The contents of the electronic sequence listing (US62260_ST25.txt; Size: 13.6 KB; and Date of Creation: Nov. 22, 2017) is herein incorporated by reference in its entirety.
The present disclosure relates generally to the field of using circulating cell-free nucleic acids in a subject to identify and monitor a disease development in the subject.
The fundamental cause of a tumor or a cancer has been attributed to genetic alterations caused by hereditary or environmental factors. These genetic alterations, once ir-repaired or irreparable, will accumulate and eventually cause normal cells to become malignant cells. As a tumor or a cancer develops its own unique spectrum of genetic alterations; therefore, monitoring of the alterations can provide information about the tumor or the cancer.
Both normal and malignant cells undergo cycles of turnover where chromosomes of dead cells are fragmented and released into body fluids, for example blood circulation, as circulating cell-free nucleic acids. Sequencing of the chromosome fragments indicates that the circulating cell-free nucleic acids from the blood or serum of patients carry the genetic alterations from the original tumor or cancer.
The conventional design of using host genome sequences containing specific genetic alterations as indicators for capturing tumor/cancer-specific nucleic acid sequences from total circulating cell-free nucleic acids works for an advanced tumor/cancer, where the tumor/cancer is sufficiently lame and a significant amount of tumor/cancer-specific nucleic acid sequences (more than 5% of total circulating nucleic acids) is released into the circulation. Given its limited amount (0.01% to 1% in total blood), the circulating cell-free nucleic acids is hard to detect even in the advanced tumor/cancer. As a result, for early or intermediate stage of the tumor/cancer, the proportion of the tumor/cancer circulating cell free nucleic acids is too low to be reliably detected. Moreover, tumor/cancer-specific mutations are usually single-base mutations, small insertions or deletions which are very difficult to be separated from nucleic acid sequences without such mutations released from the non-tumor/cancer somatic cells. In other words, not all circulating cell free nucleic acids bear the altered genetic information; most of the circulating cell free nucleic acids is unaltered and from host genome.
Conventional approach for cancer/'tumor nucleic acid detection sampled from genomic DNA. Murakami et al. presented an approach to detect HBV DNA in liver and peripheral blood mononuclear cells (Murakami, Y., Minami, M., Daimon, Y., & Okanoue, T. (2004). Hepatitis B virus DNA in liver, serum, and peripheral blood mononuclear cells after the clearance of serum hepatitis B virus surface antigen. Journal of medical virology 72(2), 203-214.). In this approach, Alu-PCR were used to detect covalently closed circular HBV DNA, HBV core DNA, HBV S DNA, and HBV X DNA in genome DNA extracted from peripheral blood mononuclear cells and liver tissue. The product of Alu-PCR was sequenced to determine the presence of above targets. In this approach, known HBV DNA regions from patient's genome were amplified by PCR and sequenced.
For the ex-vivo detection of HBV DNA integration, Lin et al. presented an approach to detect HBV DNA integration sites in liver cancer cell lines (Lin, S., Jain, S., Block, T., Song, F., & Su, Y. H. (2013). Detection of clonally expanded HBV DNA integration sites as a marker for early detection of HBV related HCC.). Lin et al. disclosed a target enrichment assay and cloned DNA constructs to identify known HBV DNA integration sites in Hep3B cell line. The HBV DNA containing nucleotide position 1571 to 1960 were captured by biotinylated HBV RNA baits and cloned, and each of the clones were sequenced. In this approach, known HBV DNA integrations sites in Hep3B cell line were detected from cloning and sequencing.
Implementations of the present technology will now be described, by way of example only, with reference to the attached figures. The aspect of the present disclosure can be better understood with reference to the following figures. The components in the figures are not necessarily drawn to scale with the emphasis instead being placed upon clearly illustrating the principles of the present disclosure.
