Membrane proteins such as receptors and ion channels are key regulators of cellular function. Membrane proteins account for up to two thirds of known drugable targets, highlighting their critical pharmaceutical importance. The G protein-coupled receptors (GPCRs) are the largest, most versatile, group of membrane receptors and also the most pharmaceutically important, accounting for over 50% of all human drug targets and acting as therapeutic targets for a wide range of disease conditions including cancer, cardiovascular, metabolic, CNS and inflammatory diseases.
Surface plasmon resonance (SPR) biosensor-based assays, such as Biacore assays, have been used to study protein interactions in real time without labeling. Biacore pioneered commercial SPR biosensors offering a unique technology for collecting high-quality, information-rich data from biomolecular binding events. Since the release of the first instrument in 1990, researchers around the world have used Biacore's optical biosensors to characterize binding events with samples ranging from proteins, nucleic acids, small molecules to complex mixtures, lipid vesicles, viruses, bacteria, and eukaryotic cells. However, the application of SPR assays to study membrane-associated systems such as GPCRs is still in its infancy.
The challenges of studying membrane-associated proteins with optical biosensors are 2-fold. First, most membrane proteins, such as GPCRs, are expressed at low levels and are unstable when extracted from the hydrophobic cell membrane environment. This makes it difficult to immobilize these receptors onto the sensor surface while maintaining high levels of activity. Second, the ligands for most membrane proteins have low molecular weights (e.g., histamine [111 Da] and serotonin [176 Da] for GPCRs). This places an added burden on surface plasmon resonance (SPR) biosensor technology, which is mass based.
One approach, developed by Karlsson and Löfås, is to immobilize a purified receptor onto the sensor surface and then reconstitute a membrane environment on the surface (Anal. Biochem., 2002, 300(2):132-8). Myszka and co-workers extended this method by showing that it was possible to capture receptors out of crude preparations and directly study the binding of antibodies (Anal. Biochem., 2006, 355(1):132-9). However, with these methods, the lipid bilayer reconstituted on the chip surface is unstable and cannot be regenerated. Therefore, this method is rarely used.
Another approach is to engineer membrane proteins specifically for immobilization. For example, in studies by Myszka and co-workers, GPCRs were engineered using point mutations, yielding improved thermostability and conformational homogeneity (Anal. Biochem., 2011, 409(2):267-72); additionally, the engineered GPCRs retained activity after immobilization onto Biacore sensor chip surfaces. However, this approach is time consuming and a stable engineered molecule may not always be achievable. In addition, this method requires pre-activation of nickel-nitrilotriacetic acid (Ni-NTA) SPR surfaces by a non-specific amine coupling reagent prior to capturing the purified receptor. Therefore, any contaminated protein can be immobilized on the activated NTA surface via this process as long as it contains a primary amine group. This yields low binding activities for the surface-immobilized target protein. Furthermore, after binding, the surface can only be regenerated with a low affinity binder, which makes it impossible for analyzing large molecules such as antibodies.
The present invention provides certain advantages and advancements over the prior art. In particular, the present disclosure provides methods of stabilizing captured membrane proteins, for example, membrane receptors such as G-protein-coupled receptors (GPCRs), on analytical surfaces, for example, surface plasmon resonance surfaces such as Biacore sensor chip surfaces, by limited chemical crosslinking. This limited chemical crosslinking is efficient and reliable. It enables high quality kinetics assays of membrane proteins via the same methods that are conventionally used for soluble proteins. Also described here are methods for capturing and stabilizing membrane protein complexes, for example, virus like particles (VLPs), on analytical surfaces for binding kinetics assays by limited chemical crosslinking.
In one aspect, the present disclosure provides methods for immobilizing a membrane protein or membrane protein complex on an analytical surface, the methods comprising: (a) obtaining a membrane protein or membrane protein complex comprising a capture moiety; (b) immobilizing the membrane protein or membrane protein complex on the analytical surface by means of the capture moiety; and (c) stabilizing at least one of the secondary, tertiary, or quaternary structures of the immobilized membrane protein or membrane protein complex by crosslinking the immobilized membrane protein or membrane protein complex with a crosslinking reagent.
In another aspect, the present disclosure provides methods for immobilizing a membrane protein or membrane protein complex on an analytical surface, the methods comprising: (a) obtaining a membrane protein or membrane protein complex modified with a capture moiety; (b) coupling to the analytical surface an antibody specific for the capture moiety using a coupling reagent; (c) immobilizing the membrane protein or membrane protein complex on the analytical surface by means of interaction between the antibody and the capture moiety; and (d) stabilizing at least one of the secondary, tertiary, or quaternary structures of the immobilized membrane protein or membrane protein complex by crosslinking the immobilized membrane protein or membrane protein complex with a crosslinking reagent.
In another aspect, the present disclosure provides analytical surfaces comprising: a membrane protein or membrane protein complex comprising a capture moiety, wherein the membrane protein or membrane protein complex is immobilized on the analytical surface by means of the capture moiety, and wherein at least one of the secondary, tertiary, or quaternary structures of the membrane protein or membrane protein complex is stabilized by crosslinking.
In another aspect, the present disclosure provides analytical surfaces comprising: (a) a membrane protein or membrane protein complex comprising a capture moiety, and (b) an antibody specific for the capture moiety, wherein the antibody is coupled to the analytical surface using a coupling reagent, wherein the membrane protein or membrane protein complex is immobilized on the analytical surface by means of interaction between the antibody and the capture moiety, and wherein at least one of the secondary, tertiary, or quaternary structures of the membrane protein or membrane protein complex is stabilized by crosslinking.
These and other features and advantages of the present invention will be more fully understood from the following detailed description of the invention taken together with the accompanying claims. It is noted that the scope of the claims is defined by the recitations therein and not by the specific discussion of features and advantages set forth in the present description.
