The response to an infection of an animal or the contamination of food by a microorganism, for example, a bacterium, requires the reliable and rapid identification of the microorganism. This is due to the speed of microbial proliferation and the necessity for quickly starting eradication of the microorganism and therapeutic maneuvers. Viewed in this context, methods that combine gene amplification technology, e.g., PCR, and hybridization have been proposed as methods for the identification of microorganisms from a sample test material. For example, a DNA microarray has been disclosed for carrying out the detection and identification of a specific bacterium using, as a target nucleic acid, a specific region of the 16S ribosomal RNA gene of the bacterium that is the detection target (Patent Document 1). In addition, the detection and identification of oral microbial species related to oral cavity diseases and the use of a DNA microarray for this detection and identification have also been disclosed (Non Patent Document 1). Thus, as shown in
Detection methods for single nucleotide polymorphism (SNP) typing using DNA microarrays are also known (Non Patent Document 2). As shown in
Hybridization is performed in the methods disclosed in Patent Document 1 and Non Patent Document 1 at a temperature lower than the usual temperatures (37° C. to 65° C.). Thus, hybridization is performed in the methods of Patent Document 1 and Non Patent Document 1 at a temperature of 37° C. to 50° C. for about 2 hours. Hybridization is performed for about 30 minutes at 37° C. in Non Patent Document 2.
Hybridization is run at low temperatures in Patent Document 1 and Non Patent Document 1 in order to increase the quantity of the hybrid formed by hybridization between the labeled probe and the specific-sequence oligonucleotide, but this also has the potential for causing mishybridization. The accuracy of identification may thus also be lowered. In addition, an examination of hybridization at higher temperatures generates the requirement for further examination of the hybridization conditions and probe design for this purpose.
The method disclosed in Non Patent Document 2 is a highly accurate SNP detection method free of mishybridization. However, the preparation of other types of probes is required and this is problematic for a rapid and convenient execution in the case of microbial contamination.
An object of the teaching in this Specification is to provide a rapid and highly accurate method of testing for a target nucleic acid and to provide an apparatus for use in this method.
The present inventors sought to improve the method disclosed in Non Patent Document 2 by reducing mishybridization and shortening the hybridization time for detecting a target nucleic acid. It was discovered as a result that the hybridization step could be sped up without using other types of primers by using a DNA fragment (chimeric DNA) acquired by preparing, for a prescribed region (target sequence) in a target nucleic acid, a primer containing a recognition sequence complementary to this probe sequence and a primer containing a tag sequence complementary to a preselected artificial sequence, annealing these primers, and thereafter ligating with a DNA ligase. The teaching of this Specification provides the following.
The teaching of this Specification provides a method of detecting or analyzing a target sequence in a genomic DNA by using a capture probe immobilized on a solid carrier, the method comprising:
bringing the target nucleic acid into contact with a first query probe that has a sequence complementary to a portion of the target sequence or to a sequence adjacent to the portion and a second query probe that has a sequence complementary to another portion of the target sequence or to a sequence adjacent to the another portion and a recognition sequence complementary to a portion of the capture probe;
acquiring a ligated molecule by ligating the first query probe and the second query probe that are hybridized to the target nucleic acid;
bringing the ligated molecule into contact with the capture probe on the solid carrier and than capturing the ligated molecule on the solid carrier by hybridizing the capture probe with the recognition sequence in the ligated molecule; and
detecting the captured ligated molecule.
The contacting step may use a plurality of the first query probes and a plurality of the second query probes in order to bring these probes into simultaneous contact with a plurality of the target nucleic acids. This method may, based on this plurality of target sequences, detect or identify a source organism or source organisms for a single type of genomic DNA or for two or more types of genomic DNAs.
In addition, labeling any selection from the group consisting of the first query probe, the second query probe, and the ligated molecule may be provided prior to the detecting step, and the detecting step may detect a signal based on this labeling. This labeling step may be a step in which labeling of the ligated molecule is carried out while amplifying the ligated molecule.
The ligated molecule acquisiting step may ligate the first query probe and the second query probe with a ligase. A DNA amplificating step may be provided prior to the contact step.
