Patent Application
20230323484
This application includes a separate sequence listing in compliance with the requirement of 37 C.F.R.§.§ 1.824(a)(2)-1.824 (a)(6) and 1.824 (b), submitted under the file name “0062US01_SEQIDComplete”, created on Feb. 28, 2023, having a file size of 21.4 KB, the contents of which are hereby incorporated by reference.
The following relates to method for preparing test solution for pathogen detection purpose, system, kit, detection primer and method thereby.
The COVID-19 (SARS-CoV-2) is a single-stranded positive-sense RNA virus wrapped in protein, which invades the body mainly through the upper respiratory tract and digestive tract. The spike protein on the surface of the virus binds to the ACE2 receptor expressed by upper respiratory tract cells and digestive tract cells with high affinity and specificity, thereby entering the host cell, and using the host organelle for virus protein synthesis and virus replication. At present, there are two main clinical detection methods for the COVID-19: nucleic acid detection and immunological detection using antigens and antibodies.
For nucleic acid detection, such as blood, sputum, saliva, pleural effusion, chest/ascites, cerebrospinal fluid, bronchial/pulmonary lavage fluid, secretions (such as nasopharyngeal secretions), excrement (such as urine, feces), etc. are usually used as a liquid specimen for the extraction of viral nucleic acid; and reverse transcription quantitative polymerase chain reaction is currently the most widely used. RT-qPCR detection involves the following steps: 1) specimen collection and stabilization of viral RNA; 2) RNA extraction; 3) reverse transcription reaction or direct (one-step) RT-qPCR.
However, the current positive rate of COVID-19 detection by this method is only 30-50% as a result of limited RNA extraction technology. Due to the high affinity of COVID-19 with the ACE2 receptor expressed in the upper respiratory tract, nasal secretions collected by nasopharyngeal swabs, pharynx and tonsil secretions collected by oropharyngeal swabs, alveolar lavage fluid, etc. are often used as specimen. Due to the technological bottleneck of existing commercial extraction devices, the volume of existing specimens generally does not exceed 200-300 μL, resulting in low RNA yield. Commercial extraction devices include but are not limited to Qiagen's QIAamp Viral RNA Mini Kit and QIAamp DNA Blood Mini Kit, the nucleic acid extraction or purification kit (magnetic bead method) produced by Daan Gene Co., Ltd. of Sun Yat-sen University (Yue Sui Xie No. 20170583 and Yue Sui Xie No. 20150302), Viral RNA extraction kit (DP315-R) produced by Tiangen Biochemical Technology (Beijing) Co., Ltd.
In addition, the current laboratory testing process exposes medical staff to a cross-infected environment, and the current COVID-19 testing is still limited by specimen transportation, reagent materials and instruments, costs, laboratory technology, environment, and completion time.
It is currently known that once infected with COVID-19, as the host's immune cells respond, it will cause the host's body to produce different cytokines and other inflammatory proteins at different stages, which can cause a cytokine storm, and the result is a life-threatening inflammatory response, which typically leads to acute respiratory distress syndrome (ARDS) and organ failure and may even prevent the development of long-term immunity after the disease is cured. Therefore, targeted screening and dynamic detection of cytokine levels can help distinguish between the general infection and the patients who are more likely to suffer from severe COVID-19, so as to facilitate clinical management to improve the treatment effect and reduce the mortality rate. The current clinical methods for detecting cytokines are mostly from blood samples through immunological detection, such as ELISA, etc., to detect specific cytokine proteins through antibodies. However, these assays are time-consuming and cost, hard to meet clinical need for a rapid, dynamic and bedside monitoring to guide differential diagnosis, clinical staging and intervention including medication management and better prognosis.
An aspect relates to a method for preparing a test solution for pathogen detection using a sample to be tested. The pathogens include but are not limited to COVID 19.
The method includes the following steps:
The method also includes a step selected from at least one of the following:
A further aspect of the present disclosure is to provide a preparation system for preparing a test liquid. The test liquid is used for the detection of pathogens and is prepared from a sample to be tested. The pathogens include but are not limited to COVID 19, and the preparation system includes collection devices and extraction devices.
