The present invention relates to the field of molecular biology and, more particularly, to a method for breaking a nucleic acid and adding an adaptor by means of a transposase, and a reagent.
Since the pyrophosphate sequencing method invented by Roche, which has opened up the next generation of sequencing, until now, the next generation of sequencing has undergone a period of rapid development. However, with the development of high-throughput sequencing, the sample preparation with high-throughput and low-cost has become a key consideration in the field of sequencing. Sample processing methods and automation devices of various principles have been developed, including: samples fragmentation, terminal treatment of nucleic acid molecules and adaptors ligation and the generation of final libraries.
The methods of samples fragmentation mainly include physical methods (such as ultrasound shear) and enzymatic methods (i.e., treatment of non-specific endonuclease). Wherein the physical methods are dominated by Covaris based on patented Adaptive Focused Acoustic (AFA) technology. Under an isothermal condition, the acoustic energy with a wavelength of 1 mm is focused on a sample by a spherical solid state ultrasonic sensor with >400 kHz, using geometric focusing acoustic energy. This method ensures the integrity of nucleic acid samples, and a high recovery rate can be achieved. Covaris's instruments include an economical M-series, a single-tube full-power S-series and higher-throughput E- and L-series. The randomization of fragments based on physical methods is good, but the physical methods depend on a large number of Covaris interrupters, and require subsequent separate terminal treatment, adaptor ligation and PCR, and various purification operations. Wherein the enzymatic methods include the NEB Next dsDNA Fragmentase from NEB company. The reagent first cleaves the double stranded DNA to produce a random cleavage site, and then clears the complementary DNA strand by identifying the cleavage site through another enzyme to achieve the purpose of interruption. This reagent can be used for genomic DNA, whole genome amplification products and PCR products, and randomness is also good, but some artificial short fragments insertion and deletion will be generated. And also inevitably need to carry out subsequent separate terminal treatment, adaptor ligation and PCR, and various purification operations. In addition, the transposase disrupting kit led by Nextera kit of Epicentra company (acquired by Illumina) has been used to complete the DNA fragmentation and the adaptors ligation simultaneously using the transposase, thereby reducing the time of sample processing.
From the simplicity of the various operations, the method of interruption by transposase is far superior to other methods in terms of flux and ease of operation, but this interruption has its own shortcomings: the transposase's founction is dependent on a specific 19 bp Me sequence. Thus, although the transposase can add different adaptor sequences at the 5′ and 3′ ends of the target sequence by embedding two completely different adaptor sequences, the adaptors need to contain a specific sequence of Me, resulting in a results that both ends of the interrupted fragment will symmetrically have a Me sequence, and due to the special effect of the transposase so that a 9 nt base missing gap will present between the target sequence (or the interrupted fragment) and the Me sequence. The identical Me sequences at both ends of the target sequence will have an impact on downstream technology applications, such as an impact on the second-generation sequencing technique based on the ligation method, where the Me sequences on both sides of the same chain are complementary sequences, thus internal annealing of the single-strand molecule will generate and harm the binding of anchoring primers.
There has been a related patent application (Application Publication No.: CN 102703426 A, filed on Oct. 3, 2012) to propose a technical solution, in which an endonuclease digestion is performed on the interrupted sequences to remove the 9nt sequence and the Me sequence. However, this method only uses the advantage of transposase interruption to randomize the nucleic acid sequences, but introduction of a shortcoming that a follow-up adaptor needed to be added separately, which is steps-cumbersome and not suitable for higher throughput applications.
So far, there has been no molecular biology experiment method be disclosed by any patents and other literatures to rapidly interrupt the target sequences by the use of transposase technology and to modify the interrupted sequence to two completely different sequences.
A method and a reagent for breaking a nucleic acid and adding an adaptor by means of a transposase are provided in the present invention, in which other sequences different from the transposase identification sequence are introduced into the nucleic acid product interrupted by the transposase, so as different adaptors are ligated to both ends of the interrupted nucleic acid, thus the application of the interrupted product is not limited by the presence of the transposase identification sequence at both ends.