The genomic DNA may originate from any selection from viruses and microorganisms that are targets for diagnosis or testing in case of food sanitation and diseases, and the detection step may detect or identify the viruses or microorganisms.
The teaching of this Specification also provides a microarray that is used in the above-described method, the microarray being characterized in that the aforementioned capture probe immobilized in the microarray is composed of at least one of the aforementioned capture probes having any base sequence selected from the base sequences described in SEQ ID NOs: 1 to 100 and base sequences that are complementary to these base sequences.
The teaching in this Specification relates to a method of detecting or analyzing a target sequence in a genomic DNA using a capture probe immobilised on a solid carrier and further relates to an array for this method. In accordance with the teaching in this Specification, the time required in the hybridization step for detection of a nucleic acid in a particular genome and for sequence determination can be shortened and the nonspecific binding to the DNA microarray of a labeled nucleic acid in a particular genome can be reduced.
In the description that follows, a recognition sequence present in the second query probe and complementary to a portion of a capture probe is indicated by recognition sequence (−), while the sequence of the portion present in the capture probe (and complementary to the recognition sequence (−)) is indicated by recognition sequence (+).
According to the method disclosed in this Specification, the detection of the target sequence is performed substantially in the contact step and ligation step with the first query probe and second query probe for the target sequence. Thus, mishybridization in hybridization can be facilitated and its accuracy can be raised by carrying out hybridization between the capture probe and a ligated molecule obtained by ligation after contact by the first and second query probes with the target nucleic acid. According to this method, the capture probe used in hybridization is preferably not intrinsic to the target sequence. Accordingly, a recognition sequence specific to the capture probe used can, when mishybridization is effectively reduced under the prescribed conditions, effectively reduce mishybridization. Similarly, hybridization can be sped up when optimization for low temperature hybridization is performed.
An outline of the teaching of this Specification is shown in
In this Specification, “nucleic acid” encompasses all DNAs and RNAs including cDNA, genomic DNA, synthetic DNA, mRNA, total RNA, hnRNA, and synthetic RNA as well as artificial synthetic nucleic acids such as peptide nucleic acids, morpholino nucleic acids, methylphosphonate nucleic acids, 5-oligo nucleic acids, and so forth. The nucleic acid may be single stranded or double stranded. In this Specification, the “target nucleic acid” is any nucleic acid having any sequence. A typical example is a nucleic acid that can have a base sequence that forms a marker on a gene in a human or in a nonhuman animal for disease onset, disease diagnosis, treatment prognosis, drug selection, treatment selection, and so forth, with regard to health status, a genetic disease, a specific disease such as cancer, and so forth. This marker can be exemplified by a polymorphism, such as an SNP, or a congenital or acquired mutation. The target nucleic acid also encompasses nucleic acid of microbial origin, for example, from a pathogenic bacteria or a virus.
The sample test material, infra, or a nucleic acid fraction therefrom, may also be directly used as the target nucleic acid; however, the use is preferred of an amplification product provided by the amplification—preferably by a PCR amplification reaction and more preferably by a multiplex PCR amplification reaction—of all of a plurality of target nucleic acids.
In this Specification, “target sequence” refers to a characteristic sequence comprising one base or two or more bases in the target nucleic acid of the detection target. For example, it may be a partial sequence of low homology among target nucleic acids or may be a sequence having a low complementarity or homology with other nucleic acids that may be present in the sample. The target sequence may be a sequence characteristic of a target nucleic acid. In addition, it may be a sequence specific to a genus or species of an organism, for example, a microorganism. This target sequence may also be a target sequence with an artificially modified sequence.
The “sample test material” in this Specification is a sample that may contain a target nucleic acid. Any sample that contains a nucleic acid can be used as the sample, including cells, tissue, blood, urine, saliva, and so forth. A nucleic acid-containing fraction can be recovered from such samples by the individual skilled in the art with reference to the pertinent conventional art.
Embodiments of the present invention are described in detail herebelow with reference to the pertinent figures.
