Patent Grant
8492082
This application is a 371 of PCT/EP2009/061276 filed on Sep. 1, 2009, which claims the benefit of European Patent Application No. 08105194.8 filed on Sep. 1, 2008, the contents of each of which are incorporated herein by reference.
The present invention relates to a method for obtaining nucleic acid aptamers that bind to cancer cell-surface epitopes, to the aptamers generated using this method and their use for diagnostic, prognostic and therapeutic purposes, including drug delivery.
The hope of success of therapeutic interventions in cancer largely relies on the possibility to distinguish, with high accuracy, even closely-related tumor types. Indeed, the identification of tumor specific signatures has been a major challenge of the last ten years to predict the responsiveness to a given therapeutic plan and to reduce the impact of side effects to be expected if unresponsive oncologic patients are being treated.
The SELEX technique refers to Systematic Evolution of Ligands by EXponential enrichment. Single-stranded oligonucleotides have the diversity characteristic both in molecular structure and function, thus, a random library of single oligonucleotides is synthesized for binding to a target protein on the membrane. The oligonucleotides bound non-specifically are washed away and the oligonucleotides bound specifically were eluted in denatured condition and collected. The oligonucleotides are amplified by PCR for further selection. The high affinity oligonucleotides, namely aptamers that have high affinity with the target proteins, can be selected from the initial library through amplification and selection over many cycles. In 1990, Tuerk and Gold selected Aptamers of T4 RNA polymerase by SELEX (Tuerk C and Gold L. 1990). Subsequently, Ellington and Szostak showed great interests in the application of aptamers in scientific research and production. Aptamers soon become a valuable research tool and show great application prospected in the fundamental research, drug selection and clinical diagnosis and therapy (Ellington and Szostak, 1990). At present, many kinds of aptamers have come into clinical test phase. For example, drugs for curing thrombus and inhibiting endometrium hyperplasic and angiogenesis (Green L S et al., 1995, Tasset D M, et al., 1997, Ruckman J et al., 1998).
An innovative aspect of the aptamers is their use in “target identification/validation” to identify various cell surface targets of a specific cellular state.
The U.S. Pat. No. 5,580,737 discloses a method for identifying nucleic acid ligands to a target molecule comprising contacting a mixture of nucleic acid with the target molecule, allowing the partitioning of increased affinity nucleic acid and then, contacting the increased affinity nucleic acid with non-target molecule. In particular ligand to theophylline and caffeine are described.
The patent application WO 2007/142713 provides a method for obtaining a probe specific for extracellular or cell-surface markers comprising several cycles of positive selection steps on a target cell followed by a step of counter-selection on a control cell. This method allows the selection of only a limited number of aptamers and only further to a high number of selection and/or counter-selection cycles. In addition, the selected aptamers display low cell specificity and are able to discriminate between cells of distant tumor types only (T-cell versus B cell lymphoma or small lung cancer cell versus large cell lung cancer, two cancer types of different origin).
Therefore, there is the need to provide a simplified method for obtaining aptamers comprising fewer cycles and resulting in aptamers with high specificity, even able to discriminate between different cells of the same tumor type, possessing different phenotypes (different resistance to a given physical or chemical therapeutic drug, different tumor mass growth properties, different ability to metastasize and different malignancy).
The authors of the present invention have already generated specific aptamers for the human receptor tyrosine kinase, Ret (Cerchia et al., 2005; WO 2005/093097), however they cannot be used to solve the problem of the invention.
The present invention discloses a simplified method to generate nucleic acid-based aptamers that bind to cancer cell-surface epitopes as unique tools to identify a surface molecular signature of cancer cells and thus permits to generate a small panel of high specific ligands capable of distinguish between even two closely related cell types. This approach, based on the use of living cells as target for the aptamers selection (whole-cell SELEX), allows selecting aptamers in a physiological context, and, most importantly, can be done without prior knowledge of the target molecules. The methods include much fewer steps than prior art methods. In addition and by contrast to the method of the application WO 2008/019142, the present protocol is specifically designed to target epitopes that are not internalised in the cell: ie short time of incubation of the library with cells are used and no trypsin treatment is performed. The present approach permits to identify and validate new tumor biomarkers.
The nucleic acid-based aptamers of the invention are able to discriminate between malignant and non malignant cell phenotype. The aptamers can also discriminate two different phenotypes within the same tumor cell type as for example, the resistance to a given physical or chemical therapeutic drug, the growth properties of the tumor mass, the ability to metastasize and the malignancy. The panel of aptamer molecules obtained and obtainable with the method of the present invention represent an innovative tool to detect cell surface specific epitopes as a signature of cancer cells in terms of tumor type, malignancy, therapeutic response, metastatic potential, proliferation and apoptotic rate. The panel of aptamer molecules obtained and obtainable with the method of the present invention represent an innovative tool to specifically target cancer cell with given surface specific epitopes in terms of tumor type, malignancy, therapeutic response, metastatic potential, proliferation and apoptotic rate.
