Patent Application
20180320211
The present invention belongs to the field of bioengineering enzymes, and in particular, to a method for preparing rebaudioside M by using a Saccharomyces cerevisiae process.
Sweetening agent, a type of food additives widely applied to food, beverages, and candies production, may be added during the food production process, and may also be appropriately diluted to replace sucrose during the home baking process. Sweetening agent comprises natural and artificial sweetening agents, with the former being, for example, sucrose, high fructose corn syrup, honey, or the like and the later being, for example, aspartame, saccharin, or the like.
Stevioside is a type of natural sweetening agent extracted from Stevia rebaudiana plant, which currently has been widely used in food and beverages. Extracts of Stevia rebaudiana contain a plurality of steviosides including rebaudioside; the different batch components of naturally extracted stevioside vary greatly, requiring subsequent purification. Current commercial products of rebaudioside A contain some other steviosides such as rebaudiosides C, D, and F or the like. Stevioside prepared by extraction method usually may have some impurities mixed therein, which may have certain influence on the range of its usage. Rebaudioside M has advantages compared with rebaudioside A, but it has a low content in Stevia rebaudiana leaves and is only detected in Stevia rebaudiana plant “Morita” (2010, J. Appl. Glycosci., 57, 199-209). Commercial production of rebaudioside M has not been made available at present.
Chinese patent CN103397064A discloses a method for enzymatically preparing rebaudioside M, in which in the presence of glucosyl donors, UDP-glucosyltransferase prepared by Escherichia coli or Escherichia coli containing UDP-glucosyltransferase is utilized to catalyze rebaudioside A or rebaudioside D to produce rebaudioside M. In this method, the genetic engineering bacteria, Escherichia coli, used for producing UDP-glucosyltransferase is not a safe strain (generally regarded as safe (GRAS)). This is because a toxin is produced during its cultivation process; thus the produced rebaudioside M therefrom cannot be used directly. Furthermore, while the Escherichia coli is prokaryote, the gene of UDP-glucosyltransferase originates from eukaryote.
Because of the complexity of the protein expression process of eukaryote and prokaryote, the expression of eukaryotic-derived enzymes by prokaryotic bacteria affects the activity of the enzyme. Saccharomyces cerevisiae is a known safe strain; but expression quantity of exogenous gene expression in Saccharomyces cerevisiae is low.
The present invention aims to solve the technical problem that the produced rebaudioside M in prior art has a safety concern which arises because a toxin is produced by engineering bacteria itself during the process for preparing rebaudioside M utilizing Escherichia coli containing UDP-glucosyltransferase. Provided in the present invention is a method for preparing rebaudioside M by utilizing a GRAS strain in an enzymatic process, and the method can produce a high purity rebaudioside M product at a lower cost and with a shorter cycle.
The following technical solution is employed by the present invention to solve the technical problem described above.
The present invention discloses a method for preparing rebaudioside M by utilizing Saccharomyces cerevisiae in an enzymatic process. In the presence of glucosyl donors, recombinant Saccharomyces cerevisiae containing UDP-glucosyltransferase or UDP-glucosyltransferase prepared therefrom is used to catalyze rebaudioside A or rebaudioside D for producing rebaudioside M; the recombinant Saccharomyces cerevisiae is constructed using the following method: introducing a strong promoter into a plasmid to obtain a vector plasmid; inserting the gene of the UDP-glucosyltransferase into the vector plasmid at an enzyme cutting site so as to obtain an expression vector under the control of the strong promoter; and then transforming the Saccharomyces cerevisiae to obtain the recombinant Saccharomyces cerevisiae.
In the foregoing method for preparing rebaudioside M, the UDP-glucosyltransferase is UGT-A from Stevia rebaudiana and/or UGT-B from Oryza sativa.
In the foregoing method for preparing rebaudioside M, an amino acid sequence of the UGT-A has at least 60% identity to an amino acid sequence shown by SEQ ID NO. 1 in a sequence listing; an amino acid sequence of the UGT-B from the Oryza sativa has at least 60% identity to an amino acid sequence shown by SEQ ID NO. 3 in the sequence listing.
In the foregoing method for preparing rebaudioside M, the amino acid sequence of the UGT-A is shown as SEQ ID NO. 1 in the sequence listing; the amino acid sequence of the UGT-B is shown as SEQ ID NO. 3 in the sequence listing.