(Method for Detecting or Analyzing a Target Sequence in a Genomic DNA)
The method disclosed in this Specification for detecting or analyzing a target sequence may comprise: a step of bringing the aforementioned target nucleic acid into contact with a first query probe that has a sequence complementary to a portion of the target sequence or to a sequence adjacent to the portion and a second query probe that has a sequence complementary to another portion of the target sequence or to a sequence adjacent to the another portion and that has a recognition sequence (−) complementary to a recognition sequence (+) held by the aforementioned capture probe (the contact step); a step of acquiring a ligated molecule by ligating the first query probe and the second query probe that are hybridized to the target nucleic acid (the ligation step); a step of bringing the ligated molecule into contact with the capture probe on the solid carrier and then capturing the ligated molecule on the aforementioned solid carrier by hybridizing the capture probe with the recognition sequence (−) in the ligated molecule (the hybridization step); and a step of detecting the captured ligated molecule (the detection step).
The detection and analysis method disclosed in this Specification (referred to hereafter simply as the present method) uses a solid article on which a capture probe containing a specified recognition sequence (+) is immobilised. Accordingly, the preparation of the solid carrier is described first below followed by a description of each step in the present method.
(Preparation of the Solid Carrier)
The solid article 100 that is used for display by the present method may be prepared in advance prior to the execution of the present method, or may be commercially acquired, or may be prepared at each execution of the detection method.
The solid article 100 may comprise a solid carrier 102 provided thereon with a plurality of capture probes 104 that each contain a recognition sequence (+) that is a specific base sequence that differs thereamong. An examination of probe design and synthesis, array fabrication, and hybridization conditions can be circumvented by the preparation of such a solid article 100.
The capture probe 104 has a recognition sequence (+) that is a base sequence specific for each probing. This recognition sequence (+) can be designed independently from the characteristic sequence in the target nucleic acid 10, i.e., the target sequence 12. By carrying out this design independently from the target sequence 12, the recognition sequence (+) in a capture probe 104 can be designed so as to inhibit or avoid nonspecific binding among the plurality of capture probes 104 and can be designed taking into account optimal hybridization conditions, e.g., temperature and time, for the hybridization. Moreover, the same capture probe 104 can always be used regardless of the type of the target nucleic acid 10.
The recognition sequence (+) for a capture probe 104 can, for example, be suitably selected from the base sequences shown in
A suitable selection from such candidate base sequences can be used for the recognition sequence (+) of a capture probe 104. The melting temperatures for two or more types of capture probes 104 used are preferably as close as possible.
The melting temperature used can be calculated by, for example, the GC % method, Wallace method, and procedures in accordance with Current Protocols in Molecular Biology (described on page 25, Bio Experiments Illustrated 3, “Real Amplification by PCR”, Shujunsha Co., Ltd.), but calculation by the nearest neighbor method—which can incorporate the influence of the base sequence concentration and melting temperature range—is preferred in the present invention. The melting temperature by the nearest neighbor method can be readily obtained using Visual OMP software (Tomy Digital Biology Co., Ltd.) or software (OligoCalculator, http://www.ngrl.cojp/tool/ngrl_tool.html) provided by Nihon Gene Research Laboratories Inc. (http://www.ngrl.co.jp/).
The recognition sequence in this capture probe 104 could be an orthonormalized sequence and may be designed, for example, by carrying out calculation of the continuous match length versus DNA sequences of prescribed base length obtained from random numbers and calculation of the predicted melting temperature by the nearest neighbor method, the Hamming distance, and predicted secondary structures. Orthonormalized base sequences refer to base sequences that are nucleic acid base sequences that have a uniform melting temperature, i.e., are sequences designed to have melting temperatures that lie within a prescribed range; that do not inhibit hybrid formation with a complementary sequence through formation of an intramolecular structure by the nucleic acid itself; and that do not form stable hybrids except with base sequences complementary thereto. A sequence that is a member of a group of orthonormalized sequences resists reactions between sequences, except for a desired combination, and resists reactions within the sequence itself, or else does not engage in these reactions at all. In addition, an orthonormalized sequence, when amplified by PCR, has the property whereby nucleic acid in the amount corresponding to the initial amount of the nucleic acid having an orthonormalized sequence, undergoes quantitative amplification. The details of these orthonormalized sequences are described in H. Yoshida and A. Suyama, “Solution to 3-SAT by breadth first search”, DIMACS, Volume 54, 9-20 (2000) and Japanese Patent Application No. 2003-108126. Orthonormalized sequences can be designed using the methods described in these documents.
