METHOD FOR CULTURING CORD BLOOD-DERIVED NATURAL KILLER CELLS USING TRANSFORMED T-CELLS

Information

  • Patent Application
  • 20240084256
  • Publication Number
    20240084256
  • Date Filed
    November 13, 2019
    5 years ago
  • Date Published
    March 14, 2024
    11 months ago
Abstract
The present invention pertains to a method for culturing cord blood-derived natural killer cells using transformed T-cells. The method for culturing natural killer cells using transformed T-cells according to the present invention can effectively propagate and produce natural killer cells from a small amount of raw cells. In addition, the method can also improve the cell-killing ability of natural killer cells. Thus, the method for culturing natural killer cells using transformed T-cells according to the present invention can be usefully used to commercialize cell therapeutic agents. Moreover, natural killer cells produced by the culturing method of the present invention can be usefully used as a cell therapeutic agent.
Description
TECHNICAL FIELD

The present invention relates to a method for culturing cord blood-derived natural killer cells using transformed T-cells.


SEQUENCE LISTING

This application contains a Sequence Listing that has been submitted electronically as an ASCII text file named sequencelisting.txt. The ASCII text file, created on Oct. 21, 2021, is 16.6 KB.


BACKGROUND ART

Immunotherapy using the patient's immune function is being developed as a treatment for cancer patients and preventing recurrence. In particular, immunotherapy using natural killer cells capable of mass production and freezing is being studied. Natural killer cells are lymphocytic cells that account for about 15% of peripheral blood lymphocytes and play an important role in congenital immune responses.


Specifically, natural killer cells activate dendritic cells and induce cytotoxic T lymphocytes (CTL) to react specifically to tumors, thereby removing tumor cells. Natural killer cells directly kill malignant tumors, such as sarcoma, myeloma, carcinoma, lymphomas, and leukemia. However, most of the natural killer cells in the body of a normal person exist in an inactive state, and activated natural killer cells are required to remove the tumor. In addition, in the case of natural killer cells in the body of cancer patients, functional defects of natural killer cells exist due to the immune evasion mechanism of cancer cells.


Therefore, in order to use natural killer cells as a therapeutic agent, it is very important to activate natural killer cells. In addition, since the number of natural killer cells present in the body is limited, it is essential to develop a technology for proliferating and freezing the natural killer cells of the blood of a normal person or the blood of a patient in large quantities.


In vitro expansion method is used as a method for mass proliferation of natural killer cells, and a method for mass culture of natural killer cells using peripheral blood lymphocytes (PBMC), cord blood (CB), or human-induced pluripotent stem cells as raw materials is being studied.


In particular, unlike bone marrow, cord blood can be obtained through a simple procedure from cord blood that is discarded during parturition. In addition, since the industry for storing cord blood has been vitalized and it is also easy to find donors, studies are being actively carried out on a method for culturing natural killer cells using cord blood.


Specifically, methods for in vitro expansion culture of cord blood-derived natural killer cells include a method for proliferating using mononuclear cells (MNC) as seed cells and a method for proliferating using hematopoietic progenitor cells (CD34+ cells) as seed cells. The method using mononuclear cells as seed cells uses interleukin-2 (IL-2), interleukin-15 (IL-15), FLT-3L, etc. alone or in combination to help proliferate natural killer cells, but it has a problem of low proliferation rate and purity (Biossel L. et al., Biology of Blood and Marrow Transplantation, 14, 1031-1038, 2008). In addition, the method using hematopoietic progenitor cells as seed cells has a high proliferation rate and purity, but the culture period is long and various cytokines and growth factors must be used in combination, which presents difficulties in commercialization in terms of cost (Fias A. M. et al., Experimental Hematology 36(1):61-68, 2008).


PBMC, CD3− cells, CD3−CD56+ cells, CD56+ cells, etc. are used as seed cells for in vitro expansion culture of natural killer cells, and cytokines such as IL-2, IL-12, IL-15, and IL-21, LPS (Goodier et al, J. Immunol. 165(1):139-147, 2000), and OKT-3 antibody that stimulates CD3 (Condiotti et al., Experimental Hematol. 29(1):104-113, 2001) are used as natural killer cell proliferation factors. Said proliferation factors alone can proliferate natural killer cells by 3 to 10 times. However, it is difficult to commercialize natural killer cells as a therapeutic agent with the level of proliferation rate described above.


Recently, a method for mass proliferating natural killer cells using various types of feeder cells is being studied. Peripheral blood monocytes, EBV-LCL, and K562 cell lines are representative cell lines use as feeder cells. The K562 cell line is a blood cancer-derived cell line lacking HLA and is a representative target cell line that can be attacked easily by natural killer cells. For most of the feeder cells for culturing natural killer cells, a method for proliferating by expressing 4-1BBL and membrane-bound IL-15 in K562 cell line (Fujisaki et al., Cancer Res. 69(9):4010-4017, 2009), a method for proliferating by expressing MICA, 4-1BBL, and IL-15 (Gong et al., Tissue Antigens, 76(6):467-475, 2010), a method for proliferating by expressing 4-1BBL and membrane-bound IL-21, etc. are known.


DETAILED DESCRIPTION OF THE INVENTION
Technical Problem(s)

Accordingly, in order to efficiently proliferate natural killer cells from cord blood, the present inventors have co-cultured cord blood-derived natural killer cells and CD4+ T cells that have expressed co-stimulating factors and growth factors capable of increasing the proliferation of natural killer cells to develop a method for in vitro proliferation.


Specifically, in order to increase the efficiency of the method for culturing natural killer cells using the CD4(+) T cells as feeder cells, the present inventors produced transformed CD4(+) T cells. The present invention was completed by co-culturing the transformed CD4(+) T cells and cord blood-derived mononuclear cells and confirming that the proliferation rate and cell killing ability of natural killer cells are increased through such co-culture.


Means to Solve the Problem(s)

One aspect of the present invention provides a method for culturing natural killer cells comprising a step for co-culturing transformed CD4+ T cells and seed cells.


Another aspect of the present invention provides natural killer cells produced by said culture method.


Effect of the Invention

The method for culturing natural killer cells using transformed T cells of the present invention can be produced by effectively proliferating natural killer cells from a small amount of cord blood-derived seed cells. In addition, the natural killer cells produced in this manner have improved cell killing ability. Therefore, the method for culturing natural killer cells using transformed T cells of the present invention can be usefully used for the commercialization of cell therapy agents. Furthermore, the natural killer cells produced by the culture method of the present invention can be usefully used as a cell therapy agent.





BRIEF DESCRIPTION OF DRAWINGS


FIG. 1a is a diagram confirming the expression status of the gene in Hut78 cell line through FACS.



FIG. 1b is a diagram confirming the expression status of a single gene introduced into Hut78 cell line through FACS.



FIG. 1c is a diagram confirming the expression status of mTNF-α/OX40L and mTNF-α/4-1BBL dual genes introduced into Hut78 cell line through FACS.



FIG. 1d is a diagram confirming the expression status of mbIL-21/OX40L and mbIL-21/4-1BBL dual genes introduced into Hut78 cell line through FACS.



FIG. 1e is a diagram confirming the expression status of triple genes introduced into Hut78 cell line through FACS.



FIG. 1f is a diagram confirming the expression status of quadruple genes introduced into Hut78 cell line through FACS.



FIG. 2a is a diagram illustrating the proliferation rate of natural killer cells produced by co-culturing Hut78 cell line into which the gene has been introduced and cord blood-derived CD3(−) mononuclear cells for each transgene.



FIG. 2b is a diagram illustrating the proliferation rate of natural killer cells produced by co-culturing H9 cell line into which the gene has been introduced and cord blood-derived CD3(−) mononuclear cells for each transgene.



FIG. 2c is a diagram illustrating the proliferation rate of natural killer cells produced by co-culturing Jurkat cell line into which the gene has been introduced and cord blood-derived CD3(−) mononuclear cells for each transgene.



FIG. 2d is a diagram illustrating the proliferation rate of natural killer cells produced by co-culturing Peer cell line into which the gene has been introduced and cord blood-derived CD3(−) mononuclear cells for each transgene.



FIG. 2e is a diagram illustrating the proliferation rate of natural killer cells produced by restimulating at 14-day or 16-day interval when co-culturing Hut78 cell line into which the triple gene has been introduced and cord blood-derived CD3(−) mononuclear cells.



FIG. 3a is a diagram illustrating the survival rate of natural killer cells produced by co-culturing Hut78 cell line into which the gene has been introduced and cord blood-derived CD3(−) mononuclear cells for each transgene.



FIG. 3b is a diagram illustrating the survival rate of natural killer cells produced by co-culturing H9 cell line into which the gene has been introduced and cord blood-derived CD3(−) mononuclear cells for each transgene.



FIG. 3c is a diagram illustrating the survival rate of natural killer cells produced by co-culturing Jurkat cell line into which the gene has been introduced and cord blood-derived CD3(−) mononuclear cells for each transgene.



FIG. 3d is a diagram illustrating the survival rate of natural killer cells produced by co-culturing Peer cell line into which the gene has been introduced and cord blood-derived CD3(−) mononuclear cells for each transgene.



FIG. 3e is a diagram illustrating the survival rate of natural killer cells produced by restimulating at 14-day or 16-day interval when co-culturing Hut78 cell line into which the triple gene has been introduced and cord blood-derived CD3(−) mononuclear cells.



FIG. 4a is a diagram illustrating the purity (CD3−CD56+) of natural killer cells produced by co-culturing Hut78 cell line into which the gene has been introduced and cord blood-derived CD3(−) mononuclear cells for each transgene.



FIG. 4b is a diagram illustrating the purity (CD3−CD56+) of natural killer cells produced by co-culturing H9 cell line into which the gene has been introduced and cord blood-derived CD3(−) mononuclear cells for each transgene.