According to a first aspect of the present invention, a method for breaking a nucleic acid and adding an adaptor by means of a transposase is provided, wherein the method comprises the following steps:
randomly interrupting a nucleic acid by using a transposase-embedded complex, wherein the transposase-embedded complex comprises a transposase and a first adaptor comprising a transposase identification sequence, and both ends of the interrupted nucleic acid are separately ligated to the first adaptor to form a gap at each end;
eliminating the influence of the transposase in the system on a follow-up reaction by means of purification or chemical reagent treatment;
ligating to a second adaptor at the gap by using a ligase, wherein the sequence of the second adaptor is different from that of the first adaptor; and
performing a PCR reaction by using primers targeted to the first adaptor and the second adaptor respectively, so as to obtain a product whose both ends are respectively ligated to different adaptor sequences.
As a preferred embodiment of the present invention, in order to prevent self-ligation or inter-ligation of the adaptors, the first adaptor having a modification to prevent self-ligation or a modification to ligate with the second adaptor.
As a preferred embodiment of the present invention, the modification on the first adaptor comprises any one of the following or combination thereof:
(a) the 3′ terminal base of the first adaptor dideoxy modification;
(b) introducing a dUTP into a chain of the first adaptor for subsequent enzymatic cleavage of excess adaptors;
(c) introducing a base pair at the outside of the transposase identification sequence of the first adaptor, wherein the 3′ terminal base dideoxy modification; and
(d) the first adaptor consisting of a complete sequence, internally complementary to form a 3′-5′ phosphodiester bond cross-linked double stranded sequence.
It is to be noted that any modification of (a) to (d) may be used alone or in combination of two or more modifications, and in particular, the modification (a) may be carried out in combination with modifications (b), (c) or (d) separately, in order to achieve a better effect of preventing self-ligation or inter-ligation of the adaptors.
As a preferred embodiment of the present invention, the modification on the first adaptor is the 3′ terminal base of the first adaptor dideoxy modification.
As a preferred embodiment of the present invention, in order to prevent the self-ligation of the adaptor, the second adaptor has a modification preventing self-ligation.
As a preferred embodiment of the present invention, the modification on the second adaptor is a 3′ terminal base dideoxy modification.
In the present invention, the term “ self-ligation ” refers to the ligation between different molecules of the same adaptor, such as the ligation between different molecules of the first adaptor or the ligation between the different molecules of the second adaptor; the term “ inter-ligation ” refers to the ligation between molecules of different kinds of adaptors, such as the ligation between the molecules of the first adaptor and the molecules of the second adaptor.
As a preferred embodiment of the present invention, in order to facilitate the acquisition of single-stranded molecules after PCR reactions for subsequent single-stranded molecular manipulation experiments, one of the primers used in the PCR reaction is a terminal biotin-labeled primer for obtaining single-stranded molecules by biotin-streptavidin affinity reaction. Specifically, after the PCR reaction, the single-stranded molecule with a biotin at the end is separated by binding to a streptavidin on the surface of the magnetic bead.
As a preferred embodiment of the present invention, the purification is purification by magnetic beads or a column. The purification by magnetic beads or a column can completely remove the transposase in the system. In one embodiment of the present invention, Ampure XP beads were used for magnetic beads purification, and a column purification was performed using a QIAGEN PCR purification column. There is no doubt that any similar products for magnetic beads purification or column purification can be used in the present invention.
As a preferred embodiment of the present invention, the chemical reagent treatment is a treatment to dissociate the transposase from a target sequence by degenerating or digesting the transposase. Since the transposase belongs to a protein in chemical form, it can be dissociated from the target sequence using a corresponding denaturation or digestion means, although the transposase after this treatment may still be present in the system but has lost its biological activity, thus the follow-up reactions will not be negatively impacted.
As a preferred embodiment of the present invention, the chemical reagent comprises a first reagent and a second reagent; wherein the first reagent comprises one or more members of the group consisting of a protease solution, a SDS solution and a NT buffer for breaking the adsorption effect of the transposase and the target sequence of the nucleic acid; the second reagent comprises a Triton-X100 solution for weakening the influence of the first reagent on the subsequent enzymatic reactions.
