Method for cloning and producing Thermomicrobium roseum DNA polymerase I in E. coli

Abstract

The present invention relates to isolating DNA coding for DNA polymerase I from Thermomicrobium roseum, expressing the T. roseum DNA polymerase I gene in E. coli and purifying the recombinant T. roseum DNA polymerase I from E. coli cell extract.

Description

BACKGROUND OF THE INVENTION

DNA polymerases are a family of enzymes involved in DNA repair and replication. Extensive research has been conducted on the isolation of DNA polymerases from mesophilic microorganisms such as E. coli (Bessman, et al., J. Biol. Chem. 233:171-177 (1957); Buttin and Kornberg J. Biol. Chem. 241:5419-5427 (1966)).

Examples of DNA polymerases isolated from E. coli include E. coli DNA polymerase I and T4 DNA polymerase. These enzymes have a variety of uses in recombinant DNA technology including DNA labeling by nick translation, second-strand cDNA synthesis in cDNA cloning, and DNA sequencing (Maniatis et al., Molecular Cloning: A Laboratory Manual (1982).

U.S. Pat. Nos. 4,683,195, 4,683,202 and 4,800,159 disclosed the use of the above enzymes in a process for amplifying, detecting, and/or cloning nucleic acid sequences. This process, commonly referred to as polymerase chain reaction (PCR), involves the use of a polymerase, primers and nucleotide triphosphates in amplifying existing nucleic acid sequences.

Some of the DNA polymerases discussed above possess a 3'-5' exonuclease activity which provides a proofreading function that gives DNA replication much higher fidelity than it would have if synthesis were the result of only a one base-pairing selection step (Brutlag, D. and Kornberg, A., J. Biol Chem., 247:241-248 (1972)). DNA polymerases with 3'-5' proofreading exonuclease activity have a substantially lower base incorporation error rate when compared with a non-proofreading exonuclease-possessing polymerase (Chang, L. M. S., J. Biol. Chem. 252:1873-1880 (1977)).

Research has also been conducted on the isolation and purification of DNA polymerases from thermophiles, such as Thermus aquaticus. Chien, A. et al. J. Bacteriol. (1976) 127:1550-1557, discloses the isolation and purification of a DNA polymerase with a temperature optimum of 80.degree. C. from T. aquaticus YT1 strain. The Chien et al., purification procedure involves a four-step process. These steps involves preparation of crude extract, DEAE-Sephadex chromatography, phosphocellulose chromatography and chromatography on DNA cellulose.

US Pat. No. 4,889,818 discloses a purified thermostable DNA polymerase from T. aquaticus, Taq polymerase, having a molecular weight of about 86,000 to 90,000 daltons prepared by a process substantially identical to the process of Kaledin with the addition of the substitution of a phosphocellulose chromatography step in lieu of chromatography on single-strand DNA-cellulose. In addition, European Patent Application 0 258 017 disclose Taq polymerase as the preferred enzyme for use in the PCR process discussed above. Research has indicated that while Taq DNA polymerase has a 5'-3' polymerase-dependent exonuclease function, Taq DNA polymerase does not possess a 3'-5' proofreading exonuclease function (Lawyer, et al. J. Biol. Chem. 264:11, p. 6427-6437 (1989). Bernard, et al. Cell 59:219 (1989). As a result, Taq DNA polymerase is prone to base incorporation errors, making its use in certain applications undesirable. For example, attempting to clone an amplified gene is problematic since any one copy of the gene may contain an error due to a random misincorporation event. Depending on where in the replication cycle that error occurs (e.g., in an early replication cycle), the entire DNA amplified could contain the erroneously incorporated base, thus, giving rise to a mutated gene product.

Accordingly, there is a continuing need in the art to obtain and produce a purified, thermostable DNA polymerase with 3'-5' proofreading exonuclease activity that may be used to improve the DNA polymerase processes described above. One such enzyme (describe in more detail below), DNA polymerase I from Thermomicrobium roseum, a Gram negative, pleomorphic, and thermophilic bacterium, has been cloned and expressed in E. coli.

SUMMARY OF THE INVENTION

In accordance with the present invention, there is provided a novel as well as Pol I like DNA polymerase from T. roseum as well as the DNA sequence which encodes that polymerase. DNA polymerase has an apparent molecular weight of approximately 103,000 daltons and an half life of 15 minutes at 95.degree. C.

More specifically, in accordance with the present invention, it has been discovered that DNA coding for Pol I related DNA polymerases from Eubacteria species share conserved regions with substantial homology both at the DNA and amino acid level. Thus, in accordance with the present invention, degenerated primers can be synthesized from the conserved regions and used to amplify a DNA fragment coding for a portion of DNA polymerase I from T. roseum. The upstream and downstream DNA sequences coding for the DNA polymerase were obtained by direct sequencing of the inverse PCR products or by sequencing the cloned PCR product. Once the DNA coding for the entire DNA polymerase has been isolated, it can be used to construct expression clone in order to produce large amounts of the DNA polymerase. T. roseum DNA polymerase I possesses 3'-5' proofreading exonuclease activity. This is the first instance of a proofreading thermostable DNA polymerase I (Pol I like DNA polymerase) isolated from Eubacteria.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows the Nucleotide sequence and the predicted amino acid sequences (SEQ ID NO:1) of the T. roseum DNA polymerase I.