A further aspect of the present disclosure is to provide a kit for preparing a test liquid which is used for the detection of pathogens and is prepared from a sample to be tested. The pathogens include but are not limited to COVID 19. The kit includes a washing buffer; and/or, the kit includes a sample processing solution; and/or, the kit includes a deoxidizer; and/or, the kit includes one or more of lysis buffer, binding buffer, elution buffer and protease. Wherein, the lysis buffer and/or the washing buffer contains tris(2-carboxyethyl)phosphine hydrochloride.
A further aspect of the present disclosure is to provide an application of the above-mentioned preparation method and/or the above-mentioned preparation system and/or the above-mentioned kit in extracting pathogen nucleic acids, such as COVID 19 nucleic acids, and host nucleic acids in a sample to be tested.
A further aspect of the present disclosure is to provide primers for detecting the nucleic acids of the COVID 19 and the host nucleic acids. The primers include primer pairs for the nucleic acids of the COVID 19 and primer pairs for one or more of the host nucleic acids.
A further aspect of the present disclosure is to provide a nucleic acid detection method, which uses the aforementioned primers to perform quantitative PCR detection on a test solution separately or simultaneously, and the test solution is extracted by the aforementioned method, or the aforementioned system, or the aforementioned kit, and the test solution contains host nucleic acids; or the test solution also contains pathogen nucleic acids.
Some of the embodiments will be described in detail, with references to the following Figures, wherein like designations denote like members, wherein:
For the purposes of promoting an understanding of the principles of the present disclosure, reference will now be made to embodiments and specific language will be used to describe the same. It will nevertheless be understood that no limitation of the scope of the disclosure is thereby intended, such alteration and further modifications of the disclosure as illustrated herein, being contemplated as would normally occur to one skilled in the conventional art to which the disclosure relates.
Articles “a” and “an” are used herein to refer to one or more than one (i.e. at least one) of the grammatical object of the article. By way of example, “an element” means at least one element and can include more than one element.
“About” is used to provide flexibility to a numerical range endpoint by providing that a given value may be “slightly above” or “slightly below” the endpoint without affecting the desired result. The use herein of the terms “including”, “comprising”, or “having”, and variations thereof, is meant to encompass the elements listed thereafter and equivalents thereof as well as additional elements. As used herein, “and/or” refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations were interpreted in the alternative (“or”).
Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise-indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. For example, if a concentration range is stated as 1% to 50%, it is intended that values such as 2% to 40%, 10%˜30%, or “1% to 3%”, etc., are expressly enumerated in this specification. These are only examples of what is specifically intended, and all possible combinations of numerical values between and including the lowest value and the highest value enumerated are to be considered to be expressly stated in this disclosure.
As used herein, “treatment”, “therapy” and/or “therapy regimen” refer to the clinical intervention made in response to a disease, disorder or physiological condition manifested by a patient or to which a patient may be susceptible. The aim of treatment includes the alleviation or prevention of symptoms, slowing or stopping the progression or worsening of a disease, disorder, or condition and/or the remission of the disease, disorder or condition.
As used herein, the term “subject” and “patient” are used interchangeable herein and refer to both human and nonhuman animals. The term “nonhuman animals” of the disclosure includes all vertebrates, eg., mammals and non-mammals, such as nonhuman primates, sheep, dog, cat, horse, cow, chickens, amphibians, reptiles, and the like.
Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by one of ordinary skilled in the conventional art to which this disclosure belongs.
A Preparation System for Preparing a Test Liquid
Embodiments include a system capable of concentrating and extracting nucleic acids in large-volume samples, which can separate or remove genomic DNAs and retain pathogen nucleic acids and host nucleic acids. The system includes a collection device and an extraction device described in detail below.
The collection device (seen from
The collection device includes a sample collector 1 and a sample storage container 2 detachably interconnected with the sample collector 1.
In some embodiments, the sample collector 1 includes a connecting part 11 and a collecting part 12. The connecting part 11 is detachably connected with the sample storage container 2. The collection part 12 and the connection part 11 are fixedly connected with each other or integrally formed. The collection part 12 has an opening, through which the liquid specimen enters the collection part 12 and finally enters the sample storage container 2. The cross-sectional area of the opening of the collecting part 12 is larger than the cross-sectional area of the connecting position where the collecting part 12 is connected.
In some embodiments, the cross section of the opening of the collecting part 12 is circular (seen from
In some embodiments, the shape of the collecting part 12 includes but is not limited to an inverted frustum of a cone shape, and can also be any other feasible shape.