Two types of human solid tumors were used as model systems, malignant glioma and non small cell lung carcinoma (NSCLC). Cultured human cancer cells that have close genetic background and only differ for their malignancy and/or therapeutic response were used as targets of the SELEX procedure. By coupling the Differential SELEX protocol to cancer cell lines, the authors were able to isolate different aptamers that are specific for targets present on the tumor cell type used (case 1: glioma; case 2: NSCLC) and absent on any other cancer type tested. Further, the authors of the present invention demonstrate that a small subset of aptamers is sufficient to distinguish two different cell lines of the same tumor type, but with different growth and therapeutic sensitivity (case 1 tumorigenic versus non-tumorigenic; case 2: TRAIL resistance versus sensitivity). Further, some of the aptamers have biological activity on the target cells.
Therefore it is an object of the present invention a method for selecting a nucleic acid aptamer specific for a protein selectively expressed on the cell surface of target cells comprising the steps of:
Preferably, the first set of unbound nucleic acid oligomers recovered in step b) is incubated with the control cells and a second set of unbound nucleic acid oligomers recovered in step b) is further processed as indicated in steps c), d) and e).
Still preferably, the collection of synthetic nucleic acid oligomers is a synthetic library.
More preferably, the synthetic nucleic acid oligomers are labelled. Yet preferably the nucleic acid oligomers are oligoribonucleotides or modified RNA-se resistant oligoribonucleotides.
In a particular embodiment the target cell is a tumor cell and the control cell is a tumor cell of the same cell type as the target cell but having a different phenotype. Preferably, the tumor cell is a glioma cell or a NSCLC cell.
Still preferably, the phenotype is selected from the group of: resistance to a given physical or chemical therapeutic drug, tumor mass growth properties, apoptosis, ability to metastasize or malignancy, drug treated tumor cell.
It is a further object of the invention a nucleic acid aptamer obtainable according to the method of the invention. Preferably, the nucleic acid aptamer is for medical use. More preferably the nucleic acid aptamer is for the treatment of a tumor, also as targeting component for biocomplexes with nano particles or siRNAs. Still preferably the nucleic acid aptamer is for the diagnosis of a tumor and/or the follow-up of a therapy, also for molecular imaging. More preferably the nucleic acid aptamer is for predicting a therapeutic response of a drug for a tumor.
Preferably the tumor is a glioma or a NSCLC.
Still preferably, the nucleic acid aptamer is for the detection of a target cell.
Preferably, the target cell is a tumor cell. More preferably, the tumor cell is a glioma cell or a NSCLC cell.
More preferably, the nucleic acid aptamer has a sequence selected from the group of: SEQ ID No. 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129 or a functional fragment thereof.
In the present invention, a functional fragment is meant as a fragment retaining essentially the same binding activity to the respective target as the sequence it derives from. The same binding activity means a binding with a Kd of 200 nM or less (see for example aptamers C13 and A5 and the common shorter sequence fragment C13 sh as indicated in
It is a further object of the invention a pharmaceutical composition comprising at least one nucleic acid aptamer of the invention and suitable excipients and/or diluents and/or carrier.
The present invention shall be disclosed in detail in the following description also by means of non limiting examples referring to the following figures.
Cell Culture and Immunoblotting
Human glioma U87MG (American Type Culture Collection, ATCC no. HTB-14) and T98G (ATCC no. CRL-1690), U251MG and TB10 (kindly provided by A. Porcellini) cells were grown in Dulbecco's modified Eagle medium (DMEM) supplemented with 2 mM L-glutamine, 10% fetal bovine serum (Invitrogen, Carlsbad, Calif.). Human glioma, LN-18 (ATCC no. CRL-2610), LN-229 (ATCC no. CRL-2611) were grown in Advanced DMEM supplemented with 2 mM L-glutamine, 10% fetal bovine serum (Invitrogen, Carlsbad, Calif.). U87MG.ΔEGFR (Nishikawa R et al., 1994), a U87MG-derived cell line expressing a truncated mutant EGFR receptor due to an in-frame deletion of exons 2-7 from the extracellular domain (ΔEGFR or de 2-7 EGFR), were grown in DMEM supplemented with 2 mM L-glutamine, 10% fetal bovine serum, 500 μg/ml gentamycin (Invitrogen, Carlsbad, Calif.). Growth conditions for cell lines used were previously reported: human neuroblastoma SH-SY5Y and SK-N-BE cells (Esposito C L et al., 2008), human breast MCF7 and SKBR3 cells (Buckley M F et al., 1993), human NSCLC H460, Calu1, A459 and A549 cells (Zanca et al., 2008) and NIH3T3 cells (Cerchia et al., 2005)
To assess the functional effects of aptamers on U87MG cells, 300.000 cells per 3.5-cm plate were treated with the indicated amount of RNA aptamers or the starting RNA G0 pool after a short denaturation-renaturation step. Cell extracts and immunoblotting analysis were performed as described (Cerchia L et al., 2003). The primary antibodies used were: anti-ERK1 (C-16) (Santa Cruz Biotechnology, Santa Cruz, Calif., United States) and anti-phospho-44/42 MAP kinase (indicated as anti-pERK) monoclonal antibodies (E10), anti-Akt, anti-phospho-Akt (Ser473, indicated as anti-pAkt), anti-PDK1, anti-phospho-PDK1 (Ser241, indicated as anti-pPDK1), anti-phospho-cyclin D1 (Thr286, indicated as p-cyclin D1), anti-cyclin D1, all from Cell Signaling, Beverly, Mass., United States), anti-α-tubulin (DM 1A) (Sigma, St. Louis, Mo.). Four independent experiments were performed. Intensity of bands have been calculated using the NIH Image Program on at least two different expositions to assure the linearity of each acquisition. Fold values are expressed relative to the reference points, arbitrarily set to 1 (labelled with asterisk).