In general, the first reagent is first used for treatment followed by the second reagent. The first reagent is used to treat the reaction product of the nucleic acid after the interruption by the transposase so as to break the adsorption effect of the transposase and the target sequence of the nucleic acid, instead of the steps of magnetic beads purification or column purification which is traditional complex and costly. And then the second reagent is used for treatment to weaken the influence of the first reagent on the subsequent enzymatic reactions, ensuring that downstream PCR amplification proceeds smoothly.
It is to be noted that the first reagent may be one or more members of the above solutions, wherein more of the above solutions may be two or three above solutions, such as the protease solution and the SDS solution, the SDS solution and the NT buffer, the protease solution and the NT buffer, the protease solution, the SDS solution and the NT buffer, wherein the NT buffer can be the NT buffer in S5 series of Truprep kit.
As a preferred embodiment of the present invention, ethylenediaminetetraacetic acid (EDTA) is further added for treatment after the treatment with the first reagent, if the first reagent comprises a protease solution. EDTA inhibits protease activity and thus prevents proteases from degrading enzymes in subsequent PCR reactions.
As a preferred embodiment of the present invention, the second reagent comprises Triton-X100 solution. Triton-X100, whose chemical name octylphenyl polyoxyethylene ether, as a nonionic surfactant, in the role of the present invention is to weaken the influence of the first reagent on the subsequent enzymatic reactions.
As a preferred embodiment of the present invention, the second reagent further comprises a Tween-20 solution if the first reagent comprises an SDS solution. The addition of Tween-20 could further weaken the influence of SDS on the subsequent enzymatic reaction and enhance the PCR effect. It should be noted that Tween-20 may be used as a component of the second reagent in the form of a mixture with Triton-X100; it may also be provided separately in the form of separation from Triton-X100, in which case the second reagent refers to the Triton-X100 solution and the Tween-20 solution.
It is to be understood that the first reagent and the second reagent in the present invention are not intended to be limited to a single object or a combination of a plurality of objects. Also, in the present invention, concepts such as “first” and “second”, which are used in any case, should not be construed as having the meaning of order or technique, instead their role in the present invention is to distinguish themselves from other objects.
In the present invention, the working concentration of the first reagent and the second reagent can be determined empirically by those skilled in the art. In general, in the first reagent, the working concentration of the protease is preferably from 50 to 5000 mAU/mL, more preferably from 75 to 3750 mAU/mL, most preferably 1500 mAU/mL; the working concentration of EDTA is preferably from 1 to 50 mmol/L, more preferably 14 mmol/L; the working concentration of SDS is preferably from 0.01% to 1.5% (by volume), more preferably 1% (by volume); the final concentration of NT buffer can be used according to 1×. In the second reagent, the working concentration of Triton-X100 is preferably from 0.1% to 2% (by volume), more preferably 1% (by volume); the working concentration of Tween-20 is preferably from 0.1% to 2% (by volume), more preferably 0.5% (by volume).
In the present invention, the sequence of the second adaptor is not limited and may be any sequence as long as it is different from the sequence of the first adaptor.
As a preferred embodiment of the present invention, the reagent further comprises a second adaptor component for ligation into the gap formed by ligating the first adaptor to the interrupted nucleic acid at both ends.
According to a second aspect of the present invention, a reagent for breaking a nucleic acid and adding an adaptor by means of a transposase is provided, wherein the reagent comprises the following components:
a transposase and a first adaptor comprising a transposase identification sequence for forming a transposase-embedded complex to randomly interrupt a nucleic acid, so as both ends of the interrupted nucleic acid are separately ligated to the first adaptor to form a gap at each end;
a second adaptor and a ligase component for ligating the second adaptor at the gap; and
primers targeted to the first adaptor and the second adaptor respectively, so as to obtain a product whose both ends are respectively ligated to different adaptor sequences by performing a PCR reaction.
As a preferred embodiment of the present invention, the first adaptor has a modification to prevent self-ligation or a modification to ligate with the second adaptor.