In some embodiments, the connecting part 11 includes a first part 111 having an internal passage communicating with the collecting part 12, and a second part 112 fixedly arranged outside the first part 111. The first part 111 is fixedly connected with the lower part of the collecting part 12 or the first part 111 is integrally formed with the lower part of the collecting part 12. An accommodating space for inserting the sample storage container 2 is formed between the inner wall of the second part 112 and the outer wall of the first part 111.
In at least one embodiment, an internal thread 113 is formed on the inner wall of the second part 112, an external thread is formed on the outer wall of the sample storage container 2. When the sample collector 1 is connected to the sample storage container 2, the sample storage container 2 is threadedly connected with the second part 112.
In some further embodiments, a gap is formed between the inner wall of the sample storage container 2 and the outer wall of the first part 111 when the sample collector 1 is connected to the sample storage container 2 (seen from
In some embodiments, the detachable connection between the sample collector 1 and the sample storage container 2 includes, but is not limited to, snap connection, threaded connection, etc. In at least one embodiment, the sample collector 1 and the sample storage container 2 are connected by threaded mating.
In some embodiments, the sample storage container 2 may be a centrifuge tube or other kinds of container capable of containing liquid, such as a 50 mL centrifuge tube (29 cm*117 cm). When in use, one can fix the connecting part 11 of the sample collector 1 with the sample storage container 2, and then collect the sample like saliva, liquid containing saliva after rinsing with water, urine, etc. to be tested, after which unscrew the sample collector 1 and close the sample storage container 2 using a lid.
In some embodiments, the sample storage container 2 is added or pre-stored with sample processing substances used to inactivate, preserve, digest or release the nucleic acids in the sample.
The sample processing substances may be in any form, including but not limited to liquid state or solid state. When the sample processing substances in a solid state include but are not limited to a dry powder state, which further include but are not limited to freeze-dried powder.
In some further embodiments, the sample processing substances in a dry powder state quickly dissolve once they come into contact with the sample, producing the same or similar effect as the sample processing substances in a liquid state.
The sample processing substances may be a sample lysis solution, a sample preservation solution or a sample inactivation solution obtained by purchase or already disclosed. In an embodiment, it may be a sample processing substances containing triton (Triton X-100), tris(2-carboxyethyl)phosphine hydrochloride and Tris-HCl buffer in the composition, where the concentration of tris(2-carboxyethyl)phosphine hydrochloride may be 1˜20 mM.
The collection device can be used to achieve the collection of samples by the personnel to be examined and avoid cross-contamination during sample collection.
In some embodiments, the sample to be tested includes but is not limited to blood, body fluids, secretions, and excrement. In at least one embodiment, the sample to be tested is one or more of saliva, urine, nasopharyngeal swab, oropharyngeal swab, bronchial/lung lavage, cerebrospinal fluid, lymphatic fluid, ascites, amniotic fluid, peritoneal dialysis fluid, among which saliva samples may be preferred in embodiments, since saliva or liquid containing saliva after rinsing with water even in large volume e.g. 1-40 ml, can be easily collected, and also, their collection may be done by a subject himself/herself, which can avoid cross-infection between medical staffs and subjects. It had been proved through experiments that the detection of pathogen nucleic acids is achieved by collecting 1-2 ml of saliva from the subject infected with pathogens, extracting and testing according to the method of the present disclosure. Moreover, the sensitivity of the present disclosure is 16 times that of the existing mainstream nucleic acid extraction and detection commercial kits.
It should be noted that the nucleic acids in the sample to be tested come from a host and a single or multiple pathogens. The pathogens include but are not limited to viruses, bacteria, fungi or parasites. Parasites include, but are not limited to, various schistosomes, liver and lung flukes, tapeworms that lead to echinococcosis and neurocysticercosis as well as intestinal worms that lead to soil-transmitted helminth infections. The host includes humans and other mammals.
Cytokine is the general term for a variety of small molecular proteins secreted by cells and used for intercellular signal transduction, such as interleukin (IL), interferon (IFN), chemokine, colony stimulating factor (CSF) and tumor necrosis factor (TNF), etc.
In some embodiments, nucleic acids from a host include, but are not limited to, nucleic acids of one or more of cytokines, chemokines, and biomarkers. The cytokines, chemokines or biomarkers are cytokines, chemokines or biomarkers produced by the host after the pathogens enter the host.