FIG. 4c is a diagram illustrating the purity (CD3−CD56+) of natural killer cells produced by co-culturing Jurkat cell line into which the gene has been introduced and cord blood-derived CD3(−) mononuclear cells for each transgene.



FIG. 4d is a diagram illustrating the purity (CD3−CD56+) of natural killer cells produced by co-culturing Peer cell line into which the gene has been introduced and cord blood-derived CD3(−) mononuclear cells for each transgene.



FIG. 4e is a diagram illustrating the purity (CD3−CD56+) of natural killer cells produced by restimulating at 14-day or 16-day interval when co-culturing Hut78 cell line into which the triple gene has been introduced and cord blood-derived CD3(−) mononuclear cells.



FIG. 5a is a diagram illustrating the activity (CD16+CD56+) of natural killer cells produced by co-culturing Hut78 cell line into which the gene has been introduced and cord blood-derived CD3(−) mononuclear cells for each transgene.



FIG. 5b is a diagram illustrating the expression level of the NKG2D phenotype marker of natural killer cells produced by co-culturing Hut78 cell line into which the gene has been introduced and cord blood-derived CD3(−) mononuclear cells by each transgene.



FIG. 5c is a diagram illustrating the expression level of the NKp30 phenotype marker of natural killer cells produced by co-culturing Hut78 cell line into which the gene has been introduced and cord blood-derived CD3(−) mononuclear cells by each transgene.



FIG. 5d is a diagram illustrating the expression level of the NKp44 phenotype marker of natural killer cells produced by co-culturing Hut78 cell line into which the gene has been introduced and cord blood-derived CD3(−) mononuclear cells by each transgene.



FIG. 5e is a diagram illustrating the expression level of the NKp46 phenotype marker of natural killer cells produced by co-culturing Hut78 cell line into which the gene has been introduced and cord blood-derived CD3(−) mononuclear cells by each transgene.



FIG. 5f is a diagram illustrating the expression level of the DNAM-1 phenotype marker of natural killer cells produced by co-culturing Hut78 cell line into which the gene has been introduced and cord blood-derived CD3(−) mononuclear cells by each transgene.



FIG. 5g is a diagram illustrating the expression level of the CXCR3 phenotype marker of natural killer cells produced by co-culturing Hut78 cell line into which the gene has been introduced and cord blood-derived CD3(−) mononuclear cells by each transgene.



FIG. 6a is a diagram illustrating the activity (CD16+CD56+) of natural killer cells produced by co-culturing H9 cell line into which the gene has been introduced and cord blood-derived CD3(−) mononuclear cells for each transgene.



FIG. 6b a diagram illustrating the expression level of the NKG2D phenotype marker of natural killer cells produced by co-culturing H9 cell line into which the gene has been introduced and cord blood-derived CD3(−) mononuclear cells by each transgene.



FIG. 6c is a diagram illustrating the expression level of the NKp30 phenotype marker of natural killer cells produced by co-culturing H9 cell line into which the gene has been introduced and cord blood-derived CD3(−) mononuclear cells by each transgene.



FIG. 6d is a diagram illustrating the expression level of the NKp44 phenotype marker of natural killer cells produced by co-culturing H9 cell line into which the gene has been introduced and cord blood-derived CD3(−) mononuclear cells by each transgene.



FIG. 6e is a diagram illustrating the expression level of the NKp46 phenotype marker of natural killer cells produced by co-culturing H9 cell line into which the gene has been introduced and cord blood-derived CD3(−) mononuclear cells by each transgene.



FIG. 6f is a diagram illustrating the expression level of the DNAM-1 phenotype marker of natural killer cells produced by co-culturing H9 cell line into which the gene has been introduced and cord blood-derived CD3(−) mononuclear cells by each transgene.



FIG. 6g is a diagram illustrating the expression level of the CXCR3 phenotype marker of natural killer cells produced by co-culturing H9 cell line into which the gene has been introduced and cord blood-derived CD3(−) mononuclear cells by each transgene.



FIG. 7a is a diagram illustrating the expression level of NKG2D phenotype marker and the activity (CD16+CD56+) of natural killer cells produced by restimulating at 14-day or 16-day intervals when co-culturing Hut78 cell line into which the triple gene has been introduced and cord blood-derived CD3(−) mononuclear cells.



FIG. 7b is a diagram illustrating the expression level of NKp30, NKp44, NKp46, DNAM-1, and CXCR3 phenotype markers of natural killer cells produced by restimulating at 14-day or 16-day interval when co-culturing Hut78 cell line into which the triple gene has been introduced and cord blood-derived CD3(−) mononuclear cells.



FIG. 8a is a diagram illustrating the tumor cell killing ability of natural killer cells produced by co-culturing Hut78 cell line into which the gene has been introduced and cord blood-derived CD3(−) mononuclear cells by each transgene.



FIG. 8b is a diagram illustrating the tumor cell killing ability of natural killer cells produced by co-culturing H9 cell line into which the gene has been introduced and cord blood-derived CD3(−) mononuclear cells by each transgene.



FIG. 8c is a diagram illustrating the tumor cell killing ability of natural killer cells produced by co-culturing Jurkat cell line into which the gene has been introduced and cord blood-derived CD3(−) mononuclear cells by each transgene.



FIG. 8d is a diagram illustrating the tumor cell killing ability of natural killer cells produced by co-culturing Peer cell line into which the gene has been introduced and cord blood-derived CD3(−) mononuclear cells by each transgene.



FIG. 8e is a diagram illustrating the tumor cell killing ability of natural killer cells produced by restimulating at 14-day or 16-day interval when co-culturing Hut78 cell line into which the triple gene has been introduced and cord blood-derived CD3(−) mononuclear cells.



FIG. 9a is a diagram illustrating an administration schedule for efficacy evaluation using the Raji mouse animal model.



FIG. 9b is a diagram illustrating the result of measuring the survival rate for confirming the efficacy of NK cells, RTX, and co-administration in the Raji animal model.



FIG. 10a is a diagram illustrating an administration schedule for efficacy evaluation using the Ramos mouse animal model.



FIG. 10b is a diagram illustrating the result of measuring the survival rate for confirming the efficacy of NK cells, RTX, and co-administration in the Ramos animal model.





BEST MODE FOR CARRYING OUT THE INVENTION

Hereinafter, the present invention will be described in detail.


One aspect of the present invention provides a method for culturing natural killer cells comprising a step for co-culturing transformed CD4+ T cells and seed cells.


The transformed CD4+ T cells may express at least one gene selected from the group composed of 4-1BBL gene, mbIL-21 gene, OX40L gene, and mTNF-α gene.


Specifically, when one gene is introduced into the transformed CD4+ T cells, the gene may be 4-1BBL, mbIL-21, OX40L, or mTNF-α. In addition, when two genes are introduced into the transformed CD4+ T cells, said gene combination may be mbIL-21/4-1BBL, 4-1BBL/OX40L, mTNF-α/4-1BBL, mbIL-21/OX40L, mbIL-21/mTNF-α or mTNF-α/OX40L. In one embodiment of the present invention, genes of a combination of mbIL-21/4-1BBL, mTNF-α/OX40L, mTNF-α/4-1BBL and mbIL-21/OX40L were introduced into T cells.


In addition, when three genes are introduced into the transformed CD4+ T cells, said gene combination may be 4-1BBL/mbIL-21/OX40L, mbIL-21/OX40L/mTNF-α, mTNF-α/ mbIL-21/4-1BBL or 4-1BBL/OX40L/mTNF-α. In one embodiment of the present invention, genes of a combination of mTNF-α/mbIL-21/4-1BBL were introduced into T cells.


In addition, when four genes are introduced into the transformed CD4+ T cells, said gene combination may be mTNF-α/mbIL-21/OX40L/4-1BBL. In one embodiment of the present invention, genes of a combination of mTNF-α/mbIL-21/OX40L/4-1BBL were introduced into T cells.


The term ‘4-1BBL’ used in the present invention is one of TNFSF (TNF superfamily) called CD137L and refers to a ligand that binds to the receptor 4-1BB by forming a trimer. The 4-1BB gene may be derived from humans.


Specifically, the 4-1BBL gene may be NCBI Reference Sequence: NM_003811, but is not limited thereto. The 4-1BBL gene may be a base sequence coding the amino acid sequence represented by sequence No. 1. The base sequence coding the amino acid sequence represented by sequence No. 1 may be a base sequence represented by sequence No. 2.


The term ‘mbIL-21’ used in the present invention may be IL-21 designed to be bound to a cell membrane. Here, mbIL-21 may be a fusion protein in which IL-21 and a transmembrane protein are combined. The transmembrane protein may be CD8α. Specifically, it may be a transmembrane domain of CD8α.


Specifically, the IL-21 gene may be NCBI Reference Sequence: NM_021803.3, but is not limited thereto. In addition, the CD8α gene may be NCBI Reference Sequence: NM_001768, but is not limited thereto. The mbIL-21 is expressed in the form of IL-21 bound to the cell membrane. In addition, the mbIL-21 gene may be a base sequence coding the amino acid sequence represented by sequence No. 3. The base sequence coding the amino acid sequence represented by sequence No. 3 may be a base sequence represented by sequence No. 4.


The term ‘OX40L’ used in the present invention is also called TNFSF4, gp34, TXGP1, CD252, and CD134L, and refers to a ligand that binds to OX40. Specifically, the OX40L gene may be NCBI Reference Sequence: NM_003326, but is not limited thereto. The OX40L gene may be a base sequence coding the amino acid sequence represented by sequence No. 5. The base sequence coding the amino acid sequence represented by sequence No. 5 may be the base sequence represented by sequence No. 6.


The term ‘mTNF-α’ used in the present invention refers to the gene in which Alanine-Valine, which is a TACE (tumor necrosis factor-alpha-converting enzyme) recognition site, has undergone a point mutation in DNA in the amino acid sequence of tumor necrosis factor-alpha to become Proline-Valine. Mutating alanine to proline was randomly chosen.