The following detailed description of the embodiments of the present invention can be best understood when read in conjunction with the following drawings, in which:
Skilled artisans will appreciate that elements in the figures are illustrated for simplicity and clarity and have not necessarily been drawn to scale. For example, the dimensions of some of the elements in the figures can be exaggerated relative to other elements to help improve understanding of the embodiment(s) of the present invention.
All publications, patents and patent applications cited herein are hereby expressly incorporated by reference for all purposes.
Before describing the present invention in detail, a number of terms will be defined. As used herein, the singular forms “a”, “an”, and “the” include plural referents unless the context clearly dictates otherwise. For example, reference to a “protein” means one or more proteins.
It is noted that terms like “preferably”, “commonly”, and “typically” are not utilized herein to limit the scope of the claimed invention or to imply that certain features are critical, essential, or even important to the structure or function of the claimed invention. Rather, these terms are merely intended to highlight alternative or additional features that can or cannot be utilized in a particular embodiment of the present invention.
For the purposes of describing and defining the present invention it is noted that the term “substantially” is utilized herein to represent the inherent degree of uncertainty that can be attributed to any quantitative comparison, value, measurement, or other representation. The term “substantially” is also utilized herein to represent the degree by which a quantitative representation can vary from a stated reference without resulting in a change in the basic function of the subject matter at issue.
The present disclosure provides methods of stabilizing captured membrane proteins, for example, membrane receptors such as G-protein-coupled receptors (GPCRs), on analytical surfaces, for example, surface plasmon resonance surfaces such as Biacore sensor chip surfaces, by limited chemical crosslinking. In some embodiments, the methods of the invention comprise purified or pre-enriched native GPCR protein immobilized on Biacore sensor chip surfaces via different capturing agents and further stabilized by a variety of crosslinkers. The resultant stabilized receptor proteins retain good ligand-binding activity and can be accessed by receptor specific antibodies. This limited chemical crosslinking is efficient and reliable. It enables high quality kinetics assays of membrane proteins via the same methods that are conventionally used for soluble proteins. Also described here are methods for capturing and stabilizing membrane protein complexes on analytical surfaces for binding kinetics assays by limited chemical crosslinking. In some embodiments, the membrane protein complexes are virus like particles (VLPs) with specific cell surface receptors displayed on the VLP surface.
As used herein, the terms “polypeptide,” “protein,” and “peptide” are interchangeable and refer to a chain of amino acid monomers linked by peptide bonds. Typically, polypeptide chains are unbranched. As used herein, the terms “residue” and “protein residue” are interchangeable and refer to an amino acid that is bonded with other amino acids by one or more peptide bonds within a protein.
As used herein, the term “membrane” refers to a phospholipid bilayer that surrounds a cell or organelle. For example, a cytoplasmic membrane is a phospholipid bilayer that surrounds a cell, whereas a nuclear membrane is a phospholipid membrane that surrounds a nucleus. Other organelles that comprise phospholipid bilayer membranes include mitochondria, chloroplasts, the Golgi apparatus, and the endoplasmic reticulum.
As used herein, the terms “membrane protein” or “membrane-associated protein” are interchangeable and refer to a protein attached to, or associated with, the membrane of a cell or organelle. Membrane proteins typically are specifically targeted to different types of biological membranes. They are also the target of over 50% of all modern medicinal drugs. It is estimated that 20-30% of all genes in most genomes encode membrane proteins. Classes of membrane proteins include integral membrane proteins, peripheral membrane proteins, and membrane-associated peptides.
Integral membrane proteins are permanently attached to the membrane. Such proteins can be separated from the biological membranes using detergents, nonpolar solvents, and sometimes denaturing agents. They can be classified according to their relationship with the bilayer. Integral polytopic proteins, also known as “transmembrane proteins,” are integral membrane proteins, which span across the membrane at least once. They have one of two tertiary structures: helix bundle proteins which are present in all types of biological membranes; and beta barrel proteins which are found only in outer membranes of Gram-negative bacteria, lipid-rich cell walls of a few Gram-positive bacteria, and outer membranes of mitochondria and chloroplasts. Integral monotopic proteins are integral membrane proteins which are attached to only one side of the membrane and do not span the whole way across.
Peripheral membrane proteins are temporarily attached either to the lipid bilayer or to integral proteins by one or a combination of hydrophobic, electrostatic, and/or other non-covalent interactions. Peripheral membrane proteins can be made to dissociate from the membrane by treatment with a polar reagent, such as a solution with an elevated pH or high salt concentration.
Membrane-associated peptides include polypeptide toxins and many antibacterial peptides, such as colicins or hemolysins, and certain proteins involved in apoptosis. These proteins are water-soluble but can aggregate and associate irreversibly with the lipid bilayer and become reversibly or irreversibly membrane-associated. For example, the antibacterial peptide magainin-2, from Xenopus laevis, is an amphipathic peptide that associates with lipid bilayers and disrupts membrane structure after insertion.
As used herein, the terms “membrane protein complex” and “membrane-associated protein complex” are interchangeable and can refer to a complex of membrane proteins, optionally comprising non-protein components, such as phospholipids. Alternatively, a membrane protein complex can be a complex of more than one protein that is associated with or attached to the membrane of a cell or organelle.
One non-limiting example of a membrane protein complex is a virus-like particle (VLP), which is a particle that resembles a virus, but is non-infectious because it does not contain any viral genetic material. The expression of viral structural proteins, such as envelope or capsid, can result in the self-assembly of virus like particles (VLPs). VLPs derived from the Hepatitis B virus and composed of the small HBV derived surface antigen (HBsAg) were described over 40 years ago from patient sera. More recently, VLPs have been produced from components of a wide variety of virus families including Parvoviridae (e.g. adeno-associated virus), Retroviridae (e.g. HIV), and Flaviviridae (e.g. Hepatitis C virus). VLPs can be produced in a variety of cell culture systems including mammalian cell lines, insect cell lines, yeast, and plant cells.