In some further embodiments, the cytokines include but are not limited to one or more of IL1B, IL1RA, IL2, IL3, IL4, IL5, IL6, IL7, IL8, IL9, IL10, IL12p70, IL13, IL15, IL17A, IL23, IL25, IL27 and IL33, the chemokines include but are not limited to one or more of chemokines CCL1, CCL2, CCL3, CCL11, CXCL1, CXCL2, CXCL8, CXCL9, CXCL10 and CXCL11 and eosinophil-activated chemokine, the biomarkers include but are not limited to one or more of basic FGF2, CSF, GCSF, GMCSF, IFN, IFN γ, IP-10, MCP1, MIP1A, MIP1B, PDGFB, RANTES, TNF, TGFβ, TSLP, VEGFA, HO1, CRP, PCT, SAA, vWF, SELP and THBD. Or the cytokines include but are not limited to one or two or three or four or five of IL2, IL6, IL10, IL17A and IL13, or the biomarkers include but are not limited to one or two or three or four or more than four of HO1, CRP, IP-10, SAA, TNF, MCP1, IFN γ, vWF, SELP and THBD. Further the biomarkers at least include HO1.
COVID-19 infection is roughly divided into three stages, namely early lymphocyte decline, middle pneumonia, and late cytokine storm (CRS). COVID-19 infection will cause a series of serious symptoms, multiple organs of the body will be infected, and a number of cytokines will rise, and the so-called cytokine storm will appear.
The cytokines produced by the organism after invasion by COVID-19 include but are not limited to one or more of IL2, IL6 and IL10, the biomarkers produced by the organism after invasion by COVID-19 include but are not limited to one or more of HO1, CRP and IP-10, and SAA.
In some embodiments, nucleic acids from a host are mRNA.
In some embodiments, the volume of the sample to be tested is 1-40 mL. Such a large volume sample may be a mixture of saliva and liquid obtained by washing the mouth/throat using pure water or physiological saline, or other large-volume body fluids such as urine, bronchial/pulmonary lavage fluid, cerebrospinal fluid, lymphatic fluid, ascites, and amniotic fluid as well as peritoneal dialysate.
The extraction device
Further, the detailed structure of this extraction device (Manually Operated Extraction System, referred to as MOES) is shown in paragraphs 0035 to 0067 of the patent CN201480042043.4 named “System and Method for Collecting Nucleic Acid Samples”, the entire contents of which are hereby incorporated by reference, and shown in
In some embodiments, oxygen scavengers or antioxidants are added or pre-stored in the shipping container to control the oxygen content in the shipping container to be less than 0.01-1%, to further protect and stabilize the extracted nucleic acids.
The term deoxidizers, also known as oxygen scavengers or oxygen absorbents, are additives that can absorb oxygen to slow down the oxidation of the protected object. They are a group of chemical mixtures that easily react with free oxygen or dissolved oxygen. The deoxidizers may remove the residual oxygen in the sealed environment to prevent the object to be protected from discoloration, deterioration, and oil rancidity due to oxidation, and also inhibit the growth of molds, aerobic bacteria and harmful organisms by packing them in a sealed bag (similar to a desiccant bag) with a certain degree of air permeability and strength.
The nucleic acid extraction step can be performed in a closed environment to avoid cross-contamination between samples, prevent samples from polluting the external environment, and effectively protect the safety of experiment operators by adopting the extraction device for nucleic acid extraction.
The collection device and extraction device of this embodiment enable the collection of large samples, such as sample collection volumes of 1 to 40 mL and allow effective concentration of large volume samples to 100 μL and below, such as 60 μL, etc.; thus, they can be used for pooled population-based epidemiological surveys which combined with multiple small volume samples (100 to 200 copies of nasopharyngeal swabs) from different people, saving cost for labor and testing materials.
A Preparation Method for Preparing the Test Solution
Embodiments include a preparation method for preparing the test solution.
The method includes the following steps:
The method also includes a step selected from at least one of the following:
In some embodiments, in the step A, the oxygen content in the environment where the extract is located is controlled to be less than 1%, for example, less than 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1% etc. For example, the oxygen content in the environment is about 0.01%˜1%, for example, about 0.01%˜0.1%.
In some further embodiments, the oxygen content can be controlled by adding oxygen scavengers to the environment, such as add oxygen scavengers to the environment where the extract is located after the extraction is completed. Among them, the environment includes the environment before the start of extraction, during the extraction process, or after the extraction.