Specifically, the mTNF-α gene may be a base sequence coding the amino acid sequence represented by sequence No. 8. The base sequence coding the amino acid sequence represented by sequence No. 8 may be the base sequence represented by sequence No. 9.


The 4-1BBL gene, mbIL-21 gene, OX40L gene, or mTNF-α gene may be introduced through a recombinant lentivirus, but is not limited thereto.


As a method for transducing the gene into a cell, a biochemical method, a physical method, or a virus mediated transduction method may be used. In addition, as a biochemical method, FuGene6 (Roche, USA), Lipofectamine (Lipofectamine™ 2000, Invitrogen, USA), or ExGen 500 (MBI Fermentas International Inc. CANADA) may be used. In addition, a lipid mediated method using lipofectamine may be used.


The term ‘vector’ used in the present invention is an expression vector capable of expressing a target gene in cells into which the vector has been introduced, refers to a gene construct comprising essential control elements operably connected so that the gene insert introduced into the vector can be expressed.


In addition, as the expression vector comprising the gene, any expression vector that can be expressed in a CD4+ cell line can be used, and in a specific embodiment of the present invention, pCDH-CMV-MCS-EF1-Puro (SBI, CD510B-1) or pCDH-CMV-MCS-EF1-Neo (SBI, CD514B-1) lentiviral vector was used.


The lentivirus refers to a virus of the retrovirus family characterized by a long incubation period. Lentiviruses can carry genetic information into the DNA of host cells. It is one of the most effective methods of gene transfer vectors capable of replicating in non-dividing cells.


The CD4+ T cells may be CD4+ T cells isolated in vitro, CD4+ T cells expanded and cultured in vitro, or CD4+ cell lines (T lymphoma cell lines). In addition, the CD4+ T cells may be accessory T cells, and may be hybridomas obtained by fusing CD4+ T cells and cancer cells. Specifically, the CD4+ T cells may be any one selected from the group composed of Hut78, H9, Jurkat, Loucy, Molt-3, Molt-13, Peer, RPMI8402 and TALL-01 cells. Preferably, it may be Hut78, H9, Jurkat or Peer cells.


The term ‘feeder cell’ used in the present invention refers to a cell that is also called a culture support cell and does not proliferate but has the metabolic activity to help the proliferation of target cells by producing various metabolites. The feeder cells may be transformed CD4+ T cells expressing at least one gene selected from the group composed of 4-1BBL gene, mbIL-21 gene, OX40L gene, and mTNF-α gene.


The T cells used as the feeder cells may be inactivated cells in which divisional proliferation is inhibited or cells that have not been inactivated, and preferably, safety can be ensured by inactivation. As a method for inactivation, a common method known in the relevant industry may be used, and for example, a method for irradiating gamma-ray may be used. When using T cells that have not been inactivated, since most are tumor cells, they can be killed during culture by activated natural killer cells.


The term “seed cell” used in the present invention refers to a cell capable of proliferating into natural killer cells through appropriate culture. Specifically, the seed cell may be cord blood-derived mononuclear cells, or cord blood-derived natural killer cells. This is not limited thereto, and preferably, the seed cells may be CD3(−) cells from which CD3(+) cells have been removed.


As for the method for culturing natural killer cells, they may be cultured by mixing the feeder cells and the seed cells with a ratio of at least 0.1. Specifically, the ratio of the feeder cells and the seed cells may be 0.1:1 to 50:1. More specifically, it may be 0.5:1 to 40:1. Even more specifically, it may be 1:1 to 30:1. Most specifically, it may be 2:1 to 20:1. As a specific example, the ratio of the feeder cell and the seed cell may be 2.5:1, but is not particularly limited thereto. The “ratio” refers to a ratio based on the number of cells.


In the method for culturing natural killer cells, the seed cells may be mixed once with the feeder cells and cultured for 5 to 60 days, or mixed with the feeders cells at least twice and cultured for at least 60 days. Preferably, the seed cells may be mixed once with the feeder cells and cultured for 14 to 21 days, but it is not limited thereto.


In the method for culturing natural killer cells, natural killer cells and T lymphoma cell lines are co-cultured in a conventional animal cell culture medium, such as AIM-V media, RPMI1640, CellGro SCGM, X-VIVO20, IMDM, and DMEM. When co-cultured, interleukins and antibodies that have low affinity to T cells and stimulate T cells may be added for culture, but it is not limited thereto.


The term ‘antibody that has low affinity to T cells and stimulates T cells’ used in the present invention refers to a protein that specifically reacts to the CD3 antigen, which is a group of molecules that meets with the T cell receptor (TCR) to form an antigen recognition complex. Compared to TCR, the CD3 molecule has a longer intracellular region and plays a role of transmitting antigen recognition signals into the cell.


Preferably, an antibody, which has a low affinity to T cells and stimulates T cells, that can be used in the present invention may be an anti-CD3 antibody. Specifically, the anti-CD3 antibody may be OKT-3, UCHT1, or HIT3a.


The term ‘interleukin’ (IL) used in the present invention refers to a group of cytokines, and refers to a proteinaceous biological active substance produced by immune cells, such as lymphocytes, monocytes, and macrophages. The interleukin may be IL-2, IL-15, IL-12, IL-18, or IL-21.


In an embodiment of the present invention, it was cultured by adding OKT-3 antibody and IL-2. The concentration of the OKT-3 antibody added may be 0.1 ng/ml to 1,000 ng/ml. Preferably, the concentration of the OKT-3 antibody may be 10 ng/μl. The concentration of IL-2 may be 10 U/ml to 2,000 U/ml. Preferably, the concentration of IL-2 may be 1,000 U/ml. In addition, it may be cultured by adding additional growth factors that support the proliferation of serum or plasma and lymphocytes. The type of serum or plasma to be added to the medium is not particularly limited, and commercially available serum or plasma derived from various animals may be used. Preferably, human-derived serum or plasma derived from the person themselves may be used.


The term ‘culture’ of the present invention refers to a method for growing cells in an environmental condition that has been appropriately artificially controlled. The method for culturing the transformed CD4+ T cells may be performed using a method well known in the relevant industry. Specifically, said culture may be carried out in a continuous manner in a batch process, a fed batch, or a repeated fed batch process.


In addition, precursors suitable for the culture medium may be used. The raw materials described above may be added in a batch, fed batch, or continuous manner to the culture during the cultivation process, but it is not particularly limited thereto. Basic compounds, such as sodium hydroxide, potassium hydroxide, and ammonia, or acidic compounds, such as phosphoric acid or sulfuric acid, can be used in an appropriate manner to adjust the pH of the culture.


The culture method using T cells as feeder cells selectively induces culture of natural killer cells in seed cells, and it can be cultured stably without differences depending on the donor when proliferating natural killer cells compared to when using the donor's PBMC feeder cells. In addition, in vitro culture of cord blood seed cells is difficult when the donor's MNC is used as feeder cells. Therefore, the culture method using T cells as feeder cells can efficiently and stably secure a large amount of therapeutic natural killer cell agents for treatment.


Another aspect of the present invention provides natural killer cells produced by said method for culturing natural killer cells.


Natural killer cells cultured according to said method for culturing natural killer cells can be frozen and the function of the cells does not get damaged even when they are thawed again. In addition, since the expression of an activating receptor, such as NKp46, is high, the killing ability and secretion of cytokines against tumor cell lines are increased, and therefore, an excellent anticancer effect can be expected. Therefore, it is possible to manufacture a cell therapy product effective for tumor treatment using a large amount of clinically applicable activated natural killer cells.


In addition, natural killer cells produced by the method for culturing natural killer cells may be comprised in an amount of 10 to 95 wt % based on the total weight of the composition for preventing or treating infectious diseases included as an active ingredient. In addition, the composition for preventing or treating infectious diseases or of the present invention may further comprise at least one type of active ingredients exhibiting the same or similar function in addition to said active ingredient.


The pharmaceutical composition for preventing or treating infectious diseases may be prepared into a pharmaceutical composition by comprising at least one type of pharmaceutically acceptable carriers in addition to the active ingredient described above for administration.


The dosage of the pharmaceutical composition for preventing or treating infectious diseases may be adjusted according to various factors including type of disease, severity of disease, type and content of active ingredients and other ingredients comprised in the composition, type of formulation, patient's age, weight, general health condition, gender, and diet, administration time, administration route, secretion rate of the composition, duration of treatment, and concurrently used drugs. However, for a desirable effect, the dost of natural killer cells according to the present invention may be 0.01×107 cells/kg to 1.0×109 cells/kg, and may be 0.5×107 cells/kg to 1.0×108 cells/kg. In this case, the administration may be carried out once a day, or may be divided into several administrations.


In addition, the pharmaceutical composition for preventing or treating infectious diseases may be administered to an individual by various methods known in the relevant industry. The administration route may be appropriately selected by a PHOSITA in consideration of the method of administration, volume of body fluid, viscosity, etc.


Another aspect of the present invention provides a composition for culturing natural killer cells comprising transformed CD4+ T cells as an active ingredient. Since the CD4+ T cells used in the present invention and the genes introduced into said cells have already been described above, the corresponding descriptions will be omitted to avoid excessive duplication.


MODE FOR CARRYING OUT THE INVENTION

Hereinafter, the present invention will be described in detail by embodiments. However, the following embodiments are intended only for illustrating the present invention, and the present invention is not limited to the following embodiments.


Embodiment 1. Production of Recombinant Lentivirus
Embodiment 1.1. Production of Recombinant Lentiviral Vector

For the lentiviral vector, pCDH-CMV-MCS-EF1-Puro (SBI, CD510B-1) or pCDH-CMV-MCS-EF1-Neo (SBI, CD514B-1) was used. For genes, 4-1BBL (TNF superfamily member 9, TNFSF9), mbIL-21 (membrane bound IL-21), OX40L (TNF superfamily member 4(TNFSF4) transcript variant 1), and mTNF-α (membrane bound TNF alpha) were used as transgenes.