The capture probe 104 is immobilized on a carrier 102. A solid carrier is preferably used for this carrier 102. For example, the carrier 102 may be plastic or glass, but the material thereof is not particularly limited. The shape of the carrier 102 may be a flat plate shape as shown in
A preferred solid article 100 may be provided with an arrangement configuration in which two or more types of the capture probes 104 are arranged in a sequence that is based on their melting temperatures. For example, by using such a solid article 100 and assigning—along the sequence of the capture probes 104—two or more types of capture probes 104 that correspond to two or more types of target nucleic acids 10 that in turn correspond to two or more types of target sequences 12 that may be present relative to a certain site in a certain gene, the hybridization scatter originating in the immobilization positions of the capture probes 104 and differences in the melting temperatures of the recognition sequences of the capture probes 104, can be inhibited and the target nucleic acid(s) 10 in a sample can be accurately detected.
The mode of immobilisation of the capture probe 104 is not particularly limited. Covalent bonding or noncovalent bonding may be used. The capture probe 104 may be immobilised on the surface of the carrier 102 by various heretofore known methods. In addition, a suitable linker sequence may be provided to the surface of the carrier 102. The linker sequence preferably has the same base length and the same sequence among the capture probes 104.
(The Target Nucleic Acid Amplification Step)
The present method may be provided, prior to the contact step, with a step of amplifying the target nucleic acid in the sample test material. The implementation of an amplification step can speed up and increase the efficiency of the contact step and the ligation step. The amplification of a single target nucleic acid in the sample test material or two or more target nucleic acids in the sample test material can be carried out in the amplification step. Thus, the amplification step can be carried out, for example, by PCR, by suitably preparing primer sets in conformity to the types (number) of target nucleic acids to be amplified and/or detected.
(The Contact Step)
The contact step is a step of bringing the target nucleic acid into contact with a first query probe, which has a sequence complementary to a portion of a target sequence in a target nucleic acid or to a sequence adjacent to the portion, and a second query probe, which is provided with a sequence complementary to another portion of the aforementioned target sequence or to a sequence adjacent to the another portion and with a recognition sequence (−) complementary to a portion of the aforementioned capture probe. When a target nucleic acid is present in the sample test material, a target sequence in the target nucleic acid can be detected in the contact step by the first query probe and the second query probe. A first query probe and a second query probe are prepared for each target nucleic acid, i.e., for each target sequence. The contact step may also be a step in which a plurality of first query probes and a plurality of second query probes are used and a plurality of target nucleic acids are simultaneously brought into contact with these.
As shown in
A sequence used to provide a label in a later stage may be provided at the 5′ terminal side of the first query probe. For example, a prescribed sequence may be disposed in conformity to the type of dye.
The second query probe has a sequence complementary to another portion of the target sequence or to a sequence adjacent to this another portion. As shown in
The second query probe is provided with a recognition sequence (−) that is complementary to a portion (the recognition sequence (+)) of a capture probe 104. This recognition sequence (−) is correlated in advance with the recognition sequence (+) of a particular capture probe 104 immobilized on the solid carrier 102. The recognition sequence (−) is disposed at the 3′ terminal of the second query probe.
The conditions in the contact step are not particularly limited. An ordinary hybridization medium can be used. In order to anneal the first query probe and the second query probe to the target sequence, the target nucleic acid (which is ordinarily double-stranded) recovered from the sample test material must be heated and melted. Thus, the contact step may be accompanied by sufficient heating to achieve this melting. The annealing of these query probes to the target sequence is subsequently realized by lowering the temperature to a suitable temperature. In addition, the contact step need not be executed as an independent step and may be a part of the ligation step. Thus, the ligation step may be carried out at the same time as the contact step.
