereto. The present invention thus provides novel methods for attaching molecules onto a substrate, devices prepared by such methods, and compositions. This method provides great advantages over the present technology in terms of simplicity, cost, speed, safety, and reproducibility.


Thus, in one embodiment of the invention, a method is provided for immobilizing a molecule onto a surface, said method comprising the steps of:


(a) contacting the molecule with an agent so as to form a reactive intermediate, said agent having a formula i:

(R1)(R2)(R3)Si—X—NCY  i

wherein R1, R2 and R3 independently represents C1-C6 alkoxy, C1-C6 alkyl, phenyl, or aryl substituted with one or more groups selected from the group consisting of C1-C6 alkyl and C1-C6 alkoxy; X represents linear or branched C1-C20 alkyl or aryl substituted with one or more groups selected from the group consisting of C1-C6 alkyl and C1-C6 alkoxy, optionally substituted with one or more heteroatoms comprising oxygen, nitrogen, or sulfur; and Y represents oxygen or sulfur, with the proviso that at least one of R1, R2 or R3 represents C1-C6 alkoxy; and


(b) contacting the reactive intermediate with said surface so as to immobilize the molecule onto said surface.


In one aspect of this embodiment, a method is provided for immobilizing a molecule onto a glass surface.


In another embodiment of the invention, a method is provided for immobilizing a molecule onto a surface, said method comprising the steps of:


(a) contacting Si(NCY)4 wherein Y represents oxygen or sulfur with an agent so as to form a first reactive intermediate, said agent having a formula ii:

(R1)(R2)(R3)Si—X-Z  ii

wherein R1, R2 and R3 independently represents C1-C6 alkoxy, C1-C6 alkyl, phenyl, or aryl substituted with one or more groups selected from the group consisting of C1-C6 alkyl and C1-C6 alkoxy; X represents linear or branched C1-C20 alkyl or aryl substituted with one or more groups selected from the group consisting of C1-C6 alkyl and C1-C6 alkoxy, optionally substituted with one or more heteroatoms comprising oxygen, nitrogen, or sulfur; and Z represents a hydroxy or amino group, with the proviso that at least one of R1, R2 or R3 represents C1-C6 alkoxy;


(b) contacting the first reactive intermediate with a molecule so as to form a second reactive intermediate;


(c) contacting the second reactive intermediate with said surface so as to immobilized the molecule onto said surface. The method allows for the production of branched captured molecules structures such as branched oligonucleotides on a surface which is useful for enhancing detection of target analytes such as nucleic acids.


In one aspect of this embodiment of the invention, a method is provided for immobilizing a molecule onto a glass surface.


In another embodiment of the invention, a compound is provided having the formula iii:

(R1)(R2)(R3)Si—X—NHCYL-M  iii

wherein R1, R2 and R3 independently represents C1-C6 alkoxy, C1-C6 alkyl, phenyl, or aryl substituted with one or more groups selected from the group consisting of C1-C6 alkyl and C1-C6 alkoxy; X represents linear or branched C1-C20 alkyl or aryl substituted with one or more groups selected from the group consisting of C1-C6 alkyl and C1-C6 alkoxy, optionally substituted with one or more heteroatoms comprising oxygen, nitrogen, or sulfur; Y represents oxygen or sulfur; L represents a linking group; and M represents a molecule, with the proviso that at least one of R1, R2, or R3 represent C1-C6 alkoxy.


In another embodiment of the invention, a compound is provided having a formula iv:

(R1)(R2)(R3)Si—X-Z-CYNH—Si(NCY)3  iv

wherein R1, R2 and R3 independently represents C1-C6 alkoxy, C1-C6 alkyl, phenyl, or aryl substituted with one or more groups selected from the group consisting of C1-C6 alkyl and C1-C6 alkoxy; X represents linear or branched C1-C20 alkyl or aryl substituted with one or more groups selected from the group consisting of C1-C6 alkyl and C1-C6 alkoxy, optionally substituted with one or more heteroatoms comprising oxygen, nitrogen, or sulfur; Y represents oxygen or sulfur; and Z represents oxygen or NH, with the proviso that at least one of R1, R2, or R3 represents C1-C6 alkoxy.


In another embodiment of the invention, a compound is provided having a formula v:

(R1)(R2)(R3)Si—X-Z-CYNH—Si(NHCYL-M)3  v

wherein R1, R2 and R3 independently represents C1-C6 alkoxy, C1-C6 alkyl, phenyl, or aryl substituted with one or more groups selected from the group consisting of C1-C6 alkyl and C1-C6 alkoxy; X represents linear or branched C1-C20 alkyl or aryl substituted with one or more groups selected from the group consisting of C1-C6 alkyl and C1-C6 alkoxy, optionally substituted with one or more heteroatoms comprising oxygen, nitrogen, or sulfur; Y represents oxygen or sulfur; L represents a linking group; and Z represents oxygen or NH; and M represents a molecule, with the proviso that at least one of R1, R2, or R3 represent C1-C6 alkoxy.


In another embodiment of the invention, a compound is provided having a formula vi:

((R1)(R2)(R3)Si—X-Z-CYNH)2—Si(NCY)2  vi

wherein R1, R2 and R3 independently represents C1-C6 alkoxy, C1-C6 alkyl, phenyl, or aryl substituted with one or more groups selected from the group consisting of C1-C6 alkyl and C1-C6 alkoxy; X represents linear or branched C1-C20 alkyl or aryl substituted with one or more groups selected from the group consisting of C1-C6 alkyl and C1-C6 alkoxy, optionally substituted with one or more heteroatoms comprising oxygen, nitrogen, or sulfur; Y represents oxygen or sulfur; and Z represents oxygen or NH, with the proviso that at least one of R1, R2, or R3 represents C1-C6 alkoxy.


In another embodiment of the invention, a compound is provided having a formula vii:

((R1)(R2)(R3)Si—X-Z-CYNH)2Si(NHCYL-M)2  vii

wherein R1, R2 and R3 independently represents C1-C6 alkoxy, C1-C6 alkyl, phenyl, or aryl substituted with one or more groups selected from the group consisting of C1-C6 alkyl and C1-C6 alkoxy; L represents a linking group; X represents linear or branched C1-C20 alkyl or aryl substituted with one or more groups selected from the group consisting of C1-C6 alkyl and C1-C6 alkoxy, optionally substituted with one or more heteroatoms comprising oxygen, nitrogen, or sulfur; Y represents oxygen or sulfur; and Z represents oxygen or NH; and M represents a molecule, with the proviso that at least one of R1, R2, or R3 represents C1-C6 alkoxy.


In another embodiment of the invention, kits are provided for preparing modified substrates. The kits may include reagents for silyating molecules and optional substrates.


These and other embodiments of the invention will become apparent in light of the detailed description below.





DESCRIPTION OF THE DRAWINGS


FIG. 1 is a scheme that illustrates one embodiment of the invention. The scheme shows the modification of a molecule such as an oligonucleotide modified at either a 3′-amino or 5′-amino to produce a silylated DNA intermediate. This silylated intermediate is then spotted onto a surface of a substrate, e.g., glass substrate and washed.



FIG. 2 illustrates spot morphology after spotting a substrate with a DMF solution containing a silylated DNA in water or DMF. Branching and spreading of the spot was observed with the aqueous solution.



FIG. 3 illustrates spot morphology using a DMF solution containing a silyated DNA spotted on a overhydrated substrate. Branching of the spot was observed with the over hydrated substrate.



FIG. 4 illustrates spot morphology with an aqueous solution containing no silylated DNA (blank control) and with silylated DNA (silyl).



FIG. 5 is (a) a scheme that illustrates another embodiment of the invention. The scheme shows the coupling of a tetraisocyanatosilane with a 1-amino-4-triethoxysilylbenzene to form a first reactive intermediate 4. The reactive intermediate is then coupled to a oligonucleotide having a free 3′ or 5′-amino group to silylated DNA intermediate as a second reactive intermediate containing three molecules bound thereto. This silylated intermediate is then spotted onto a surface of a substrate, e.g., glass substrate. In part (b), a scheme is provided that illustrates another embodiment of the invention. The scheme shows the coupling of a tetraisocyanatosilane with a 1-amino-4-triethoxysilylbenzene to form a first reactive intermediate 4. The reactive intermediate is then coupled to a oligonucleotide having a free 3′ or 5′-amino group to silylated DNA intermediate as a second reactive intermediate containing two molecules bound thereto.



FIG. 6 illustrates the results of detection of M13 capture sequences using a DNA array chip prepared as described in Example 1 (method no. 1). In plate no. 1, a non-complementary nanoparticle-labeled oligonucleotide probe was used. In plates nos. 2 and 3, a specific complementary nanoparticle-labeled oligonucleotide probe was used. As expected, the plates using the specific complementary probes showed detection events. See Example 3.