It will be appreciated that for simplicity and clarity of illustration, where appropriate, reference numerals have been repeated among the different figures to indicate corresponding or analogous elements. In addition, numerous specific details are set forth in order to provide a thorough understanding of the embodiments described herein. However, it will be understood by those of ordinary skill in the art that the embodiments described herein can be practiced without these specific details. In other instances, methods, procedures and components have not been described in detail so as not to obscure the related relevant feature being described. The drawings are not necessarily to scale and the proportions of certain parts may be exaggerated to better illustrate details and features. The description is not to be considered as limiting the scope of the embodiments described herein.
Several definitions that apply throughout this disclosure will now be presented.
The term “coupled” is defined as connected, whether directly or indirectly through intervening components, and is not necessarily limited to physical connections. The connection can be such that the objects are permanently connected or releasably connected. The term “comprising,” when utilized, means “including, but not necessarily limited to”; it specifically indicates open-ended inclusion or membership in the so-described combination, group, series and the like.
The term “subject” refers to an object of studies or experimental samples, may include human, monkey, groundhog or any animal. The term “integration” or “integrant” is making up or being a part of a whole. The integrant herein means single nucleic acid base pair, a part of nucleic acid sequence, a fragment of nucleic acid sequence or a gene sequence from a viral chromosome embed in a host chromosome sequence. The term “junction” is a combination of a fragment of a viral chromosome sequence and a part of a host chromosome sequence. The term “read number” refers to the times of next generation sequencing (NGS) reads. Each NGS read is analyzed to see whether it contained junction sequences or not. The reads containing junction sequences are then assembled into the finalized junction sequences. Therefore, each finalized junction sequence is assembled by the NGS reads containing the same junction region, and the accumulated read number represents the number of reads assembled into that specific finalized junction sequence. The term “amount” means the relative quantification of copy numbers of the specific junction cfDNA fragment in subject serum or plasma. The specific junction sequences are obtained from NGS analyzed results. According to the sequence, the specific junction cfDNA fragment from serum or plasma are detected by droplet digital PCR (ddPCR) platform in absolute quantification which can estimate the concentration (copy numbers) of the specific junction cfDNA fragment in each milliliter serum or plasma.
The present disclosure is described in relation to the innovation of using circulating cell-free nucleic acids in a subject to identify and monitor a disease development in the subject.
Certain human tumors/cancers, for example hepatocellular carcinoma (HCC), are caused by chronic infection of hepatitis B virus (HBV). These tumors/cancers accumulate genetic alterations in their genomes. Among such alterations, a unique one is the integration of viral genome into the host genome, usually occurring in the early stage of infections. Superimposed upon these mutations are other somatic mutations that continue to occur and finally transform the cells to tumors/cancers.
As noted, when HCC cells turn over, fragmented genetic nucleic acids will be released into the body fluids, comprising blood, urine or interstitial fluid. Circulating cell free nucleic acids which floats freely in the circulatory system, for example blood circulation, usually comprises DNA fragments. These fragments include those from host genome, from viral genome, and/or from the viral integration sites, for example the viral-host junction.
Infected cells, for example HBV-infected hepatocytes, proliferate if they become cancerous and so is the amount of the viral integrants carried by the infected cells. The amount of viral integrants thus is in proportion to the size of tumor/cancer in general. In addition, as the viral integrates into the host genome at different sites, each tumor/cancer carries a unique spectrum of viral integration sites. The viral integration sites and/or the viral-host junction, are cancer/tumor-specific and can be used to identify and monitor the tumor/cancer development.
In one embodiment, human subjects are employed in the tests to illustrate the present invention. Subject 1 has a 12×10×9 (cm) tumor diagnosed by computer tomography. According to the histological report when Subject 1 is employed in this test, Subject 1 is defined as a Grade III HCC patient. Subject 2 has a 18×13.5×9 (cm) tumor diagnosed by computer tomography. According to the histological report, Subject 2 is defined as a Grade III HCC patient. Subject 3 has a 8×7.5×7 (cm) tumor identified by computed tomography. According to the histological report, Subject 3 is defined as a Grade III HCC patient. Subject 4 has a 2×2×2 (cm) tumor and is at Grade II. Subject 5 has a tumor smaller than 2×2×2 (cm) and the stage of the cancer development is not determined and/or not available at the time of test enrollment. Subject 6 is defined as a Grade III HCC patent, and has a tumor size of 9.1 cm3. Subject 7 is defined as a Grade II HCC patent, and has a tumor size of 11 cm3. Subject 8 has a tumor size of 3 cm3. Subject 9 has a tumor size of 11.58 cm3. Subject 10 has a tumor size of 4.6 cm3.