As a preferred embodiment of the present invention, the modification on the first adaptor comprises any one of the following or combination thereof:
(a) the 3′ terminal base of the first adaptor dideoxy modification;
(b) introducing a dUTP into a chain of the first adaptor for subsequent enzymatic cleavage of excess adaptors;
(c) introducing a base pair at the outside of the transposase identification sequence of the first adaptor, wherein the 3′ terminal base dideoxy modification; and
(d) the first adaptor consisting of a complete sequence, internally complementary to form a 3′-5′ phosphodiester bond cross-linked double stranded sequence.
As a preferred embodiment of the present invention, the second adaptor has a modification preventing self-ligation; preferably, the modification on the second adaptor is a 3′ terminal base dideoxy modification.
As a preferred embodiment of the present invention, one of the primers used in the PCR reaction is a terminal biotin-labeled primer for obtaining single-stranded molecules by biotin-streptavidin affinity reaction.
The method of the present invention modifies the sequence by ligating a second adaptor on both sides of the product interrupted by a transposase to achieve a different specific sequence on both sides of the the final interrupted product or the PCR product, thus the application of the interrupted product is not limited by the presence of the transposase identification sequence (19 bp Me) at both ends, and the application is more flexibility, such as molecular cyclization, digestion or ligation.
The invention will now be described in further detail by way of specific examples. Unless otherwise specified, the techniques used in the examples below are conventional techniques known to those skilled in the art; the instruments and reagents used are accessable to those skilled in the art through public approaches such as commercial approaches and so on.
The terms used in the present invention are set forth as follows: the first adaptor is referred to as a No.1 adaptor in a specific embodiment; the second adaptor is referred to as a No. 2 adaptor or gap adaptor in a specific embodiment; the first reagent is referred to as a No. 1 reagent in a specific embodiment; and the second reagent is referred to as a No. 2 reagent in a specific embodiment.
Referring to
In the present invention, a transposase kit of domestic production (S50 series of Truprep kit of Nanjing Nuoweizan Ltd.) was used to carry out the following experiment. The kit containes two doses respectively for 5 ng genomic DNA and 50 ng genomic DNA.
A variety of adaptor sequences (the NO. 1 adaptor) for embedding was designed in the present invention, and a transposase and said adaptor sequences for embedding were used to prepare the transposase complex.
In this example, 5 ng or 50 ng of high quality genomic DNA was first interrupted by the embedded transposase complex; the free unembedded No. 1 adaptors were removed after purification by magnetic beads or column purification; then a No. 2 adaptor (a gap adaptor) was inventively ligated, and the free No. 2 adaptors were removed by purification, and thus a linear genome sequence with different adaptor sequences at both ends were constructed; a PCR amplification was performed by using PCR primers targeted respectively to the No. 1 adaptor and the No. 2 adaptor, enriching the PCR product with different adaptor sequences at both ends.
One application of the PCR product of this example is by labeling the PCR primers in a biotin-labeled manner, and a single-stranded molecule of a particular sequence is obtained, and a single-stranded cyclic molecule is prepared by a single-stranded cyclization or by a cyclization with a short nucleic acid sequence as a bridge-mediated sequence. The formed single-stranded cyclic molecule can be used for the preparation of solid dense DNA nanospheres.
Multiple pairs of primer sequences (Sequence A and sequence B) with a l9bp transposase identification sequence were designed and manufactured, for the preparation of a single-adaptor (the No. 1 adaptor) for embedding, and three different single-adaptors (i.e., single-adaptor 1 sequence, single-adaptor 2 sequence and single-adaptor sequence) and a standard double-adaptors sequence (Sequence A+sequence B; sequence A+sequence C) were tested in the present example.