A sub-type of VLPs are lipoparticles, which are VLPs developed to aid the study of integral membrane proteins. Lipoparticles are stable, highly purified, homogeneous VLPs that are engineered to contain high concentrations of one or more conformationally intact membrane proteins of interest. Because of their hydrophobic domains, integral membrane proteins are insoluble in aqueous solution (at least in their native conformation) and are thus difficult to manipulate outside of living cells. Lipoparticles can incorporate a wide variety of structurally intact membrane proteins, including G protein-coupled receptors (GPCRs), ion channels, and viral envelopes. Lipoparticles provide a platform for numerous applications including antibody screening, production of immunogens, and ligand binding assays. Some lipoparticles comprise a protein core surrounded by a phospholipid bilayer that comprises membrane proteins.
As used herein, “primary structure” refers to the sequence of a biopolymer, such as the amino acid sequence of a protein or peptide.
As used herein, “secondary structure” refers to the general three-dimensional form of local segments of biopolymers such as proteins and nucleic acids (DNA/RNA). For example, in a protein, secondary structure comprises both alpha helices and beta sheets. Secondary structure can be formally defined by the hydrogen bonds of the biopolymer, as observed in an atomic-resolution structure. In proteins, the secondary structure is defined by the patterns of hydrogen bonds between backbone amino and carboxyl groups. In nucleic acids, the secondary structure is defined by the hydrogen bonding between the nitrogenous bases.
As used herein, “tertiary structure” refers to the three-dimensional structure of a protein or other macromolecule, as defined by its atomic coordinates. Proteins and nucleic acids are capable of diverse functions ranging from molecular recognition to catalysis. Such functions require a precise three-dimensional tertiary structure. Thus, in many cases, loss of tertiary structure is associated with a loss of functionality. For membrane proteins, such as integral membrane proteins, removal from the membrane environment is often associated with a loss of tertiary structure because membrane proteins contain many hydrophobic domains, which mis-fold when moved to a hydrophilic environment.
As used herein, “quaternary structure” refers to the arrangement of multiple folded protein or coiling protein molecules in a multi-subunit complex. For nucleic acids, the term is less common, but can refer to the higher-level organization of DNA in chromatin, including its interactions with histones, or to the interactions between separate RNA units in the ribosome or spliceosome.
As used herein, the term “analytical surface” refers to a surface used for chemical, physical, biophysical, biochemical, and/or biological analysis. Non-limiting examples of analytical surfaces include surfaces used for optical microscopy, atomic force microscopy, surface plasmon resonance analysis, Raman spectroscopy, fluorometry, fluorescence microscopy, electron microscopy, x-ray spectroscopy, and any other technique used for analyzing molecules or other analytes at a surface.
As used herein, the term “immobilize” refers to the capture or attachment of a molecule, such as a protein, on an insoluble material, such as an analytical surface.
As used herein, the term “surface plasmon resonance” (“SPR”) can refer both to a physical phenomenon and the analytical technique that employs the physical phenomenon. SPR is the collective oscillation of electrons in a solid or liquid stimulated by incident light. The resonance condition is established when the frequency of light photons matches the natural frequency of surface electrons oscillating against the restoring force of positive nuclei. SPR in nanometer-sized structures is called localized surface plasmon resonance. SPR is the basis of many standard tools for measuring adsorption of material onto planar metal (typically gold and silver) surfaces or onto the surface of metal nanoparticles. It is the fundamental principle behind many color-based biosensor applications and different lab-on-a-chip sensors.
Biacore pioneered commercial SPR biosensors offering a unique technology for collecting high-quality, information-rich data from biomolecular binding events. Since the release of the first instrument in 1990, researchers around the world have used Biacore's optical biosensors to characterize binding events with samples ranging from proteins, nucleic acids, small molecules to complex mixtures, lipid vesicles, viruses, bacteria, and eukaryotic cells. Other SPR systems include Bio-Rad ProteOn XPR36, Eco Chemie Autolab TWINGLE, Reichert Inc. SR7000DC, and Sierra Sensors GmbH.
SPR reflectivity measurements can be used to detect molecular adsorption, such as that of polymers, DNA, or proteins. In some cases, the angle of the reflection minimum (i.e. the absorption maximum) is measured. This angle changes on the order of 0.1° during thin (about nm thickness) film adsorption. In other cases the changes in the absorption wavelength is measured. The mechanism of detection is based on the fact that the adsorbing molecules cause changes in the local index of refraction, changing the resonance conditions of the surface plasmon waves.
When the affinity of two ligands is to be determined, the binding constant KD can be determined as KD=kd/ka, where kd is the dissociation rate constant and ka is the association rate constant. This value can also be found using dynamical SPR parameters. For this, a “bait” molecule is immobilized on an SPR surface. Through a microflow system, a solution with the molecule's binding partner (the “prey” molecule) is injected over the immobilized bait layer. As the prey analyte binds the bait ligand, an increase in SPR signal (expressed in response units, RU) is observed. After desired association time, a solution without the prey analyte (usually the buffer) is injected over the surface that dissociates the bound complex between bait ligand and prey analyte. As the prey analyte dissociates from the bait ligand, a decrease in SPR signal (expressed in resonance units, RU) is observed. From these association (“on rate,” ka or kon) and dissociation (“off rate,” kd or koff) rates, the equilibrium dissociation constant (“binding constant,” KD) can be determined. The actual SPR signal can be explained by the electromagnetic “coupling” of the incident light with the surface plasmon of the gold layer. This plasmon can be influenced by the layer just a few nanometers across the gold-solution interface, i.e. the bait protein and possibly the prey protein. Binding makes the reflection angle change.