FIG. 2 illustrates the 3'-5' exonuclease activity assay for Vent.RTM., T. roseum and Taq DNA polymerases in percent of �.sup.3 H! released as the function of time.

FIG. 3 illustrates the thermostability of the recombinant T. roseum DNA polymerase I at 95.degree. C. The polymerase reaction assay was carried out at 70.degree. C. for 10 min after incubation of the DNA polymerase at 95.degree. C. for a various time.

FIG. 4 illustrates the SDS-PAGE gel showing the purification steps for recombinant T. roseum DNA polymerase. Lane 1 and 12, protein size marker; lane 2, cell extract of non-induced cells; lane 3, cell extract of non-induced cells after heat denaturation at 70.degree. C. for 30 min; lane 4, cell extract of IPTG-induced cells; lane 5, cell extract of IPTG-induced cells after heat denaturation at 70.degree. C. for 30 min. lanes 6 to 8, fractions from DEAE column; lanes 9-11, fractions from heparin Sepharose.RTM. column. The purified recombinant T. roseum DNA polymerase appears to have two different migration patterns on SDS-PAGE gel. One migrates at about 103,000 daltons, the other migrates at about 120,000 daltons.

DETAILED DESCRIPTION OF THE INVENTION

A recombinant Pol I like DNA polymerase is cloned from T. roseum, a thermophilic microorganism found in the hot spring in Yellowstone National Park, Wyo. USA. This strain is available from the American Type Culture Collection (ATCC No. 27502). The organism is a Gram.sup.- pleomorphic rod bacterium with a temperature growth optimum at about 70.degree. C.

The method described herein by which the T. roseum DNA polymerase I gene is cloned and expressed includes the following steps:

1. The genomic DNA is purified from T. roseum cells.

2. Conserved regions in Pol I DNA polymerase are found by nucleotide sequence comparison of Pol I type DNA polymerases from Eubacteria. Based on conserved sequences, one set of degenerate primers is designed and an initial PCR is carried out using the degenerate primers to amplify part of the T. roseum DNA polymerase I (670 bp).

3. Inverse PCR is used to amplify and sequence the upstream and downstream sequences. T. roseum genomic DNA is digested with restriction enzymes that will give rise to reasonable size template DNA for inverse PCR reaction. The digested DNA is self-ligated at a low DNA concentration (less than 2 microgram per ml). The ligated circular DNA is used as templates for inverse PCR reaction using a set of primers that annealed to the end of the initial fragment. The inverse PCR product is cloned in pUC19 and sequenced. Alternatively, the inverse PCR products are purified in low-melting agarose gel and sequenced directly using primers. The newly derived DNA sequences are compared with sequences in Genbank using Blast program. This step is repeated until the start codon was found upstream and stop codon was found downstream. The entire T. roseum DNA polymerase gene is amplified in PCR and re-sequenced with primers to ensure 100% accuracy of the sequence.

4. The T. roseum DNA polymerase I gene is amplified by PCR using Vent.RTM. DNA polymerase and then cloned into a pET21a vector. T. roseum DNA polymerase I production is induced by addition of IPTG in cell culture.

5. T. roseum DNA polymerase I is purified by heat-denaturation of E. coli proteins at 70.degree. C. for 30 min. The T. roseum DNA polymerase I is further purified by chromatography through DEAE and heparin Sepharose.RTM. columns.

6. The purified T. roseum DNA polymerase I is used in polymerization assay at 70.degree. C., in thermostability test at 95.degree. C., in exonuclease assay at 70.degree. C., and in PCR reactions at 60.degree. C. to 94.degree. C.

7. The purified T. roseum DNA polymerase I is subjected to N-terminal amino acid sequencing to confirm the correct start of translation in E. coli.

The following Examples are given to illustrate embodiments of the present invention as it is presently preferred to practice. It will be understood that these Examples are illustrative, and that the invention is not to be considered as restricted thereto as indicated in the appended claims.

All references cited above and below are herein incorporated by reference.

EXAMPLE I

1. Cloning of T. roseum DNA Polymerase I Gene

T. roseum DNA polymerase I gene was cloned by PCR and inverse PCR without library construction. Two conserved and closely spaced regions of Pol I polymerases were found and degenerate primers based on the conserved region were synthesized:

5' TCCGA(CT)CCCAACCT(GC)CAGAACATCCC 3' (138-151) (SEQ ID NO:2) 5' AGGA(GC)(GC)AGCTCGTCGTG(GC)ACCTG 3' (138-152) (SEQ ID NO:3).

PCR was performed using 50 ng of T. roseum genomic DNA, 0.5 mM of primers, 0.25 mM dNTP and 2 mM MgCl.sub.2 in 1.times.Taq buffer (10 mM Tris-HCl, pH 9, 50 mM KCl and 0.1% Triton.RTM. X-100). PCR conditions were 40 cycles at 95.degree. C. 1 min, 50.degree. C., 1 min, 72.degree. C., 1 min. The unique product of the predicted length of 650-700 bp was cloned and sequenced. This DNA sequence is 670 bp and shows 55.7% and 56% identity to E. coli and Taq DNA polymerase I genes, respectively. Two sets of inverse PCR primers were made based on the 670 bp sequence.