In another embodiment, multiple blood samples are obtained from human subjects. Each time, blood is drawn, collected in a clinically suitable container and, if needed, stored in a suitable condition for later analysis. Each blood sample is processed to obtain serum, such as by centrifugation. The cfDNA can be extracted by using a commercial kit, comprising MagNA Pure LC Total Nucleic acid Isolation kit (Roche). The tumor tissues are obtained. Genomic DNAs of tumor cells are extracted.
In another embodiment, in order to proportionally amplify the all ctDNA obtained from the human subject, the ctDNA can be attached or ligated with at least one adaptor to at least one end or both ends of the ctDNA. The ligating at least one adaptor to at least one end or both ends of the ctDNA can be performed by using TruSeq DNA Sample Preparation (Illumina), TruSeq Nano DNA LT Library Preparation Kit (Illumina), IonTorrent (Life Technologies) or other equivalent reagents.
In another embodiment, after the ctDNA is ligated with at least one adaptor, each ctDNA in the sample from the human subject can be amplified by using TruSeq DNA Sample Preparation (Illumina), TruSeq Nano DNA LT Library Preparation Kit (Illumina). IonTorrent (Life Technologies) or other equivalent reagents.
In another embodiment, polynucleotides having HBV genome sequence are used as probes here. The probes can be either designed or synthesized from the fragmentation of HBV genome. The probes portfolio can be cover the whole HBV genome sequence. The whole HBV genome sequences can be obtained from the National Center for Biotechnology Information. The probes can be synthesized by using a commercial kit, comprising Ion TargetSeq Custom Enrichment Kit (Life Technologies). The length of the probes is synthesized in a range from about 20 bases to about 200 bases. The length of the probes is preferably synthesized in a range from about 50 bases to about 180 bases. After the synthesis of the probes, each probe can be labeled, comprising biotinylated, at least one end of the probe. Biotinylation of probes can be performed by using a commercial kit, comprising ruSeq Nano DNA LT Library Preparation Kit (Illumina), Ion TargetSeq Custom Enrichment Kit (Life Technologies) or other equivalent kit. The probes can be subsequently attached or linked to a bead, for example through biotin.
In another embodiment, the all amplified ctDNA are mixed and incubated with the beads coated with the biotinylated probes to allow hybridization between the ctDNA and the biotinylated probes. The certain ctDNA that have at least partial viral sequences anneal to the complementary sequences on the probes and can form a bead-probe-ctDNA complex. The other ctDNA that does not bind to the probes float freely and does not form any complex. The bead-probe-ctDNA complexes are separated from non-binding ctDNA by, for example, centrifugation. The bead-probe-ctDNA complexes are obtained. After the bead and the probe are removed from the bead-probe-ctDNA complexes, target ctDNA can be collected. Capturing of the ctDNA hybridized with the probes can be performed by using TargetSeq Hybridization & Wash Buffer Kit (Life Technologies) or other equivalent kit.
In another embodiment, in order to sequence and identify the target ctDNA. The target ctDNA can be further sequenced using lonTorrent platform, HiSeq 2500 (Illumina) or other equivalent sequencing platform.
In another embodiment, the copy number of specific target ctDNA junctions are quantified by BIO-RAD Eva Green Droplet Digital PCR kit. The copy number of each of the specific target ctDNA junction in the subject can be determined. Other equivalent DNA quantification kits can also be used.