Biacore SPR sensor chips are available with a variety of types of surfaces. For example, CM3, CM4, CM5, and CM7 chips comprise dextran chains that are covalently bonded to the chip surface, and which contain carboxyl groups at their free ends. These chips can be used to attach proteins, nucleic acids, carbohydrates or small molecules to the chip surface by coupling the molecules to the carboxyl groups on the sensor surface via —NH2, —SH, —CHO, —OH or —COOH moieties. C1 chips comprise a matrix-free surface (i.e. no dextran chains) that is carboxymethylated; like the CM chips, the surface comprises free carboxyl groups that can be used to attach molecules via —NH2, —SH, —CHO, —OH or —COOH moieties. Streptavidin (SA) chips comprise carboxymethylated dextran pre-immobilized with streptavidin for immobilization of biotinylated interaction partners and is capable of high-affinity capture of biotinylated ligands such as proteins, peptides, nucleic acids or carbohydrates. NTA chips comprise carboxymethylated dextran pre-immobilized with nitrilotriacetic acid (NTA). His-tagged molecules are immobilized via Ni2+/NTA chelation. These, and other sensor chips and analytical surfaces may be used with the methods and apparatuses disclosed herein.
As used herein, the term “capture moiety” refers to a chemical moiety attached to a molecule that can be used to capture or immobilize the molecule, for example, through interaction with another chemical moiety. For example, a poly-histidine tag (His-tag, 6×His-tag, hexa histidine-tag, or His6-tag) is a capture moiety comprising at least six histidine amino acid residues that can be used to capture or immobilize a His-tagged molecule because the string of histidine residues binds to several types of immobilized metal ions, including nickel, cobalt and copper, under specific buffer conditions. In addition, anti-His-tag antibodies are commercially available for use in assay methods involving His-tagged proteins. Any protein for which an antibody specific for that protein exists can comprise a capture moiety. For example, CD52 can be a capture moiety, which is captured using an anti-CD52 antibody. CD81 can be a capture moiety, which is captured using an anti-CD81 antibody.
As used herein, the term “crosslink” or “cross-link” refers to a bond, such as a covalent bond or ionic bond, that links one polymer chain, such as a biopolymer or synthetic polymer, to another.
As used herein, the terms “thiol,” “thiol moiety,” “thiol group,” “sulfhydryl,” “sulfhydryl group,” and “sulfhydryl moiety” are interchangeable and refer to a —SH functional group in a molecule.
As used herein, the terms “amine,” “amine group,” and “amine moiety” are interchangeable and refer to a —NH functional group in a molecule.
As used herein, the terms “carboxyl group,” “carboxyl moiety,” “carboxy group,” and “carboxy moiety” are interchangeable and refer to a functional group consisting of a carbonyl (RR′C═O) and a hydroxyl (R—O—H), which has the formula —C(═O)OH, also written as —COOH or —CO2H.
As used herein, the terms “carbohydrate group,” “carbohydrate moiety,” “saccharide group,” or “saccharide moiety” are interchangeable and refer to carbohydrate or sugar groups, such as monosaccharide, disaccharide, oligosaccharide, or polysaccharide groups, that are covalently attached to a molecule.
As used herein, the terms “crosslinking reagent,” “crosslinking agent,” or “crosslinker” are interchangeable and refer to a reagent or set of reagents capable of chemically linking two molecules, for example two proteins, by one or more covalent bonds. Crosslinking reagents contain two or more reactive ends that are capable of attaching to specific functional groups (primary amines, sulfhydryls, etc.) on proteins or other molecules, and can be broadly grouped into homobifunctional and heterobifunctional crosslinkers.
Homobifunctional crosslinking reagents have the same type of reactive group at either end of the crosslinker and thus link two functional groups of the same type, forming, for example, amine-to-amine or thiol-to-thiol linkages. Examples of crosslinkers that form amine-to-amine linkages include, but are not limited to:
Examples of homobifunctional crosslinkers that form thiol-to-thiol linkages include, but are not limited to:
Heterobifunctional crosslinking reagents have different types of reactive groups at either end of the crosslinker and thus link two functional groups of different types, forming, for example, amine-to-thiol or carboxyl-to-amine, thiol-to-carbohydrate, or hydroxyl-to-thiol linkages. Examples of heterobifunctional crosslinking reagents that form amine-to-thiol (amine-to-sulfhydryl) linkages include, but are not limited to:
Examples of heterobifunctional crosslinking reagents that form carboxyl-to-amine linkages include, but are not limited to:
An example of a heterobifunctional crosslinking reagent that forms thiol-to-hydroxyl linkages is p-maleimidophenyl isocyanate (PMPI).
Examples of heterobifunctional crosslinking reagents that form thiol-to-carbohydrate linkages include, but are not limited to:
In some embodiments of the methods and apparatuses disclosed herein, the amount of crosslinking is limited so as not to interfere with the activity of the crosslinked protein or protein complex. In some embodiments, the amount of crosslinking is more than a lower threshold, such that the protein or protein complex is stabilized, but is less than an upper threshold, at which the activity is diminished or modulated or altered to an unacceptable degree.
In some embodiments, the amount of crosslinking is assessed according to the average number of crosslinks per protein or protein complex. For example, a desired number of crosslinks per immobilized protein or protein complex according to the methods and apparatuses disclosed herein could be about 1, or about 2, or about 3, or about 4, or about 5, or about 6, or about 7, or about 8, or about 9, or about 10, or about 15, or about 20, or about 30 crosslinks per protein or protein complex.