To amplify the downstream sequence, first round of inverse PCR primers used were:

5' CGAACGCGGCTTGCGCAGCCGCAT 3' (142-79) (SEQ ID NO:4) 5' TGGACAGCGATCATGGCCAACTTC 3' (142-80). (SEQ ID NO:5)

A second round of inverse PCR primers to amplify the downstream sequence were:

5' ATTGGGCTGACCTTGAGCCGG 3' (163-108) (SEQ ID NO:6) 5' CCCGCTTTGGCATCGACTTCG 3' (163-107) (SEQ ID NO:7)

To amplify the upstream sequence of the known 670 bp sequence, first round of inverse PCR primers used were:

5' GACTACTCGCAGATCGAGCTTCGC 3' (160-183) (SEQ ID NO:8) 5' GCGATTGCTAGCGATGAAGGCGCGG 3' (160-184). (SEQ ID NO:9)

Second round of inverse PCR primers were:

5' GACATGGAAAAGGCGGGATTCGCGATC 3' (161-132) (SEQ ID NO:10) 5' TCGATTTCGGTGAACAGCCGGA 3' (161-133).(SEQ ID NO:11)

Third round of inverse PCR primers were:

5' GATGCAAAGCTGTCGTCTCTACATC 3' (163-06) (SEQ ID NO:12) 5' TGTACCCCGACTTCGTGGGCATCG 3' (163-07).(SEQ ID NO:13)

Forth round of inverse PCR primers were:

5' TCCCGGGAATCGGCGAGAAGAC 3' (168-115) (SEQ ID NO:14) 5' CCAGGAATGTTGTCGGACGG 3' (168-114).(SEQ ID NO:15)

The genomic DNA used in inverse PCR was digested with the appropriate restriction enzyme and self-ligated. 2 .mu.g of genomic DNA was digested in a total volume of 200 .mu.l using 20 units of restriction enzymes. After phenol extraction and ethanol precipitation, the DNA was ligated overnight at 16.degree. C. in a total volume of 500 .mu.l to facilitate intramolecular ligation. Inverse PCR conditions were: 50 ng of circularized genomic DNA, 95.degree. C. 1 min, 55.degree. C. 1 min, 72.degree. C. 1 to 2 min, 0.5 mM of primers, 0.25 mM dNTP and 2 mM MgCl.sub.2, 5 units of Taq DNA polymerase in 1.times.Taq Buffer.

Amplified products were found in HaeII, AvaI, BsaHI and EcoO109I digested and self-ligated DNA for the first inverse PCR amplification of the upstream of the initial 670 bp fragment. In second round of inverse PCR, amplified product was found in PvuII digested and ligated DNA. In third round of inverse PCR, inverse PCR products were found in the AvaI and HaeII digested and ligated DNA. In the fourth round of inverse PCR, inverse PCR products were found in the RsaI and NlaIII digested and self-ligated genomic DNA.

In the first round of inverse PCR to amplify the downstream sequence, inverse PCR products were found in PvuI, SphI, SacI and SacII digested and self-ligated DNA.

Inverse PCR products were cloned in pUC19 and the insert was sequenced. Alternatively, the inverse PCR products were gel-purified in low-melting agarose gel and sequenced directly without the cloning step. The newly-derived sequence was analyzed by Blast and FASTA program to confirm that they are homologous to known Pol I polymerase genes. The entire T. roseum polymerase gene was found to be 2754 bp, encoding a protein of 917 amino acid residues with a predicted molecular weight of 103.6 kDa.

2. Expression of T. roseum DNA Polymerase I in E. coli

The entire polymerase gene was amplified by PCR using two primers. The forward primer contains an NdeI site and the reverse primer contains an EcoRI site after the stop codon.

5' GGGGAATTCCATATGCCGGAGCGCTCACGTCGACCACG 3' (175-49) (SEQ ID NO:16) 5' GCCGGAATTCCTAGTGGGAGAGATTTCACTCGAACCG G 3' (175-55) (SEQ ID NO:17).

PCR conditions were 95.degree. C. 1 min, 55.degree. C. 1 min, 72.degree. C. 2 min, for 20 cycles. T. roseum polymerase gene was digested with NdeI and EcoRI and cloned into T7 expression vector pET21a (Novagen). The ligated DNA was used to transform E. coli cells ER2566 and transformants were plated on Amp plates. In plasmid mini-prep screening, one out of four was found to contain the correct size insert. E. coli cells carrying the insert plasmid were induced by addition of IPTG for 3 h at 37.degree. C. Cell lysates were prepared as follows.

Cells were lysed by sonication. The clarified lysate was then treated at 70.degree. C. for 10-30 min to inactivate the endogenous polymerases. 20 .mu.g of DNaseI treated calf thymus DNA was mix with 25 mM of each dNTP, 1 mM MgCl.sub.2, �H.sup.3 ! dTTP (1 .mu.Ci) together with a fraction of the crude extract in a total volume of 50 .mu.l. After 15 min at 70.degree. C., the reaction was stopped by addition of SDS (1%) and EDTA (50 mM) and total mixture was spotted onto a disc. The disc was washed twice in a 10% TCA solution and then washed in isopropanol. The disc was then dried and counted in a scintillation counting machine.