Cell Viability and Apoptosis Assays
NSCLC cell lines were plated in 96-well plates in triplicate and incubated at 37° C. in a 5% CO2 incubator. Cell were untreated or treated with CL4 or L0 starting poll as negative control at a final concentration of 200 nM.
Cell viability was evaluated following 24 hs of treatment with the CellTiter 96® AQueous One Solution Cell Proliferation Assay (Promega, Madison, Wis., USA), according to the manufacturer's protocol. Metabolically active cells were detected by adding 20 μl of MTS to each well. After 2 hrs of incubation, the plates were analysed in a Multilabel Counter (Bio-Rad).
Apoptosis was analyzed after 24 and 48 hs of CL4 treatment via propidium iodide incorporation in permeabilized cells by flow cytometry. The cells were washed in PBS and resuspended in 500 μl of a solution containing 0.1% sodium citrate, 0.1% Triton X-100 and 50 lg/ml propidium iodide (Sigma). Following incubation at 4° C. for 30 min in the dark, nuclei were analyzed with a Becton Dickinson FACScan flow cytometer. The percentage of elements in the hypodiploid region was calculated.
Whole-Cell SELEX
Transcription was performed in the presence of 1 mM 2′F-Py, 1 mM ATP, 1 mM GTP, 10 mM DTT, 0.5 u/μl RNAse inhibitors (Amersham Pharmacia), 10 μCi/μl 32P-αUTP (3000 Ci/mmol), 1 pmol/μl DNA and a mutant form of T7 RNA polymerase (2.5 u/μl T7 R&DNA polymerase, Epicentre) was used to improve yields. 2′F-Py RNAs were used because of their increased resistance to degradation by seric nucleases.
2′F-Py RNAs (800-300 pmol) were heated at 85° C. for 5 min in 1.5 ml of DMEM serum free, snap-cooled on ice for 2 min, and allowed to warm up to 37° C. Before incubation with the cells, 13.5 ml of medium were added to RNA to reach a final volume of 15 ml.
Glioma as Target
Counterselection Against T98G Cells
To avoid selecting for aptamers non-specifically recognizing the U87MG cell surface, the pool was first incubated for 30 min (up to round 9) or for 15 min (for the following rounds) at 37° C. with 107 T98G cells (150-mm cell plate), and unbound sequences were recovered for the selection phase. This step was meant to select sequences recognizing specifically the U87MG cells.
Selection Against U87MG Cells
The recovered sequences were incubated with 107 U87MG cells for 30 min at 37° C. and the U87MG-bound sequences were recovered after several washings with 5 ml of DMEM serum free by total RNA extraction (Ambion).
During the selection process, the authors progressively increased the selective pressure by increasing the number of washings (from one for the first cycle up to five for the last cycles) and by decreasing the incubation time (from 30 to 15 min from round 9). To follow the evolution of the pool the authors monitored the appearance of four-base restriction sites in the population by RFLP as previously described (Cerchia et al., 2005). After 14 rounds of selection, sequences were cloned with TOPO-TA cloning kit (Invitrogen, Carlsbad, Calif., United States) and analyzed.
NSCLC as Target
Counter-Selection on H460
To avoid selecting for aptamers non-specifically recognizing the A459 cell surface, the pool has been first incubated for 30 min (up to round 5) or for 15 min (for the following rounds) at 37° C. with 2×106 H460 cells (150-mm cell plate), and unbound sequences have been recovered for the selection phase.
Selection on A459
The sequences recovered from the counter-selection have been incubated with 2×106 A459 cells for 30 min (up to round 5) or for 15 min (for the following rounds) at 37° C. and the A459-bound sequences were recovered after several washings with DMEM serum free by total RNA extraction.
During the selection process, the authors progressively increased the selective pressure by: a) increasing the number of washings (from three for the first 9 cycles up to five for the last cycles); b) decreasing the incubation time (from 30 to 15 min starting from round 5); c) adding a second counter-selection step on H460 cells (from 1 to 2 counter-selections starting from round 4); d) adding polyI (polyinosinic acid) as a competitor for the last two selection cycles (round 13 and round 14).
Binding Analysis
Binding of individual aptamers (or of the starting pool as a control) to U87MG cells and T98G cells was performed in 24-well plates in triplicate with 5′-32P-labeled RNA. 3.5×104 cells per well were incubated with various concentrations of individual aptamers in 200 μl of DMEM serum free for 20 min at RT in the presence of 100 μg/ml polyinosine as a nonspecific competitor (Sigma, St. Louis, Mo.). After five washings of 500 μl DMEM, bound sequences were recovered in 300 μl of SDS 1%, and the amount of radioactivity recovered was counted. The background values obtained with the starting pool were subtracted from the values obtained with the specific aptamers. Apparent Kd values for each aptamers were determined by Linewaver Burk analysis according to the equation:
1/[complex]=Kd/[Cmax]×1/[aptamer]+1/[Cmax].