Specifically, a 4-1BBL gene expression vector (Origene, RC211160) was used for the 4-1BBL gene (sequence No. 2). For the mbIL-21 gene (sequence No. 4), a pcDNA3.1 vector (Genscript, US) into which the codon-optimized mbIL-21 gene sequence has been inserted was used. The OX40L gene (sequence No. 6) was requested to be synthesized by Bioneer.


For mTNF-α gene (sequence No. 9), RNA was extracted from peripheral blood mononuclear cell (PBMC), and then CDS was obtained by RT(Reverse transcriptase)-PCR. TNF-α is cut by TACE (tumor necrosis factor-alpha-converting enzyme) to be secreted, and A-V (Alanine-Valine), which is a TACE recognition site, has undergone a point mutation in DNA in the TNF-α amino acid sequence to become P-V (Proline-Valine), thereby maintaining the state of being attached to the cell membrane. The point mutation was performed by substituting guanine, the 226th base, with cytosine, and adenine, the 228th base, with guanine in the human mTNF-α gene represented by sequence No. 7.


Using primers suitable for each transgene, CDS (Coding Sequence) of the transgene was amplified through PCR (Table 1).












TABLE 1








Sequence


Gene
Primer
Sequence information (5′→3′)
number







4-1BBL
4-1BBL
TCTAGAGCTAGCGAATTCGCCACCATG
Sequence



Forward
GAATACGCCTCTGACGCTT
number 10



4-1BBL
TTCGCGGCCGCGGATCCTTATTCCGACC
Sequence



Reverse
TCGGTGAAGG
number 11





mbIL-21
mbIL-21
TAGAGCTAGCGAATTCGCCACCGCCAC
Sequence



Forward
CATGGCTCTGCCC
number 12



mbIL-21
TCGCGGCCGCGGATCCTCAATACAGGG
Sequence



Reverse
TGATGACC
number 13





OX40L
OX40L
TAGAGCTAGCGAATTCGCCACCATGGA
Sequence



Forward
ACGGGTGCAAC
number 14



OX40L
TCGCGGCCGCGGATCCTCACAAGACAC
Sequence



Reverse
AGAACTCCCC
number 15





mTNF-α
mTNF-α
TAGAGCTAGCGAATTCGCCACCGCCAC
Sequence



Forward
CATGGCTCTGCCC
number 16



mTNF-α
TCGCGGCCGCGGATCCTCACAGGGCAA
Sequence



Reverse
TGATCCC
number 17









Table 1 shows the primers used in the experiment. The transgene and lentiviral vector were treated with EcoRI and BamHI restriction enzymes. Then, it was ligated using In-Fusion HD cloning kit (Clontech, 639649). The ligated lentiviral vector was transformed in DH5a soluble cells (competent cells) and cultured. Plasmid DNA was obtained from the transformed DH5α soluble cells using a plasmid mini-prep kit (MACHEREY-NAGEL/740422.50). A request for sequencing was made to an external company and it was confirmed that all plasmid DNA matches the DNA sequence. In addition, the desired transgene was inserted into cLV-CMV-MCS-IRES-Puro (puromycin) or cLV-CMV-MCS-IRES-Neo (neomycin), cLV-CMV-MCS-IRES-Bsd (blasticidin) by an outsourced manufacturer by the same method as the one described above.


Embodiment 1.2. Production of Concentrated Lentivirus

In order to produce recombinant lentivirus, the 293T cell line was inoculated into a 75T flask (Nunc, 156499) with 1.5×106 to 2×106 cells 2 days before transfection, and cultured in an incubator at a temperature condition of 5% CO2, 37° C. When the cell saturation of the 293T cells reached about 80% to 90%, the medium was replaced with 6 ml OPTI-MEM (Gibco, 31985-088) and incubated for 30 minutes at a temperature of 37° C. and under the condition of 5% CO2. A DNA mixture and a lipofectamine (lipofectamine 2000, Life technologies, 11668500) mixture were prepared (Table 2).












TABLE 2







Category
Ingredients









DNA mixture
6 μg target DNA, 6 μg Gag, 6 μg REV,




3 μg VSVG, 1 m custom-character  OPTI-MEM



Lipofectamine mixture
36 μ custom-character  lipofectamine 2000,




1 m custom-character  OPTI-MEM










Table 2 shows the DNA mixture and the lipofectamine (lipofectamine 2000, Life technologies, 11668500) mixture. Each of the components of the mixtures was mixed well using a vortexer and left at room temperature for 3 minutes. Then, the two mixtures were mixed and left at room temperature for at least 20 minutes. 2 mcustom-character of a mixed solution of DNA and lipofectamine was treated with 293T cells being cultured in 6 mcustom-character OPTI-MEM. After 4 hours, it was replaced with DMEM (Gibco, 11995073) medium to which 10% (v/v) FBS has been added, and was cultured at a temperature of 37° C. for 48 hours under the condition of 5% CO2. 8 mcustom-character of the culture solution of 293T cells cultured for 48 hours was collected and filtered through a 0.45 μm filter (Millipore, SLHP033RS). The filtered culture solution was concentrated to 250 μl or less using an Amicon Ultra-15 Centrifugal Filter Unit with Ultracel-100 membrane (Merckmillipore, UFC910096). The concentrated virus was divided into an appropriate amount and stored at a temperature of −80° C.


Embodiment 2. Production of Transgenic T Cells
Embodiment 2.1. Lentivirus infection

0.5×106 cell lines being cultured, 1 mcustom-character OPTI-MEM, 50 μcustom-character lentivirus thawing solution, and 10 μg/mcustom-character polybrene (Santa Cruz, C2013) were mixed and placed in a 6-well plate (Nunc, 140675), and spinoculation was performed for 90 minutes under 1800×g and at a temperature of 32° C. Then, after culturing in an incubator under a temperature condition of 5% CO2, 37° C., it was replaced with an existing culture medium and cultured for 48 hours.


Hut78 cell line (ATCC, TIB-161™) was cultured in IMDM (ATCC, 30-2005) medium containing 20% (v/v) FBS. During subculture, the cell concentration was maintained at 1.5×105 cells/mcustom-character to 2.0×105 cells/mcustom-character. H9 cell line (ATCC, HTB-176™) and Jurkat cell line (ATCC, TIB-152™) were cultured in RPMI1640 (ATCC, 30-2001) medium containing 10% (v/v) FBS. During subculture, cell concentrations were maintained at 1.0×105 cells/mcustom-character to 1.5×105 cells/mcustom-character and 0.5×105 cells/mcustom-character to 1.0×105 cells/mcustom-character, respectively Peer cell line was cultured in RPMI1640 medium containing 20% (v/v) FBS. During subculture, the cell concentration was maintained at 3.0×105 to 5.0×105 cells/mcustom-character. The subculture of all cell lines was performed at intervals of 2 to 3 days. A 75T flask was used as the culture vessel, and the amount of medium was maintained between 15 mcustom-character to 20 mcustom-character.


Cell lines infected with the recombinant lentivirus were selected using antibiotics (Table 3).














TABLE 3







Transgenic


Antibiotic usage



combination
Vector used
Cell line
concentration




















Single gene
mTNF-ambIL-21
pCDH(System
Hut78
0.5 μg/m custom-character  puromycin


expression

Biosciences,

(Life technologies.




SBI)

A1113802)



OX40L4-1BBL
pCDH(System
Hut78
1 mg/m custom-character  G148(Sigma




Biosciences,

Aldrich, A1720-5G)




SBI)


Double gene
mTNF-a/OX40L
pCDH(System
Hut78
0.5 μg/m custom-character


expression
mbIL-21/OX40L
Biosciences,

puromycin1 mg/m custom-character



mTNF-a/4-1BBL
SBI)

G418



mbIL-21/4-1BBL
cLV (Sirion)
Hut78H9
6 μg/m custom-character





JurkatPeer
Blasticidin(Invitrogen,






R210-01)1






mg/m custom-character  G148


Triple gene
mTNF-a/mbIL-21/
cLV (Sirion)
Hut78H9
0.5 μg/m custom-character


expression
4-1BBL

Jurkat
puromycin6 μg/m custom-character






Blasticidin1 mg/m custom-character






G418


Quadruple
mTNF-a/mbIL-21/
mTNF-a/mbIL-21/
Hut78
0.5 μg/m custom-character


gene
OX40L/
4-1BBL;

puromycin6 μg/m custom-character


expression
4-1BBL
cLVOx40L;

Blasticidin1 mg/m custom-character




pCDH

G418









Table 3 above shows the antibiotics used in cell lines into which the gene was introduced.


Embodiment 2.2. Confirmation of Transgene Expression

In order to confirm the expression of the transgene through flow cytometry, the cell lines subcultured in embodiment 2.1. were collected and centrifuged at 1,200 rpm for 5 minutes. Then, the culture solution was removed by suction. FACS buffer was created by adding 2 %(v/v) FBS to PBS. The number of cells was measured by diluting with 1 mcustom-character of FACS buffer, and it was diluted with FACS buffer to a concentration of 5×106 cells/mcustom-character. 100 μcustom-character of diluted cell solution was added to each of 5 mcustom-character FACS tubes (Falcon, 352052). After staining with anti-human TNF-a(membrane)-PE (R&D systems, FAB210P), anti-human OX40L-PE (BD, 558184), anti-human 4-1BBL-PE (BD, 559446), anti-human IL-21-PE (eBioscience, 12-7219-42), 7-AAD (Beckman coulter, IM3630c), PE mouse IgG1 κ isotype control (BD Pharmingen, 555749), and PerCP-Cy5.5 mouse IgG1 κ isotype control (BD, 550795), the expression rate of each gene was analyzed using FACS equipment (FIGS. 1a to 1f).