In the foregoing method for preparing rebaudioside M, the enzyme cutting sites are HindIII and XbaI.
In the foregoing method for preparing rebaudioside M, the strong promoter is ADH2 or TEF1.
In the foregoing method for preparing rebaudioside M, the plasmid is pYES2.
In the foregoing method for preparing rebaudioside M, the method for constructing the vector plasmid is introducing an AgeI enzyme cutting site into the plasmid, and then introducing the strong promoter through the AgeI/HindIII site.
In the foregoing method for preparing rebaudioside M, the Saccharomyces cerevisiae is Saccharomyces cerevisiae BY4742.
In the foregoing method for preparing rebaudioside M, the glucosyl donors is UDP-glucose or UDP-glucose regeneration system consisted of sucrose, sucrose synthetase, and UDP.
In the foregoing method for preparing rebaudioside M, the recombinant Saccharomyces cerevisiae is affected by a cell-permeating agent to form recombinant Saccharomyces cerevisiae permeabilized cells for catalysis.
In the foregoing method for preparing rebaudioside M, the recombinant Saccharomyces cerevisiae is cultivated and then ultrasonically disrupted in an ice bath, and the crushed liquid is centrifuged and the supernatant is collected to obtain lyophilized powder of UGT-A or UGT-B for catalysis.
In the foregoing method for preparing rebaudioside M, the catalytic reaction is carried out in an aqueous system at a temperature of 4° C.˜50° C. and a pH of 5.0˜9.0.
Because of the implementation of the above technical solutions, the present invention has the following advantages compared with the prior art:
The invention is further described through FIGURES and detailed description.
Hereinafter rebaudiosides A, D, and M are respectively termed as Reb A, Reb D, and Reb M for short.
The structural formulae of these three are described in formula I, II, and III respectively.
Four routes for synthesizing Reb M are provided by the present invention:
According to the present invention, the used -UGT-A or UGT-B may exist in the form of lyophilized enzyme powder or in the recombinant Saccharomyces cerevisiae.
The method for obtaining UGT-A or UGT-B is as follows:
A recombinant Saccharomyces cerevisiae expression strain of UGT-A or UGT-B is obtained by utilizing molecular cloning technique and genetic engineering technique; then the recombinant Saccharomyces cerevisiae is fermented to obtain recombinant cells containing UGT-A or UGT-B, or to obtain lyophilized powder of UGT-A or UGT-B.
The molecular cloning technique and genetic engineering technique described herein are known, unless otherwise specified. The molecular cloning technique may be found in ‘Molecular Cloning: A Laboratory Manual’ (3rd Edition) (J. Sambrook, 2005).
The expression steps of the recombinant strain herein constructed by employing genetic engineering technique are as follows:
Recombinant cells containing UGT-A or UGT-B, or lyophilized powder of UGT-A or UGT-B are prepared by utilizing the recombinant Saccharomyces cerevisiae expression strain containing UGT-A or UGT-B.
The specific steps of the foregoing method are described below via examples.
Based on the sequence of pYES2 plasmid, primers pYES2-AgeI-F(GATGATCCACTAGTAACCGGTAGAAGCCGCCG) and pYES2-AgeI-R(CGGCGGCTTCTACCGGTTACTAGTGGATCATC) were designed; an AgeI cutting site was introduced into the pYES2 plasmid through expand-loop PCR to obtain plasmid pYES2-AgeI.
INVSc2 genome was used as a template, primers ADH2-F(CACTAGTAACCGGTGCAAAACGTAGGGGC) and ADH2-R(GTCCAGCCCAAGCTTGTATTACGATATAG) were designed; after PCR amplification, the gene fragment of promoter ADH2 was obtained, then the gel was cut and recycled. The resulting gene fragment was digested with AgeI/HindIII; then the purified fragment was recovered; the fragment was ligated into corresponding enzyme cutting site of pYES2-AgeI by adding T4 ligase to obtain pEZTEF1 plasmid.