UCUUGCUGGUCUCACAGAAUUCGACAGGAGGCUCACAACAGGC
UUUAUAGCGUACUCUCAAUGUUCGACAGGAGGCUCACAACAGGC
CCGCUUACGCCUAAUGUCAUUUCGACAGGAGGCUCACAACAGGC
AAUGUGAUACCUCUUAUGAUUCGACAGGAGGCUCACAACAGGC
AAUGUGAUACCUCUUAUGAUUCGACAGGAGGCUCACAACAGGC
AAUGUGAUACCUCUUAUAAUUCGACAGGAGGCUCACAACAGGC
AAUGUGAUACCCCCUCAAUUCGACAGGAGGCUCACAACAGGC
CACUAGUUUAGCUUCCUACAUUCGACAGGAGGCUCACAACAGGC
CACUAGUUUAGCUUCCUACAUUCGACAGGAGGCUCACAACAGGC
AACGCUGACCUGCCAAUAAUUCGACAGGAGGCUCACAACAGGC
UGCGAGUCUUUUGUCUACAUUCGACAGGAGGCUCACAACAGGC
UGCGAGUCUUUUGUCUACAAUUCGACAGGAGGCUCACAACAGGC
UGCGAGUCUUUUUGUCUAUUCGACAGGAGGCUCACAACAGGC
CGCGAGUCUUUUGUCUAAUUCGACAGGAGGCUCACAACAGGC
UACCAUUGACUAGUACCUUCGACAGGAGGCUCACAACAGGC
ACUUGACAAUAUCAAAUGCCUUCGACAGGAGGCUCACAACAGGC
AACAUGAUCAAUCGCCUCAAUUCGACAGGAGGCUCACAACAGGC
AACAUGAUCAAUCGCCUCAAUUCGACAGGAGGCUCACAACAGGC
UUACCAAUCACUGACUUCGACAGGAGGCUCACAACAGGC
CUACUUGUAGUACCUUCGAUUCGACAGGAGGCUCACAACAGGC
AACCCAUGUUGAAUCACAAUUCGACAGGAGGCUCACAACAGGC
CCUUGUUCAAUUGUGACUUCUUCGACAGGAGGCUCACAACAGGC
CCACAAUUUUGAUGCCUUAUUUCGACAGGAGGCUCACAACAGGC
UAGUCACAUUGCUUGCGUUUCGACAGGAGGCUCACAACAGGC
UAGUCACAUUGCUUGCGUUUCGACAGGAGGCUCACAACAGGC
UCUCUGUCCCACUGUACUUGAUUCGACAGGAGGCUCACAACAGGC
GCCCACUUUUAGUGAACUCCAUUCGACAGGAGGCUCACAACAGGC
CUCGUAAUACAAGCCUUCAUUCGACAGGAGGCUCACAACAGGC
GUCUAUCGCAAUACUAUCCUUCGACAGGAGGCUCACAACAGGC
ACAUAGUUAGUCUCAUAAUUCGACAGGAGGCUCACAACAGGC
UACAAUCUCACAAUACCUUCUUCGACAGGAGGCUCACAACAGGC
UAAUAACCAAAUGCCUCUGAUUCGACAGGAGGCUCACAACAGGC
UAAUAACCAAAUGCCUCUGAUUCGACAGGAGGCUCACAACAGGC
UACAACAAAGCAUAGCCUCAUUCGACAGGAGGCUCACAACAGGC
AACGAACUAGCCUCUACUAUUCGACAGGAGGCUCACAACAGGC
CACAAAGCCUCUUACUAUAUUUCGACAGGAGGCUCACAACAGGC
AACAGCCACUGUCAUAAACUUCGACAGGAGGCUCACAACAGGC
CAUUCUCUCAACAAGCCUAUUCGACAGGAGGCUCACAACAGGC
UACUCUCAACUCAAAUAGCUUCGACAGGAGGCUCACAACAGGC
AAUAGCCUCUUAUAGUUCUUCGACAGGAGGCUCACAACAGGC
UAAUAGCCUCUUAUAGUUCUUCGACAGGAGGCUCACAACAGGC
UUAAUAGCCUCUUACAGAAUUCGACAGGAGGCUCACAACAGGC
AUACCACCUUGUCAUGUUAAUUCGACAGGAGGCUCACAACAGGC
AUUAAUUGUAUAGCCUUAUUCGACAGGAGGCUCACAACAGGC
CUUCCAAGCCUCUAUAGAACUUCGACAGGAGGCUCACAACAGGC
CUCCAAUUUCAAUCGACUAAUUCGACAGGAGGCUCACAACAGGC
AACAAACUAUAGCCAGACCUUUCGACAGGAGGCUCACAACAGGC
UAACAAAUUUCAGCCACUAAUUCGACAGGAGGCUCACAACAGGC
CUUCUGACGUACACUAAGUUCGACAGGAGGCUCACAACAGGC
CACAAAUGCCUUCACACAUAUUCGACAGGAGGCUCACAACAGGC
UCAUGCAUACAUUCCAACUAUUCGACAGGAGGCUCACAACAGGC
CUUGCCGCCUCCACGAACACUUCGACAGGAGGCUCACAACAGGC
UUAACGAACUGUUGAUGAUUCGACAGGAGGCUCACAACAGGC
CAGUAACCUAAGCCUUCUAUUCGACAGGAGGCUCACAACAGGC
AAAUGUUAACAUCUGCAAAUUCGACAGGAGGCUCACAACAGGC
AACAACAAUGAUUAGACGGCUUCGACAGGAGGCUCACAACAGGC
AAAUUCACAAGAUUUCAUUUUCGACAGGAGGCUCACAACAGGC
CUGCCACCAUACCUGUUGUAUUCGACAGGAGGCUCACAACAGGC
UCAAGUUAUUAGCAGCCUCAUUCGACAGGAGGCUCACAACAGGC
CAGCGAACUAGCCUCUACAUUCGACAGGAGGCUCACAACAGGC
UUACAACAGCCUCACAAUAAUUCGACAGGAGGCUCACAACAGGC
UGUCCAUAUCAUAAGCCUUUCGACAGGAGGCUCACAACAGGC
GUAACGUGCUUUGACGUCGAUUCGACAGGAGGCUCACAACAGGC
CAUAACCGUACUGCACGAUUCGACAGGAGGCUCACAACAGGC
CUCACACGAACGAUAAGAUUUCGACAGGAGGCUCACAACAGGC
UGCGAGUCUUUUGUCUAAUUUCGACAGGAGGCUCACAACAGGC