Wherein a dUTP is introduced into a strand (strand A) of the single-adaptor 1 sequence for subsequent digest of excess adaptors; a base pair is introduced into the outside of the 19 bp transposase identification sequence of the single-adaptor 2 sequence, wherein the 3′ end base is a dideoxy-modified base; the whole double-stranded sequence of the single-adaptor 3 sequence consists of a complete sequence, which is internally complementary to form a double-stranded sequence crosslinked by a 3′-5′ phosphodiester bond. In addition, the modification modes of the above-mentioned three kinds of adaptors have at least one strand containing a 3′-end dideoxy modification, which helps to prevent the self-ligation of the No. 1 adaptor and inter-ligation with the No. 2 adaptor. Each of the first adaptors sequences is shown as follows:
G
CTGTCTCTTATACACATC ddT;
ACATC ddT
;
2. Each pair of single-adaptor sequence was diluted to 100 μM, fully mixed and centrifuged, annealing to form NO. 1 adaptor (stored at −20° C.) in a PCR instrument according to the following procedure (Table 1), for the preparation of embedded complex. The sequence A, B and C of double-adaptors were diluted to 100 μM, sequence A+sequence B combined, sequence A+sequence C combined, fully mixed and centrifuged, annealing to form NO. 1 adaptor (stored at −20° C.) in a PCR instrument according to the following procedure (Table 1), for the preparation of embedded complex.
3. The NO. 1 adaptor and the transposase were embedded into a transposase-embedded complex according to the following system (Table 2), after gently blowing 20 times and incubating 1 hour at 30° C., the complex embedding was completed. The complex was stored at −20° C.
4. 50 ng of high quality genome and transposase complex were mixed according to the following system (Table 3), after gently mixing 20 times and incubating for 10 minutes at 55° C., and then cooling to 4° C., genome interruption is completed.
5. Purification was carried out according to the following two methods. Method 1: A 1-fold volume of PBI (Qiagen PCR Purification Kit) was added and mixed evenly, and purified with 1.3-fold Ampure XP beads (automated operation); Method 2: Purification with QIAGEN PCR Column. After purification, the product was dissolved with pure water.
6. As for the single-adaptor 1, after the interruption, USER enzyme was added to digest, and then a purification was carried out similarly to the previous steps, and the reaction system as follows (Table 4):
7. The product after purification is submitted to the ligation of a gap adaptor (i.e., No. 2 adaptor) in accordance with the following system (Table 5), the ligation was completed after incubation for 60 minutes at 25° C.
8. As for the product after ligation, purification was carried out according to the following two methods. Method 1: A 1-fold volume of PBI (Qiagen PCR Purification Kit) was added and mixed evenly, and purified with 1.3-fold Ampure XP beads (automated operation); Method 2: Purification with QIAGEN PCR Column. After purification, the product was dissolved with pure water.
9. PCR amplification was carried out according to the following PCR reaction system (Table 6) and reaction conditions (Table 7).
10. The PCR product test results after ligation of gap adaptor (No. 2 adaptor) are shown in
PCR results show that the method of the present invention has successfully introduced the gap adaptor.
11. After single-stranded separation of the PCR product, the target band is submitted to single-stranded cyclization, according to the current common means of sequencing, resulting in single-stranded circular DNA molecules for preparation of DNA nanoball by rolling ring replication on a whole genome sequencing platform and for ligation sequencing. The single-stranded separation and cyclization operation is as follows:
(1) The PCR product was subjected to thermal denaturation at 95° C. and then immediately ice bath for 5 min;
(2) 3 pmol of single-stranded molecules of the PCR product that were denatured were subjected to single-stranded cyclization according to the following reaction system (Table 9);
(3) The single-strand without cyclization is digested, a reaction system is configured according to the following system (Table 10), after mixing and briefly centrifuging, 20 μL was added to the previous reaction system, incubating for 30 minutes at 37° C., followed by purification with 1.8-fold Ampure XP beads to prepare a single-stranded cyclic molecule for sequencing.
12. Sequencing can be carried out from the 5′ and 3′ ends, and the target fragment with different sequences at both ends has a 19 bp transposase identification sequence only at one end, thus avoiding the specific annealing of the 19 bp transposase identification sequence at both ends and competition with the sequencing adaptors, and thus greatly improve the quality of sequencing, the results shown in
In this example, 50 ng of high quality genomic DNA was first interrupted by an embedded transposase complex, followed by treating with protease, SDS, NT or a composition of protease and EDTA to remove the transposase protein bound to DNA; and then after the ligation of a gap adaptor, directly amplified using PCR primers, with a certain concentration of TritonX-100 is added into the PCR reaction system.