3. Purification of the Recombinant T. roseum DNA Polymerase

Five ml of an overnight culture was inoculated into 1 liter of LB+Amp (100 .mu.g/ml). After incubation at 37.degree. C. until OD.sub.600 =0.5, IPTG was added to 2 mM final concentration to induce the T. roseum DNA polymerase I production. After IPTG induction for 3 hours at 37.degree. C., cells were harvested by centrifugation at 4000 rpm for 30 min. Cell pellets were resuspended in 24 ml lysis buffer (20 mM Tris-HCl, pH 8, 500 mM NaCl, 0.1 mM EDTA, 0.1% Triton X-100). Cells were lysed by sonication. Cell debris were removed by centrifugation at 10,000 rpm for 30 min. The clarified lysate was treated at 70.degree. C. for 30 min. Heat denatured proteins were removed by centrifugation at 10,000 rpm for 30 minutes. The solution was then dialyzed against 20 mM Bistris pH 6 and 75 mM NaCl. The proteins were loaded onto a DEAE column equilibrated with 20 mM Bistris pH 6, 75 mM NaCl. T. roseum polymerase I was eluted at the NaCl concentration of 200 mM (in 20 mM Bistris). Fractions containing the polymerase activity were dialyzed against 0.1 M Tris-HCl, pH 8 and loaded onto a heparin Sepharose.RTM. column equilibrated with 0.1 M Tris-HCl, pH 8. Elution of T. roseum polymerase I occurred at approximately 0.4 M NaCl, o.1 M Tris-HCl.

The purified T. roseum DNA polymerase I was subjected to electrophoresis in 4%-20% SDS-PAGE gradient gel. Two protein bands were detected. The major protein band corresponds to the predicted molecular mass of the T. roseum polymerase I at about 103 kDa. N-terminal amino acid sequence analysis of the 103 kDa protein confirmed that it is the T. roseum polymerase I protein.

4. 3'-5' Exonuclease Activity Assay

The predicted amino acid sequence of T. roseum polymerase I contains all the conserved amino acid residues in the 3'-5' exonuclease domain (exol, II and III). Table I shows the conserved amino acids of T. roseum polymerase I and the E. coli DNA polymerase I in the 3'-5' exonuclease domain. A 3'-5' exonuclease activity assay was performed using the purified T. roseum polymerase I. T. roseum DNA polymerase or polymerases with a well characterized exonuclease functions (Vent.RTM. DNA polymerase) were incubated with 1 .mu.g of EcoRI digested and �.sup.3 H!-thymidine labeled double-stranded DNA (0.8.times.10.sup.5 CPM/.mu.g) in Vent.RTM. polymerase buffer. After incubation period of 20 minutes, the exonuclease digested DNA was assayed by measuring the acid-soluble �.sup.3 H! label (shown in FIG. 2).

TABLE 1______________________________________Conserved amino acid residues in 3'-5' exonuclease domain in E. coliand Tro polymerase I Exo I Exo II Exo III______________________________________E. coli Pol I D.sub.355 TE.sub.357 NLKY.sub.423 D.sub.424 Y.sub.497 AAED.sub.501Tro Pol I D.sub.333 VE.sub.335 HGKY.sub.399 D.sub.400 Y.sub.471 ACAD.sub.475______________________________________

5. Thermostability of T. roseum Polymerase I

The thermostability of the recombinant T. roseum DNA polymerase was determined by the following method. Purified T. roseum DNA polymerase was preincubated at 95.degree. C. in a buffer containing 0.1 M Tris-HCl, 0.2 M NaCl in 50% glycerol. At time 0.5; 2.5; 5; 10; 20; 40, and 120 min, tubes containing the enzymes were removed from 95.degree. C. and polymerase activity was measured by determining incorporation of deoxynucleotide �.sup.3 H! TTP into DNA. The half-life of T. roseum polymerase I at 95.degree. C. was about 15 minutes (shown in FIG. 3).

EXAMPLE 2

1. Purification of the Native DNA Polymerase I from T. roseum

T. roseum cells were cultured in ATCC medium 655 for 48 hours at 70.degree. C. A total of about 10 grams of cells were resuspended in a sonication buffer (50 mM Tris-HCl, pH 8, 10 mM .beta.-mercaptoethanol). Cells were lysed by sonication for a total of 10 min at 4.degree. C. Cell debris was removed by centrifugation. Cleared cell lysate was transferred to a new tube and protease inhibitor cocktail tablets were added to prevent protease cleavage of DNA polymerase I. The cell extract was loaded onto a 40 ml DEAE-Sepharose.RTM. column. Proteins were eluted with 50 mM Tris-HCl, 2 mM .beta.-mercaptoethanol, 10% glycerol, NaCl gradient of 0-0.3 M. Two ml fractions were collected and each fraction was assayed for DNA polymerase activity. The polymerase activity assay consisted of 20 .mu.g of activated calf-thymus DNA, 33 .mu.M dNTP, 50 mM Tris-HCl, 1 .mu.Ci �.sup.3 H!TTP, 2 mM MgCl.sub.2, 10 .mu.l of each protein fraction in a total volume of 100 .mu.l. The assayed was carried out at 70.degree. C. for 15 min. Fractions 47 to 63 contain thermostable DNA polymerase activity and these fractions were pooled and dialyzed in a buffer containing 50 mM Tris-HCl, 2 mM .beta.-mercaptoethanol, 10% glycerol at 4.degree. C.