AUUGACCGUUCUCAUUAAUUCGACAGGAGGCUCACAACAGGC
AAUUUGCUGUCGUUACACAUUCGACAGGAGGCUCACAACAGGC
UAAUAACCAAAUGCCUCUGAUUCGACAGGAGGCUCACAACAGGC
UUAACGAACAGUUGAUGAUUCGACAGGAGGCUCACAACAGGC
CUCGACCAUCAUCACAAUAAUUCGACAGGAGGCUCACAACAGGC
CUCUACCUUCACAUCGUAAUUCGACAGGAGGCUCACAACAGGC
CUCACACGAACGAUAAGAUUUCGACAGGAGGCUCACAACAGGC
CACAAAUGCCUUCACACAUGUUCGACAGGAGGCUCACAACAGGC
AAAUUGAUCAAGCCUAGUAAUUCGACAGGAGGCUCACAACAGGC
GUAACGUACUUUGAUGUCGAUUCGACAGGAGGCUCACAACAGGC
UAUCAGCCUCAACAAUUAUUUUCGACAGGAGGCUCACAACAGGC
UACCAAUCAGCCUUUACUUCGACAGGAGGCUCACAACAGGC
CAACGAACUAGCCUCUACUAUUCGACAGGAGGCUCACAACAGGC
AAAUCUAUGCGCCUCAAUAUUCGACAGGAGGCUCACAACAGGC
GCUUAGCCUGUUCAACAUAAUUCGACAGGAGGCUCACAACAGGC
UUUGAGCCACUGCAGUAACAUUCGACAGGAGGCUCACAACAGGC
AAGUAUCAGUCAGAGGCAAUUCGACAGGAGGCUCACAACAGGC
CGCGAGUCUUUUGUCUACAUUCGACAGGAGGCUCACAACAGGC
UACGAGUCUUUUGUCUAUUCGACAGGAGGCUCACAACAGGC
UGCGAGUCUUUUGUCUAAUUCGACAGGAGGCUCACAACAGGC
GACCAAAUGUGUGAUACCUUCGACAGGAGGCUCACAACAGGC
UUCCGGCAGUAUGUGAAGCAUUCGACAGGAGGCUCACAACAGGC
UUAGCGAGCUGUUGAUGAUUCGACAGGAGGCUCACAACAGGC
UUAACGAGCUGUUGAUGGUUCGACAGGAGGCUCACAACAGGC
UCUCAAUGAUGUGUGCUUUCGACAGGAGGCUCACAACAGGC
UCUCAAUGAUGUGUGUCUUUCGACAGGAGGCUCACAACAGGC
UCCCAAUGAUGUGUGCUUUCGACAGGAGGCUCACAACAGGC
UCUCAAUGAUGUGUGCUUUCGACAGGAGGCUCACAACAGGC
UAAUAACCAAAUGCCUCUGAUUCGACAGGAGGCUCACAACAGGC
AAUGUGAUACCUCUUAUGAUUCGACAGGAGGCUCACAACAGGC
AAUGUGAUACCUCUUAUGAUUCGACAGGAGGCUCACAACAGGC
AAUGUGAUACCUCUUAUGGUUCGACAGGAGGCUCACAACAGGC
AAUGUGAUACCUCUUAUGAUUCGACAGGAGGCUCACAACAGGC
AAACCCAACCGUUGUGUACCUUUCGACAGGAGGCUCACAACAGGC
AUCUCAAUGAUGUGUGCUUUCGACAGGAGGCUCACAACAGGC
GUAAUCUCAUUGCGAGCUCUUCGACAGGAGGCUCACAACAGGC
GUAAUCUCAUUGCGAGCUCUUCGACAGGAGGCUCACAACAGGC
GUAAUUCAAGAGCGCAAGUUCGACAGGAGGCUCACAACAGGC
CAAAUACAAGCGUUAACAUUCGACAGGAGGCUCACAACAGGC
UGCCAUGUGAAAGCUUUCGACAGGAGGCUCACAACAGGC
UUUUCAGUCUUGAUACCUGUUCGACAGGAGGCUCACAACAGGC
CAAAUACAAGCGUUAACAUUCGACAGGAGGCUCACAACAGGC
CGCUUCAAUUUCGCAGCAUUCGACAGGAGGCUCACAACAGGC
CACAGCCUCUAUAACAACUUUCGACAGGAGGCUCACAACAGGC
UUCUCCUACCUUUUGUGAUUCGACAGGAGGCUCACAACAGGC
UUCUAAUCUACCAUGAGCAUUCGACAGGAGGCUCACAACAGGC
AACAUGAUCAAUCGCCUCAAUUCGACAGGAGGCUCACAACAGGC
GGAUACAAUGUGGAGCCAUAUUCGACAGGAGGCUCACAACAGGC
CGGCUGUGAGACUUCAGAAUUCGACAGGAGGCUCACAACAGGC
CGGCUGUGAGACUUCAGGAUUCGACAGGAGGCUCACAACAGGC
CGGCUGUGAGACUUCGGAAUUCGACAGGAGGCUCACAACAGGC
UGGCUGUGAGACUUCAGAAUUCGACAGGAGGCUCACAACAGGC
CGUUCUGUUUGUGUGAGUAUUCGACAGGAGGCUCACAACAGGC
CGUUCUGUUUGUGUGAGUAUUCGACAGGAGGCUCACAACAGGC
CGUUCUGUUGUGUGAGUAUUCGACAGGAGGCUCACAACAGGC
GCUAGUUUAGCUUUCUACAUUCGACAGGAGGCUCACAACAGGC
CUCGUAAUACAAGCCUUCAUUCGACAGGAGGCUCACAACAGGC
GUAACGUGCUUUGAUGUCGAUUCGACAGGAGGCUCACAACAGGC
Enrichment of Selection for a Complex Target, RFLP, Enrichment of Recovery, Differential Binding on Different Cell Lines