Referring again to
The amplified cfDNA can be categorized into cfDNA having only host genome sequences (cfDNA D), cfDNA having only viral genome sequences (not shown), and cfDNA having both viral and host genome sequences and thus comprising viral-host junctions 22 (cfDNA A, B, and C). According to a preferred approach, all amplified cfDNA are incubated with polynucleotide probes 23 (designed and derived from the viral genome sequence) to allow hybridization to occur. It is to be noted that the polynucleotide probes 23 may have different sequences even though all drawn alike. Referring again to
Table 1 shows top ten target sequences identified in the DNA samples obtained from Subject 1 tumor tissue. As shown, a junction sequence is inserted into the host chromosome (Host Chromosome #) at a specific integration position (Integration Position) with an accumulated read number (Accumulated Reads). Accumulated read number is obtained by NGS sequencing result. Sequences having the same junction are counted to give the number of the junction present in the sample. Each sequence includes at least partial viral chromosome sequence (underlined) and a partial host chromosome sequence to form a viral-host junction.
GGTCTTACATAAGAGGACTCAGAAAATACTTT
GTCCCCAG
GTAAGACC
GGGATAGG
AGTTGGGG
AGCAGGAAAATATATGCCCCACCTTCCCTTTC
AGGAAGACTGCCTACTCCCACAGGCCTGAAAG
GGCACATTG
GCATTTGGTGGTCTATAAGCACACCCGCCCAC
AGGTGGAGA
Table 2 shows the target sequences identified in the ctDNA samples obtained from the serum of Subject 1. The ctDNA samples are obtained from Subject 1 13 days before a tumor excision. As shown, each sequence contains at least partial viral chromosome sequence (underlined) and a partial host chromosome sequence to form a viral-host junction.
CAGGGTCCCC
ATGTAAGACC
AACAGAAAGATTCGTCCCCAAATCCAATCT
AGCAGGAAAATATATGCCCCACCTTCCCTT
GGTCTTACATAAGAGGACTCAGAAAATACT
GCATTTGGTGGTCTATAAGCACACCCGCCC
ATCATCCTGGGCTTTCTGCACTTCCCATAG
GGGCACATTG
As illustrated in Tables 1 and 2, at least #3 (from tumor sample) and #12 (from serum sample), #1 (from tumor sample) and #15 (from serum sample), and #2 (from tumor sample) and #11 (from serum sample) each pair have the same viral-host junction sequences. Similar patterns (including the relative read numbers) of viral-host junction sequences identified in both tumor DNA and ctDNA indicate that chimera ctDNA in serum is derived from tumor DNA. By selectively enriching the ctDNAs carrying at least a portion of the viral genome in the serum, viral-host junctions are identified to provide tumor-specific information about the subject.
Table 3 shows the target sequences identified in the DNA samples obtained from Subject 2 tumor tissue. As shown, each sequence contains at least partial viral genome sequence (underlined) and partial host genome sequence and forms a viral-host junction.
TGACTTCTTTCCTTCTATTCGAGATCTCCT
GATATGTAATTGGAAGTTGGGGTACTTTACC
CAGAGTATGTAAATAATGCCTAGTTTTGAA
CAGCCTCCTAGTACAAAGACCTTTAACCTA
GGACAAACGGGCAACATACCTTGGTAGTCC
AAGGAACCTCTATGTTTCCCTCTTGTTGCT
GGCCAGATTCATCAACTCACCCCAACACAG
ATTGGTAATAGAGGGTAAAAAGGGACTCAAG
TGTGGATTCGCACTCCTCCCGCTTACAGAC
GCCTCCTAGTACAAAGACCTTTAACCTAAT
Table 4 shows the target sequences identified in the ctDNA samples obtained from serum of Subject 2. Serum samples are obtained from Subject 2 at tumor excision. As shown, each sequence contains at least partial viral genome sequence (underlined) and partial host genome sequence and forms a viral-host junction.