The dialyzed proteins were loaded onto a 40 ml heparin-Sepharose.RTM. column. The column was washed with 50 ml of 50 mM Tris-HCl, 2 mM .beta.-mercaptoethanol, 10% glycerol. Proteins were eluted with 100 ml of 0-0.5M NaCl gradient in 50 mM Tris-HCl, 2 mM .beta.-mercaptoethanol, 10% glycerol. Two ml fractions were collected and each fraction was assayed for DNA polymerase I activity. It was found that fractions 52-58 contain DNA polymerase activity. The total yield was about 1400 units of DNA polymerase. The purified DNA polymerase was dialyzed in 2 liters of 50 mM Tris-HCl, 2 mM .beta.-mercaptoethanol, 10% glycerol overnight at 4.degree. C.

2. Thermostability of T. roseum DNA Polymerase I

The purified T. roseum DNA polymerase I was incubated at 75.degree. C., 80.degree. C., 85.degree. C. for 30 min and then assayed for DNA polymerase activity. It was found that T. roseum DNA polymerase I is stable at 70.degree. C. to 85.degree. C. and it displayed 70 to 100% activity at this temperature range.

3. The use of T. roseum DNA Polymerase I in PCR

The purified T. roseum DNA polymerase I was used in PCR reaction to amplify the BsoBI restriction endonuclease gene from Bacillus stearothermophilus genomic DNA. The two PCR primer sequence are:

5' AAGCTTGCATGCGGAGGTTTAATAATGAACACTCAAAAACCTTT TGAA 3' (136-164) (SEQ ID NO:18) 5' CTAGGATCCTTATATATTAATTATCCATCTACAAAGAGA 3' (136-165) (SEQ ID NO:19)

PCR conditions were 95.degree. C. 30 sec, 55.degree. C. 1 min, 72.degree. C. 1 min for 20 cycles. A 972 bp DNA fragment was clearly detected after PCR amplification from the genomic DNA. It was concluded that T. roseum DNA polymerase I is relatively thermostable and can be used in PCR reaction.