In order to isolate cell specific ligands for a given tumor cell phenotype, the authors used as a model system, stable human glioma cell lines. Stable cell lines have the advantage that they can be kept under well controlled growth conditions and that they remain stable all along the SELEX procedure. The authors used as target for the selection steps the human malignant glioma cell line, U87MG and for the counterselection steps the T98G. These two cell lines differ for the potential to form tumors in nude mice and for resistance to radiation-induced cell death. U87MG being highly tumorigenic and radio-resistant while the T98G are poorly tumorigenic and sensitive to radiations. On the other hand, these cell lines share the same altered cellular pathways as both harbor p14arf/p16 deletion and PTEN mutation. The major difference found between the two cell lines is the levels of ErbB2 and pErk, that are higher in U87MG than in T98G, while pAkt and NCAM levels are similar (data not shown). The relative levels of these four molecules were monitored at each cycle of the SELEX procedure to verify and standardize the growth conditions of the cells.
A library of 2′Fluoro Pyrimidines (2′F-Py), nuclease-resistant RNAs was utilized for differential SELEX against intact cells (
The method of the present invention is particularly efficient in selecting highly selective aptamers since at each SELEX cycle, the pool of aptamers is deprived of aptamers that recognize common cellular antigens present at high levels on the surface of both control and target cell lines. As a consequence, in the pool is impoverished of unwanted sequences, thus the aptamer for the specific rare antigens will be able to bind its target even if embedded in a complex target. The protocol consists of applying at each round one or more counterselection steps before each positive selection step.
During the selection process, the authors progressively increased the selective pressure by changing both incubation and washing conditions (
Cloning and Distribution of Individual Sequences
After 14 rounds of selection, the pool, named G14, was enriched for aptamers that preferentially bind to U87MG cells when compared with the in vitro binding efficiency on T98G cells and compared to the binding of the naïve starting pool (
A panel of 71 sequences were cloned from the pool G14 and aptamers were grouped in families based on their primary sequence similarity (
Using the starting pool as a control, binding of individual aptamers to U87MG and T98G cells was then performed. In order to screen for individual ligand aptamers that efficiently target U87MG cells, at least one member for each family (a total of 21 aptamers were tested) was first analysed at 500 nM. At this concentrations, 8 aptamers display up to a five-fold increase of binding to U87MG cells with respect to the starting pool, the remaining 13 aptamers having no specific binding for U87MG. The results are shown in
As shown in Table 1, these 8 sequences bind at high affinity (with Kd ranging between 38 nM and 710 nM) the U87MG cells and have no or low affinity for T98G (not shown).