(the Ligation Step)
The ligation step is a step that provides a ligated molecule by ligating the first query probe and second query probe that have hybridized to a target sequence of a target nucleic acid. In this step, the first query probe and second query probe are ligated to each other while they reside in a state of hybridization to the target sequence. Generally, the 3′ terminal of the first query probe is ligated with the 5′ terminal of the second query probe through the action of a DNA ligase. The ligation step can be carried out in a state in which the annealed state by the query probes to the target sequence is maintained and under conditions in which the ligase used is functional. Thus, the contact step and ligation step can be executed as a single step by considering the annealing temperature and the ligation reaction temperature. When a heat-resistant ligase is used, these can easily be run as a single step.
(the Labeling Step)
The present method may be provided, prior to the detection step described below, with a step of labeling any selection from the group consisting of the first query probe, the second query probe, and the ligated molecule. The labeling of any of these provides the ligated molecule with a label and makes possible the detection of hybridization based on the detection in the detection step of labeling at a specific capture probe.
The label may be attached in advance to the first query probe or the second query probe, but the attachment of the label to the ligated molecule provides for a more efficient use of the label. A PCR-based amplification step can be used for attachment of the label. For example, as shown in
An appropriate selection from the heretofore known labels can be used as the label. The label may be any of various dyes, e.g., fluorescent substances that emit a fluorescent signal when the substance itself is excited, or may be a substance that, in combination with a second component, emits any of various signals by an enzymatic reaction or an antigen-antibody reaction. Fluorescent labels such as Cy3, Alexa555, Cy5, and Alexa647 are typically used. In addition, detection based on color generation, for example, by treatment with a substrate using the biotin/streptavidin HPR combination, may also be used.
(The Hybridization Step)
The hybridization step is a step of bringing the ligated molecule into contact with the capture probe 104 on the solid carrier and capturing the ligated molecule on the solid carrier by hybridization between the recognition sequence (+) in the capture probe 104 and the recognition sequence (−) in the ligated molecule. This step results in specific hybridization by the ligated molecule to a particular capture probe 104 based on pairing between the recognition sequences (+) (−), with the formation of a double strand. This makes possible as a result the detection of a target sequence that has been correlated in advance to a specific capture probe 104.
According to the present method, only in those instances in which a target nucleic acid is present in the sample test material does the synthesis occur of a ligated molecule having a recognition sequence (−) for a capture probe 104 that has been correlated in advance to the target nucleic acid, while a ligated molecule is not synthesized when the target nucleic acid is not present. In addition, the capture probe 104 is an artificial sequence for which mishybridization is strongly inhibited. Accordingly, the generation of mishybridization between a capture probe 104 and a ligated molecule is strongly inhibited in the hybridization step of the present method. A suitable washing step may also be incorporated after the hybridization step.
(the Detection Step)
The detection step is a step of detecting a ligated molecule that has been captured by a capture probe 104. There are no particular limitations on the method of detecting the hybridization product in the detection step. When the ligated molecule has a label, this label may be detected. In addition, double strand detection may be carried out by, for example, an electrical detection method.
The presence/absence and proportion of a target nucleic acid in a test sample can be detected by the detection in the detection step of, for example, a label. According to the present method, the target sequences that are the detection targets can be reliably detected even when detection is simultaneously performed on a plurality of target nucleic acids.
Known detection methodologies, e.g., chemical detection methodologies, electrical detection methodologies, and so forth, can be used as appropriate to detect the ligated molecule captured on the capture probe 104. The presence/absence and proportion of a target nucleic acid 10 can be elucidated from the signal strength information obtained by these detection methodologies.