__________________________________________________________________________# SEQUENCE LISTING- (1) GENERAL INFORMATION:- (iii) NUMBER OF SEQUENCES: 19- (2) INFORMATION FOR SEQ ID NO:1:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 2754 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: Genomic DNA- (ix) FEATURE: (A) NAME/KEY: Coding Se - #quence (B) LOCATION: 1...2751 (D) OTHER INFORMATION:- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:- ATG CCG GAG CGC TCA CGT CGA CCA CGC CTG GT - #A CTC GTT GAT GGA CAT 48Met Pro Glu Arg Ser Arg Arg Pro Arg Leu Va - #l Leu Val Asp Gly His# 15- GGG CTC GCC TAT CGC GCG TAT CAC GCG TTG CC - #C CCG ACT CTC GCG ACC 96Gly Leu Ala Tyr Arg Ala Tyr His Ala Leu Pr - #o Pro Thr Leu Ala Thr# 30- AGT GCC GGC GAA CCG ACA CAT GTG GTG TTC GG - #A TTC GCC AGC ATG TTA 144Ser Ala Gly Glu Pro Thr His Val Val Phe Gl - #y Phe Ala Ser Met Leu# 45- TTG GAA GTG CTG AAC GAT TTC GAA CCC GAT TA - #C GTC ATC GTC TGT TTC 192Leu Glu Val Leu Asn Asp Phe Glu Pro Asp Ty - #r Val Ile Val Cys Phe# 60- GAT ACG GGA CGG AGC TTT CGA CAA CAA CTC TA - #C GAG GAA TAC AAG GCT 240Asp Thr Gly Arg Ser Phe Arg Gln Gln Leu Ty - #r Glu Glu Tyr Lys Ala#80- CAC CGC CCT GAA ACA CCG GAT GAC CTC AAG CA - #C CAG CTC GAG CGA ATC 288His Arg Pro Glu Thr Pro Asp Asp Leu Lys Hi - #s Gln Leu Glu Arg Ile# 95- CGC CAA CTA CTC GAT GCG TTG GGA ATC CCG AT - #C GTC ACG CGC GAG GGC 336Arg Gln Leu Leu Asp Ala Leu Gly Ile Pro Il - #e Val Thr Arg Glu Gly# 110- TAC GAA GCT GAT GAC CTC ATC GGG ACA CTC GC - #T GCT CGC GCC ACT GCC 384Tyr Glu Ala Asp Asp Leu Ile Gly Thr Leu Al - #a Ala Arg Ala Thr Ala# 125- AAC GGG CTC GAA GTT CTG ATC GTC ACC GGC GA - #T ACC GAT TTG CTC CAG 432Asn Gly Leu Glu Val Leu Ile Val Thr Gly As - #p Thr Asp Leu Leu Gln# 140- CTC GTC GAT GAA GAT GTC CGT GTC ATC CTT CC - #C GGT CGC CAA CGC TTC 480Leu Val Asp Glu Asp Val Arg Val Ile Leu Pr - #o Gly Arg Gln Arg Phe145 1 - #50 1 - #55 1 -#60- GGC GAT TAC CGT GTT TAT GAC CGT CAA GCA GT - #C ATC GAG CGG TAC GGC 528Gly Asp Tyr Arg Val Tyr Asp Arg Gln Ala Va - #l Ile Glu Arg Tyr Gly# 175- TTT CCA CCG GAA CGG TTG CCC GGA ATA CAA GG - #C ATG GTC GGT GAT CCG 576Phe Pro Pro Glu Arg Leu Pro Gly Ile Gln Gl - #y Met Val Gly Asp Pro# 190- TCC GAC AAC ATT CCT GGA GTC CCG GGA ATC GG - #C GAG AAG ACA GCG ACA 624Ser Asp Asn Ile Pro Gly Val Pro Gly Ile Gl - #y Glu Lys Thr Ala Thr# 205- CGA CTC ATC CAG CGA TTC TCT TCC CTC GAG GA - #G ATG CTC GAC CGC ATC 672Arg Leu Ile Gln Arg Phe Ser Ser Leu Glu Gl - #u Met Leu Asp Arg Ile# 220- GAC GAA GTC GAA CCG CCG CGA CTG CGC GAG GC - #G CTT CGG GCG GCC CGC 720Asp Glu Val Glu Pro Pro Arg Leu Arg Glu Al - #a Leu Arg Ala Ala Arg225 2 - #30 2 - #35 2 -#40- GAA ACC GTT CTC GCA AGT CGC CGC CTC GCC AC - #C ATC GTT CGC GAT GCA 768Glu Thr Val Leu Ala Ser Arg Arg Leu Ala Th - #r Ile Val Arg Asp Ala# 255- GAC ATC ACC CTC GAC CTC GAA CAG GCT CGC TT - #C GGC GAT TTC GAC CGG 816Asp Ile Thr Leu Asp Leu Glu Gln Ala Arg Ph - #e Gly Asp Phe Asp Arg# 270- GAA CGG GTC CTC CAG CTG TTT CGC GAA CTC GA - #G TTC CGC AGC CTG GTT 864Glu Arg Val Leu Gln Leu Phe Arg Glu Leu Gl - #u Phe Arg Ser Leu Val# 285- CCT CGA CTT CCG CAA CCG CGC CAG CCG GTG CG - #G AAG ACG GCG GCA CCA 912Pro Arg Leu Pro Gln Pro Arg Gln Pro Val Ar - #g Lys Thr Ala Ala Pro# 300- GCG AGT CAG CGA CGC GCC GTC CTG ACC GAT GC - #C GAT TTG AGC GAC CTT 960Ala Ser Gln Arg Arg Ala Val Leu Thr Asp Al - #a Asp Leu Ser Asp Leu305 3 - #10 3 - #15 3 -#20- GTC CGG GAT TTG GAA ACC TGT CAG GCC TTT GC - #G CTC GAT GTA GAG ACG1008Val Arg Asp Leu Glu Thr Cys Gln Ala Phe Al - #a Leu Asp Val Glu Thr# 335- ACA GCT TTG CAT CCC ATG TAC GCC GAC TTC GT - #G GGC ATC GCG TTG GCG1056Thr Ala Leu His Pro Met Tyr Ala Asp Phe Va - #l Gly Ile Ala Leu Ala# 350- ACA GCT CCC GAC CGG AGT TAT TAC GTG CCG CT - #C GGA CAC ACG ACG GGT1104Thr Ala Pro Asp Arg Ser Tyr Tyr Val Pro Le - #u Gly His Thr Thr Gly# 365- GAT ACC CAA TTC GAT ATC GAA CAG GTG TTG CA - #A CGA CTG GCG CCC TTC1152Asp Thr Gln Phe Asp Ile Glu Gln Val Leu Gl - #n Arg Leu Ala Pro Phe# 380- CTG CGC CAT CCA GAG AAG CAA CGT TAT GCG CA - #C CAC GGC AAA TAC GAT1200Leu Arg His Pro Glu Lys Gln Arg Tyr Ala Hi - #s His Gly Lys Tyr Asp385 3 - #90 3 - #95 4 -#00- GCC CTG GTC TTG GAA CGT GCC GGT TTT CCC CG - #A CCA CAC ATC GAC TTC1248Ala Leu Val Leu Glu Arg Ala Gly Phe