FIG. 7 illustrates the results of detection of Factor V target sequence using a sandwich hybridization assay. A DNA array chip was prepared as described in Example 1 (method no. 1) using Factor V capture probe. The DNA chip performed as expected. See Example 4.



FIG. 8 illustrates the results of detection of MTHFR target sequence using a DNA array chip prepared as described in Example 1 (method no. 1). The DNA chip performed as expected. Plate No. 1 shows that the detection probe does not hybridized above its melting temperature. Plate No. 2 showed detection of a 100 mer MTHFR synthetic target. Plate No. 3 showed detection of a MTHFR PCR product. See Example 5. See Example 5.



FIG. 9 illustrates the results of detection of Factor V target sequence using a DNA array chip prepared as described in Example 1 (method no. 1). The DNA chip performed as expected. No non-specific background noise was observed. See Example 6.



FIG. 10 illustrates the results of detection of Factor V target sequence using a DNA array chip prepared as described in Example 1 (method no. 1). The DNA chip performed as expected. The probes reacted specifically to the target sequence and no cross-hybridization between the probes and targets was observed. See Example 7.





DESCRIPTION OF THE INVENTION

All patents, patent applications, and references cited herein are incorporated by reference in their entirety.


As defined herein, the term “molecule” refers to any desired specific binding member that may be immobilized onto the surface of the substrate. The “specific binding member,” as defined herein, means either member of a cognate binding pair. A “cognate binding pair,” as defined herein, is any ligand-receptor combination that will specifically bind to one another, generally through non-covalent interactions such as ionic attractions, hydrogen bonding, Vanderwaals forces, hydrophobic interactions and the like. Exemplary cognate pairs and interactions are well known in the art and include, by way of example and not limitation: immunological interactions between an antibody or Fab fragment and its antigen, hapten or epitope; biochemical interactions between a protein (e.g. hormone or enzyme) and its receptor (for example, avidin or streptavidin and biotin), or between a carbohydrate and a lectin; chemical interactions, such as between a metal and a chelating agent; and nucleic acid base pairing between complementary nucleic acid strands; a peptide nucleic acid analog which forms a cognate binding pair with nucleic acids or other PNAs. Thus, a molecule may be a specific binding member selected from the group consisting of antigen and antibody-specific binding pairs, biotin and avidin binding pairs, carbohydrate and lectin bind pairs, complementary nucleotide sequences, complementary peptide sequences, effector and receptor molecules, enzyme cofactor and enzymes, and enzyme inhibitors and enzymes. Other specific binding members include, without limitation, DNA, RNA, polypeptide, antibody, antigen, carbohydrate, protein, peptide, amino acid, carbohydrate, hormone, steroid, vitamin, drug, virus, polysaccharides, lipids, lipopolysaccharides, glycoproteins, lipoproteins, nucleoproteins, oligonucleotides, antibodies, immunoglobulins, albumin, hemoglobin, coagulation factors, peptide and protein hormones, non-peptide hormones, interleukins, interferons, cytokines, peptides comprising a tumor-specific epitope, cells, cell-surface molecules, microorganisms, fragments, portions, components or products of microorganisms, small organic molecules, nucleic acids and oligonucleotides, metabolites of or antibodies to any of the above substances. Nucleic acids and oligonucleotides comprise genes, viral RNA and DNA, bacterial DNA, fungal DNA, mammalian DNA, cDNA, mRNA, RNA and DNA fragments, oligonucleotides, synthetic oligonucleotides, modified oligonucleotides, single-stranded and double-stranded nucleic acids, natural and synthetic nucleic acids. Preparation of antibody and oligonucleotide specific binding members is well known in the art. The molecules (M) have at least one or more nucleophilic groups, e.g., amino, carboxylate, or hydroxyl, that are capable of linking or reacting with the silylating agents to form a reactive silylated molecule which is useful for modifying the surfaces of substrates. These nucleophilic groups are either already on the molecules or are introduced by known chemical procedures.


As defined herein, the term “substrate” refers any solid support suitable for immobilizing oligonucleotides and other molecules are known in the art. These include nylon, nitrocelluose, activated agarose, diazotized cellulose, latex particles, plastic, polystyrene, glass and polymer coated surfaces. These solid supports are used in many formats such as membranes, microtiter plates, beads, probes, dipsticks, optical fibers, etc. Of particular interest as background to the present invention is the use of glass and nylon surfaces in the preparation of DNA microarrays which have been described in recent years (Ramsay, Nat. Biotechnol., 16: 40-4 (1998)). The journal Nature Genetics has published a special supplement describing the utility and limitations of microarrays (Nat. Genet., 21(1): 1-60 (1999). Typically the use of any solid support requires the presence of a nucleophilic group to react with the silylated molecules of the invention that contain a “reactive group” capable of reacting with the nucleophilic group. Suitable nucleophilic groups or moieties include hydroxyl, sulfhydryl, and amino groups or any moiety that is capable of coupling with the silyated molecules of the invention. Chemical procedures to introduce the nucleophilic or the reactive groups onto solid support are known in the art, they include procedures to activate nylon (U.S. Pat. No. 5,514,785), glass (Rodgers et al., Anal. Biochem., 23-30 (1999)), agarose (Highsmith et al., J., Biotechniques 12: 418-23 (1992) and polystyrene (Gosh et al., Nuc. Acid Res., 15: 5353-5372 (1987)). The preferred substrate is glass.


The term “analyte,” or “target analyte”, as used herein, is the substance to be quantitated or detected in the test sample using devices prepared by the method of the present invention. The analyte can be any substance for which there exists a naturally occurring specific binding member (e.g., an antibody, polypeptide, DNA, RNA, cell, virus, etc.) or for which a specific binding member can be prepared, and the analyte can bind to one or more specific binding members in an assay.


In one embodiment of the invention, a method is provided for immobilizing a molecule onto a substrate surface, said method comprising the steps of contacting the molecule with an agent so as to form a reactive intermediate, said agent having a formula i:

(R1)(R2)(R3)Si—X—NCY  i

wherein R1, R2 and R3 independently represents C1-C6 alkoxy, C1-C6 alkyl, phenyl, or aryl substituted with one or more groups selected from the group consisting of C1-C6 alkyl and C1-C6 alkoxy; X represents linear or branched C1-C20 alkyl or aryl substituted with one or more groups selected from the group consisting of C1-C6 alkyl and C1-C6 alkoxy, optionally substituted with one or more heteroatoms comprising oxygen, nitrogen, or sulfur; and Y represents oxygen or sulfur, with the proviso that at least one of R1, R2 or R3 represents C1-C6 alkoxy; and contacting the reactive intermediate with said surface so as to immobilized the molecule onto said surface.


In practice, the molecule is contacted with the agent in solution. Generally, the molecule is dissolved in a solution and agent is added drop-wise to the molecule solution. Suitable, but non-limiting, examples of solvents used in preparing the solution include DMF, DMSO, ethanol and solvent mixtures such as DMSO/ethanol. The preferred solvent is ethanol. Water is preferably excluded from the reaction solvent because water may interfere with the efficient modification of the molecule. However, if water is necessary to increase solubility of the molecule in the solution, the amount of water generally ranges from about 0.1% to about 1%, usually no greater than 1%.


The amount of molecule to agent generally ranges from about 1 to about 1.5 typically from about 1 to about 1.1, preferably from about 1 to about 1 molar equivalents. The reaction may be performed in any suitable temperature. Generally, the temperature ranges between about 0° C. and about 40° C., preferably from about 20° C. to about 25° C. The reaction is stirred for a period of time until sufficient amount of molecule and agent reacts to form a reactive intermediate. The reactive intermediate has a structure defined by formula iii.


Thereafter, the reaction solution containing the reactive intermediate is then concentrated and dissolved in desired solvent to provide a spotting solution which is then applied to the surface of a substrate. The reactive intermediate is applied as a spotting solution. Any suitable solvent may be used to prepare the spotting solution. Suitable, but non-limiting, examples of solvents used in preparing the spotting solution include DMF, DMSO, and ethanol as well as any suitable solvent mixtures such as DMF/pyridine. Any suitable concentration of the spotting solution may be prepared, generally the concentration of the spotting solution is about 1 mM. Any suitable spotting technique may be used to produce spots. Representative techniques include, without limitation, manual spotting, ink-jet technology such as the ones described in U.S. Pat. Nos. 5,233,369 and 5,486,855; array pins or capillary tubes such as the ones described in U.S. Pat. Nos. 5,567,294 and 5,527,673; microspotting robots (e.g., available from Cartesian); chipmaker micro-spotting device (e.g., as available from TeleChem Interational). Suitable spotting equipment and protocols are commercially available such as the ArrayIt® chipmaker 3 spotting device. The spotting technique can be used to produce single spots or a plurality of spots in any suitable discrete pattern or array.