In addition, in order to confirm the expression of the transgene through RT-qPCR (Real time qPCR), the cell lines subcultured in embodiment 2.1. were collected and centrifuged at 1,200 rpm for 5 minutes. Then, the culture solution was removed by suction. The number of cells was measured by diluting with PBS, and RNA was isolated and quantified for 1×106 cells using an RNA prep kit. In addition, cDNA was synthesized using a cDNA synthesis kit. RT-qPCR was performed using the synthesized cDNA. Primers used in RT-qPCR are as shown in Table 4 below.












TABLE 4






Primer
Sequence information (5′→3′)
Sequence number







4.1BBL
Forward
TCTGAGACAGGGCATGTT
Sequence



primer
TG
number 18



Reverse
CCACCAGTTCTTTGGTGTC
Sequence



primer
C
number 19





mTNF-α
Forward
AACCTCCTCTCTGCCATCA
Sequence



primer
A
number 20



Reverse
ATAGTCGGGCCGATTGAT
Sequence



primer
CT
number 21





mbIL-21
Forward
TGGAAACAATGAGCGAAT
Sequence



primer
CA
number 22



Reverse
AACCGCTCCAGGAACTCT
Sequence



primer
TT
number 23





hTOP1
Forward
CCAGACGGAAGCTCGGAA
Sequence



primer
AC
number 24



Reverse
GTCCAGGAGGCTCTATCT
Sequence



primer
TGAA
number 25









Table 4 shows the primers used in the RT-qPCR experiment. The expression level of the transgenes in the cell lines is shown in Table 5 below.













TABLE 5





Ct value
TOP1
mTNF-α
mbIL-21
4.1BBL







H9
20.3
21.5
n.d
n.d


H9-mbIL-21-4.1BBL
20.0
22.2
19.5
19.4


H9-mTNF-α-mbIL-21-4.1BBL
19.9
18.2
18.1
18.2


Jurkat
20.1
30.7
n.d
n.d


Jurkat-mbIL-21-4.1BBL
27.4
37.0
36.4
34.1


Jurkal-mTNF-α-
20.4
19.8
19.2
19.8


mbIL-21-4.1BBL


Peer
21.4
26.2
34.2
34.9


Peer-mbIL-21-4.1BBL
26.8
33.8
29.0
25.6





* n.d: not detected






As shown in Table 5, it was confirmed that the expression level of the genes introduced into the cell lines was increased.


Embodiment 3. Co-Cultivation of CD3(−) PBMC and Transgenic T Cells
Embodiment 3.1. Preparation of Cord Blood-Derived CD3(−) PBMC Seed Cells

Cord blood for research was placed in a 50 mcustom-character tube and centrifuged for 10 minutes at 1,500 rpm. Plasma of the upper layer was removed and PBS (phosphate buffered saline, LONZA, 17-516Q) was added in a 1:1 ratio. Then, after separating cord blood mononuclear cells (MNC) through Ficoll (Ficoll-Paque Plus, GE Healthcare, 17-1440-03) density gradient centrifugation method, the number of cells was measured using the ADAM cell counter system (Nano Entek).


In order to obtain seed cells from which CD3(+) cells have been removed, 5×107 cord blood mononuclear cells were moved to a new 50 mcustom-character tube, and then centrifuged at 1,200 rpm and a temperature of 4° C. for 5 minutes. A MACS running buffer containing 2% (v/v) FBS and EDTA with a concentration of 2 mM in PBS was prepared. After the centrifugation, 400 μcustom-character of MACS running buffer and 100 μcustom-character of CD3 magnetic beads (Miltenyi biotech, 130-050-101) were added to the pellet and reacted at a temperature of 4° C. for 20 minutes. After washing by adding 10 mcustom-character MACS running buffer, it was centrifuged at 13,500 rpm and a temperature of 4° C. for 8 minutes and suspended in 0.5 mcustom-character of MACS running buffer.


Cells were separated by mounting a CS column (Miltenyi Biotech, 130-041-305) on VarioMACS (Miltenyi Biotech). Cells were recovered by washing the column until finally reaching 20 mcustom-character. The recovered cells were placed in a new 50 mcustom-character tube, centrifuged at 1,200 rpm and a temperature of 4° C. for 5 minutes, and suspended in a frozen medium. The number of cells was measured using the ADAM cell counter system to freeze 5×106 cells per vial in liquid nitrogen.


One vial of frozen CD3(−) cord blood mononuclear cells was thawed in a water bath at a temperature of 37° C. and moved to a 50 mcustom-character tube, suspended in PBS containing 0.6% (v/v) ACD (Citrate-dextrose solution, Sigma-Aldrich, C3821), 0.2% (v/v) FBS (Fetal serum bovine), and 2 mM EDTA, and centrifuged at 1,500 rpm and a temperature of 4° C. for 10 minutes. CD3(−) cord blood mononuclear cells were suspended in CellGro medium (Cellgenix, 20802-0500), and the number of cells was measured using the ADAM cell counter system. CD3(−) cord blood mononuclear cells were suspended in CellGro medium at a concentration of 1×106 cells/mcustom-character.


Embodiment 3.2. Co-Cultivation of CD3(−) Cord Blood Mononuclear Cells and Transgenic T Cells

The transgenic T cells prepared in embodiment 2 were recovered from the culture flask and centrifuged at 1,200 rpm and a temperature of 4° C. for 5 minutes. Then, it was suspended in CellGro medium, and the number of cells was measured using the ADAM cell counter system. The transgenic T cells were suspended in CellGro medium at a concentration of 2.5×106 cells/mcustom-character, and then prepared by inactivating it with irradiation at 20,000 cGy in a gamma-ray irradiator.


When culturing natural killer cells, 1,000 IU of IL-2 (Proleukin Injection, Novartis Korea) and 10 ng/mcustom-character of OKT-3 (eBioscience, 16-0037-85) were placed in a culture plastic plate. On day 0 of cultivation, 0.25 mcustom-character of each of CD3(−) cord blood mononuclear cells and transgenic T cells was added at a ratio of 1:2.5, 0.25 mcustom-character of CellGro medium containing 2% (v/v) human plasma was added, and stationary culture was carried out for 4 days in an incubator at a temperature condition of 37° C.


On the fourth day of cultivation, the same amount of CellGro medium containing 1% (v/v) human plasma and 1,000 IU/mcustom-character of IL-2 was added, and then stationary culture was performed again. Then, the number of cells was measured at intervals of 2 to 3 days, and suspension culture was carried out until the 21st day while adding CellGro medium containing 1% (v/v) human plasma and 1,000 IU/mcustom-character of IL-2 to reach a concentration of 1×106 cells/mcustom-character. Proliferated natural killer cells were obtained by performing suspension culture until the 21st day. In this case, if the Jurkat cell lines or the Peer cell lines were used as feeder cells, the suspension culture was performed until the 11th day. If genes were introduced into H9 and Hut78 and used as feeder cells, the suspension culture was performed until the 21st day.


The result of comparing the proliferation rate of cultured natural killer cells showed that, based on the total number of cells (Total nucleated cells, TNC), when co-cultured with the Hut78 cell lines to which the gene was not introduced, it proliferated 93 times. It was confirmed that the proliferation rate of natural killer cells was significantly increased when co-cultured with the Hut78 cell lines into which one or more genes (mTNF-α, mbIL-21, 4-1BBL) were introduced. In particular, when co-cultured with the Hut78 cell lines into which the gene of mbIL-21/4-1BBL was introduced, it proliferated 957 times. In addition, when co-cultured with the Hut78 cell lines into which mTNF-α/mbIL-21/4-1BBL was introduced, it proliferated 1,138 times (Table 6, FIG. 2a).













TABLE 6







HuT78/Transgene
Average
STDEV




















HuT78 parental
92.7
90.4



mTNF-α
112.3
67.2



mbIL-21
448.1
251.4



OX40L
50.5
30.7



4.1BBL
274.9
189.6



mTNF-α + OX40L
204.5
123.2



mTNF-α + 4.1BBL
389.1
352.1



mbIL-21 + OX40L
372.0
189.2



mbIL-21 + 4.1BBL
957.0
537.4



mTNF-α + mbIL21 + 4.1BBL
1138.5
192.0



mTNF-α + OX40L + mbIL21 + 4.1BBL
823.1
330.0










In addition, when co-cultured with the H9 cell lines into which the gene was not introduced, it proliferated 13 times, but when co-cultured with the H9 cell lines into which mbIL-21/4-1BBL or mTNF-α/mbIL-21/4-1BBL was introduced, it proliferated 367 times and 979 times, respectively (Table 7 and FIG. 2b).













TABLE 7







H9 + Transgene
Average
STDEV




















H9 parental
12.6
4.3



mbIL21 + 4.1BBL
367.4
80.1



mTNF-α + mbIL21 + 4.1BBL
978.8
287.7










When co-cultured with other cell lines, such as Jurkat cell lines or Peer cell lines, cultivation was possible until the 11th day of culture. A relatively high proliferation rate was displayed in cell lines into which the mbIL-21/4.1BBL gene was introduced or cell lines into which the mTNF-α/mbIL-21/4-1BBL gene was introduced (Table 8 and Table 9, FIG. 2c and FIG. 2b).











TABLE 8





Jurkat + Transgene
Average (11-day culture)
STDEV

















Jurkat Parental
0.9
0.7


mbIL21 + 4.1BBL
36.3
4.8


mTNF-α + mbIL21 + 4.1BBL
43.6
6.6




















TABLE 9







Peer + Transgene
Average (11-day culture)
STDEV




















Peer Parental
1.6
0.7



mbIL21 + 4.1BBL
14.3
4.1










The results described above showed that it is possible to culture natural killer cells by culturing CD3(−) cells isolated from cord blood mononuclear cells for 21 days with feeder cells into which the gene was introduced, and exhibited a higher proliferation that the non-transduced feeder cells.