Based on the nucleotide sequence shown in SEQ ID NO. 2 in a sequence listing, the gene fragment of UGT-A was synthesized by gene and then was ligated into a vector pUC57 to obtain PUC57-UGT-A (Suzhou GENEWIZ Biotechnology Ltd.). Using pUC57-UGT-A as a template, gene UGT-A was obtained through PCR; HindIII and XbaI enzyme cutting sites were added to both ends of gene UGT-A; the UGT-A gene fragment was digested by restrictive endonuclease HindIII and XbaI; then the purified fragment was recovered; the fragment was ligated into respective enzyme cutting sites of pEZADH2 by adding T4 ligase to obtain pEZADH2-UGT-A plasmid; the plasmid was introduced into the Saccharomyces cerevisiae BY4742 to obtain a recombinant EZ-A strain.
The monoclonal plate was picked to SC-Ura+2% glucose medium, incubated at 30° C. at 200 rpm for 48 h, and EZ-A strain was inoculated to 50 ml YPD+1% glucose medium at 2% for oscillation at 30° C., and incubated at 200 rpm for 48 h. Cells were collected through centrifugation (4,000 rpm, 10 min); and the collected cells were resuspended with 5 ml of 0.1 mol/L phosphate buffer (pH 7.0) to obtain the recombinant cells containing UGT-A.
The recombinant cells containing UGT-A prepared in example 1 were ultrasonically disrupted in ice bath; the homogenate was centrifuged (8,000 rpm, 10 min); and the supernatant was collected and lyophilized for 24 h to obtain lyophilized powder of UGT-A.
Method 1: 1 g of wet cells of the recombinant cells of UGT-A prepared in Example 1 were weighed and resuspended to 20 ml of 75 mmol imidazole-0.1 mol/L KCl-10 mmol/L Mgcl2+1 ml terpene:ethanol (v/v)=1:4, 25° C., shaken at 160 rpm for 15 min; cells were collected through centrifugation (4,000 rpm, 10 min) and concentrated 10 times and resuspended in 0.1 mol/L Phosphoric acid buffer (pH 7.0) to obtain UGT-A recombinant Saccharomyces cerevisiae permeabilized cells for catalysis.
Method 2: The monoclonal plate was picked to an SC-Ura+2% glucose medium; then the medium was shaken for cultivating at 30° C. and 200 rpm for 48 h; EZ-A strain of 2% ratio was inoculated to 50 ml YPD+1% glucose medium; after the medium was shaken for cultivating at 30° C. and 200 rpm for 48 h, 500 μl of 200/% Triton X-100 (V/V) was added to the medium and the medium was shaken for another 2 h; cells were collected through centrifugation (4,000 rpm, 10 min); and the collected cells were resuspended with 5 ml of 0.1 mol/L phosphate buffer (pH 7.0) to obtain the recombinant Saccharomyces cerevisiae permeabilized cells containing UGT-A for catalysis.
Based on the sequence of pYES2 plasmid, primers pYES2-AgeI-F(GATGATCCACTAGTAACCGGTAGAAGCCGCCG) and pYES2-AgeI-R(CGGCGGCTTCTACCGGTTACTAGTGGATCATC) were designed; an AgeI cutting site was introduced into the pYES2 plasmid through expand-loop PCR to obtain plasmid pYES2-AgeI.
INVSc2 genome was used as a template, primers TEF1-F(CCACTAGTAACCGGTCACACACCATAGCTTC) and TEF1-R(GTCCAGCCCAAGCTTTGTAATTAAAACTTAG) were designed; after PCR amplification, the gene fragment of promoter TEF1 was obtained, then the gel was cut and recycled. The resulting gene fragment was digested with AgeI/HindIII; then the purified fragment was recovered; the fragment was ligated into corresponding enzyme cutting site of pYES2-AgeI by adding T4 ligase to obtain pEZTEF1 plasmid.
Based on the nucleotide sequence shown by SEQ ID NO. 4 in a sequence listing, the gene fragment of UGT-B was synthesized by gene and then was ligated into a pUC57 vector to obtain PUC57-UGT-B (Suzhou GENEWIZ Biotechnology Ltd.). Using pUC57-UGT-B as a template, gene UGT-B was obtained through PCR; HindIII and XbaI enzyme cutting sites were added to both ends of gene UGT-B; the gene UGT-B fragment was digested by restrictive endonuclease HindIII and XbaI; then the purified fragment was recovered; the fragment was ligated into respective enzyme cutting site of pEZTEF1 by adding T4 ligase to obtain pEZTEF1-UGT-B plasmid; the plasmid was introduced into the Saccharomyces cerevisiae BY4742 to obtain a recombinant EZ-B strain.