Bioinformatic Analysis of Individual Sequences
Four of the eight aptamers considered (B22, B15, C19 and D20) have unrelated primary sequences and predicted 2D folded structures. Two of them (C13 and A5) differ for the presence of two cytosine residues [C42 C43] that are only present in C13 whose presence however doesn't alter the affinity for the target cells (see Table 1). Consistently, the predicted secondary structures are unaltered by the presence of C42, C43 (
Binding on Unrelated and Glioma Cell Lines
The identification of a small set of aptamers that may distinguish the U87MG cells from the T98G cells raises the obvious question of whether these aptamers may also bind to other cell types. To this aim, the authors determined the relative binding potential of each aptamer to several cell lines. The authors first determined the cell type specificity by measuring the binding of each aptamer on a panel of unrelated cell lines. They found that the aptamers did not bind to fibroblast NIH3T3 and did not recognize other cancer types including human neuroblastoma (SKNBE and SHSY5Y), lung (H460 and A459) and breast (MCF7 and SKBR3) cells (
Biological Activities
Biological activities of each aptamer have been thus verified in U87MG cells. As previously demonstrated for the anti RET receptor tyrosine kinase D4 aptamer, high affinity aptamer binding to an extracellular receptor may inhibit activity of downstream transducing molecules, as ERK family members. Therefore, the authors first determined whether any of the U87MG specific aptamer may interfere with the presence of the phosphorylated active Akt and Erk 1/2. Surprisingly, five of the tested aptamers (A9, D9, C13, A5 and B22) inhibited ERK phosphorylation, compared to the control starting pool and to the other aptamers (B15, C19, D20) (
To further confirm the biological activity of A9, D9, C13, A5 and B22, the authors determined the extent of inhibition of expression of the cell cycle-related protein, cyclin D1 and of phosphorylation of ERK 1/2 upon treatment of U87MG cells with aptamers for increasing time periods. As shown in
As shown in
To extend the validity of the whole-cell SELEX approach to a different cell system, the authors have also performed the selection on NSCLC cells.
In order to generate RNA-aptamers able to discriminate between TRAIL-resistant and TRAIL-sensitive cell phenotype, the authors have selected for the SELEX method, two different cell lines of human lung carcinoma among four different NSCLC: A459, Calu1, H460, and A549.
These NSCLC have been extensively characterized for their resistance to the cytotoxic effects of TRAIL and it has been established that the human lung A459 (epidermoid lung carcinoma) cells (p53 null) are resistant to TRAIL, while the H460 (lung epithelial cell carcinoma) cells (wild type p53) are highly sensitive to TRAIL (Zanca C. et al., 2008).
Furthermore, these four NSCLC have been characterized for their expression of molecules participating in the apoptotic process and for their different sensitivity to the chemotherapies that are currently in use for the treatment of lung cancer: paclitaxel, cisplatinum, carboplatin, navelbine and gemcitabine. The experiments revealed that the cell lines tested are all resistant to cisplatinum, cambomplatinum, navelbine and gemcitabine. By contrast, they are characterised by different sensitivity to paclitaxel: two cell lines are resistant (A459, Calu1) and two are sensitive (H460, and A549). As a further characterization, the authors have performed immunoblotting analyses on cell extracts from the four cell lines and among them, Calu1 and H460 cells showed the highest and the lowest, respectively, levels of the analyzed proteins, for examples EGFR, PED, c-FLIP (not shown).
The authors applied the same approach as for glioma cells by using a selection step on A459 cells preceded by counter-selection on H460.
RFLP analysis performed on the pool from each round of selection (named L1 to L14) and on the starting pool (L0) revealed stabilized profiles following 14 rounds of selection.
Enrichment of Selection for a Complex Target, RFLP, Enrichment of Recovery, Differential Binding on Different Cell Lines
In order to isolate cell specific ligands for a given tumor cell phenotype, the authors used as a model system, stable human NSCLC cell lines. Stable cell lines have the advantage that they can be kept under well controlled growth conditions and that they remain stable all along the SELEX procedure. The authors used as target for the selection steps the human malignant NSCLC cell line, A459 and for the counterselection steps the H460. These NSCLC have been extensively characterized for their resistance to the cytotoxic effects of TRAIL and it has been established that the human lung A459 (adenocarcinoma) cells (wild type p53) are resistant to TRAIL, while the H460 (lung epithelial cell carcinoma) cells (wild type p53) are highly sensitive to TRAIL (Zanca C. et al., 2008 and authors personal communication).
Furthermore, we have characterised these two NSCLC for their different sensitivity to the chemotherapies that are currently in use for the treatment of lung cancer: paclitaxel, cisplatinum. The experiments revealed A459 are resistant to both chemotherapeutics while the H460 are sensitive. As a further characterization, the authors have performed immunoblotting analyses on cell extracts from two cell lines and A459 and H460 cells showed the highest and the lowest, respectively, levels of the analyzed proteins, for examples EGFR, PED, c-FLIP (not shown).