Embodiment 3.3. Restimulation of Natural Killer Cell Culture Using Hut78 Cells Into Which the mTNF-α/mbIL-21/4-1BBL Gene was Introduced

The transgenic T cells prepared in embodiment 2 were recovered from the culture flask and centrifuged for 5 minutes at 1,200 rpm and a temperature of 4° C. Then, it was suspended in CellGro medium, and the number of cells was measured using the ADAM cell counter system. After suspending the transgenic T cells in CellGro medium at a concentration of 2.5×106 cells/me, it was prepared by inactivating it with irradiation at 20,000 cGy in a gamma-ray irradiator.


When culturing natural killer cells, 1,000 IU of IL-2 and 10 ng/mcustom-character of OKT-3 were placed in a culture plastic plate. On day 0 of cultivation, 0.25 mcustom-character to 1 mcustom-character of each of CD3(−) cord blood mononuclear cells and transgenic T cells were added at a ratio of 1:2.5, 0.25 mcustom-character to 1 mcustom-character of CellGro medium containing 2% (v/v) human plasma was added, and stationary culture was carried out for 4 days in an incubator at a temperature condition of 37° C.


On the fourth day of cultivation, the same amount of CellGro medium containing 1% (v/v) human plasma and 1,000 IU/mcustom-character of IL-2 was added, and then stationary culture was performed again. Then, the number of cells was measured at intervals of 2 to 3 days, and cultivation was carried out while adding CellGro medium containing 1% (v/v) human plasma and 1,000 IU/mcustom-character of IL-2 to reach a concentration of 1×106 cells/mcustom-character.


For restimulation, on day 0 of cultivation, HuT78 cells into which the mTNF-α/mbIL-21/4-1BBL was introduced were used at the same ratio. On the sixteenth day of cultivation, the first restimulation was given. First, the number of natural killer cells in cultivation was measured using the ADAM cell counter system, they were diluted with CellGro medium to become 1.5×106 cells/me, and 0.25 mcustom-character was prepared on a culture plastic plate. HuT78 cells into which the mTNF-α/mbIL-21/4-1BBL was introduced were suspended in CellGro medium to become 2.5×106 cells/me, and then prepared by inactivating it with irradiation at 10,000 cGy in a gamma-ray irradiator.


0.25 mcustom-character HuT78 cells into which the inactivated mTNF-α/mbIL-21/4-1BBL gene was introduced were added to a culture plastic. 1,000 IU/mcustom-character of IL-2 and 10 ng/mcustom-character of OKT-3, and 1 %(v/v) human plasma were placed in a culture plastic plate, and stationary culture was carried out for 3 days in an incubator at a temperature of 37° C. Then, the number of cells was measured at intervals of 2 to 3 days, and cultivation was performed while adding CellGro medium containing 1% (v/v) human plasma and 1,000 IU/mcustom-character of IL-2 to reach a concentration of 1×106 cells/mcustom-character. After the first restimulation, restimulation through feeder cells was performed on the 32nd, 46th, and 60th day of culture in the name manner, and culture was continued until the 70th day.


As a result, the proliferation rate of natural killer cells on the 32nd day of cultivation after the first restimulation was 6.9×104 times, 3.7×106 times after the second restimulation, 2.3×108 times on the 60th day of cultivation after the third restimulation, and 5.9×109 times on the 70th day of cultivation after the fourth restimulation, maintaining sustained proliferation and showing a high proliferation rate (Table 10, FIG. 2e).













TABLE 10







Culturing day
Average
STDEV









Day 32
6.9 × 104
3.2 × 103



Day 46
3.7 × 106
3.1 × 105



Day 60
2.3 × 108
1.4 × 108



Day 70
5.9 × 109
1.1 × 108










Through this, it was confirmed that when a periodic restimulation was provided to HuT78 cell lines into which the mTNF-α/mbIL-21/4-1BBL was introduced, the proliferation rate continued to increase, making it an excellent feeder cell to be used.


Experimental Example 1. Confirmation of Cell Viability of Natural Killer Cells According to Transgenes

In order to compare and evaluate the in-vitro cell viability, an ADAM cell counter system, which is one of the cell counters using PI staining solution capable of binding with the intracellular nucleus, was used. After calculating the number of viable cells by subtracting the number of dead cells from the measured total number of cells, cell viability was calculated using Equation I below.





Cell viability (%)=(viable cell count/total cell count)×100   [Equation I]


In the case of natural killer cells co-cultured with HuT78 cell lines into which the gene was introduced, it exhibited viability of around 90% regardless of whether the gene was introduced (Table 11, FIG. 3a).













TABLE 11







HuT78 + Transgene
Average
STDEV




















Parental
91
2.6



mTNF-α
92.8
2.1



mbIL-21
92.8
1.5



OX40L
90.3
1.3



4.1BBL
91.3
1.3



mTNF-α + OX40L
93.5
1.7



mTNF-α + 4.1BBL
92.5
1.7



mbIL-21 + OX40L
89
2.4



mbIL-21 + 4.1BBL
89.8
2.6



mTNF-α + mbIL-21 + 4.1BBL
89
3.4



QD
88.5
3.4










In the case of other H9, Jurkat, or Peer cell lines, the viability of natural killer cells cultured in the cell line into which the mbIL-21/4-1BBL gene was introduced and the cell line into which the mTNF-α/mbIL-21/4-1BBL gene was introduced exhibited viability of at least 90% when cultured for 21 days (H9) and cultured for 11 days (Jurkat, Peer) (Tables 12 to 14, FIGS. 3b to 3d).













TABLE 12







H9 + Transgene
Average
STDEV









Parental
86
6.1



mbIL21 + 44.1BBL
91
3.1



mTNF-α + mbIL21 + 4.1BBL
94
0.6





















TABLE 13







Jurkat + Transgene
Average
STDEV









Parental
80
6.1



mbIL21 + 4.1BBL
91
0.6



mTNF-α + mbIL21 + 4.1BBL
92
2.0





















TABLE 14







Peer + Transgene
Average
STDEV




















Parental
83.5
6.1



mbIL21 + 4.1BBL
91
0.6










In addition, as a result of culturing while increasing the number of restimulations with HuT78 into which the mTNF-α/mbIL-21/4-1BBL gene was introduced, the viability of natural killer cells shows high viability of about 90% or higher even when the number of restimulations was increased (Table 15, FIG. 3e).















TABLE 15







Culturing day
Day 32
Day 42
Day 60
Day 70






















Average
96.0
93.5
97.5
91.5



STDEV
1.4
0.7
0.7
4.9










Through this, it was confirmed that since the natural killer cells maintain high viability even if the cultivation is continued for a long period of time, the expanded cultivation of natural killer cells is possible for a long period of time.


Experimental Example 2. Confirmation of Purity of Natural Killer Cells

Natural killer cells cultured for 21 days or natural killer cells cultured by repeated restimulation were collected, centrifuged at 1,200 rpm for 5 minutes, and the culture solution was removed by suction. The number of cells was measured by diluting with 1 mcustom-character of FACS buffer, and was diluted with FACS butter to be 5×106 cells/mcustom-character. 100 μcustom-character of the diluted cell solution was added to each of 5 mcustom-character FACS tubes (Falcon, 352052), and the phenotype was analyzed with the following antibodies:

    • Tube 1: Anti-human CD3-FITC (BD Pharmingen, 555332), anti-human CD16-PE (BD Pharmingen, 555407), anti-human CD56-BV421 (BD Pharmingen, 562751)
    • Tube 2: Anti-human CD14-FITC (BD Pharmingen, 555397), anti-human CD19-PE (BD Pharmingen, 555413), anti-human CD3-BV421 (BD Pharmingen, 562438)
    • Tube 3: Anti-human CD3-FITC, anti-human NKG2D-PE (R&D system, FAB139P), anti-human CD56-BV421
    • Tube 4: Anti-human CD3-FITC, anti-human NKp30-PE (BD Pharmingen, 558407), anti-human CD56-BV421
    • Tube 5: Anti-human CD3-FITC, anti-human NKp44-PE (BD Pharmingen, 558563), anti-human CD56-BV421
    • Tube 6: Anti-human CD3-FITC, anti-human NKp46-PE (BD Pharmingen, 557991), anti-human CD56-BV421
    • Tube 7: Anti-human CD3-FITC, anti-human DNAM-1-PE (BD Pharmingen, 559789), anti-human CD56-BV421
    • Tube 8: Anti-human CD3-FITC, anti-human CXCR3-PE (BD Pharmingen, 557185), anti-human CD56-BV421
    • Tube 9: Anti-human CD3-FITC, PE mouse IgG1 κ isotype control (BD Pharmingen, 555749), anti-human CD56-BV421
    • Tube 10: FITC mouse IgG1 κ isotype control (BD Pharmingen, 555748), PE mouse IgG1 κ isotype control, BV421 mouse IgG1 κ isotype control (BD Pharmingen, 562438)


In tube 1 described above, the anti-human CD56 was carried out by selecting one of three fluorescence, and accordingly, the same fluorescence was selected for CD3 of tube 2, CD56 of tubes 3 to 9, and isotype control of tube 10.


The tubes were stained at refrigeration temperature for 30 minutes. Then, 2 mcustom-character of FACS buffer was added to the stained cells, and centrifuged at 1,500 rpm for 3 minutes. The supernatant was removed, 2 mcustom-character of FACS buffer was added again, and it was centrifuged at 2,000 rpm for 3 minutes. The supernatant was removed again, 200 μcustom-character of cytofix buffer (fixation buffer, BD, 554655) was added and suspension was performed, and then FACS LSRII Fortessa (BD Biosciences) was used for confirmation of cells and investigation of purity and various phenotypes.