Pro Ar - #g Pro His Ile Asp Phe# 415- GAT ACG ATG ATC GCC GCC TAC CTA CTG GGC GA - #A AAT GCT GTC GGC CTC1296Asp Thr Met Ile Ala Ala Tyr Leu Leu Gly Gl - #u Asn Ala Val Gly Leu# 430- AAA GAA TTG GCA TTC ACG AAG CTC GGG TGG GA - #G ATG GAG GAA ATC ACC1344Lys Glu Leu Ala Phe Thr Lys Leu Gly Trp Gl - #u Met Glu Glu Ile Thr# 445- GAG CTA ATT GGA CGG GGC AAG AAG CAA CTC AC - #G ATG GAT CGC GCC GAG1392Glu Leu Ile Gly Arg Gly Lys Lys Gln Leu Th - #r Met Asp Arg Ala Glu# 460- ATC GCA CGG GTC ACG CAA TAC GCC TGT GCC GA - #C GTC GAG GCG ACA TAC1440Ile Ala Arg Val Thr Gln Tyr Ala Cys Ala As - #p Val Glu Ala Thr Tyr465 4 - #70 4 - #75 4 -#80- CGG TTA GTC GAG GTA CTT CGT CCA CAA TTC GA - #A GCC CAC AAT CAA CTC1488Arg Leu Val Glu Val Leu Arg Pro Gln Phe Gl - #u Ala His Asn Gln Leu# 495- CGG CTG TTC ACC GAA ATC GAA CTT CTT TTC AT - #C GAT GTA CTG ATC GAC1536Arg Leu Phe Thr Glu Ile Glu Leu Leu Phe Il - #e Asp Val Leu Ile Asp# 510- ATG GAA AAG GCG GGA TTC GCG ATC GAT GTG CC - #G TAC CTC GAA CAG CTC1584Met Glu Lys Ala Gly Phe Ala Ile Asp Val Pr - #o Tyr Leu Glu Gln Leu# 525- TCC ATC ATG CTG GAC GGT CAG CTG CAT GCG CT - #C GAG CGA CGC ATC TAC1632Ser Ile Met Leu Asp Gly Gln Leu His Ala Le - #u Glu Arg Arg Ile Tyr# 540- GAA CTG GCT GGG CAT CCC TTC AAC ATC ACT TC - #G CCA CAA CAG TTG AGC1680Glu Leu Ala Gly His Pro Phe Asn Ile Thr Se - #r Pro Gln Gln Leu Ser545 5 - #50 5 - #55 5 -#60- ACC CTG CTT TTC GAC GAA CTC GGC CTG CCT CG - #C GGC AAA CGA ACC AAG1728Thr Leu Leu Phe Asp Glu Leu Gly Leu Pro Ar - #g Gly Lys Arg Thr Lys# 575- ACT GGG TAT TCA GTT TCT CAA GAA GTG CTC GA - #G AAT CTC CGC GAT ACC1776Thr Gly Tyr Ser Val Ser Gln Glu Val Leu Gl - #u Asn Leu Arg Asp Thr# 590- CAC CCC ATC GTC GAG GCG ATT TTG GAA TAC CG - #G CAA CTC CTC AAA TTG1824His Pro Ile Val Glu Ala Ile Leu Glu Tyr Ar - #g Gln Leu Leu Lys Leu# 605- AAG TCG ACG TAC GTC GAT GCC TTA CCG CGG CA - #A GTC CAT CCC CAA ACC1872Lys Ser Thr Tyr Val Asp Ala Leu Pro Arg Gl - #n Val His Pro Gln Thr# 620- GGA CGC GTC CAC ACG ATT TTC CAT CAA ACT GT - #C GCG GCC ACC GGC CGC1920Gly Arg Val His Thr Ile Phe His Gln Thr Va - #l Ala Ala Thr Gly Arg625 6 - #30 6 - #35 6 -#40- TTG AGT TCC TCC GAC CCG AAC CTT CAG AAC AT - #T CCT GCT CGC GGC GAG1968Leu Ser Ser Ser Asp Pro Asn Leu Gln Asn Il - #e Pro Ala Arg Gly Glu# 655- CTG GGA CTC GCC GTT CGC CGC GCC TTC ATC GC - #T GAC AAT CGC CCA GGT2016Leu Gly Leu Ala Val Arg Arg Ala Phe Ile Al - #a Asp Asn Arg Pro Gly# 670- TAT CGA ATC GCC GAT GAA CCG ATC CTG CTT CT - #T TCA GCT GAC TAC TCG2064Tyr Arg Ile Ala Asp Glu Pro Ile Leu Leu Le - #u Ser Ala Asp Tyr Ser# 685- CAG ATC GAG CTT CGC CTG ATG GCT CAC TTC AG - #T CAG GAT CCC GCA CTC2112Gln Ile Glu Leu Arg Leu Met Ala His Phe Se - #r Gln Asp Pro Ala Leu# 700- CTG CGT GCC TTC GCT GAA GGC AAG GAC ATT CA - #C GCG GCT ACC GCG TCT2160Leu Arg Ala Phe Ala Glu Gly Lys Asp Ile Hi - #s Ala Ala Thr Ala Ser705 7 - #10 7 - #15 7 -#20- GAA GTG TTC GGG GTC CCA CTC GAC GCG GTC AC - #G CCA GAG ATG CGT CGC2208Glu Val Phe Gly Val Pro Leu Asp Ala Val Th - #r Pro Glu Met Arg Arg# 735- ATC GCG AAA GTC GTC AAT TTC GGC ATC ATG TA - #T GGG ATG CAA GCG TAC2256Ile Ala Lys Val Val Asn Phe Gly Ile Met Ty - #r Gly Met Gln Ala Tyr# 750- GGC CTC GCT CGC GAC ACC GGT ATG AGC CGT CA - #A GAC GCA CAG CGC TTC2304Gly Leu Ala Arg Asp Thr Gly Met Ser Arg Gl - #n Asp Ala Gln Arg Phe# 765- ATC GAA GCG TAT TTT CAG CGC TTC CCC GGC GT - #C GCC CGT TAT CTC GAA2352Ile Glu Ala Tyr Phe Gln Arg Phe Pro Gly Va - #l Ala Arg Tyr Leu Glu# 780- GAA ACG AGA CGC CGT GCG GCC GAA CTC GGT TA - #C GTC GAA ACG CTC TTC2400Glu Thr Arg Arg Arg Ala Ala Glu Leu Gly Ty - #r Val Glu Thr Leu Phe785 7 - #90 7 - #95 8 -#00- GGC CGG CGG CGA TAC TTG CCC GAA ATC ACC TC - #C TCC AAC CCG GCA CGA2448Gly Arg Arg Arg Tyr Leu Pro Glu Ile Thr Se - #r Ser Asn Pro Ala Arg# 815- CGG CAG GCG GCC GAA CGG ATG GCG GTC AAT AT - #G CCG CTG CAA GGC ACC2496Arg Gln Ala Ala Glu Arg Met Ala Val Asn Me - #t Pro Leu Gln Gly Thr# 830- GCA GCC GAT ATT ATG AAG TTG GTC ATG ATC GC - #T GTC CAC CGA CCG CTG2544Ala Ala Asp Ile Met Lys Leu Val Met Ile Al - #a Val His Arg Pro Leu# 845- GGC GAA CGC GGC TTG CGC AGC CGC ATG CTG CT - #C CAG GTT CAT GAC GAA2592Gly Glu Arg Gly Leu Arg Ser Arg Met Leu Le - #u Gln Val His Asp Glu# 860- CTC GTC TTG GAG GTA CCG GAG TCG GAA CTT GC - #G ACG ACA ACG GAA