In some embodiments, the amount of crosslinking is assessed according to the function of the immobilized protein or protein complex, and more specifically according to the affinity or ability of the protein or protein complex to bind to one or more of its binding partners. As used herein, the term “binding partner” refers to any molecule that a membrane protein or complex is capable of binding or interacting with, for example, but not limited to, one or more of the protein or protein complex's ligands, receptors, epitopes, substrates, co-factors, co-complexes, sub-domains, units, subunits, etc. In some embodiments, the amount of crosslinking preserves about 40%, or about 50%, or about 60%, or about 70%, or about 80%, or about 90%, or about 100% of the binding activity of the protein or protein complex for its binding partner. In other embodiments, the amount of crosslinking decreases the binding activity of the protein or protein complex for its binding partner only by about 1%, or about 2%, or about 5%, or about 10%, or about 15%, or about 20%, or about 30%, or about 40%, or about 50%.
In some embodiments, the amount of crosslinking is assessed or determined according to the amount or concentration of the crosslinking reagent that is used. This in turn is dependent on the particular crosslinking reagent employed. As a non-limiting example, NHS/EDC may be used in a ratio of 4:1 at about 4 nM NHS and 1 nM EDC, or about 20 nM NHS and 5 nM EDC, or about 200 nM NHS and 50 nM EDC, or about 4 μM NHS and 1 μM EDC, or about 20 μM NHS and 5 μM EDC, or about 200 μM NHS and 50 μM EDC. Thus, EDC may be used at concentrations from about 1 nM to about 1 mM, and NHS may also be used at concentrations from about 1 nM to about 1 mM. In the methods and apparatuses described herein, the optimal concentrations of crosslinking reagents to be used will adequately stabilize an immobilized protein without resulting in an unacceptable decrease or loss in protein functionality or binding affinity.
In one aspect, the invention provides methods for immobilizing a membrane protein or membrane protein complex on an analytical surface, the methods comprising: (a) obtaining a membrane protein or membrane protein complex comprising a capture moiety; (b) immobilizing the membrane protein or membrane protein complex on the analytical surface by means of the capture moiety; and (c) stabilizing at least one of the secondary, tertiary, or quaternary structures of the immobilized membrane protein or membrane protein complex by crosslinking the immobilized membrane protein or membrane protein complex with a crosslinking reagent.
In some embodiments of this aspect, the analytical surface is a surface plasmon resonance (SPR) surface. In some embodiments, the capture moiety is a 6×His tag and the analytical surface is a nickel-nitrilotriacetic acid (Ni-NTA) surface. In some embodiments, the crosslinking reagent forms a linkage between an amine moiety and a carboxylic acid moiety, and in certain embodiments, the crosslinking reagent comprises: (i) N-hydroxysulfosuccinimide (NHSS) and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC); or (ii) N-hydroxysuccinimide (NHS) and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC). In some embodiments, the crosslinking reagent forms a linkage between a thiol moiety and an amine moiety, and in certain embodiments, the crosslinking reagent comprises: (i) succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC); or (ii) 3-(2-pyridyldithio)propionate (SPDP). In some embodiment, the crosslinking reagent forms a linkage between two amine moieties, and in certain embodiments, the crosslinking reagent comprises bis(succinimidyl)penta(ethylene glycol) (BS(PEG)5). In some embodiments, the method of claim 1, wherein the crosslinking reagent forms a linkage between two thiol moieties, and in certain embodiments, the crosslinking reagent comprises: (i) dithiobismaleimidoethane (DTME); or (ii) 1,8-bismaleimido-diethyleneglycol (BM(PEG)2). In some embodiments, the crosslinking reagent forms a linkage between two carbohydrate moieties, and in certain embodiments, crosslinking reagent comprises: (i) S-(2-thiopyridyl)-L-cysteine hydrazide (TPCH); or (ii) S-(2-thiopyridyl)mercapto-propionohydrazide (TPMPH). In some embodiments, the crosslinking reagent forms a linkage between a carbohydrate moiety and a thiol moiety, and in certain embodiments, the crosslinking reagent comprises: (i) N-beta-maleimidopropionic acid hydrazide (BMPH); or (ii) 3-(2-pyridyldithio)propionyl hydrazide (PDPH). In some embodiments, the membrane protein or membrane protein complex is capable of binding with a binding partner after crosslinking.
In another aspect, the invention provides methods for immobilizing a membrane protein or membrane protein complex on an analytical surface, the methods comprising: (a) obtaining a membrane protein or membrane protein complex modified with a capture moiety; (b) coupling to the analytical surface an antibody specific for the capture moiety using a coupling reagent; (c) immobilizing the membrane protein or membrane protein complex on the analytical surface by means of interaction between the antibody and the capture moiety; and (d) stabilizing at least one of the secondary, tertiary, or quaternary structures of the immobilized membrane protein or membrane protein complex by crosslinking the immobilized membrane protein or membrane protein complex with a crosslinking reagent.
In some embodiments of this aspect, the analytical surface is a surface plasmon resonance (SPR) surface. In some embodiments, the capture moiety is a 6×His tag and the antibody is an anti-6×His antibody. In some embodiments, the membrane protein complex is a virus-like particle (VLP). In some embodiments, the capture moiety is a protein or protein complex present on the surface of the VLP and the antibody is specific to the capture moiety. In some embodiments, the capture moiety is CD52 and the antibody is an anti-CD52 antibody. In some embodiments, the capture moiety is CD81 and the antibody is an anti-CD81 antibody. In some embodiments, the analytical surface is a surface comprising free carboxyl groups and the coupling reagent comprises N-hydroxysulfosuccinimide (NHS) and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC). In some embodiments, the surface comprising free carboxyl groups is a CM5 sensor chip surface or a C1 sensor chip surface.