In the preferred embodiment, the agent is triethoxysilylisocyanate. The preferred molecule is a nucleic acid.


In another embodiment of the invention, a method is provided for immobilizing a molecule onto a substrate surface, said method comprising the steps of contacting Si(NCY)4 with an agent so as to form a first reactive intermediate, said agent having a formula ii:

(R1)(R2)(R3)Si—X-Z  ii

wherein R1, R2 and R3 independently represents C1-C6 alkoxy, C1-C6 alkyl, phenyl, or aryl substituted with one or more groups selected from the group consisting of C1-C6 alkyl and C1-C6 alkoxy; X represents linear or branched C1-C20 alkyl or aryl substituted with one or more groups selected from the group consisting of C1-C6 alkyl and C1-C6 alkoxy, optionally substituted with one or more heteroatoms comprising oxygen, nitrogen, or sulfur; wherein Y represents oxygen or sulfur; and Z represents a hydroxy or amino group, with the proviso that at least one of R1, R2 or R3 represents C1-C6 alkoxy; contacting the first reactive intermediate with a molecule so as to form a second reactive intermediate; and contacting the second reactive intermediate with said surface so as to immobilized the molecule onto said surface.


In this embodiment of the invention, the method provide for a modification of substrate surfaces with branched molecules so as to increase molecule loading on the substrate surface. These branched molecules behave like dendrimers to enhance sensitivity in assay performance. In practice, either Si(NCO)4 or Si(NCS)4 are reacted with a compound of formula ii to form a first reactive intermediate having the formula iv:

(R1)(R2)(R3)Si—X-Z-CYNH—Si(NCY)3  iv

wherein R1, R2 and R3 independently represents C1-C6 alkoxy, C1-C6 alkyl, phenyl, or aryl substituted with one or more groups selected from the group consisting of C1-C6 alkyl and C1-C6 alkoxy; X represents linear or branched C1-C20 alkyl or aryl substituted with one or more groups selected from the group consisting of C1-C6 alkyl and C1-C6 alkoxy, optionally substituted with one or more heteroatoms comprising oxygen, nitrogen, or sulfur; Y represents oxygen or sulfur; and Z represents oxygen or NH, with the proviso that at least one of R1, R2, or R3 represents C1-C6 alkoxy.


Generally, Si(NCO)4 or Si(NCS)4 is dissolved in a suitable dry solvent as described above. In practice, ethanol is the preferred solvent. The resulting ethanol solution is contained in a reaction flask and a solution of formula ii compound is added to the reaction flask. The formula ii solution may include any of the dried solvents described above. In practice, ethanol is the preferred solvent. The reaction temperature generally ranges from about 0° C. to about 40° C., preferably about 22° C. The reaction mixture is allowed to stir from about 1 min to about 60 min, usually about 5 min to about 10 min, until it reaches completion. The molar amount of Si(NCO)4 or Si(NCS)4 to formula ii compound generally ranges from about 3:1 to 1:1, preferably about 1:1.


Thereafter, the molecule is contacted with the first reactive intermediate to form a second reactive intermediate having the formula v:

(R1)(R2)(R3)Si—X-Z-CYNH—Si(NHCYL-M)3  v

wherein R1, R2 and R3 independently represents C1-C6 alkoxy, C1-C6 alkyl, phenyl, or aryl substituted with one or more groups selected from the group consisting of C1-C6 alkyl and C1-C6 alkoxy; X represents linear or branched C1-C20 alkyl or aryl substituted with one or more groups selected from the group consisting of C1-C6 alkyl and C1-C6 alkoxy, optionally substituted with one or more heteroatoms comprising oxygen, nitrogen, or sulfur; L represents a linking group; Y represents oxygen or sulfur; and Z represents oxygen or NH; and M represents a molecule, with the proviso that at least one of R1, R2, or R3 represent C1-C6 alkoxy. The linking group L may be a nucleophile that is naturally present or chemically added to the molecule such as an amino, sulfhydryl group, hydroxy group, carboxylate group, or any suitable moiety. L may represent —NH, —S—, —O—, or —OOC—.


The molecule is contacted with the first reactive intermediate in solution. Generally, the molecule is dissolved in a solvent and added dropwise to the reaction flask containing the first reactive intermediate. The molecule is generally mixed in any suitable solvent as described above. The molar amount of molecule to first reactive intermediate generally ranges from about 1 to about 10 typically from about 1 to about 3, preferably from about 1 to about 4. The reaction may be performed in any suitable temperature. Generally, the temperature ranges between about 0° C. and about 40° C., preferably from about 20° C. to about 25° C. The reaction is stirred for a period of time until sufficient amount of molecule and first reactive intermediate reacts to form a second reactive intermediate. Generally, an excess amount of molecule is used to react with the first reactive intermediate. In practice, typically at least 3 equivalents of molecule to 1 equivalent of first reactive intermediate is used.


Thereafter, the second reactive intermediate is then applied to the surface of a substrate using techniques described above.


In another aspect of this invention, if the ratio of Si(NCO)4 or Si(NCS)4 to formula ii compound is about 1:2 equiv./equiv., a first reactive intermediate is formed having the formula vi:

((R1)(R2)(R3)Si—X-Z-CYNH)2—Si(NCY)2  vi


wherein R1, R2 and R3 independently represents C1-C6 alkoxy, C1-C6 alkyl, phenyl, or aryl substituted with one or more groups selected from the group consisting of C1-C6 alkyl and C1-C6 alkoxy; X represents linear or branched C1-C20 alkyl or aryl substituted with one or more groups selected from the group consisting of C1-C6 alkyl and C1-C6 alkoxy, optionally substituted with one or more heteroatoms comprising oxygen, nitrogen, or sulfur; Y represents oxygen or sulfur; and Z represents oxygen or NH, with the proviso that at least one of R1, R2, or R3 represents C1-C6 alkoxy. Preferably, R1, R2 and R3 represent methoxy, X represents phenyl, Y represents oxygen, and Z represents NH.


Thereafter, the molecule is contacted with the first reactive intermediate of formula vi as described above to produce a second reactive intermediate having the formula vii:

((R1)(R2)(R3)Si—X-Z-CYNH)2Si(NHCYL-M)2  vii


wherein R1, R2 and R3 independently represents C1-C6 alkoxy, C1-C6 alkyl, phenyl, or aryl substituted with one or more groups selected from the group consisting of C1-C6 alkyl and C1-C6 alkoxy; L represents a linking group; X represents linear or branched C1-C20 alkyl or aryl substituted with one or more groups selected from the group consisting of C1-C6 alkyl and C1-C6 alkoxy, optionally substituted with one or more heteroatoms comprising oxygen, nitrogen, or sulfur; Y represents oxygen or sulfur; and Z represents oxygen or NH; and M represents a molecule, with the proviso that at least one of R1, R2, or R3 represent C1-C6 alkoxy. The linking group L may be a nucleophile that is naturally present or chemically added to the molecule such as an amino, sulfhydryl group, hydroxy group, carboxylate group, or any suitable moiety. L may represent —NH, —S—, —O—, or —OOC—. Generally, an excess amount of molecule is used to react with the first reactive intermediate. In practice, typically at least 3 equivalents of molecule to 1 equivalent of first reactive intermediate is used.


Thereafter, the second reactive intermediate is then applied to the surface of a substrate using the techniques described above.


In another embodiment of the invention, a compound is provided having the formula iii:

(R1)(R2)(R3)Si—X—NHCYL-M  iii

wherein R1, R2 and R3 independently represents C1-C6 alkoxy, C1-C6 alkyl, phenyl, or aryl substituted with one or more groups selected from the group consisting of C1-C6 alkyl and C1-C6 alkoxy; L represents a linking group; X represents linear or branched C1-C20 alkyl or aryl substituted with one or more groups selected from the group consisting of C1-C6 alkyl and C1-C6 alkoxy, optionally substituted with one or more heteroatoms comprising oxygen, nitrogen, or sulfur; Y represents oxygen or sulfur; and M represents a molecule, with the proviso that at least one of R1, R2, or R3 represent C1-C6 alkoxy. The linking group L may be a nucleophile that is naturally present or chemically added to the molecule such as an amino, sulfhydryl group, hydroxy group, carboxylate group, or any suitable moiety. L may represent —NH, —S—, —O—, or —OOC—. In the preferred embodiment, R1, R2, and R3 represent alkoxy, L represents —NH—, X represents propyl, and Y represents O. The compound is useful for modifying substrate surfaces with a desired molecule.