After co-culturing CD3(−) cells isolated from cord blood mononuclear cells with HuT78 cell lines into which the gene was introduced, natural killer cells were checked and purity was analyzed, and the result confirmed a high content of natural killer cells (CD3−CD56+) of 90% or higher in all conditions regardless of whether or not the gene was introduced (Table 16, FIG. 4a).













TABLE 16







HuT78 + Transgene
Average
STDEV




















Parental
92.4
9.6



mTNF-α
96.8
2.5



mbIL-21
98.6
0.9



OX40L
95.7
3.6



4.1BBL
98
1.8



mTNF-α + OX40L
97.2
2.5



mTNF-α + 4.1BBL
98.6
1



mbIL-21 + OX40L
98.4
1.3



mbIL-21 + 4.1BBL
98.5
0.9



mTNF-α + mbIL-21 + 44.1BBL
98.7
0.9



QD
99.3
0.5










In the case of other H9, Jurkat, or Peer cell lines, the natural killer cells co-cultured with the cell line into which the mbIL-21/4-1BBL gene or mTNF-α/mbIL-21/4-1BBL gene was introduced was confirmed and it was confirmed that its purity was maintained to be higher compared to the condition in which the gene is not introduced (Tables 17 to 19, FIGS. 4b to 4d).













TABLE 17







H9 + Transgene
Average
STDEV




















Parental
91.5
4.1



mbIL21 + 4.1BBL
98.5
0.7



mTNF-α + mbIL21 + 44.1BBL
99
0.3





















TABLE 18







Jurkat + Transgene
Average
STDEV









Parental
88.6
6.9



mbIL21 + 4.1BBL
97.6
1.3



mTNF-α + mbIL21 + 44.1BBL
97.5
0.8





















TABLE 19







Peer + Transgene
Average
STDEV




















Parental
79.2
14.6



mbIL21 + 4.1BBL
94.9
2.1










In addition, for the natural killer cells cultured by increasing the number of restimulations with the cell line into which three genes, mTNF-α/mbIL-21/4-1BBL, were introduced, a high content of natural killer cells (CD3−CD56+) of 90% or higher up to 60 days of cultivation was confirmed (Table 20, FIG. 4e).













TABLE 20







Culturing day
Day 32
Day 60




















Average
99.7
97.8



STDEV
0.1
0.8










Experimental Example 3. Analysis of Active Markers of Natural Killer Cells

In addition, after co-culturing CD3(−) cells isolated from cord blood mononuclear cells with feeder cells into which the gene was introduced for 21 days, receptor expression of representative natural killer cells was analyzed.


When co-cultured with HuT78 cell lines, all CD16 was highly expressed, and all of them were highly expressed without any variation between donors under the condition of double transgenic feeder cells compared to the condition in which NKG2D, NKp30, NKp44, NKp46, and DNAM-1, which are active markers, were not introduced or the condition of single transgenic feeder cells (FIGS. 5a to 5g).


In addition, when co-cultured with H9 cell lines, it was confirmed that the expression levels of CD16 and NKG2D, DNAM-1, CXCR3 were higher when co-cultured with feeder cells into which the mbIL-21/4-1BBL gene and three genes, mTNF-α/mbIL-21/4-1BBL, were introduced compared to the condition in which the gene was not introduced. The expression of other active markers, NKp30, NKp44, and NKp46, was highly expressed without variations between donors. Therefore, it was confirmed that the double and triple transgene feeder cells are useful feeder cells capable of increasing the activity of NK cells and tumor targeting (FIGS. 6a to 6g).


In addition, as a result of confirming the phenotype of co-cultured natural killer cells by restimulation using the Hut78 cell lines into which the three genes, mTNF-α/mbIL-21/4-1BBL, were introduced, the expression of active markers, such as NKG2D, NKp44, NKp46, DNAM-1, and CXCR3, showed a tendency to decrease when cultured under the condition of being restimulated 4 times rather than 1 time. Through this, it was confirmed that as the number of restimulation increases, the culture period lengthens and may affect the expression level of some active markers (FIGS. 7a to 7b).


Experimental Example 4. Confirmation of Cell Killing Ability of Natural Killer Cells According to the Transgene and Co-Culture of T Cells

1×106 K562 cancer cell lines were placed in a 15 mcustom-character tube and centrifuged. The cell pellet was suspended in RPMI1640 medium to which 1 mcustom-character of 10% (v/v) FBS was added. Then, 30 μcustom-character of 1 mM Calcein-AM (Molecular probe, C34852) was added, and then the light was blocked with foil, and it was stained for an hour in an incubator at a temperature condition of 37° C.


Tumor cell lines after Calcein-AM staining were washed by adding 10 mcustom-character to 15 mcustom-character of RPMI1640 medium to which 10% (v/v) FBS was added and centrifuged, and then the pellet was suspended in 10 mcustom-character of RPMI1640 medium to which 10 %(v/v) FBS was added to reach a concentration of 1×105 cells/mcustom-character. For natural killer cells, 1×106 cells were placed in a 15 mcustom-character tube and centrifuged, and the pellet was suspended in RPMI1640 medium to which 10% (v/v) FBS was added at the desired ratio (1:1) compared to the K562 cancer cell line. 100 μcustom-character of each of the prepared K562 cancer cell line and the natural killer cell line were mixed and divided into a round-bottom 96-well plate (96-well U-bottom plate, Nunc, 163320), and each well was prepared in triplicate to obtain an average value.


100 μcustom-character of the stained K562 cancer cell line was added to each Spon (Spontaneous release) well and 100 μcustom-character of RPMI1640 medium to which 10% (v/v) FBS was added was inserted to each. 100 μcustom-character of the stained K562 cancer cell lines was added to each Max (Maximum release) well and 100 μcustom-character of triple distilled water to which 2% (v/v) Triton-X 100 was added was inserted to each.


In order to correct auto-fluorescence present in RPMI1640 medium to which 10% (v/v) FBS was added and RPMI1640 medium to which 2% (v/v) Triton-X 100 was added, a medium value was prepared by adding 200 μcustom-character of RPMI1640 medium to which 10% (v/v) FBS was added, and 100 μcustom-character of RPMI1640 medium to which 2% (v/v) Triton-X 100 was added was added to 100 μcustom-character of RPMI1640 medium to which 10% (v/v) FBS was added to prepare the value of the mixture of the two solutions. The auto-fluorescence value was corrected by adding the difference (A) obtained by subtracting the value of the mixture from the medium value to the Max (Maximum release) value.


After blocking the light and reacting for 4 hours in an incubator at a temperature condition of 37° C., the plate was centrifuged at 2,000 rpm for 3 minutes. The supernatant was divided into 100 μcustom-character on a 96-well black plate (Nunc, 237108). The fluorescence value (OD480/535 nm) was measured using a fluorescent plate reader (Perkin Elmer, VICTOR X3), and the tumor cell killing ability of natural killer cells was calculated using Equation II below.





% of killing=(Sample well average fluorescence value−Spon well average fluorescence value)/{(Max well average fluorescence value+A)−Spon well average fluorescence value}×100   [Equation II]


Natural killer cells cultured with various feeder cells were reacted with K562 cancer cell lines to measure the direct cell killing ability. As a result, for all feeder cells, the cell killing ability of natural killer cells cultured under the conditions in which the mbIL-21/4-1BBL gene and the mTNF-α/mbIL-21/4-1BBL gene were introduced was increased compared to the condition in which the gene was not introduced (FIGS. 8a to 8d).


The cell killing ability of natural killer cells according to the number of restimulations of HuT78 cell lines into which the mTNF-α/mbIL-21/4-1BBL gene was introduced exhibited a high killing ability up to 60 days of culture without significant difference (FIG. 8e).


Through this, it was confirmed that compared to feeder cells without genes introduced, feeder cells into which the mbIL-21/4-1BBL gene or mTNF-α/mbIL-21/4-1BBL gene was introduced can be used usefully for in vitro expansion culture of high-purity natural killer cells having high activity as well as excellent cell killing ability.


Embodiment 4. Animal Experiment
Embodiment 4.1. Culture of Natural Killer Cells Using Transgenic T Feeder Cells

When culturing natural killer cells, 500 or 1000 IU/mL of IL-2 (2 (Proleukin Injection, Novartis Korea) and 10 ng/mL of OKT-3 (eBioscience, 16-0037-85) were placed in a culture plastic plate, and on day 0 of cultivation, CD3(−) cord blood mononuclear cells or peripheral blood mononuclear cells and transgenic T cells were added at a ratio of 1:2.5, CellGro medium containing 2% (v/v) human plasma was added, and stationary culture was carried out for 4 days in an incubator at 37° C. 1000 IU/mL of IL-2 was used for cord blood mononuclear cells and 500 IU/mL for peripheral blood mononuclear cells.


Thereafter, the cultivation of cord blood-derived natural killer cells was carried out by the following procedure: On the 4th day of cultivation, after adding the same amount of CellGro medium containing 1 v/v % human plasma and 1000 IU/mL of IL-2, stationary culture was carried out again. Then, the number of cells was measured at intervals of 2 to 3 days, CellGro medium containing 1 V/V % human plasma and 1000 IU/mL of IL-2 was added to reach 1×106 cells/mL, and it was cultured until the 14th day. On the 14th day of cultivation, transgenic T feeder cells were restimulated at a ratio of 1:2.5 and cultured in CellGro medium containing 1 V/V % human plasma, OKT3, and IL-2. Then, the number of cells was measured at intervals of 2 to 3 days, CellGro medium containing 1 V/V % human plasma and 1000 IU/mL of IL-2 was added to reach 1×106 cells/mL, and it was additionally cultured for 14 days, culturing cells for a total of 28 days.