In some embodiments of this aspect, the crosslinking reagent forms a linkage between an amine moiety and a carboxylic acid moiety, and in certain embodiments, the crosslinking reagent comprises: (i) N-hydroxysulfosuccinimide (NHSS) and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC); or (ii) N-hydroxysuccinimide (NHS) and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC). In some embodiments, the crosslinking reagent forms a linkage between a thiol moiety and an amine moiety, and in certain embodiments, the crosslinking reagent comprises: (i) succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC); or (ii) 3-(2-pyridyldithio)propionate (SPDP). In some embodiment, the crosslinking reagent forms a linkage between two amine moieties, and in certain embodiments, the crosslinking reagent comprises bis(succinimidyl)penta(ethylene glycol) (BS(PEG)5). In some embodiments, the method of claim 1, wherein the crosslinking reagent forms a linkage between two thiol moieties, and in certain embodiments, the crosslinking reagent comprises: (i) dithiobismaleimidoethane (DTME); or (ii) 1,8-bismaleimido-diethyleneglycol (BM(PEG)2). In some embodiments, the crosslinking reagent forms a linkage between two carbohydrate moieties, and in certain embodiments, crosslinking reagent comprises: (i) S-(2-thiopyridyl)-L-cysteine hydrazide (TPCH); or (ii) S-(2-thiopyridyl)mercapto-propionohydrazide (TPMPH). In some embodiments, the crosslinking reagent forms a linkage between a carbohydrate moiety and a thiol moiety, and in certain embodiments, the crosslinking reagent comprises: (i) N-beta-maleimidopropionic acid hydrazide (BMPH); or (ii) 3-(2-pyridyldithio)propionyl hydrazide (PDPH). In some embodiments, the membrane protein or membrane protein complex is capable of binding with a binding partner after crosslinking.
In another aspect, the invention provides analytical surfaces comprising: a membrane protein or membrane protein complex comprising a capture moiety, wherein the membrane protein or membrane protein complex is immobilized on the analytical surface by means of the capture moiety, and wherein at least one of the secondary, tertiary, or quaternary structures of the membrane protein or membrane protein complex is stabilized by crosslinking. In some embodiments of this aspect, the analytical surface is a surface plasmon resonance (SPR) surface. In some embodiments, the capture moiety is a 6×His tag and the analytical surface is a nickel-nitrilotriacetic acid (Ni-NTA) surface.
In some embodiments of this aspect, the membrane protein or membrane protein complex is crosslinked using a crosslinking reagent that forms a linkage between an amine moiety and a carboxylic acid moiety, and in certain embodiments, the crosslinking reagent comprises: (i) N-hydroxysulfosuccinimide (NHSS) and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC); or (ii) N-hydroxysuccinimide (NHS) and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC). In some embodiments, the membrane protein or membrane protein complex is crosslinked using a crosslinking reagent that forms a linkage between a thiol moiety and an amine moiety, and in certain embodiments, the crosslinking reagent comprises: (i) succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC); or (ii) 3-(2-pyridyldithio)propionate (SPDP). In some embodiments, the membrane protein or membrane protein complex is crosslinked using a crosslinking reagent that forms a linkage between two amine moieties, and in certain embodiments, the crosslinking reagent comprises bis(succinimidyl)penta(ethylene glycol) (BS(PEG)5). In some embodiments, the membrane protein or membrane protein complex is crosslinked using a crosslinking reagent that forms a linkage between two thiol moieties, and in certain embodiments, the crosslinking reagent comprises: (i) dithiobismaleimidoethane (DTME); or (ii) 1,8-bismaleimido-diethyleneglycol (BM(PEG)2). In some embodiments, the membrane protein or membrane protein complex is crosslinked using a crosslinking reagent that forms a linkage between two carbohydrate moieties, and in certain embodiments, the crosslinking reagent comprises: (i) S-(2-thiopyridyl)-L-cysteine hydrazide (TPCH); or (ii) S-(2-thiopyridyl)mercapto-propionohydrazide (TPMPH). In some embodiments, the membrane protein or membrane protein complex is crosslinked using a crosslinking reagent that forms a linkage between a carbohydrate moiety and a thiol moiety, and in certain embodiments, the crosslinking reagent comprises: (i) N-beta-maleimidopropionic acid hydrazide (BMPH); or (ii) 3-(2-pyridyldithio)propionyl hydrazide (PDPH). In some embodiments, the membrane protein or membrane protein complex is capable of binding with a binding partner after crosslinking.
In another aspect, the invention provides analytical surfaces comprising: (a) a membrane protein or membrane protein complex comprising a capture moiety, and (b) an antibody specific for the capture moiety, wherein the antibody is coupled to the analytical surface using a coupling reagent, wherein the membrane protein or membrane protein complex is immobilized on the analytical surface by means of interaction between the antibody and the capture moiety, and wherein at least one of the secondary, tertiary, or quaternary structures of the membrane protein or membrane protein complex is stabilized by crosslinking. In some embodiments of this aspect, the analytical surface is a surface plasmon resonance (SPR) surface. In some embodiments, the capture moiety is a 6×His tag and the antibody is an anti-6×His antibody. In some embodiments, the membrane protein complex is a virus-like particle (VLP). In some embodiments, the capture moiety is a protein or protein complex present on the surface of the VLP and the antibody is specific to the capture moiety. In some embodiments, the capture moiety is CD52 and the antibody is an anti-CD52 antibody. In some embodiments, the capture moiety is CD81 and the antibody is an anti-CD81 antibody. In some embodiments, the analytical surface is a surface comprising free carboxyl groups and the coupling reagent comprises N-hydroxysulfosuccinimide (NHS) and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC). In some embodiments, the surface comprising free carboxyl groups is a CM5 sensor chip surface or a C1 sensor chip surface.