In some embodiments, the oxygen content in the environment after the extraction is mainly controlled to further stabilize and protect the nucleic acid by keeping the extract in the environment with low oxygen content.
In some embodiments, the extraction step includes passing the lysis buffer containing nucleic acids through a filter column for adsorption, and then passing a washing buffer for washing, and then eluting the filter column with an eluent to obtain a test solution, where at least the adsorption and washing are performed in a closed environment. Among them, the nucleic acid adsorption step can be to use a filter column treated with a binding buffer for adsorption, or to mix a lysate containing nucleic acids with a binding buffer and then pass through the filter column for adsorption.
Further, the washing buffer includes absolute ethanol.
The term tris-(2-carboxyethyl)-phosphine hydrochloride (TCEP-HCl): also known as TCEP hydrochloride, tris(2-carboxy) phosphine hydrochloride, tris(2-Carboxyethyl) phosphine hydrochloride. TCEP-HCl is a pure, odorless and stable tris(2-carboxyethyl)phosphine crystal, which is a sulfhydryl-free compound that can efficiently reduce the disulfide bonds of proteins and polypeptides. TCEP-HCl is stable at room temperature, resistant to air oxidation, stable in water-soluble buffer, acid and lye, and can inhibit RNase enzyme activity. Dissolving tris(2-carboxyethyl)phosphine hydrochloride in absolute ethanol can further protect and stabilize the extracted nucleic acids.
In some embodiments, the concentration of the tris(2-carboxyethyl)phosphine hydrochloride in the lysis buffer or the washing buffer is 1-20 mM.
In some embodiments, the extraction method of the present disclosure can further isolate or remove genomic DNA, retain viral RNA and host RNA, and use different solid-liquid phase combinations to specifically extract the substances to be analyzed or specifically exclude interfering substances.
In some embodiments, the method of the present disclosure can extract a large-volume sample to be tested, which significantly improves the detection sensitivity, and the obtained nucleic acids also include short fragment nucleic acids, that is, free nucleic acids. Furthermore, the RNA and DNA extracted by the method of the present disclosure can remain stable for a long time at room temperature. Therefore, the method of the present disclosure solves the capacity limitation of the existing commercial extraction device for extracting liquid, and is suitable for operation in various laboratory environments such as high-end and low-end, and has no special requirements on the laboratory environment and technical conditions.
Primers and Method for Detecting Nucleic Acids to be Tested
Embodiments include a detection method capable of simultaneously detecting nucleic acids of different pathogens and host nucleic acids in the same sample. This is beneficial to monitor the dynamic changes of the body's immune response to pathogens, such as the dynamic changes of cytokines, which is beneficial to the early differential diagnosis of infectious diseases, and is beneficial to guide clinical intervention and medication. It has obviously practical value for better clinical staging, management and prognosis.
In some embodiments, the primers include primer pairs for the nucleic acids of the COVID 19 and primer pairs for one or more of the host nucleic acids.
In some further embodiments, the primers further comprise primer pairs for housekeeping genes of host, the housekeeping genes of host are present in both a healthy host and an infected host, so that the primer pairs for the housekeeping genes of host can be used as an internal standard. The primer pairs shown in SEQ ID NO. 29˜30 and SEQ ID NO. 129˜136 are primer pairs designed for RNA polymerase 2, and SEQ ID NO. 127˜128 are primer pairs designed for Beta microglobulin-2.
In some further embodiments, the primer pairs are primer pairs that span introns. They can only amplify the cDNA transcribed from mRNA after the splicing is completed. The introns in the sequence have been cut out, genomic DNA (gDNA) will be not amplified, and the interference of gDNA is avoided.
The primer pairs for various nucleic acids in this application are selected from SEQ ID NO.1-144. Among all the primer pair sequences, SEQ ID NO: 1 and SEQ ID NO: 2 are the 1st primer pair, SEQ ID NO: 3 and SEQ ID NO: 4 are the 2nd pair, SEQ ID NO: 5 and EQID NO: 6 are the 3rd primer pair, SEQ ID NO: 7 and SEQ ID NO: 8 are the 4th primer pair, and so on. The odd number is the upstream primer, the even number is the downstream primer, and the primers are written in order from the 5′ end to the 3′ end.