The monoclonal plate was picked to SC-Ura+2% glucose medium, incubated at 30° C. at 200 rpm for 48 h, and EZ-A strain was inoculated to 50 ml YPD+1% glucose medium at 2% for oscillation at 30° C., and incubated at 200 rpm for 48 h. Cells were collected through centrifugation (4,000 rpm, 10 min); and the collected cells were resuspended with 5 ml of 0.1 mol/L phosphate buffer (pH 7.0) to obtain the recombinant cells containing UGT-B.
The recombinant cells containing UGT-B prepared in example 4 were ultrasonically disrupted in ice bath; the homogenate was centrifuged (8,000 rpm, 10 min); and the supernatant was collected and lyophilized for 24 h to obtain lyophilized powder of UGT-B.
Method 1: 1 g of wet cells of the recombinant cells of UGT-B prepared in Example 1 were weighed and resuspended to 20 ml of 75 mmol imidazole-0.1 mol/L KCl-10 mmol/L Mgcl2+1 ml terpene:ethanol (v/v)=1:4, 25° C., shaken at 160 rpm for 15 min; cells were collected through centrifugation (4,000 rpm, 10 min) and concentrated 10 times and resuspended in 0.1 mol/L Phosphoric acid buffer (pH 7.0) to obtain UGT-B recombinant Saccharomyces cerevisiae permeabilized cells for catalysis.
Method 2: The monoclonal plate was picked to an SC-Ura+2% glucose medium; then the medium was shaken for cultivating at 30° C. and 200 rpm for 48 h; EZ-B strain of 2% ratio was inoculated to 5 ml YPD+1% glucose medium; after the medium was shaken for cultivating at 30° C. and 200 rpm for 48 h, 500 μl of 20% Triton X-100 (V/V) was added to the medium and the medium was shaken for another 2 h; cells were collected through centrifugation (4,000 rpm, 10 min); and the collected cells were resuspended with 5 ml of 0.1 mol/L phosphate buffer (pH 7.0) to obtain the recombinant Saccharomyces cerevisiae permeabilized cells containing UGT-B for catalysis.
Based on the sequence of pYES2 plasmid, primers pYES2-AgeI-F(GATGATCCACTAGTAACCGGTAGAAGCCGCCG) and pYES2-AgeI-R(CGGCGGCTTCTACCGGTTACTAGTGGATCATC) were designed; an AgeI cutting site was introduced into the pYES2 plasmid through expand-loop PCR to obtain plasmid pYES2-AgeI.
INVSc2 genome was used as a template, primers ADH1-F(TCCACTAGTAACCGGTCTCCCTAACATGTAGG) and ADH1-R(GTCCAGcccAAGCTTAGTTGATTGTATGC) were designed; after PCR amplification, the gene fragment of promoter ADH1 was obtained, then the gel was cut and recycled. The resulting gene fragment was digested with AgeI/HindIII; then the purified fragment was recovered; the fragment was ligated into corresponding enzyme cutting site of pYES2-AgeI by adding T4 ligase to obtain pEZADH1 plasmid.
Based on the nucleotide sequence shown in SEQ ID NO. 2 or the nucleotide sequence shown by SEQ ID NO. 6 in a sequence listing, the gene fragment of SUS was synthesized by gene and then was ligated into a pUC57 vector to obtain PUC57-SUS (Suzhou GENEWIZ Biotechnology Ltd.). Using pUC57-SUS as a template, gene SUS was obtained through PCR; HindIII and XbaI enzyme cutting sites were added to both ends of gene SUS; the gene SUS fragment was digested by restrictive endonuclease HindIII and XbaI; then the purified fragment was recovered; the fragment was ligated into respective enzyme cutting site of pEZADH1 by adding T4 ligase to obtain pEZADH1-SUS plasmid; the plasmid was introduced into the Saccharomyces cerevisiae BY4742 to obtain a recombinant EZ-S strain.