According to the present method, a target sequence-containing DNA fragment (the ligated molecule) is acquired using a first query probe, which has a sequence complementary to a target sequence specific to a target nucleic acid that originates from a detection target, and using a second query probe, which contains a sequence complementary to a portion of this target sequence or to a sequence adjacent to this portion and which also contains a recognition sequence (−) that has been correlated in advance with a highly selective recognition sequence (+). This ligated molecule is then brought into contact with a capture probe that contains the recognition sequence (+) to form a hybridization product, which is detected. A ligated molecule is acquired selectively with respect to a target sequence in the contact step and ligation step in the present method, and the hybridization step just has to check for, with respect to the ligated molecule, the efficient and highly selective formation of a hybrid between the recognition sequences (+)(−). As a result, the present method can improve the accuracy of and time requirement for the hybridization step, which has heretofore been a bottleneck. In addition, the time and labor required for an examination of conditions can be eliminated in relation to the hybridization step.
As described above, starting from a nucleic acid, e.g., a DNA that is a test target, the source organism for this DNA can be identified using the present method. Accordingly, the present method is useful as a test method for checking for the presence/absence of various organisms that may be test targets. In particular, the present method is useful as a test method for, e.g., viruses and microorganisms that are test targets for food hygiene and safety and targets for disease diagnosis and testing.
(the Probe Set)
The teaching of this Specification provides a probe set comprising the previously described first query probe and second query probe. This probe set is used in combination with a solid article 100 on which a capture probe 104 is immobilised and is a probe set adapted for acquiring the previously described ligated molecule. The first query probe, for example, has a sequence complementary to a target sequence that enables the detection, relative to a single gene, of a mutation present in an individual or differences present in a species or genus and has a recognition sequence (−) correlated to a capture probe 104, while the second query probe has a sequence complementary to another portion of the target sequence or to a sequence adjacent to the another portion and has a recognition sequence (−) complementary to the recognition sequence (+) present in a preliminarily correlated capture probe. The probe set may comprise at least one such first query probe and second query probe or may comprise two or more types of probe sets in order to detect two or more types of target nucleic acids.
The present invention is specifically described below using an embodiment, but the present invention is not limited to the following embodiment.
A target sequence in a specified genome was detected and identified in this embodiment.
(1) Fabrication of the DNA Microarray
Using for the capture probe an aqueous solution prepared by dissolving a synthetic oligo DNA (Nihon Gene Research Laboratories Inc.) modified by the amino group at the 3′ terminal, a geneslide (Toyo Kohan Co., Ltd.) glass slide was spotted using a GENESHOT (registered trademark) spotter from NGK Insulators, Ltd. The synthetic oligo DNA sequences used were the 100 species D1—1 to D1—100 described in Supplementary Table 1 in the literature, Analytical Biochemistry, 364(2007) 78-85. (Table 1).
After each of these synthetic oligonucleotides had been spotted on a slide, baking was carried out for 1 hour at 80° C. The synthetic oligo DNA was then immobilized and washed using the following procedure. After baking, washing was carried out for 15 minutes with 2×SSC/0.2% SDS followed by washing for 5 minutes at 95° C. with 2×SSC/0.2% SDS. Washing was then carried out a total of 3 times with sterile water (shaking up and down 10 times), and liquid elimination was performed by centrifugation (1000 rpm×3 minutes).
(2) Amplification of the Target Nucleic Acid
Among the microbial species present in the oral cavity, Enterococcus faecalis and Pseudoramibacter alactolyticus were used as the detection target microorganisms. The following primers were used in order to amplify target nucleic acids originating with each of these microorganisms. These primers are designed to amplify a specific portion of the 16S rRNA gene region of these microorganisms.
PCR was run under the conditions given below on the DNA extracted from these microorganisms to obtain the following amplification products: sample 1 originating from Enterococcus faecalis and sample 2 originating from Pseudoramibacter alactolyticus. These samples were purified using a MinElute PCR Purification Kit from QIAGEN followed by confirmation that amplification had occurred for the intended length.