The preparation of the test solution of this example and the materials and specific steps used for PCR detection are as follows:
Quantitative nucleic acid PCR detection has one-step RT-qPCR or two-step RT-qPCR. The former is that RT reactions and PCR reactions are in the same test tube, which uses target primers for RT reactions to produce specific cDNA fragments, and then uses the same specific primers for PCR amplification reactions. The reaction process does not need to open the test tube lid, which greatly reduces pollution. The latter is that first uses random primers for RT reactions to convert the RNA in the extract into corresponding cDNA, and then adds one or more pairs of specific primers to specifically amplify the specific target cDNA (target nucleic acid) and carry out quantitative detection.
There are usually two methods for real-time quantitative monitoring of PCR products: 1. Use non-specific fluorescent dyes such as SYBR Green to chimerize into the double-stranded DNA fragments of PCR products to generate fluorescence. 2. Fluorescent molecules and quenching groups are labeled with nucleic acid sequence-specific probes that complement and hydrolyze specific PCR product sequences during the PCR reaction, releasing the quenching groups and resulting in fluorescence.
The following is an example of a two-step RT-qPCR, that is, RT reaction uses Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT, M1701, Promega, WI, USA), and then performs SYBR Green qPCR (QuantiNova SYBR Green RT-PCR Kit, Cat No. 208054, QIAGEN GmbH, Hilden, Germany). In practical applications, one-step RT-qPCR or 2-step RT-qPCR can often be selected according to specific needs, as are the fluorescent chimeric dye method and nucleic acid sequence-specific probe method. The following examples are not listed in specific probes.
4. Sample Source
Nasopharyngeal swabs from patients with inflammations and infections were collected and centrifuged for 10 min (3000 g), and 2-20 ml of supernatant was aspirated in a sample storage container pre-stored with sample processing solution and stored at −20° C. Pseudovirus of COVID-19 was added to the samples from patients who have recovered or cured from anti-inflammatory treatment for subsequent experiments.
5. Extraction of Free Nucleic Acid
5. Removal of DNA Secondary Structure (DNA Secondary Structure in the Template Needs to be Removed as it has an Effect on PCR Amplification)
0.5 μg of random primers (synthesized by Shanghai Biotech, 6 random pr (5′-NNN NNN-3′); 9 random pr (5′-NNN NNN NNN-3′)) and 15-20 μl of RNA template (eluate collected in the previous step) were mixed to a total volume of 20 μl at 4° C., and then PCR amplification was performed with an amplification procedure of 70° C. for 5 mins; the amplification products were used in the next experiments or stored at 4° C. for a short period (1-2d).
Reverse transcription (25 ul reaction system)
MMLV enzyme system: Promega M170, abbreviated MMLV.
Rnase inhibitor: Rnasin N2525, abbreviated as RNasin.
The reaction system is as follows.
PCR amplification, program: 42° C., 60 mins.
The products were stored at 4° C. for a short period (5-7d).
6. Quantitative PCR Detection of Free Nucleic Acid DNA (Using QIAGEN Fluorescent Quantitative PCR MIX)
Quantitative PCR detection is to amplify unique fragments, and at the same time chimerize into the amplified products through the fluorescent dye SYBR Green, to generate fluorescence signals with excitation wavelengths of 480 nm and radiation wavelengths of 520 nm, to achieve quantitative detection of amplified products, at the same time, specific amplification products were determined by melting curve analysis.
The primer pairs and the assay results are shown in Table 1.
The method of this example is essentially the same as that of Example 1, with the following differences.
Sample A was processed in the same way as in Example 1.
Sample B and sample C were extracted with the first binding buffer according to the same method as in Example 1 to obtain the first eluate for the assay (the eluate was recorded as the first column pass), and the liquid from the lysate column in Step E was collected and the second binding buffer was added to the liquid to extract the free nucleic acid according to the same method as in Example 1 (the eluate was recorded as the second column pass). Where the main component of the first sorbent is anhydrous ethanol, and the volume is 2 mL; the main component of the second sorbent is anhydrous ethanol and guanidine isothiocyanate, and the volume is 7 mL.
Sample D was treated in the same way as sample B or sample C, except that the volume of binding buffer added is 4 times the volume added in sample B or sample C.
The primer pairs in this example were shown in Table 3, and the results of the assay using each primer pair for each eluate of each of the above samples, respectively, were shown in Table 4.