ACTTCTTTCCTTCTATTCGAGATCTCCT
CCAGATTCATCAACTCACCCCAACACAG
ACAAACGGGCAACATACCTTGGTAGTCC
GACAAACGGGCAACATACCTTGGTAGTC
CGCTTACAGACCACCAAATGCCCCTATC
ATGTAATTGGAAGTTGGGGTACTTTACC
TGGATTCGCACTCCTCCCGCTTACAGAC
GGAACCTCTATGTTTCCCTCTTGTTGCT
GGAACCTCTATGTTTCCCTCTTGTTGCT
GCCTCCTAGTACAAAGACCTTTAACCTA
As illustrated in Tables 3 and 4, at least #1 (from tumor sample) and #11 (from serum sample), #7 (from tumor sample) and #12 (from serum sample), and #5 (from tumor sample) and #3 (from serum sample) both have the same viral-host junction sequences. Similar patterns of viral-host junction sequences identified in both tumor DNA and ctDNA show that chimera ctDNA in serum is derived from tumor DNA. By selectively enriching the target ctDNA in the serum, viral-host junctions are identified to provide tumor-specific information about the subject.
Table 5 shows the target sequences identified in the DNA samples obtained from Subject 3 tumor tissue. As shown, each sequence contains at least partial viral genome sequence (underlined) and partial host genome sequence and forms a viral-host junction.
CAGGACTCCTAGGACCCCTGCTCGTGTTACA
GGCGGGG
ACAGTCCCCCGTGGGGAGGGGTGAACCCTGG
CCCGAAT
TCCCCAATCCCCTGGGATTCTTCCCCGATCA
TCAGTTG
GCAGCTCCTCCTCCTGCCTCCACCAATCGGC
AGTCAGG
AGATTCCCGAGATTGAGATCTTCTGCGACGC
GGCGATT
ATATGTTCCTGTGGCAATGTGCCCCAACTCC
CAATTAC
GGTGGTTTCCATGCGACGTGCAGAGGTGAAG
CGAAGTG
GTGGTATTGTGAGGATTTTTGTCAACAAGAA
AAACCCC
TGCTCGGCAACGGCCTGGTCTGTGCCAAGTG
TTTGCTG
CTCCTCCTCCTGCCCTCCACCAATCGGCAGT
CAGGAAGG
Table 6 shows the target sequences identified in the ctDNA samples obtained from serum of Subject 3. Serum samples are obtained from Subject 3 at tumor excision. As shown, each sequence contains at least partial viral genome sequence (underlined) and partial host genome sequence and forms a viral-host junction.
GGACTCCTAGGACCCCTGCTCGTGTTACAGGC
GGGG
AGTCCCCCGTGGGGAGGGGTGAACCCTGGCCC
GAAT
TATATGGATGATGTGGTATTGGGGGCCAAGTC
TGTA
TCTCATGTTCATGTCCTACTGTTCAAGCCTCC
AAGC
GTTCATGTCCTACTGTTCAAGCCTCCAAGCTG
TGCC
CTCAATCGCCGCGTCGCAGAAGATCTCAATCT
CGGG
TCGCCTCGCAGACGAAGGTCTCAATCGCCGCG
TCGC
TTGGCGAGAAAGTAAAAGCCTGTTTTGCTTGT
ATAC
CACTCCAAAAGACACCAAATATTCAAGAACAG
TTTC
TCTCATGTTCATGTCCTACTGTTCAAGCCTCC
AAGC
As illustrated in Tables 5 and 6, similar patterns of viral-host junction sequences identified in both tumor DNA and ctDNA show that ctDNA in serum is derived from tumor DNA. By selectively enriching the target ctDNA in the serum, viral-host junctions are identified to provide tumor-specific information about the subject.
GGTCTTACATAAGAGGACTCAGAAAATACTTTGTGATGAT
ACTTCAAAGACTGTGTGTTTCTAATTATTTTGGGGGACAT,
GTAGGCATAAATTGGTCTGTACCTCACTTCCCTGCTTTCC.