CTC2640Leu Val Leu Glu Val Pro Glu Ser Glu Leu Al - #a Thr Thr Thr Glu Leu865 8 - #70 8 - #75 8 -#80- GTC ACG ACA CGC ATG AGT CGC GTC GTC GAA CC - #C AGC GTG CCA CTC GAA2688Val Thr Thr Arg Met Ser Arg Val Val Glu Pr - #o Ser Val Pro Leu Glu# 895- GTC GAT GCC AAA GCG GGG CCC AAT TGG GCT GA - #C CTT GAG CCG GTT CGA2736Val Asp Ala Lys Ala Gly Pro Asn Trp Ala As - #p Leu Glu Pro Val Arg# 910#2754 AC TAGVal Lys Leu Ser His 915- (2) INFORMATION FOR SEQ ID NO:2:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 26 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: Synthetic DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:# 26 AGAA CATCCC- (2) INFORMATION FOR SEQ ID NO:3:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 23 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: Synthetic DNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:# 23GSAC CTG- (2) INFORMATION FOR SEQ ID NO:4:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 24 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:# 24AGCC GCAT- (2) INFORMATION FOR SEQ ID NO:5:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 24 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:# 24CCAA CTTC- (2) INFORMATION FOR SEQ ID NO:6:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 21 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:#21 GCCG G- (2) INFORMATION FOR SEQ ID NO:7:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 21 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:#21 CTTC G- (2) INFORMATION FOR SEQ ID NO:8:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 24 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:# 24AGCT TCGC- (2) INFORMATION FOR SEQ ID NO:9:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 25 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:# 25 AAGG CGCGG- (2) INFORMATION FOR SEQ ID NO:10:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 27 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:# 27 GATT CGCGATC- (2) INFORMATION FOR SEQ ID NO:11:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 22 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:# 22CCG GA- (2) INFORMATION FOR SEQ ID NO:12:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 25 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:# 25 CTCT ACATC- (2) INFORMATION FOR SEQ ID NO:13:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 24 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:# 24GGGC ATCG- (2) INFORMATION FOR SEQ ID NO:14:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 22 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:# 22AAG AC- (2) INFORMATION FOR SEQ ID NO:15:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:# 20 ACGG- (2) INFORMATION FOR SEQ ID NO:16:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 38 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:# 38 CGGA GCGCTCACGT CGACCACG- (2) INFORMATION FOR SEQ ID NO:17:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 37 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:# 37 GGAG AGTTTCACTC GAACCGG- (2) INFORMATION FOR SEQ ID NO:18:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 48 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:# 48GTTT AATAATGAAC ACTCAAAAAC CTTTTGAA- (2) INFORMATION FOR SEQ ID NO:19:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 39 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:# 39 TTAA TTATCCATCT ACAAAGAGA__________________________________________________________________________

Claims

1. A substantially pure thermostable DNA polymerase endogenous to Thermomicrobium roseum, ATCC No. 27502, wherein said polymerase has a molecular weight of about 103,000 daltons.

2. An isolated DNA which encodes a thermostable DNA polymerase with 3'-5' exonuclease activity from Thermomicrobium roseum ATCC No. 27502.

3. A cloning vector comprising the isolated DNA of claim 2.

4. A host cell transformed with the cloning vector of claim 3.

5. The polymerase of claim 2, wherein said polymerase is isolated from a recombinant organism transformed with the vector of claim 3.

6. A method of producing a Thermomicrobium roseum comprising culturing a host cell transformed with the vector of claim 3 under conditions suitable for expression of said endonuclease.