The monoclonal plate was picked to SC-Ura+2% glucose medium, incubated at 30° C. at 200 rpm for 48 h, and EZ-S strain was inoculated to 50 ml YPD+1% glucose medium at 2% for oscillation at 30° C., and incubated at 200 rpm for 48 h. Cells were collected through centrifugation (4,000 rpm, 10 min), and the collected cells were resuspended with 5 ml of 0.1 mol/L phosphate buffer (pH 7.0) to obtain the recombinant cells containing SUS for catalysis.
The recombinant cells containing SUS prepared in example 7 were ultrasonically disrupted in ice bath; the homogenate was centrifuged (8,000 rpm, 10 min); and the supernatant was collected and lyophilized for 24 h to obtain lyophilized powder of SUS.
Method 1: 1 g of wet cells of the recombinant cells of SUS prepared in Example 7 were weighed and resuspended to 20 ml of 75 mmol imidazole-0.1 mol/L KCl-10 mmol/L Mgcl2+1 ml terpene:ethanol (v/v)=1:4, 25° C., shaken at 160 rpm for 15 min; cells were collected through centrifugation (4,000 rpm, 10 min) and concentrated 10 times and resuspended in 0.1 mol/L Phosphoric acid buffer (pH 7.0) to obtain SUS recombinant Saccharomyces cerevisiae permeabilized cells for catalysis.
Method 2: The monoclonal plate was picked to an SC-Ura+2% glucose medium; then the medium was shaken for cultivating at 30° C. and 200 rpm for 48 h; EZ-S strain of 2% ratio was inoculated to 50 ml YPD+1% glucose medium; after the medium was shaken for cultivating at 30° C. and 200 rpm for 48 h, 500 μl of 200/% Triton X-100 (V/V) was added to the medium and the medium was shaken for another 2 h; cells were collected through centrifugation (4.000 rpm, 10 min); and the collected cells were resuspended with 5 ml of 0.1 mol/L phosphate buffer (pH 7.0) to obtain the recombinant Saccharomyces cerevisiae permeabilized cells containing SUS for catalysis.
100 mL of 0.1 mol/L phosphate buffer (pH 7.0), 0.224 g of UDP, 34.2 g of sucrose, 0.2 g of Reb D, 1 g lyophilized powder of UGT-A and 0.4 g lyophilized powder of SUS were sequentially added to the reaction system and uniformly mixed.
The mixture was placed in a 37° C. water bath and stirred at 200 rpm for 18 h. After the reaction was complete, 300 μl of the reaction liquid was taken and added therein 600 μl of 3% formic acid and mixed; centrifuged at 10,000 rpm for 5 min; and high performance liquid chromatography was used to detect the supernatant filtration membrane (chromatographic conditions: column:Agilent eclipse sb-C18 4.6×150 mm; detection wavelength: 210 nm; mobile phase: methanol:water=68%:32%; flow rate: 1.0 mL/min; column temperature: 30° C.). The conversion ratio of Reb D was more than 900/o. After the supernatant was purified through post-processing such as isolating with resin and crystallizing, 0.1 g of Reb M was obtained with a purity thereof greater than 99%. The 1HNMR spectrum thereof is shown in
100 mL of o.1 mol/L phosphate buffer (pH 7.0), 0.18 g of UDP, 41.04 g of sucrose, 0.2 g of Reb A, 2 g lyophilized powder of UGT-A, 1 g lyophilized powder of UGT-B, and 0.5 g lyophilized powder of SUS were sequentially added to the reaction system and uniformly mixed. The mixture was placed in a 37° C. water bath and stirred at 200 rpm for 18 h. After the reaction was complete, 300 μl of the reaction liquid was taken and added therein 600 μl of 3% formic acid and mixed; centrifuged at 10,000 rpm for 5 min; and high performance liquid chromatography was used to detect the supernatant filtration membrane (chromatographic conditions: column:Agilent eclipse sb-C18 4.6×150 mm; detection wavelength: 210 nm; mobile phase: methanol:water=68%:32%; flow rate: 1.0 mL/min; column temperature: 30° C.). The conversion ratio of Reb A was more than 95%. After the supernatant was purified by post-processing such as isolating by resin and crystallizing, 0.09 g of Reb M was obtained, and the purity of which was greater than 99%.