In another embodiment of the invention, a compound is provided having a formula iv:

(R1)(R2)(R3)Si—X-Z-CYNH—Si(NCY)3  iv

wherein R1, R2 and R3 independently represents C1-C6 alkoxy, C1-C6 alkyl, phenyl, or aryl substituted with one or more groups selected from the group consisting of C1-C6 alkyl and C1-C6 alkoxy; X represents linear or branched C1-C20 alkyl or aryl substituted with one or more groups selected from the group consisting of C1-C6 alkyl and C1-C6 alkoxy, optionally substituted with one or more heteroatoms comprising oxygen, nitrogen, or sulfur; Y represents oxygen or sulfur; and Z represents oxygen or NH, with the proviso that at least one of R1, R2, or R3 represents C1-C6 alkoxy. In the preferred embodiment, R1, R2, and R3 represent ethoxy or methoxy, X represents benzyl, Y represents oxygen, and Z represents NH. The compound is useful for modifying molecules so that they can be attached to substrate surfaces.


In another embodiment of the invention, a compound is provided having a formula v:

(R1)(R2)(R3)Si—X-Z-CYNH—Si(NHCYL-M)3  v

wherein R1, R2 and R3 independently represents C1-C6 alkoxy, C1-C6 alkyl, phenyl, or aryl substituted with one or more groups selected from the group consisting of C1-C6 alkyl and C1-C6 alkoxy; L represents a linking group; X represents linear or branched C1-C20 alkyl or aryl substituted with one or more groups selected from the group consisting of C1-C6 alkyl and C1-C6 alkoxy, optionally substituted with one or more heteroatoms comprising oxygen, nitrogen, or sulfur; Y represents oxygen or sulfur; and Z represents oxygen or NH; and M represents a molecule, with the proviso that at least one of R1, R2, or R3 represent C1-C6 alkoxy. The linking group L may be a nucleophile that is naturally present or chemically added to the molecule such as an amino, sulfhydryl group, hydroxy group, carboxylate group, or any suitable moiety. L may represent —NH, —S—, —O—, or —OOC—. In the preferred embodiment, R1, R2, and R3 represent methoxy or ethoxy, X represents 3- or 4-phenyl, Y represents oxygen, and Z represents NH. The compound is useful for modifying molecules so that they can be attached to substrate surfaces.


In another embodiment of the invention, a device is provided for the detection of target analytes in a sample. The device comprises a surface having an immobilized molecule as a specific binding member to the target analyte, wherein said surface is prepared by any of the above methods. The preferred surface is a glass surface. The surface may have one or more different specific binding members attached thereto in an array to allow for the detection of different portions of a target analyte or multiple different types of target analytes.


In another embodiment of the invention, a kit is provided. The kit may comprise one or more containers containing any of the silylating agents mentioned above with an optional substrate, and a set of instructions.


EXAMPLES

The invention is demonstrated further by the following illustrative examples. The examples are offered by way of illustration and are not intended to limit the invention in any manner. In these examples all percentages are by weight if for solids and by volume if for liquids, and all temperatures are in degrees Celsius unless otherwise noted.


Example 1
Preparation of DNA Array Chips

This Example provides a general procedure for the covalent attachment of a molecule, e.g., 3′ or 5′-silylated DNA, directly to surfaces such as pre-cleaned glass surface via single silylated molecule or dendritic silylated molecule procedure.


(a) Method No. 1


As shown in FIG. 1, a method is shown for attaching a 3′-amino or 5′-amino DNA molecule to a pre-cleaned glass surface. 3′-Amine linked DNA is synthesized by following standard protocol for DNA synthesis on DNA synthesizer. The 3′ amine modified DNA synthesized on the solid support was attached through succinyl linker to the solid support. After synthesis, DNA attached to the solid support was released by using aqueous ammonia, resulting in the generation of a DNA strand containing a free amine at the 3′-end. The crude material was purified on HPLC, using triethyl ammonium acetate (TEAA) buffer and acetonitrile. The dimethoxytrityl (DMT) group was removed on the column itself using trifluoroacetic acid.


After purification, 1 equivalents of 3′-amine linked DNA was subsequently treated with 1.2 equivalents of triethoxysilyl isocyanate (GELEST, Morrisville, Pa., USA) for 1-3 h in 10% DMSO in ethanol at room temperature. Traces of water that remained in the DNA following evaporation did not effect the reaction. After 3 h, the reaction mixture was evaporated to dryness and spotted directly on pre-cleaned glass surface using an arrayer (Affymetrix, GMS 417 arrayer with 500 micron pins for spotting). Typically, 1 mM silylated DNA was used to array a glass surface and the arrayed substrate is then kept in the chamber for 4 h-5 h. Thereafter, the slides were incubated in nanopure water for 10 minutes to remove the unbound DNA, washed with ethanol, and dried in the dessicator. After drying, these plates were tested with target DNA samples.


In a preliminary study using linear silyl oligonucleotides prepared by the above procedure to spot a glass surface, it was observed that spotting in DMSO or DMF medisurprisingly controlled spot branching or diffusion. See FIG. 2. The spot morphology was clean and discrete. If the substrate was overhydrated in the dessicator chamber prepared by filing a portion of a chamber with water and storing the glass slides on a rack above the water level overnight, the slides become overhydrated. Undesirable branching of the spot was observed on overhydrated slides, even when DMSO or DMF solvent is used. See FIG. 3. When water was used as the sole solvent for spotting, the resultant spots were branched out and spread to other spots. See FIG. 4. Without being bound to any theory of operation, an aqueous spotting solution and/or the presence of water in a overhydrated substrate results in the polymerization of silyl oligonucleotides and thus interfered with the modification of the surface with the desired molecule. Thus, dried polar aprotic solvents such as DMF, DMSO and dried polar solvents like ethanol, isopropanol and mixture of solvents like DMF/Pyridine were found to be suitable solvents for arraying the silyl modified oligonucleotides. The presence of water (>1%) in the spotting solution or over hydration of slides results in spot branching after arraying. Spot branching is undesirable because it may lead to false positive results in binding studies.


(b) Method No. 2


As shown in FIG. 5, a method is shown for attaching multiple 5′ or 3′ amino DNA molecules to a glass surface. To 1 equivalent of silyl amine in dry acetonitrile, 1.2 equivalents of tetraisocyante is added dropwise and the reaction mixture is stirred at room temperature for 10 minutes to form compound 3. 5′ or 3′-amine linked oligonucleotide is synthesized and deprotected using aqueous ammonia conditions by conventional procedures. After HPLC purification, 5′ or 3′-amine free oligonucleotide is treated with compound 3 in a 1:10 DMSO/ethanol (v/v) mixture. After 10 minutes, the modified oligonucleotides are evaporated under vacuum and spotted on unmodified glass surface in DMSO or DMF media.


Example 2
Detection of Factor V Target Sequence Using a DNA Array Chip

This Example illustrates that DNA plates prepared as described in Example 1 are useful for sandwich hybridization assays for detection of nucleic acid targets.


(a) Gold Colloid Preparation:


Gold colloids (13 nm diameter) were prepared by reduction of HAuCl4 with citrate as described in Frens, Nature Phys. Sci., 241, 20 (1973) and Grabar, Anal. Chem., 67, 735 (1995). Briefly, all glassware was cleaned in aqua regia (3 parts HCl, 1 part HNO3), rinsed with Nanopure H2O, then oven dried prior to use. HAuCl4 and sodium citrate were purchased from Aldrich Chemical Company. Aqueous HAuCl4 (1 mM, 500 mL) was brought to reflux while stirring. Then, 38.8 mM sodium citrate (50 mL) was added quickly. The solution color changed from pale yellow to burgundy, and refluxing was continued for 15 min. After cooling to room temperature, the red solution was filtered through a Micron Separations Inc. 1 micron filter. Au colloids were characterized by UV-V is spectroscopy using a Hewlett Packard 8452A diode array spectrophotometer and by Transmission Electron Microscopy (TEM) using a Hitachi 8100 transmission electron microscope. Gold particles with diameters of 13 nm will produce a visible color change when aggregated with target and probe oligonucleotide sequences in the 10-35 nucleotide range.


(b) Synthesis Of Oligonucleotides:


Oligonucleotides were synthesized on a 1 micromole scale using a Milligene Expedite DNA synthesizer in single column mode using phosphoramidite chemistry. Eckstein, F. (ed.) Oligonucleotides and Analogues: A Practical Approach (IRL Press, Oxford, 1991). All solutions were purchased from Milligene (DNA synthesis grade). Average coupling efficiency varied from 98 to 99.8%, and the final dimethoxytrityl (DMT) protecting group was cleaved from the oligonucleotides to do final epiendrosterone coupling on the synthesizer itself. Capture strands were synthesized with DMT on procedure and purified on HPLC system.


(c) Purification of Oligonucleotides


Reverse phase HPLC was performed with using Agilent 1100 series system equipped with Tosch Biosep Amberchrom MD-G CG-300S column (10×118 mm, 35 μm particle size) using 0.03 M Et3NH+ OAc buffer (TEAA), pH 7, with a 1%/min. gradient of 95% CH3CN/5% TEAA. The flow rate was 1 mL/min. with UV detection at 260 nm. The final DMT attached was deprotected on HPLC column itself using 1-3% trifluoro acetic acid and TEAA buffer. After collection and evaporation of the buffer contained the DMT cleaved oligonucleotides, was then evaporated to near dryness. The amount of oligonucleotide was determined by absorbance at 260 mm, and final purity assessed by reverse phase HPLC.