(3) Annealing to the Amplification Product and the Ligation Reaction
The query probes were then annealed to samples 1 and 2, which were the amplification products, and a ligation reaction was carried out. Taq DNA Ligase (Catalog #M0208S) from New England Biolabs was used for the ligation reaction. A GeneAmp PCR System 9700 from Applied Biosystems was used as the thermal cycler for heating. The first query probe and second query probe that were used are shown below. The 5′-phosphorylated second query probe was used in each case. Query 1-1 and query 2-1 are a probe set for amplifying the target nucleic acid in sample 1, while query 2-1 and query 2-2 are a probe set for amplifying the target nucleic acid in sample 2. The italicized letters in the first and second query probes refer to the sequence complementary to the target sequence. The underlining in the second query probe is a recognition sequence (−) for each of the preliminarily correlated capture probes.
CCGTGTCCACTCTAGAAAAACCT
TGACCACTC
CCGTGTCCACTCTAGAAAAACCT
TGAGCGCAA
TAGAGATA
GCAGATTCATTGGTCAGAGAACA
TAGAGATA
CATCTAAAGCGTTCCCAGTTCCA
Annealing and ligation were carried out as follows. After preparation of the reagent with the composition given below, heating was performed for 5 minutes at 95° C., 1 minute at 50° C., and then 60 minutes at 58° C., followed by a reduction to 10° C. Of the 15 samples obtained, a ligated molecule was made for each sample. The following three combinations were used for the amplification product sample: 3 μL sample 1+3 μL sterile water, 3 μL sample 2+3 μL sterile water, and 3 μL sample 1+3 μL sample 2.
(Reagent)
(4) Fluorescent Labeling of the Ligated Molecule
Fluorescent labeling of the ligated molecule was performed by carrying out PCR using a labeled primer. TaKaRa Ex Taq® (Catalog# RR001B) from Takara Bio Inc. was used for the labeling. The GeneAmp PCR System 9700 from Applied Biosystems was used for the thermal cycler. Here, the labeling reagent for the labeled primer can be matched to the specifications of the scanner, e.g., Cy3, 5, Alexa555, 647, and so forth.
The labeled primer and unlabeled primers shown in the table below were first prepared. The labeled primer has the same sequence as the 5′ terminal side of the first query probe of the ligated molecule, while the unlabeled primer has a sequence complementary to the recognition sequence (−) of the second query probe of the ligated molecule.
The labeling reaction was run by preparing the reagent shown below and then performing a thermal cycler reaction (1 minute/95° C., then 30 cycles of 30 seconds/95° C.→6 minutes/55° C.→30 seconds/72° C., then lowering to 10° C.) using this reagent.
(5) Hybridization using the DNA Microarray
The reaction with the DNA microarray using the labeled samples and the detection thereof were carried out using the following procedures. A labeled sample solution with the composition given below was first prepared and the prepared labeled sample solution was heated for 1 minute at 90° C. using a GeneAmp PCR System 9700 from Applied Biosystems and was then heated for 1 minute at 80° C. using a heating block (DTU-N from TAITEC). After the treatment, 9 μL of each labeled sample solution was applied to the spot area of a DNA microarray, and, using a Thermoblock Slide (eppendorf) for the comfort/plus to prevent drying, a hybridization reaction was run by standing for 60 minutes at 37° C.
(Preparation of the Labeled Sample Solution for Hybridization)
A wash solution with the composition given below was then prepared and washing was carried out. Thus, the wash solution was transferred to a glass staining tank; the glass slide was immersed after the completion of the hybridization reaction; and up-and-down shaking was performed for 5 minutes. The glass slide was then transferred to a glass staining tank containing sterile water and up-and-down shaking was performed for 1 minute. Centrifugal drying was thereafter carried out for 1 minute at 2000 rpm to remove the moisture remaining on the surface of the glass slide.
(Preparation of the Wash Solution)
(6) Detection of Fluorescence with a Scanner
Using an ArrayWoRx from Applied Precision, a fluorescent image was acquired with adjustment of the photoexposure time as appropriate. Digitization was carried out on the fluorescent signal in the obtained image using GenePix Pro. The results are shown in
(7) Data Analysis
As shown in
In the preceding embodiment, nonspecific hybridization was inhibited in the hybridization step even though this step was 60 minutes, and it was thus demonstrated that the present method exhibits an excellent accuracy and speed. When the capture probes shown in Table 1 were used, it was found that the hybridization step could be carried out even in about 30 minutes, and when run for 30 minutes for confirmation, the same results as at 60 minutes could be obtained.