1. A pair of primer sequences with a 19 bp transposase identification sequence, sequence A and sequence B, were designed and prepared, for preparation of NO. 1 adaptor in the form of single-adaptor:
Sequence A of the NO. 1 adaptor in the form single-adaptor:
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG (SEQ ID NO: 17);
Sequence B of the NO. 1 adaptor in the form single-adaptor:
CTGTCTCTTATACACATC ddT (SEQ ID NO: 18, dd represents a dideoxy modification).
2. The sequence A and sequence B were diluted to 10004, fully mixed and centrifuged, annealing to form the No. 1 adaptor (stored at −20° C.) in a PCR instrument according to the following procedure (Table 11), for the preparation of embedded complex.
3. The NO. 1 adaptor and the transposase were embedded into a transposase-embedded complex according to the following system (Table 12), after gently blowing 20 times and incubating 1 hour at 30° C., the complex embedding was completed. The complex was stored at −20° C.
4. 50 ng of high quality genome and transposase complex were mixed according to the following system (Table 13), after gently mixing 20 times and incubating for 10 minutes at 55° C., and then cooling to 4° C., genome interruption is completed.
5. The sample processing methods after the interruption comprises the following options. Method 1: 0.1-5 μL of protease (750 mAU/mL) was added, in this example preferred 2 μL of protease, and at the same time 0.1 μL protease and 5 μL of protease was tested respectively. Method 2: adding the final concentration of commercial 1× NT buffer (a matching reagent in Truprep kit S5 series). Method 3: adding 0.01% to 1.5% (by volume) of SDS, preferably 1% (by volume) of SDS in this example, and 0.01% (by volume) and 1.5% (by volume) concentrations were tested separately. Method 4: 0.1-5 μL of protease (750 mAU/mL) was added and then added to a final concentration of 1-50 mM EDTA. This example preferred 2 μL of protease and final concentration of 14 mM EDTA, and at the same time 0.1 μL protease plus 1 mM EDTA and 5 μL of protease plus 50 mM EDTA was tested. Method 5: adding 1 times of the volume of PBI (a commercial reagent in Qiagen PCR purification kit), after mixing evenly, purifying with 1.3 times of Ampure XP beads, and dissolving with pure water.
6. In the product after the above treatment, 0.1%-2% (by volume) of Triton-X100 was added, preferably 1% (by volume) in this example, while 0.1% (by volume) and 2% (by volume) of Triton-X100 was used to test.
7. The product treated with the above Triton-X100 was ligated to a gap adaptor (the NO. 2 adaptor) according to the following system (Table 14) at 25° C. for 60 minutes, the adaptor ligation was completed.
Note: Sequence A of the NO. 2 adaptor: 5′-pAAGTCGGAGGCCAAGCGGTCGT ddC-3′ (SEQ ID NO: 9); Sequence B of the NO. 2 adaptor: 5′-TTGGCCTCCGACT ddT-3′ (SEQ ID NO: 10)(p represents phosphorylation modification , dd represents dideoxy modification).
8. PCR amplification was carried out according to the following PCR reaction system (Table 15) and reaction conditions (Table 16). For the experimental group with SDS added, a specific concentration of Tween-20 was added to the PCR system to partially increase the efficiency of the PCR. The working concentration of Tween-20 could be adjusted to different, such as 0.1% -2% (by volume), preferably 0.5% (by volume) in this example, while the working concentrations of 0.1% (by volume) and 2% (by volume) was tested.
9. PCR product detection result of after interruption by single-adaptor embedding complex and ligation of the gap adaptor is shown in
The foregoing is a further detailed description of the present invention in reference with the specific embodiments, thus it cannot be determined that the specific implementation of the invention is limited to these above illustrations. It will be apparent to one skilled in the art to which the invention pertains that several simple deductions or substitutions may be made without departing from the inventive concept.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/CN2014/088542 | 10/14/2014 | WO | 00 |