The same protocol was used for epiendrosterone linked-oligonucleotides for probe preparation and no DMT removal needed10.


(d) Attachment of Oligonucleotides to Gold Nanoparticles


Probes used in the Example: (3′-act tta aca ata g-a20-Epi-5′ and 3′-t taa cac tcg c-a20-Epi-5′) (SEQ ID NO:1) was attached in the following fashion. These probes were designed for M13 target sequence detection.


A 1 mL solution of the gold colloids (15 nM) in water was mixed with excess (3.68:M) 5′epi-endrosterone linked-oligonucleotide (33 and 31 bases in length) in water, and the mixture was allowed to stand for 12-24 hours at room temperature. Then, 100 μL of a 0.1 M sodium hydrogen phosphate buffer, pH 7.0, and 100 μL of 1.0 M NaCl were premixed and added. After 10 minutes, 10 μL of 1% aqueous NaN3 were added, and the mixture was allowed to stand for an additional 20 hours then increased the salt concentration to 0.3. After standing 4 h at 0.3 M NaCl again increased to 1M NaCl and kept further 16 h. This “aging” step was designed to increase the surface coverage by the epi disulfide linked-oligonucleotides and to displace oligonucleotide bases from the gold surface. Somewhat cleaner, better defined red spots in subsequent assays were obtained if the solution was frozen in a dry-ice bath after the 40-hour incubation and then thawed at room temperature. Either way, the solution was next centrifuged at 14,000 rpm in an Eppendorf Centrifuge 5414 for about 15 minutes to give a very pale pink supernatant containing most of the oligonucleotide (as indicated by the absorbance at 260 nm) along with 7-10% of the colloidal gold (as indicated by the absorbance at 520 nm), and a compact, dark, gelatinous residue at the bottom of the tube. The supernatant was removed, and the residue was resuspended in about 200 μL of buffer (10 mM phosphate, 0.1 M NaCl) and recentrifuged. After removal of the supernatant solution, the residue was taken up in 1.0 mL of buffer (10 mM phosphate, 0.1 M NaCl) and 10 μL of a 1% aqueous solution of NaN3. Dissolution was assisted by drawing the solution into, and expelling it from, a pipette several times. The resulting red master solution was stable (i.e., remained red and did not aggregate) on standing for months at room temperature, on spotting on silica thin-layer chromatography (TLC) plates, and on addition to 2 M NaCl, 10 mM MgCl2, or solutions containing high concentrations of salmon sperm DNA.


For examples 2-5 we prepared different set of Factor V probes using an aqueous solution of 17 nM (150 μL) Au colloids, as described above, was mixed with 3.75 μM (46 μL) 5′-epiendrosterone-a20-tattcctcgcc (SEQ ID NO:2), and allowed to stand for 24 hours at room temperature in 1 ml Eppendorf capped vials. A second solution of colloids was reacted with 3.75 μM (46 μL) 5′-epiendrosterone-a20-attccttgcct-3′. (SEQ ID NO:3). Note that these oligonucleotides are non-complementary. The residue was dissolved using the same procedure described above and the resulting solution was stored in a glass bottle until further use.


(e) Hybridization Conditions


Stock buffer solution: For the hybridization buffer, the following stock solution was used: 3.0 NaCl, 0.3 M Na-Citrate, 10 mM MgCl2, 4.0 mM NaH2P04 and 0.005% SDS.


Hybridization assay was performed using diluted buffer (0.78 M NaCl, 70 mM sodium citrate, 2.64 mM MgCl2, 1.1 mM sodium phosphate, 0.01%) from the stock buffer solution by adding 0.5% of Tween. In a typical experiment procedure, target and probe were mixed with the hybridization buffer and heated the mixture at 95° C. for 5 minutes. After cooling to room temperature aliquots were transferred on to the glass substrate and placed in humidity chamber for hybridization (Different assays were done at different temperature conditions since each probe has a different melting temperature). After hybridization, plates were washed with two different wash buffers and spin dried. Plates dried were treated with silver amplification solutions (silverA+silverB) (silver amplification kit available from SIGMA, St. Louis, Mo. 63178, catalog no: S 5020 and S 5145) and the data was collected from the amplified plates using an imaging system for data collection described in (Nanosphere, Inc. assignee) U.S. patent application Ser. No. 10/210,959 and PCT/US02/24604, both filed Aug. 2, 2002, which are incorporated by reference in their entirety.


(f) Target Sequence Used


This Factor V target sequence was used in examples 2-6 for detection. M13 probes were used in example 1 for direct probe targeting to capture strand test the plates and no target detection was performed here. But from example 2-5 Factor V target detection was done in presence of Factor V probes and M13 probes. Here M13 probes served as controls. In plate no: 5 different combination of assay were performed on one plate including Factor V wild type and mismatch detection. Each well in plate no:6 was clearly defined with target and probes used.


Factor V wild type sequence:










(SEQ ID NO: 4)









5′ gacatcgcctctgggctaataggactacttctaatctgtaagagcag






atccctggacaggcaaggaatacaggtattttgtccttgaagtaaccttt





cag 3′







Probe sequence:













Probe FV (13D):





5′-Epi-a20- tattcctcgcc 3′
(SEQ ID NO: 5)







Probe FV (26D):



5′-Epi-a20-attccttgcct3′
(SEQ ID NO: 6)







Capture Strand Sequence For factor V target detection:










(SEQ ID NO: 7)









5′-tcc tga tga aga tta gac att ctc gtc- NH—CO—NH—






Si—(OEt)3-3′







Stock buffer solution: For the hybridization buffer, the following stock solution was used: 3.0 NaCl, 0.3 M Na-Citrate, 10 mM MgCl2, 4.0 mM NaH2P04 and 0.005% SDS.


Example 3
Detection of M13 Target Sequence Using DNA Array Chip

In this Example, probe was targeted directly to the capture strand and a detection assay was performed. Plates Nos. 1-3 were prepared as described in Example 1 (method no. 1). In Plates 2 & 3, probes (FIG. 6) were clearly hybridized to the capture strand within 45 minutes. The gold colloid nanoparticles hybridized to the capture were clearly visible before silver amplification. In plate no 1 (FIG. 6), a different probe was used and the assay was developed to show the specificity. After silver stain development, signals were not shown on the glass surface even after silver amplification. This experiment established the specificity of the DNA chip prepared in accordance with the invention.


M13 Capture sequence:












(SEQ ID NO: 8)











5′-tga aat tgt tat c- NH—CO—NH—Si—(OEt)3-3′








Probe used on plates Nos. 2-3 plates:











3′-act tta aca ata g-a20-Epi-5′
(SEQ ID NO: 9)







On plate no. 1, a detection probe 3′-t taa cac tcg c-a20-Epi-5′ (SEQ ID NO:10) was used which was non-complementary to the capture strand for sequence specificity testing (no signals). This clearly showed the specificity of the both capture strand sequence and the probe. In both cases, 6 nM probe was used in diluted buffer conditions. In a typical experimental procedure, 30 μl of the diluted buffer (1.3M NaCl, 130 mM sodium citrate, 4.38 mM MgCl2, 1.82 mM sodium phosphate, 0.003% SDS) and 20 μl of probe (10 nM) was flooded on the arrayed glass chip and allowed to hybridize for 1.5 h at room temperature. The final concentration of probe was 4 nM and buffer concentration was 0.78 M NaCl, 70 mM sodium citrate, 2.64 mM MgCl2, 1.1 mM sodium phosphate, 0.002% SDS. Thereafter, the chip was washed with 0.75 M sodium chloride, 75 mM citrate and 0.05% Tween buffer and then washed again with 0.5 M sodium nitrate buffer. Then plates were treated with silver amplification solutions silver A+SilverB (1 mL+1 mL=total 2 mL) for 4 minutes and washed with nanopure water. Finally, the plates were exposed to the imaging system for data collection as discussed above.