In some embodiments of this aspect, the membrane protein or membrane protein complex is crosslinked using a crosslinking reagent that forms a linkage between an amine moiety and a carboxylic acid moiety, and in certain embodiments, the crosslinking reagent comprises: (i) N-hydroxysulfosuccinimide (NHSS) and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC); or (ii) N-hydroxysuccinimide (NHS) and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC). In some embodiments, the membrane protein or membrane protein complex is crosslinked using a crosslinking reagent that forms a linkage between a thiol moiety and an amine moiety, and in certain embodiments, the crosslinking reagent comprises: (i) succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC); or (ii) 3-(2-pyridyldithio)propionate (SPDP). In some embodiments, the membrane protein or membrane protein complex is crosslinked using a crosslinking reagent that forms a linkage between two amine moieties, and in certain embodiments, the crosslinking reagent comprises bis(succinimidyl)penta(ethylene glycol) (BS(PEG)5). In some embodiments, the membrane protein or membrane protein complex is crosslinked using a crosslinking reagent that forms a linkage between two thiol moieties, and in certain embodiments, the crosslinking reagent comprises: (i) dithiobismaleimidoethane (DTME); or (ii) 1,8-bismaleimido-diethyleneglycol (BM(PEG)2). In some embodiments, the membrane protein or membrane protein complex is crosslinked using a crosslinking reagent that forms a linkage between two carbohydrate moieties, and in certain embodiments, the crosslinking reagent comprises: (i) S-(2-thiopyridyl)-L-cysteine hydrazide (TPCH); or (ii) S-(2-thiopyridyl)mercapto-propionohydrazide (TPMPH). In some embodiments, the membrane protein or membrane protein complex is crosslinked using a crosslinking reagent that forms a linkage between a carbohydrate moiety and a thiol moiety, and in certain embodiments, the crosslinking reagent comprises: (i) N-beta-maleimidopropionic acid hydrazide (BMPH); or (ii) 3-(2-pyridyldithio)propionyl hydrazide (PDPH). In some embodiments, the membrane protein or membrane protein complex is capable of binding with a binding partner after crosslinking.
The Examples that follow are illustrative of specific embodiments of the invention, and various uses thereof. They are set forth for explanatory purposes only, and are not to be taken as limiting the invention.
Expression of hCXCR5:
Human CXCR5 receptor was expressed in Sf9 cells using the FastBac expression system (Invitrogen). Sf9 cells were grown in suspension in flasks with serum-free medium. Cells were infected with recombinant virus at a density of 6×106 cells/ml; virus was added at the multiplicity of infection (MOI) of 10. An equal volume of fresh medium was added immediately afterward. Cells were harvested by centrifugation 72 h post-infection.
Purification of hCXCR5:
After expression Sf9 insect cell membranes were initially disrupted by homogenization in a hypotonic buffer containing 10 mM HEPES (pH 7.5), 20 mM KCl, and 10 mM MgCl2. Extensive washing of the isolated raw membranes was performed by repeated centrifugation (typically six to nine times) in a high-osmotic buffer containing 1.0 M NaCl, 10 mM HEPES (pH 7.5), 10 mM MgCl2, 20 mM KCl, and protease inhibitor cocktail (Roche), followed by Dounce homogenization to resuspend the membranes in fresh wash buffer thereby separating soluble and membrane-associated proteins from integral transmembrane proteins. Highly purified membranes were solubilized by incubation in the presence of 0.5% (w/v) n-dodecyl-D-maltopyranoside (DDM) (Sigma) and 0.01% (w/v) cholesteryl hemisuccinate (CHS) (Sigma) for two to three hours at 4° C. After solubilization, the unsolubilized material was removed by centrifugation at 150,000×g for 45 minutes. The supernatant was separated, supplemented with 25 mM buffered imidazole and incubated with Ni-NTA resin (Qiagen) overnight at 4° C.; typically, 1.5 ml of resin per one liter of original culture volume was used. After binding the resin was washed with ten column volumes of 25 mM HEPES (pH 7.5), 800 mM NaCl, 10% (v/v) glycerol, 55 mM imidazole, 0.05% (w/v) DDM and 0.001% (w/v) CHS. The receptor was eluted with 25 mM HEPES (pH 7.5), 800 mM NaCl, 10% (v/v) glycerol, 0.05% (w/v) DDM, 0.001% (w/v) CHS, and 200 mM imidazole. The eluted receptor was desalted with P-10 column (GE) to 25 mM HEPES (pH 7.5), 800 mM NaCl, 10% (v/v) glycerol, 0.05% (w/v) DDM, 0.001% (w/v) CHS and stored at −80° C.
Capturing hCXCR5 on Biacore Sensor Chip Surface:
For direct NTA chip capture, the purified hCXCR5 receptor was diluted 10 to 20-fold in HBS—N running buffer and injected with a flow rate of 5 μl/min to achieve capture level between 300-1000 resonance units (RU), depending on experiment purpose. For indirect CM5 chip capture, anti-6×His mAb (Qiagen) was amine-coupled to the free carboxyl groups on the chip surface using standard NHS/EDC coupling, yielding surface mAbs at about 15K RU. hCXCR5 receptor was then injected at 5 μl/min to achieve a similar capture level as for the NTA chip (i.e. between 300-1000 RU, depending on experiment purpose).