As seen from Table 4, different extraction methods are feasible for different types of samples, and the amount of target fragments obtained can be controlled by changing the ratio of each component of the binding buffer to adapt to different testing requirements, and M11, K1, and P1 can be used as internal standard markers, and all the above primers are feasible.
In this example, samples from different patient sources than in Example 2 were used, and the extraction of free nucleic acids from the samples was performed according to the method of Example 2, and no pseudovirus of COVID-19 was added to Sample A and Sample B. The results of each primer and experiment were shown in Table 5.
The method of this example is essentially the same as that of sample C in Example 2, where the sample was extracted in two steps (two passes through the column), and the samples and reagents used were listed in Table 6 below.
The results of each primer pair were shown in Table 7, where the meaning of the sample number in Table 7 is as follows, taking A2-1 as an example, where A refers to the serial number corresponding to the specimen in Table 6, 2 refers to the second specimen of that serial number, and −1 refers to the test solution collected by the first pass through the column, so A2-1 refers to the test result corresponding to the test solution collected by the first pass through the column for the second A sample.
where the upstream primer for RdRp-2 is gtgaratggtcatgtgtggcgg (SEQ TD NO. 125) and the downstream primer is caratgttaaasacactattagcata (SEQ ID NO.126).
The upstream primer for E Gene of EU is acaggtacgttaatagttaatagcgt (SEQ TD NO. 123) and the downstream primer is atattgcagcagtacgcacaca (SEQ ID NO. 124).
Comparison of sensitivity of Magnetic Bead Extraction Kit/PCR COVID-19 Reaction Kit (Daan/Sansure) and OBI product (MOES)
Daan/Sansure: 200 ul of pharyngeal swab extracted, about 50 ul of eluate was collected, 25 ul of reaction system at RT-qPCR, of which 5 ul of eluate (template) was used.
The OBI product (MOES) was extracted and detected as in Example 4.
The assay results are shown in Table 8.
As seen from Table 7, the ct values of N gene for the OBI product of this application were 31-33, the internal standard ct values were 21-23, and the E gene ct values were 27-31; while the corresponding Ct values of Daan and Sansure were 3-4 higher than those of this application, thus, the sensitivity of OBI was more than 16 times higher than that of Daan/Sansure.
In this example, different samples were processed and tested according to the method of Example 2. Some sequences are shown in Table 9 and some sequences are shown in Table 13, and the test results of each sequence are shown in Table 10 to Table 16, respectively.
The sample numbers in Tables 10 to 11 above represent the samples as follows: T2-1 is the test result of the first pass-column collected test solution for the serum sample, T4-1 is the test result of the first pass-column collected test solution for the urine sample, RT1 is the test result of the serum sample, RT2 is the test result of the serum sample, RT3 is the test result of the nasopharyngeal swab sample, and T1-2 is the blood T1-2 are the results of the test solution collected from the second pass of the sample.
The comparison between the conventional art and the technique of the embodiments in terms of virus collection and viral RNA extraction is shown in Table 17.
Advantage: 1. Using MOES with the feature of extracting a larger volume of body fluid specimen, a larger volume (10-40 ml) of water or saline is used to gargle the throat area to make the water or saline mix with saliva to extract RNA. 2. Cross-intron primer design, only the cDNA transcribed by mRNA after splicing is amplified, and the introns in the sequence have been cut out, not amplifying genomic DNA (gDNA), therefore, avoiding gDNA interference. Overall, it greatly improves sensitivity and specificity of the assay.
The reagents used in the process of sample collection, concentration, nucleic acid extraction, etc. may be sold separately or assembled into kits for sale.
Although the present invention has been disclosed in the form of embodiments and variations thereon, it will be understood that numerous additional modifications and variations could be made thereto without departing from the scope of the invention.
For the sake of clarity, it is to be understood that the use of ‘a’ or ‘an’ throughout this application does not exclude a plurality, and ‘comprising’ does not exclude other steps or elements.
| Number | Date | Country | Kind |
|---|---|---|---|
| 202010889216.3 | Aug 2020 | CN | national |
This application claims priority to PCT Application No. PCT/CN2021/115118, having a filing date of Aug. 27, 2021, which claims priority to CN Application No. 202010889216.3, having a filing date of Aug. 28, 2020, the entire contents both of which are hereby incorporated by reference.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/CN2021/115118 | 8/27/2021 | WO |