Example 4
Detection of Factor V Target Sequence Using a DNA Array Chip

In this Example, two different silanized capture strands were spotted directly on the plate and detected. The plate was prepared as described in Example 1 (method no. 1). The middle row always carried the positive control capture with other capture on top and bottom rows. Here, wild type, mutant and heterozygous samples were used for the detection. All samples were showed signals in the proper place using the above mentioned assay conditions. See FIG. 7.












a) Positive controls capture sequence:











(SEQ ID NO: 10)











5′-tga aat tgt tat c- NH—CO—NH—Si—(OEt)3-3′








Probe used was for positive control:










(SEQ ID NO: 11)











3′-act tta aca ata g-a20-Epi-5′








b) Probes used for target detection are:












Probe FV 13D (probe for wild type target):












5′-Epi-a20-tattcctcgcc 3′
(SEQ ID NO: 12)















Probe FV 26D (probe for mutant target):












5′-Epi-a20-attccttgcct3′
(SEQ ID NO: 13)








Capture Strand Sequence For factor V target detection:










5′-tcc tga tga aga tta gac att ctc gtc- NH—CO—NH—






Si−(OEt)3-3′







Factor V wild type target sequence:










(SEQ ID NO: 13)









5′ gacatcgcctctgggctaataggactacttctaatctgtaagagcag






atccctggacaggcaaggaatacaggtattttgtccttgaagtaaccttt





cag 3′







Mutant Factor V target sequence:










(SEQ ID NO: 14)









gtaggactacttctaatctgtaagagcagatccctggacaggtaaggaat






acaggtattttgtccttgaagtaacctttcag-3′







Heterozygous: 50% of wild type and 50% of mutant target.
  • Well 1: Heterozygous—Probe 26D was used
  • Well 2: Heterozygous—Probe 13D was used
  • Well 3: Control—with probe 26D, only positive control should show up
  • Well 4: Control—with probe 13D, only positive control should show up
  • Well 5: Mutant—target with mutant probe 26D+positive control probe
  • Well 6: Mutant target—with wild type probe 13D+positive control
  • Well 7: Heterozygous—with probe 26D
  • Well 8: Heterozygous—with probe 13D
  • Well 9: Wild type target—with mutant probe 26D
  • Well 10: Wild type target—with wild type probe 13D


Example 5
Detection of MTHFR Target Sequence on a DNA Array Plate

In this Example, an MTHFR 100 mer synthetic target and 208 base pair PCR product (10 nM˜50 nM) was used in the detection assay. The plates were prepared as described in Example 1 (method no. 1). Alternative wells were used as controls using M13 target and MTHFR 18 mer probe and did not show even traces of silver, following silver signal amplification. As shown in plate no. 1 (FIG. 8), an experiment was performed at 70° C. to show that probe does not hybridize above melting temperature (MTHFR target and 18 mer probe). The results show probe specificity and that at high temperature, the probes are not binding nonspecifically to the silyl oligo-attached substrate.


100 mer synthetic target:










(SEQ ID NO: 14)









5′-aag cac ttg aag gag aag gtg tct gcg gga gcc gat






ttc atc atc acg cag ctt ttc ttt gag gct gac aca





ttc ttc cgc ttt gtg aag gca tgc acc ga-3′







18 mer probe sequence used on all three plates:












(SEQ ID NO: 15)











3′-ctg tgt aag aag gcg ttt-A20-Epi-5′








PCR product: 208 base pair











5′ ccttgaacaggtggaggccagcctctcctgactgtcatccctattggcaggttaccccaaaggccaccccgaagcagggag
(SEQ ID NO: 16)






ctttgaggctgacctgaagcacttgaaggagaaggtgtctgcgggagccgatttcatcatcacgcagcttttctttgaggctgaca





cattcttccgctttgtgaaggcatgcaccgacatgggcatcacttgccccatcgtccccgggatctttcccatccaggtgaggggc





ccaggagagcccataagctccctccaccccactctcaccgc







Experimental Conditions:


In a typical experimental procedure (on plate no:2), to 30 μl of the diluted buffer (1.3M NaCl, 130 mM sodium citrate, 4.38 mM MgCl2, 1.82 mM sodium phosphate, 0.003% SDS), 10 μl of 18 mer probe (10 nM) and 2 μl of 100 mer synthetic target (10 μM) 8 μl of water were mixed and flooded on the arrayed glass chip and allowed to hybridize for 1.5 h at room temperature. The final concentration of probe was 2 nM and target concentration was 400 pM and buffer concentration was 0.78 M NaCl, 70 mM sodium citrate, 2.64 mM MgCl2, 1.1 mM sodium phosphate, 0.01%). After that washed with 0.75 M sodium chloride, 75 mM citrate and 0.05% Tween buffer and then washed again with 0.5M sodium nitrate buffer. After that plates were treated with silver A+SilverB (1 mL+1 mL=total 2 mL) (silver amplification kit available from SIGMA, St. Louis, Mo. 63178, catalog no: S 5020 and S 5145) for 4 minutes and washed with nanopure water. Finally plates were exposed to imaging system for data collection as discussed above. In Example 3 on plate no:2, wells no: 2 1, 4, 5, 8 are controls and controls made up with M13 synthetic target and MTHFR 18 mer probe (5′-tat gct tcc ggc tcg tat gtt gtg tgg aat tgt gag cgg ata aca att tca-3′). (SEQ ID NO: 17)


As mentioned earlier, the experiment on plate no. 1 (FIG. 8) was performed at 70° C. to show that above melting temperature probe 18 mer probe did not bind to the capture probe.


Plate no. 3 (FIG. 8) was generated following the same experimental procedure and using the same probes. 10 μl (2 nm˜10 nM) of MTHFR PCR product was used as target. Plate no. 3 wells 2, 3, 6 and 7 are the controls with Factor V 99 mer mutant target and MTHFR 18 mer probe.


Factor V 99 Mer Mutant Factor V target had the following sequence:










(SEQ ID NO: 18)









5′ gtaggactacttctaatctgtaagagcagatccctggacaggtaaggaatacaggtattttgtccttgaagtaacctttcag-3′)







Example 6
Detection of Factor V Target Sequence on DNA Array Plate

In this Example and in the following Example 7, the same capture strands were arrayed on the plate. The purpose of this experiment was to find out the difference in intensity of the spots after silver development when same oligomer was spotted on the slide at different places. Positive control was spotted in the middle of two Factor V 4 G oligomer captures on the slide. The results are shown in FIG. 9.


Capture strand sequence for Factor V target detection was:










(SEQ ID NO: 19)









5′ tcc tga tga aga tta gac att ctc gtc-NH—CO—NH—






Si—(OEt)3-3′







Positive capture control capture spotted was (M13):












(SEQ ID NO: 20)











5′ tga aat tgt tat c-NH—CO—NH—Si—(OEt)3-3′








The target sequence used was wild type Factor V 99 base pair single strand DNA having the following sequence:











gtaggactacttctaatctgtaagagcagatccctggacaggcaaggaatacaggtattttgtccttgaagtaacctttcag-3′)
(SEQ ID NO: 21)








Mutant Factor V target had the following sequence:











gtaggactacttctaatctgtaagagcagatccctggacaggtaaggaatacaggtattttgtccttgaagtaacctttcag-3′)
(SEQ ID NO: 22)








and probes used had the following sequence:













probe FV 13D:





5′-Epi-a20-tattcctcgcc 3′,
(SEQ ID NO: 23)







probe FV 26D:



5′-Epi-a20-attccttgcct3′.
(SEQ ID NO: 24)







Capture Strand Sequence for factor V target detection:










(SEQ ID NO: 25)









5′-tcc tga tga aga tta gac att ctc gtc- NHd—CO—NH—






Si—(OEt)3-3′














Positive control sequence:










5′-tga aat tgt tat c-NH2-3′
(SEQ ID NO: 26)



and











probe used for positive control was:










3′-act tta aca ata g-a20-Epi-5′
(SEQ ID NO: 27)







In a typical experimental procedure, to 25 μl of the diluted buffer (1.3M NaCl, 130 mM sodium citrate, 4.38 mM MgCl2, 1.82 mM sodium phosphate, 0.003% SDS), 10 μl of probe (10 nM) and 10 μl of PCR target (15-50 nM) and 5 μl of positive control probe (10 nM) were mixed and flooded on the arrayed glass chip and allowed to hybridize for 1.5 h at room temperature. The final concentration of probe was 2 nM, and buffer concentration was 0.78 M NaCl, 70 mM sodium citrate, 2.64 mM MgCl2, 1.1 mM sodium phosphate, 0.01%). that the plates was then washed with 0.75 Sodium chloride, 75 mM citrate and 0.05% Tween buffer and then washed again with 0.5 M Sodium Nitrate buffer. The plates were treated with silver A+SilverB (1 mL+1 mL=total 2 mL) for 4 minutes and washed with nanopure water. Finally, the plates were exposed to the imaging system described above for data collection. Both positive control probe and target reacted probe were mixed and the assay was run to show the selectivity of the probe. The wells were identified as follows:

  • Wells 1, 6, 8 and 9 have only positive control probe with target and buffer.
  • Wells 2, 5 had both positive control probe and target probe with targets and buffer.
  • Wells 4, 7 and 10 have only target probe with target and buffer and here positive control probe and target were absent.
  • Well 3 did not have any target and positive control probe but it had target probe and buffer.


    These results (FIG. 9) show that probes were specific to target detection and no non-specific background noise was observed when target was absent.