In addition, conventional methods have also required an optimization of the hybridization conditions until desirable results are obtained as well as redesign of the probe sequences for the array and re-construction of the array, but in contrast to this the present invention does not require the redesign of the probe sequences for the array and does not require re-construction of the array and makes it possible to carry out evaluations on an ongoing basis using an array with the same specifications.
The procedure and results for an evaluation carried out using an existing method (Non Patent Document 1) are shown below. As in the embodiment, Enterococcus faecalis and Pseudoramibacter alactolyticus were used as the detection target microorganisms from among the microbial species present in the oral cavity.
(1) Fabrication of the DNA Microarray
Using for the capture probe an aqueous solution prepared by dissolving a synthetic oligo DNA (Nihon Gene Research Laboratories Inc.) modified by the amino group at the 3′ terminal, a geneslide (Toyo Kohan Co., Ltd.) glass slide was spotted using a GENESHOT (registered trademark) spotter from NGK Insulators, Ltd. Spotting was followed by baking for 1 hour at 80° C. The immobilisation of the synthetic oligo DNA was carried out by the same procedure as in the embodiment. The following sequences were used in the capture probes for detection of each of the aforementioned microorganisms.
(2) Target Nucleic Acid Amplification and Labeling
In order to amplify the target nucleic acids originating with the individual microorganisms, target nucleic acid amplification primers were used that had the same sequence as in the embodiment and that had Cy3 at the 5′ terminal.
PCR was run under the conditions given below on the DNAs extracted from the aforementioned microorganisms to provide comparative examples 1 and 2, respectively. The amplified sample gene was purified with a MinElute PCR Purification Kit from QIAGEN, followed by confirmation that amplification had occurred for the intended length.
(3) Hybridization using the DNA Microarray
The protocols given below were used for reaction with the DNA microarray using the labeled comparative examples 1 and 2 and for washing. Washing was carried out by transferring the wash solution to a glass staining tank; immersing the glass slide after the completion of the hybridization reaction; and shaking up and down for 5 minutes. The glass slide was additionally transferred into a glass staining tank containing sterile water and up-and-down shaking was carried out for 1 minute. The residual moisture on the surface of the glass slide was then removed by centrifugal drying for 1 minute at 2000 rpm.
(4) Detection of Fluorescence with a Scanner
Using an ArrayWoRx from Applied Precision, a fluorescent image was acquired with adjustment of the photoexposure time as appropriate.
(5) Data Analysis
Using GenePix Pro as the image digitization software, digitization was carried out on the fluorescent signal in the obtained image. The results are shown in
As shown in
The time required for hybridization in this comparative example was about 2 hours. In addition, a nonspecific reaction (about 10% as the fluorescence intensity) by the labeled sample to the nontarget probe (sequence not a complete match) was seen on the DNA microarray. On the other hand, in the case of the embodiment, the time required for hybridization could be shortened to about 30 minutes and the nonspecific reaction by the labeled sample to the nontarget probe (sequence not a complete match) on the DNA microarray could be substantially reduced (less than 1% as the fluorescence intensity).
Thus, according to the present invention, hybridization can be carried out generally at a constant temperature (about 37° C.) and in a time of about 30 minutes (one-fourth that of conventional methods) and a nucleic acid can be detected in a particular genome more accurately than heretofore and sequence determination can be carried out more accurately than heretofore. Sequence Listing Free Text
SEQ ID NOs 1 to 100, 103, 104, 105, 106, 108, 109: probe SEQ ID NOs 101, 102, 107: primer
Sequence Listing
The present invention relates to a method for detecting or analyzing a target sequence in a genomic DNA. This application claims priority to U.S. Provisional Application 61/213,739, filed on Jul. 9, 2009, the contents of which are hereby incorporated by reference in their entirety into the present application.
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/JP2010/061720 | 7/9/2010 | WO | 00 | 2/14/2012 |
| Number | Date | Country | |
|---|---|---|---|
| 61213739 | Jul 2009 | US |