A library of 2′Fluoro Pyrimidines (2′F-Py), nuclease-resistant RNAs was utilized for differential SELEX against intact cells (
The method of the present invention is particularly efficient in selecting highly selective aptamers since at each SELEX cycle, the pool of aptamers is deprived of aptamers that recognize common cellular antigens present at high levels on the surface of both control and target cell lines. As a consequence, in the pool is impoverished of unwanted sequences, thus the aptamer for the specific rare antigens will be able to bind its target even if embedded in a complex target. The protocol consists of applying at each round one or more counterselection steps before each positive selection step.
During the selection process, the authors progressively increased the selective pressure by changing both incubation and washing conditions (
Cloning and Distribution of Individual Sequences
After 14 rounds of selection, the pool, named L14, was enriched for aptamers that preferentially bind to A459 cells when compared with the in vitro binding efficiency on H460 cells and compared to the binding of the naïve starting pool (
A panel of 42 sequences were cloned from the pool L14 and aptamers were grouped in families based on their primary sequence similarity (
The selective induction of cell death by drugs or cytokines in cancer treatment is the goal of new therapeutic strategies. Apoptosis is believed to be the major mechanism of chemotherapy-induced cell death in cancer. However, tumour cells often retain the ability to evade drug-induced death signals but the mechanisms that determine resistance are largely unknown and it is therefore urgent to identify the molecules involved as potential therapeutic targets.
Biochemical Properties
The whole-cell SELEX procedure developed against non small cell lung carcinoma (NSCLC) let the authors to obtain a pool of aptamers that specifically bind to chemo-resistant A459 cells. The secondary structure prediction of one of these aptamers (named CL4) (including the fixed-primer sequences at extremities) was predicted by using MFOLD software (
Binding on NSCLC and Unrelated Cell Lines
The identification of a small set of aptamers that may distinguish the A459 cells from the H460 cells raises the obvious question of whether these aptamers may also bind to other cell types. To this aim, using the starting pool as a control, the authors determined the relative binding potential of one of these aptamers, the CL4 aptamer to several cell lines. The aptamer binds to different extents to human NSCLC cell lines (A459, H460, Calu1, A549). As expected, the best binding was found with cells used for the selection, the A459, and the worst binding with cells used for counterselection, the H460. Further, the authors show that the CL4 aptamer binds at a very low extent to the human neuroblastoma, SKNBE and glioma, U87MG and T98G cell lines, and does not bind to the human breast MCF7 and T47D (
Biological Activity of CL4
Biological activities of the CL4 aptamer has been thus verified in A459 and H460 cells. By using a MTT assay, the authors first determined whether the CL4 may interfere with the cell viability. Interestingly, treating the A459 for 24 hrs, but not the cells used for counterselection, H460, inhibited the cell viability of around 60%. Inhibition was likely the consequence of increased apoptosis as shown by the induction of the percent of apoptotic cells as assessed by propidium iodine incorporation assay (
As mentioned above, four out of the eight aptamers from the Glioma selection (B22, B15, C19 and D20) have unrelated primary sequences and predicted 2D folded structures. Two (C13 and A5) differ for the presence of two cytosine residues (cyt42 and cyt43) that are only present in C13 whose presence however doesn't alter the affinity for the target cells (see Table 1). Comparing the predicted secondary structures defines a conserved stem-loop (residues 1-39) that is unaltered by the presence of cyt42 and cyt43. Consistently the shortened sequence, constituted of the first 39 residues, is sufficient to bind the U87MG cells (
| Number | Date | Country | Kind |
|---|---|---|---|
| 08105194 | Sep 2008 | EP | regional |
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/EP2009/061276 | 9/1/2009 | WO | 00 | 2/28/2011 |
| Publishing Document | Publishing Date | Country | Kind |
|---|---|---|---|
| WO2010/023327 | 3/4/2010 | WO | A |
| Number | Date | Country |
|---|---|---|
| 2005093097 | Oct 2005 | WO |
| 2006096754 | Sep 2006 | WO |
| 2008019142 | Feb 2008 | WO |
| Entry |
|---|
| Pestourie C., et al., “Comparison of different strategies to select aptamers against a transmembrane protein target”, Oligonucleotides, vol. 16, No. 4, 2006, pp. 323-335. |
| Cerchia L., et al., “Neutralizing aptamers from whole-cell SELEX inhibit the RET Receptor Tyrosine Kinase”, PLOS Biology, vol. 3, No. 4, Apr. 2005, pp. 697-704. |
| Wang C., et al., “Single-stranded DNA aptamers that bind differentiated but not parental cells: subtractive systematic evolution of ligands by exponential enrichment”, Journal of Biotechnology, Elsevier Science Publishers, Amsterdam, NL, vol. 102, No. 1, Apr. 10, 2003, pp. 15-22. |
| Blank M., et al., “Systematic evolution of a DNA aptamer binding to rat brain tumor microvessels”, Journal of Biological Chemistry, American Society of Biolochemical Biologists, Birmingham, US, vol. 276, No. 19, May 11, 2001, pp. 16464-16468. |
| Number | Date | Country | |
|---|---|---|---|
| 20110166213 A1 | Jul 2011 | US |