Example 7
Detection of Factor V Target Sequence

In this Example, all capture strands pattern is the same as described in Example no. 6. Moreover, the same experimental conditions and concentrations described in Example 6 were used to perform the assay at 52° C. Wild type and mutant targets were given in the example 6. The results are shown in FIG. 10. The wells are identified as follows:

  • Well 1: Positive control probe directly probing to the capture strand in the same buffer conditions mentioned in example 4.
  • Well 2: Factor V Probe 5′-Epi-a20-attccttgcct-3′ (26D) (SEQ ID NO: 27) and Factor V 99base pair mutant target, positive control probe and buffer.
  • Well 3: Factor V Probe 5′-Epi-a20-attccttgcct-3′ (26D) (SEQ ID NO: 28) and Factor V 99base pair mutant target and hybridization buffer.
  • Well 4: Probe 13D and Factor V mutant PCR target, positive control and hybridization buffer.
  • Well 5: Probe 13D and Factor V mutant PCR target, and hybridization buffer.
  • Well 6: Control (MTHFR target and Probe 13D and hybridization buffer).
  • Well 7: Wild type Factor V target, probe (26D), positive control probe and hybridization buffer,
  • Well 8: Wild type Factor V target and probe (26D), and hybridization buffer.
  • Well 9: Wild type Factor V target, probe 13(D), positive control probe and hybridization buffer.
  • Well 10: Wild type Factor V target, probe 13(D), and hybridization buffer.













Probe FV 13D:





5′-Epi-a20-tattcctcgcc-3′
(SEQ ID NO: 29)







Probe FV 26D:



5′-Epi-a20-attccttgcct-3′
(SEQ ID NO: 30)







These results (FIG. 10) show that probes were reacted specifically to the target and there is no cross hybridization between probes and targets were observed when probes were mixed with different targets.


REFERENCES



  • 1. Nucleic Acids research, vol 22, 5456-5465 (1994).

  • 2. Nucleic Acids research, vol 24, 3040-3047 (1996).

  • 3. Nucleic Acids research, vol 24, 3031-3039 (1996).

  • 4. Nucleic Acids research, vol 27, 1970-1977 (1999).

  • 5. Angew. Chem. Int. Ed, 38, No. 9, 1297 (1999)

  • 6. Analytical biochemistry 280, 143-150 (2000).

  • 7. (a) Nucleic Acids research, vol. 28, No. 13 E71 (2000);
    • (b) Huber et al. WO 01/46214, published Jun. 28, 2001
    • (c) Huber et al. WO 01/46213, published Jun. 28, 2001
    • (d) Huber et al. WO 01/46464, published Jun. 28, 2001

  • 8. Nucleic Acids research, vol 29, 955-959 (2001).

  • 9. Nucleic Acids research, vol 29, No. 13 e69 (2001).

  • 10. Bioconjugate Chemistry, 2000, 11, 289-291


Claims
  • 1. A compound having a formula v: (R1)(R2)(R3)Si—X-Z-CYNH—Si(NHCYL-M)3  v
  • 2. The compound of claim 1 wherein L represents a nucleophilic group from the molecule.
  • 3. The compound of claim 2 wherein the nucleophilic group comprises —NH, —S—, —O—, or —OOC—.
  • 4. The compound of claim 1, wherein the molecule comprises a protein, a peptide, a nucleic acid, a peptide nucleic acid, an amino acid, a linked nucleic acid, a nucleoside triphosphate, a carbohydrate, a lipid, a lipid bound protein, an aptamer, a virus, a cell fragment, or a whole cell.
  • 5. The compound of claim 1, wherein the lipid bound protein comprises a G-protein coupled receptor.
  • 6. The compound of claim 1, wherein the molecule comprises an antibody, an antigen, a receptor, or a ligand.
CROSS-REFERENCE

This application is a divisional of U.S. application Ser. No. 10/447,073, filed May 28, 2003, which claims the benefit of U.S. Provisional application No. 60/383,564, filed May 28, 2002, which are incorporated by reference in their entirety.