100 mL of 0.1 mol/L phosphate buffer (pH 7.0), 0.54 g of UDP-G, 0.1 g of Reb D, and 1 g whole cells of UGT-A were sequentially added to the reaction system and uniformly mixed. The mixture was placed in a 37° C. water bath and stirred at 200 rpm for 18 h. After the reaction was complete, 300 μl of the reaction liquid was taken and added therein 6001 of 3% formic acid and mixed; centrifuged at 10,000 rpm for 5 min; and high performance liquid chromatography was used to detect the supernatant filtration membrane (chromatographic conditions: column:Agilent eclipse sb-C18 4.6×150 mm; detection wavelength: 210 nm; mobile phase: methanol:water=68%:32%; flow rate: 1.0 mL/min; column temperature: 30° C.). The conversion ratio of Reb D was more than 90%. After the supernatant was purified by post-processing such as isolating by resin and crystallizing, 0.09 g Reb M was obtained, and the purity of which was higher than 99%.
100 mL of 0.1 mol/L phosphate buffer (pH 7.0), 1.08 g of UDP-G, 0.1 g of Reb A, 2 g whole cells of UGT-A, and 1 g whole cells of UGT-B were sequentially added to the reaction system and uniformly mixed. The mixture was placed in a 37° C. water bath and stirred at 200 rpm for 18 h. After the reaction was complete, 300 μl of the reaction liquid was taken and added therein 600 μl of 3% formic acid and mixed; centrifuged at 10,000 rpm for 5 min; and high performance liquid chromatography was used to detect the supernatant filtration membrane (chromatographic conditions: column:Agilent eclipse sb-C18 4.6×150 mm; detection wavelength: 210 nm; mobile phase: methanol:water=68%:32%; flow rate: 1.0 mL/min; column temperature: 30° C.). The conversion ratio of Reb A was more than 40%. After the supernatant was purified by post-processing such as isolating by resin and crystallizing, 0.04 g of Reb M was obtained, and the purity of which was greater than 99%.
1.5 L of deionized water was added to 500 ml of reaction solution, then the solution was heated at 55° C. for 1 hour, sonicated, and centrifuged at 6,700 rpm for 30 min. The obtained supernatant was sample A. After centrifugation and precipitation, 500 ml of water was added; heated at 55° C. for 0.5 hour and sonicated, centrifuged at 6700 rpm for 30 minutes, and the supernatant was sample B. The sample A was mixed with the sample B to obtain sample C, which was isolated with macroporous adsorption resin (AB-8). Water was used to flush a 4-column volume and then 70% ethanol was used to elute a 3.5-column volume to obtain crude Reb M solution. The foregoing crude solution was distilled under reduced pressure (40-50° C.) to about 50 mL of a remaining volume; the remaining solution was centrifuged at 9900 rpm for 10 min; the supernatant was discarded. The precipitation was washed with 20 mL of water, then the obtained solution was centrifuged at 9900 rpm for 10 min; the supernatant was discarded. The obtained precipitation was suspended with 50%° ethanol aqueous solution; the suspension was heated to 65° C. for dissolving; then an equal volume of water was added to the obtained solution until ethanol concentration was 25%. The solution was gradually cooled to room temperature; after a solid was precipitated, the solution was filtered by suction and dried in vacuo to obtain a Reb M sample with a purity more than 99%.
The substrate conversion ratios in the processes of catalytically preparing Reb M by the UDP-glucosyltransferase gene in different plasmids and host bacteria were as shown in Table 1-2, wherein the glucosyl donors are UDP-G.
Table 1 shows the substrate conversion rates in the process of catalytically preparing Reb M by UDP-glucosyltransferase gene under the action of pYES2, Gal promoter and different host bacteria.
Table 2 shows the substrate conversion ratios in the processes for catalytically preparing Reb M in CEN.PK2-1C or BY4742 by UDP-glucosyltransferase gene via the pYES2 plasmid containing different promoters.
Obviously, the foregoing examples are merely for clearly describing the illustrated examples, and not intended to limit embodiments. Other variations or modifications of the various forms may be made on the basis of the above description for those of ordinary skill in the art. It is not required or possible to exhaust all embodiments. And obvious variations or alterations derived therefrom still fall within the protection scope of the present invention patent.
| Number | Date | Country | Kind |
|---|---|---|---|
| 201510375211.8 | Jun 2015 | CN | national |
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/CN2015/087751 | 8/21/2015 | WO | 00 |