The presence of the three specific viral-host junctions is determined in the tumor gDNA (T) and non-tumor gDNA (N). Porphobilinogen deaminase (PBGD) and miR-122 are used as internal control. No-template control (NTC) is also included. As illustrated in
After accumulating read number of junction sequences in patient's serum or plasma in Table 2, 4 and 6, the junction sequence in each of the subjects with the most read number are selected to analyze the concentration of specific viral-host junction sequence in patient's serum or plasma. The specific viral-host junction sequence, and its' read number are identified in Subject 8, 9 and 10 by similar methods conducted in Table 2, 4 and 6. To determine the concentration of the specific viral-host sequence in Subject 8, 9 and 10, the plasma samples are analyzed with BIO-RAD Eva Green droplet digital PCR kit. Each samples diluted and the diluted samples are mixed with a reaction mix containing one or more fluorescence dyes and other reagents, the sample-reaction mix are then subjected QX2000™ Droplet Generator to generation a plurality of small droplets. The droplets are then transferred to C1000 Touch™ Thermal Cycler to conduct polymerase chain reaction. Finally, the QX2000™ Droplet Reader is used to quantify fluorescence signals presented. The fluorescence signal indicated by QX2000™ Droplet Reader provides absolute quantifications of the specific viral-host junctions.
Table 7 shows the information of Subject 8, 9 and 10, including the gender, age, tumor size and ctDNA junction concentration.
The above results from Subject 8, Subject 9 and Subject 10 suggest a relationship of tumor size. The copy number of specific viral-host junctions can be inferred. The tumor size is positively correlated to the concentration of ctDNA junctions. The larger tumor size represents higher copy number of ctDNA junction in patient's blood. The presence of ctDNA junction in patient's serum or plasma can be indicative of tumor status. Specifically, the copy number of ctDNA junction in patient's blood can be used to monitor the size of tumor within one patient when evaluating the prognosis after the surgical removal, radiotherapy, chemotherapy or other therapeutic approach on the tumor. The copy number of ctDNA junction in patient's blood can also be used to assess the size of tumor when diagnosing the tumor status. The ctDNA junction concentration in the plasma or serum of more than 30 copies per milliliter of plasma or serum may represent a tumor size of more than 4.6 cm3. The relationship between the ctDNA junction concentration in the plasma or serum and the tumor size may be an exponential function or a linear function.
The read number of ctDNA junction in patient's serum or plasma provides a non-invasive diagnosis for tumor. Therefore, the read number of ctDNA junction can be used to diagnose the presence of tumor to a patient with hepatitis-B virus infection, or to evaluate the tumor status before surgical removal, radiotherapy, chemotherapy of other therapeutic approach on the tumor. The read number of ctDNA junction in patient's blood can also be used to assess the presence and the size of tumor.
It is to be noted that by using the approach described in the present invention, mutated p53 or beta-catenin genes cannot be detected in the ctDNAs despite the mutations are identified in the tumor tissues (data not shown). The result shows that by using the method of present invention, tumor specific viral-host junctions (viral genome sequence insertion into host genome), and not conventional somatic mutations, are selectively enriched and obtained to provide cancer/tumor information.
The embodiments shown and described above are only examples. Many details are often found in the art for example the other features of a circuit board assembly. Therefore, many such details are neither shown nor described. Even though numerous characteristics and advantages of the present technology have been set forth in the foregoing description, together with details of the structure and function of the present disclosure, the disclosure is illustrative only and changes may be made in the detail, including in matters of shape, size and arrangement of the parts within the principles of the present disclosure up to, and including the full extent established by the broad general meaning of the terms used in the claims. It will therefore be appreciated that the embodiments described above may be modified within the scope of the claims.
This application is a continuation-in-part of U.S. application Ser. No. 14/515,550, filed Oct. 16, 2014, which claims priority to U.S. Provisional Application No. 61/892,796, filed Oct. 18, 2013, and the contents of which are incorporated by reference herein.
Number | Date | Country | |
---|---|---|---|
61892796 | Oct 2013 | US |
Number | Date | Country | |
---|---|---|---|
Parent | 14515550 | Oct 2014 | US |
Child | 15821864 | US |