Stabilization of hCXCR5:
Direct- or indirect-captured hCXCR5 receptor protein was stabilized with crosslinking by treatment of mixtures of 0-200 μM EDC and 0-50 μM NHS for 7 min. Subsequently, the surface was deactivated with 1 M ethanolamine for 10 min. In separate experiments, five other crosslinkers, BS(PEG)5 (bis(succinimidyl)penta(ethylene glycol)); DSS (disuccinimidyl suberate); SMCC (succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate); DTME (dithiobismaleimidoethane) and BM(PEG)2 (1,8-bismaleimido-diethyleneglycol), all from Pierce, were tested at 50 μM concentration for stabilizing the captured hCXCR5 receptor at flow rate of 5 μl/min for 7 min. Excess crosslinkers were quenched with 1M ethanolamine for 10 min for amine reactive crosslinkers BS(PEG)5 and DSS, or 50 mM cysteine in 0.1M sodium acetate and 1 M sodium chloride pH 4.0 for 10 min for thiol-reactive crosslinkers BM(PEG)2 and DTME, or 1M ethanol amine for 10 min flowed with 50 mM cysteine in 0.1M sodium acetate and 1 M sodium chloride pH 4.0 for 10 min for heterobifunctional crosslinker SMCC. The surface stabilized receptor chip was primed with running buffer before subsequent assay steps.
Regeneration of Captured-Stabilized hCXCR5 Surfaces:
At the end of each binding cycle, the GPCR surfaces were regenerated with injection of 50 mM HCl for 1 min.
Kinetic Characterization of hCXCR5 Ligand and Antibodies:
CXCL13 and 3 anti-hCXCR5 mAbs were each tested in triplicate in 2-fold dilution series for binding to hCXCR5 in HBS-EP+ running buffer. All samples were injected at a flow rate of 50 μl/min.
Data Processing and Analysis:
All biosensor data processing and analysis was performed using Biacore T100 Evaluation Software (GE). For kinetic analyses, data were locally fit to a 1:1 interaction model. CV (coefficient of variation) was calculated as the standard deviation (STDEV) divided by the mean.
A mouse antibody capturing kit from GE was used for Biacore CM5 chip surface preparation. Following standard protocols provided by the manufacturer, as shown in
This assay format took advantage of the availability of biotinylated N-terminal hCXCR5 peptide and a streptavidin (SA) Biacore chip. As shown in
However, since antibodies are dimeric molecules, it is possible that one antibody molecule could bind to two peptides on the chip surface thereby resulting in artificially high affinity through the avidity effect. In fact, affinity (KD) data generated by this assay format indeed was higher than the data generated by the conventional assay format. Therefore, the higher affinity data for the same antibody at least in part is attributed to the avidity effect. In order to evaluate the avidity effect, different levels (5, 20, and 100 RU) of biotinylated peptides were captured on a SA chip surface and kinetics assays were performed using the same procedures as above. As shown in
Peptide-based assays for anti-GPCR antibodies are convenient; however, they can only be used for analyzing antibodies recognizing linear epitopes. The conventional assay format (Example 2) lacks resolution (it can't distinguish three mAb clones) whereas the reversed assay format (Example 3) lacks accuracy due to the avidity effect. A whole-receptor assay addresses these issues.
The whole-receptor assay method requires mutagenesis to obtain a stable GPCR molecule and it relies on utilizing a low-affinity small molecule compound for regeneration. Therefore, it is not applicable to antibody analysis. Nevertheless, a simple yet reliable method for analyzing antibodies against GPCRs was developed.
As described in Example 1, C-terminal 6×His-tagged hCXCR5 whole receptor protein was expressed in insect cells and purified via IMAC affinity purification as shown in
For direct capturing by an NTA SPR sensor chip, the purified 6×His-hCXCR5 protein was diluted to 50 ug/ml with HBS—N (from GE) buffer. An NTA reagent kit (GE) was used for chip surface preparation. The flow rate was set to 5 ul/ml and HBS—N was used as the running buffer. As shown in
Similarly, the purified 6×His-hCXCR5 protein was captured via anti-6×His antibody which was immobilized on CM5 chip surface by a standard antibody coupling method. Five other crosslinkers were evaluated as shown in
In order to assess the impact of the avidity effect on this capture and stabilization method, chip surfaces with different receptor densities were prepared. As shown in
To further expand the applicability of limited chemical crosslinking for non-purified protein samples, a virus-like particle (VLP) expression system was developed. Full-length CD52 coding sequence (ATGAAGCGCTTCCTCTTCCTCCTACTCACCA TCAGCCTCCTGGTTATGGTACAGATACAAACTGGACTCTCAGGACAAAACGACACC AGCCAAACCAGCAGCCCCTCAGCATCCAGCAGCATGAGCGGAGGCATTTTCCTTTT CTTCGTGGCCAATGCCATAATCCACCTCTTCTGCTTCAGTTGA) (SEQ ID NO: 2) was cloned into pEF_DEST51 vector (Invitrogen). Following the user guide for MembranePro™ Functional Protein Expression System from Life Technologies, CD52 VLP prep was obtained. As shown in
Since CD52 molecules were displayed on the VLP surface with native structure, VLPs were captured by using an anti-CD52 mAb (Campath) on the Biacore C1 sensor chip surface. As shown in
Having described the invention in detail and by reference to specific embodiments thereof, it will be apparent that modifications and variations are possible without departing from the scope of the invention defined in the appended claims. More specifically, although some aspects of the present invention are identified herein as particularly advantageous, it is contemplated that the present invention is not necessarily limited to these particular aspects of the invention.
This application claims the benefit of priority under 35 U.S.C. §120 and is a continuation-in-part of U.S. application Ser. No. 13/745,377, filed Jan. 18, 2013, and a continuation-in-part of International Application No. PCT/US13/22280, filed Jan. 18, 2013, the disclosures of each of which are explicitly incorporated herein by reference in their entirety.
| Number | Date | Country | |
|---|---|---|---|
| Parent | 13745377 | Jan 2013 | US |
| Child | 14158056 | US | |
| Parent | PCT/US13/22280 | Jan 2013 | US |
| Child | 13745377 | US |