Thereafter, the cultivation of peripheral blood-derived natural killer cells is as follows: On the 4th day of cultivation, after adding the same amount of CellGro medium containing 1 V/V % human plasma and 500 IU/mL of IL-2, stationary culture was carried out again. Then, the number of cells was measured at intervals of 2 to 3 days, CellGro medium containing 1 V/V % human plasma and 500 IU/mL of IL-2 was added to reach 1×106 cells/mL, and it was cultured until the 11th day. On the 11th day of cultivation, transgenic T feeder cells were restimulated at a ratio of 1:2.5 and cultured in CellGro medium containing 1 V/V % human plasma, OKT3, and IL-2. Then, the number of cells was measured at intervals of 2 to 3 days, CellGro medium containing 1 V/V % human plasma and 1000 IU/mL of IL-2 was added to reach 1×106 cells/mL, and it was additionally cultured for 8 to 10 days, culturing cells for a total of 19 to 21 days.


The cultured cells are suspended in a freezing medium to reach 1×106 cells/mL, frozen using a temperature-controlled cell freezer, and stored in liquid nitrogen.


As a result of comparing the proliferation rate of cultured natural killer cells, CB-enFeeder proliferated approximately 80,000 times and PBMC-enFeeder proliferated 50,000 times, showing no significant difference (Table 21).












TABLE 21







Average
STDEV




















CB-enFeeder
79288.3
37381.0



PBMC-enFeeder
53649.3
16827.9










Embodiment 4.2. Efficacy Evaluation of the Raji Animal Model

For the Raji-luci cell lines, cancer cells were collected on the last day of culture, the cell concentration was adjusted to 5×105 cells/mL using PBS, and then 0.2 mL (1×105 cells/mouse) per mouse was injected into the tail vein. Natural killer cells were injected into the tail vein at 2×107 cells/200 μL, and Rituxan (hereinafter RTX, Mabthera Injection, Roche Korea) was diluted to a concentration of 0.01 μg/100 μL using PBS and 100 μL was injected under the skin of the weakened area between the scapular region and the chest wall of the mouse. NK cells were administered a total of 6 times to the tail vein using a fixator the day after cancer cell transplantation, and RTX was administered once under the skin (Table 22, FIG. 9a).













TABLE 22









Number of


Group
Average
Administration
Volume (μl)
animals







1
Frozen culture medium + IgG 0.01 μg/head
i.v + s.c
200 + 100
10


2
RTX 0.01 μg/head
s.c
100
10


3
PBMC-enFeeder NK 2 × 107 cells/head
i.v
200
10


4
CB-eFeeder NK 2 × 107 cells/head
i.v
200
10


5
PB-eFeeder NK + RTX
i.v + s.c
200 + 100
10


6
CB-eFeeder NK + RTX
i.v + s.c
200 + 100
10









The observation of all animals was carried out twice a day and general symptoms and dead animals were observed, and after observing the death status, the median survival time of the frozen medium control group, natural killer cells, and RTX-treated group was calculated to evaluate the effect of prolonging the viability. After transplantation of the Raji-luci cell line, dead animals were observed over 26 to 122 days in two types of groups, natural killer cells and RTX alone and co-administration, and the median survival time until the last day (day 122) was 48.5 days, 43 days, and 47 days in the group administered with RTX, PBMC-enFeeder, and CB-enFeeder alone compared to 30 days for the frozen medium control group. The median survival time in the PBMC-enFeeder+RTX and CB-enFeeder+RTX co-administration group was shown to be at least 55 days and 75.5 days (Table 23, FIG. 9b).















TABLE 23





Raji-
Frozen



RTX +
RTX +


luci
culture

PBMC-
CB-
PBMC-
CB-


model
medium
RTX
enFeeder
enFeeder
enFeeder
enFeeder







Average
29.5
48.5
43
47
55
75.5


survival


rate









Embodiment 4.3. Efficacy Evaluation of the Ramos Animal Model

For the Ramos cell lines, cancer cells were collected on the last day of cultivation, the cell concentration was adjusted to 5×106 cells/mL using PBS, and then 0.2 mL (1×106 cells/mouse) per mouse was injected into the tail vein. Natural killer cells were injected into the tail vein at 2×107 cells/200 μL, and RTX was diluted to a concentration of 0.03 μg/100 μL using PBS and 100 μL was injected under the skin of the weakened area between the scapular region and the chest wall of the mouse. Natural killer cells were administered a total of 6 times to the tail vein using a fixator from the fourth day of cancer cell transplantation, and RTX was administered 6 times to the tail vein from the third day of cancer cell transplantation (Table 24, FIG. 10a).













TABLE 24









Number of


Group
Amount
Administration
Volume (μl)
animals







1
Frozen culture medium + IgG 0.3 μg/head
i.v + i.v
200 + 100
10


2
RTX 0.3 μg/head
i.v
100
10


3
PBMC-enFeeder NK 2 × 107 cells/head
i.v
200
10


4
CB-eFeeder NK 2 × 107 cells/head
i.v
200
10


5
PB-eFeeder NK + RTX
i.v + i.v
200 + 100
10


6
CB-eFeeder NK + RTX
i.v + i.v
200 + 100
10









The observation of all animals was carried out twice a day and general symptoms and dead animals were observed, and after observing the death status, the median survival time of the frozen medium control group, natural killer cells, and RTX-treated group was calculated to evaluate the effect of prolonging the viability. After transplantation of the Ramos cell line, dead animals were observed over 34 to 110 days in two types of groups, natural killer cells and RTX alone and co-administration, and the median survival time until the last day (day 124) was 49.5 days, 42 days, and 42.5 days in the group administered with RTX, PBMC-enFeeder, and CB-enFeeder alone compared to 31 days for the frozen medium control group. The median survival time in the PBMC-enFeeder+RTX and CB-enFeeder+RTX co-administration group was shown to be at least 63.5 days and 87.5 days (Table 25, FIG. 10b).















TABLE 25






Frozen



RTX +
RTX +


Ramos
culture

PBMC-
CB-
PBMC-
CB-


model
medium
RTX
enFeeder
enFeeder
enFeeder
enFeeder







Average
31
49.5
42
42.5
63.5
87.5


survival


rate









As described above, specific parts of the present invention have been described in detail, and it is obvious to a PHOSITA that these specific technologies are only preferred embodiments, and the scope of the present invention is not limited thereto. Accordingly, it will be considered that the substantial scope of the present invention is defined by the appended claims and their equivalents.

Claims
  • 1. A method for culturing natural killer cells comprising a step for co-culturing transformed CD4+ T cells and seed cells.
  • 2. The method for culturing natural killer cells of claim 1, wherein the transformed CD4+ T cells express one or more of 4-1BBL, mbIL-21, OX40L, and mTNF-α.
  • 3. The method for culturing natural killer cells of claim 2, wherein the 4-1BBL gene product comprises the amino acid sequence of SEQ ID NO: 1.
  • 4. (canceled)
  • 5. The method for culturing natural killer cells of claim 2, wherein the mbIL-21 gene product comprises the amino acid sequence of SEQ ID NO: 3.
  • 6. (canceled)
  • 7. The method for culturing natural killer cells of claim 2, wherein the OX40L gene product comprises the amino acid sequence of SEQ ID NO: 5.
  • 8. (canceled)
  • 9. The method for culturing natural killer cells of claim 2, wherein the mTNF-α gene product comprises the amino acid sequence of SEQ ID NO: 8.
  • 10. (canceled)
  • 11. (canceled)
  • 12. The method for culturing natural killer cells of claim 1, wherein the CD4+ T cells express 4-1BBL or mbIL-21.
  • 13. The method for culturing natural killer cells of claim 1, wherein the CD4+ T cells express 4-1BBL and mbIL-21.
  • 14. The method for culturing natural killer cells of claim 1, wherein the CD4+ T cells express 4-1BBL, mbIL-21, and mTNF-α.
  • 15. The method for culturing natural killer cells of claim 1, wherein the CD4+ T cells express 4-1BBL, mbIL-21, OX40L, and mTNF-α.
  • 16. (canceled)
  • 17. The method for culturing natural killer cells of claim 1, wherein the seed cells are mononuclear cells derived from cord blood.
  • 18. The method for culturing natural killer cells of claim 1, wherein the seed cell is the cell from which CD3(+) cells have been removed.
  • 19. The method for culturing natural killer cells of claim 1, wherein the cultivation is performed by mixing the transformed CD4+ T cells and seed sells at a ratio of 0.1:1 to 50:1.
  • 20. The method for culturing natural killer cells of claim 1, wherein the seed cells are mixed once with the support cells and cultured for 5 to 60 days, or mixed with the support cells at least twice and cultured for at least 60 days.
  • 21. The method for culturing natural killer cells of claim 1, wherein the cultivation is performed in a medium containing an anti-CD3 antibody and interleukin protein.
  • 22. The method for culturing natural killer cells of claim 21, wherein the anti-CD3 antibody comprises any one selected from the group composed of OKT3, UCHT1, and HIT3a.
  • 23. The method for culturing natural killer cells of claim 21, wherein the interleukin protein comprises any one selected from the group composed of IL-2, IL-12, IL-15, IL-18, and IL-21.
  • 24. A natural killer cell produced by the method of culturing natural killer cells of claim 1.
  • 25. A composition for culturing natural killer cells comprising transformed CD4+ T cells as an active ingredient.
  • 26. The method for culturing natural killer cells of claim 25, wherein the transformed CD4+ T cells express one or more of 4-1BBL, mbIL-21, OX40L, and mTNF-α.
Priority Claims (2)
Number Date Country Kind
10-2018-0139722 Nov 2018 KR national
10-2019-0145068 Nov 2019 KR national
CROSS-REFERENCE TO RELATED APPLICATIONS

This application is a U.S. National Phase application of International Application No. PCT/KR2019/015469, filed on Nov. 13, 2019, which claims the priority of Korean Patent Application No. 10-2019-0145068 filed on Nov. 13, 2019, and Korean Patent Application No. 10-2018-0139722, filed on Nov. 14, 2018, the disclosures of which are incorporated by reference herein.

PCT Information
Filing Document Filing Date Country Kind
PCT/KR2019/015469 11/13/2019 WO