US Referenced Citations (246)
Number Name Date Kind
4059685 Johnson Nov 1977 A
4067959 Bolz Jan 1978 A
4275149 Litman et al. Jun 1981 A
4751177 Stabinsky Jun 1988 A
4797355 Stabinsky Jan 1989 A
4824776 Heller Apr 1989 A
4847159 Glajch et al. Jul 1989 A
4853335 Olsen et al. Aug 1989 A
4877745 Hayes et al. Oct 1989 A
4886741 Schwartz Dec 1989 A
5057301 Wilbur et al. Oct 1991 A
5071978 San Dec 1991 A
5109124 Ramachandran et al. Apr 1992 A
5114674 Stanbro et al. May 1992 A
5124246 Urdea et al. Jun 1992 A
5143854 Pirrung et al. Sep 1992 A
5233369 Carlotta et al. Aug 1993 A
5314731 Yoneda et al. May 1994 A
5324633 Fodor et al. Jun 1994 A
5342867 Ryan et al. Aug 1994 A
5399501 Pope et al. Mar 1995 A
5482867 Barrett et al. Jan 1996 A
5486855 Carlotta et al. Jan 1996 A
5514785 Van Ness et al. May 1996 A
5527673 Reinhartz et al. Jun 1996 A
5532170 Buckle et al. Jul 1996 A
5567294 Dovichi et al. Oct 1996 A
5567295 Swamy et al. Oct 1996 A
5585275 Hudson et al. Dec 1996 A
5591646 Hudson et al. Jan 1997 A
5599695 Pease et al. Feb 1997 A
5622826 Varma Apr 1997 A
5624711 Sundberg et al. Apr 1997 A
5631734 Stern et al. May 1997 A
5690894 Pinkel et al. Nov 1997 A
5717083 Cook Feb 1998 A
5770456 Holmes Jun 1998 A
5773308 Conrad et al. Jun 1998 A
5831070 Pease et al. Nov 1998 A
5837196 Pinkel et al. Nov 1998 A
5837454 Cozzette Nov 1998 A
5840190 Scholander et al. Nov 1998 A
5858653 Duran et al. Jan 1999 A
5868936 Ofsthun et al. Feb 1999 A
5871649 Ofsthun et al. Feb 1999 A
5919523 Sundberg Jul 1999 A
5959098 Goldberg et al. Sep 1999 A
6004752 Loewy et al. Dec 1999 A
6004755 Wang Dec 1999 A
6013440 Lipshutz et al. Jan 2000 A
6040138 Lockhart et al. Mar 2000 A
6045996 Cronin et al. Apr 2000 A
6080585 Southern et al. Jun 2000 A
6101946 Martinsky Aug 2000 A
6103474 Dellinger et al. Aug 2000 A
6124102 Fodor et al. Sep 2000 A
6136269 Winkler et al. Oct 2000 A
6140044 Besemer et al. Oct 2000 A
6141096 Stern et al. Oct 2000 A
6146593 Pinkel et al. Nov 2000 A
6150103 Ness et al. Nov 2000 A
6150147 Goldberg et al. Nov 2000 A
6153743 Hubbell et al. Nov 2000 A
6174683 Hahn et al. Jan 2001 B1
6180942 Tracey et al. Jan 2001 B1
6203989 Goldberg et al. Mar 2001 B1
6225625 Pirrung et al. May 2001 B1
6239273 Pease et al. May 2001 B1
6248127 Shah et al. Jun 2001 B1
6261776 Pirrung et al. Jul 2001 B1
6262216 McGall Jul 2001 B1
6271957 Quate et al. Aug 2001 B1
6274384 Starzl et al. Aug 2001 B1
6280950 Lipshutz et al. Aug 2001 B1
6284465 Wolber et al. Sep 2001 B1
6284497 Sabanayagam et al. Sep 2001 B1
6291183 Pirrung et al. Sep 2001 B1
6294324 Bensimon et al. Sep 2001 B1
6306584 Bamdad Oct 2001 B1
6309824 Drmanac Oct 2001 B1
6309828 Schleifer et al. Oct 2001 B1
6319674 Fulcrand et al. Nov 2001 B1
6326489 Church et al. Dec 2001 B1
6329143 Stryer et al. Dec 2001 B1
6361944 Mirkin et al. Mar 2002 B1
6383742 Drmanac et al. May 2002 B1
6383749 Bochkariov et al. May 2002 B2
6399365 Besemer et al. Jun 2002 B2
6403317 Anderson Jun 2002 B1
6403957 Fodor et al. Jun 2002 B1
6406844 Pirrung et al. Jun 2002 B1
6406921 Wagner et al. Jun 2002 B1
6410229 Lockhart et al. Jun 2002 B1
6410675 McGall et al. Jun 2002 B2
6417340 Mirkin et al. Jul 2002 B1
6417506 Pinkel et al. Jul 2002 B1
6429275 McGall et al. Aug 2002 B2
6440677 Lipshutz et al. Aug 2002 B2
6448010 Zhao Sep 2002 B1
6458533 Felder et al. Oct 2002 B1
6465178 Chappa et al. Oct 2002 B2
6475440 Bochkariov Nov 2002 B1
6475808 Wagner et al. Nov 2002 B1
6475809 Wagner et al. Nov 2002 B1
6480324 Quate et al. Nov 2002 B2
6482593 Walt et al. Nov 2002 B2
6486287 McGall et al. Nov 2002 B2
6489160 Hashimoto Dec 2002 B2
6498010 Fitzgerald et al. Dec 2002 B1
6506895 Guire et al. Jan 2003 B2
6511849 Wang Jan 2003 B1
6514768 Guire et al. Feb 2003 B1
6548021 Church et al. Apr 2003 B1
6548257 Lockhart et al. Apr 2003 B2
6548263 Kapur et al. Apr 2003 B1
6548652 Lukhtanov et al. Apr 2003 B2
6551817 Besemer et al. Apr 2003 B2
6562136 Chappa et al. May 2003 B1
6569671 Okamoto et al. May 2003 B1
6579463 Winningham et al. Jun 2003 B1
6579719 Hutchens et al. Jun 2003 B1
6589778 Hawkins Jul 2003 B1
6605363 Ho et al. Aug 2003 B2
6617125 Adler, Jr. Sep 2003 B2
6621553 Baxter et al. Sep 2003 B2
6630308 Stryer et al. Oct 2003 B2
6630358 Wagner et al. Oct 2003 B1
6632605 Cronin et al. Oct 2003 B1
6646243 Pirrung et al. Nov 2003 B2
6660234 Stryer et al. Dec 2003 B2
6667394 Pease et al. Dec 2003 B2
6680178 Harris et al. Jan 2004 B2
6703498 Tchaga Mar 2004 B2
6706408 Jelle Mar 2004 B2
6709712 Chappa et al. Mar 2004 B2
6713262 Gellibolian et al. Mar 2004 B2
6733894 Ho et al. May 2004 B2
6733977 Besemer et al. May 2004 B2
6741344 Stern et al. May 2004 B1
6743630 Sato Jun 2004 B2
6743882 McGall et al. Jun 2004 B2
6747143 Stryer et al. Jun 2004 B2
6753145 Holcomb et al. Jun 2004 B2
6756232 Schermer et al. Jun 2004 B1
6762019 Swan et al. Jul 2004 B2
6773676 Schembri Aug 2004 B2
6773888 Li et al. Aug 2004 B2
6777239 Dower et al. Aug 2004 B2
6784982 Blumenfeld et al. Aug 2004 B1
6794197 Indermuhle et al. Sep 2004 B1
6797393 Qiao et al. Sep 2004 B2
6800849 Staats Oct 2004 B2
6806047 Goldberg et al. Oct 2004 B2
6806050 Zhou et al. Oct 2004 B2
6808908 Yao et al. Oct 2004 B2
6811969 Hutchens et al. Nov 2004 B1
6818394 O'Donnell-Maloney et al. Nov 2004 B1
6818411 Hutchens et al. Nov 2004 B2
6828104 Lipshutz et al. Dec 2004 B2
6828110 Lee et al. Dec 2004 B2
6844165 Hutchens et al. Jan 2005 B2
6849462 Winkler et al. Feb 2005 B1
6852393 Gandon Feb 2005 B2
6855490 Sompuram et al. Feb 2005 B2
6855501 Huang Feb 2005 B2
20010031468 Chenchick et al. Oct 2001 A1
20010031469 Volinia Oct 2001 A1
20010041249 Patron et al. Nov 2001 A1
20010053521 Kramer et al. Dec 2001 A1
20020001834 Keogh et al. Jan 2002 A1
20020019015 Lahiri et al. Feb 2002 A1
20020042048 Drmanac Apr 2002 A1
20020072127 Sofield et al. Jun 2002 A1
20020075490 Chappell Jun 2002 A1
20020076716 Sabanayagam et al. Jun 2002 A1
20020076727 Cardone et al. Jun 2002 A1
20020094544 Fang et al. Jul 2002 A1
20020106702 Wagner et al. Aug 2002 A1
20020137090 Pinkel et al. Sep 2002 A1
20020142351 Diamond Oct 2002 A1
20020155442 Mirkin et al. Oct 2002 A1
20020164656 Hoeffler et al. Nov 2002 A1
20030013130 Charych et al. Jan 2003 A1
20030027154 Narahara et al. Feb 2003 A1
20030027298 Bott et al. Feb 2003 A1
20030032035 Chatelain et al. Feb 2003 A1
20030036095 Tchaga Feb 2003 A1
20030040129 Shah Feb 2003 A1
20030044801 Harvey Mar 2003 A1
20030059094 Cattell et al. Mar 2003 A1
20030068621 Briggs Apr 2003 A1
20030099930 Graves et al. May 2003 A1
20030138853 Lahiri et al. Jul 2003 A1
20030143542 Qiao et al. Jul 2003 A1
20030143576 Chao et al. Jul 2003 A1
20030148360 Guire et al. Aug 2003 A1
20030166261 Sompuram et al. Sep 2003 A1
20030170914 Guire et al. Sep 2003 A1
20030180957 Koopmann et al. Sep 2003 A1
20030186252 Ilsley et al. Oct 2003 A1
20030186310 Kincaid et al. Oct 2003 A1
20030198967 Matson et al. Oct 2003 A1
20030215806 Lewis et al. Nov 2003 A1
20030215841 Lockhart et al. Nov 2003 A1
20030215856 Church et al. Nov 2003 A1
20030231987 Carmack et al. Dec 2003 A1
20040002078 Boutell et al. Jan 2004 A1
20040018523 Hawkins et al. Jan 2004 A1
20040029303 Hart et al. Feb 2004 A1
20040063220 Lebrun Apr 2004 A1
20040073017 Skrzypcznski et al. Apr 2004 A1
20040076961 Lewis et al. Apr 2004 A1
20040096856 Garimella et al. May 2004 A1
20040096914 Fang et al. May 2004 A1
20040101838 Thompson et al. May 2004 A1
20040106131 Roy et al. Jun 2004 A1
20040132080 Kawaguchi et al. Jul 2004 A1
20040137493 Goldberg et al. Jul 2004 A1
20040142095 Narahara et al. Jul 2004 A1
20040161748 He et al. Aug 2004 A1
20040175717 Van Zyle et al. Sep 2004 A1
20040185451 Leproust et al. Sep 2004 A1
20040185464 Kris et al. Sep 2004 A1
20040185473 Cuppoletti et al. Sep 2004 A1
20040191813 Bruhn et al. Sep 2004 A1
20040206902 Staats et al. Oct 2004 A1
20040209383 Yin et al. Oct 2004 A1
20040214019 McGall et al. Oct 2004 A1
20040215031 McGall et al. Oct 2004 A1
20040224326 Kim et al. Nov 2004 A1
20040229287 Sato et al. Nov 2004 A1
20040234788 Li et al. Nov 2004 A1
20040241663 Peck et al. Dec 2004 A1
20040241666 Amorese et al. Dec 2004 A1
20040241668 Amorese et al. Dec 2004 A1
20040241742 Peck et al. Dec 2004 A1
20040241880 Leproust et al. Dec 2004 A1
20040248162 Cuppoletti et al. Dec 2004 A1
20040248323 Zhou et al. Dec 2004 A1
20040253460 McGall et al. Dec 2004 A1
20040253640 Chen et al. Dec 2004 A1
20040265813 Takechi et al. Dec 2004 A1
20050003395 Gellibolian et al. Jan 2005 A1
20050008674 Wagner et al. Jan 2005 A1
20050014292 Wagner et al. Jan 2005 A1
20050032060 Shah et al. Feb 2005 A1
Foreign Referenced Citations (16)
Number Date Country
0 245 206 Nov 1987 EP
0 628 568 Jun 1994 EP
1 001 267 May 2000 EP
WO 9100288 Jan 1991 WO
WO 9804740 Feb 1998 WO
WO 9904896 Feb 1999 WO
WO 0100876 Jan 2001 WO
WO 0146213 Jun 2001 WO
WO 0146214 Jun 2001 WO
WO 0146464 Jun 2001 WO
WO 0151665 Jul 2001 WO
WO 0151689 Jul 2001 WO
WO 0198458 Dec 2001 WO
WO 0206384 Jan 2002 WO
WO 02096979 Dec 2002 WO
WO 03006676 Jan 2003 WO
Related Publications (1)
Number Date Country
20070292843 A1 Dec 2007 US
Provisional Applications (1)
Number Date Country
60383564 May 2002 US
Divisions (1)
Number Date Country
Parent 10447073 May 2003 US
Child 11656219 US