Patent Application
20170051323
The present invention relates to a method for producing L-amino acids, in which an alkaliphilic bacterium, particularly a strain of the species Corynebacterium humireducens, is used.
Methods for producing L-amino acids, in which bacteria from the genus Corynebacterium are used, are known to those skilled in the art.
Although numerous Corynebacterium types are known, bacteria of the Corynebacterium glutamicum type are normally used in these methods since this type has been found to be particularly advantageous for producing L-amino acids.
The object of the present invention was to provide a new strain which is either directly useful as an alternative to C. glutamicum for the production of L-amino acids, since it has a significant overproduction of at least one L-amino acid, or can be considered at least as a promising starting strain for developing a new L-amino acid production strain.
In order to be a possible starting strain for the development of a new L-amino acid production strain, relatively slight L-amino acid overproduction is already sufficient. This is because by overexpression or attenuation of genes or enzymes for which the favourable or deleterious effect on the production of the relevant amino acids is known, and optionally by undirected mutagenesis, starting from such a starting strain the L-amino acid yield can be correspondingly increased.
In accordance with the invention, it has now been found, surprisingly, that an alkaliphilic bacterium, namely a bacterium of the species Corynebacterium humireducens, already naturally overproduces the L-amino acids L-alanine, L-glutamic acid and L-valine in significant amounts.
Furthermore, by culturing in a medium that comprises AEC and optionally threonine, a C. humireducens strain could be obtained which produces significant amounts of L-lysine.
C. humireducens therefore constitutes at the same time a suitable starting point for the production of further L-amino acid production strains. This is because by corresponding diversion of the bacterial metabolism, the overproduction of the L-amino acids mentioned may be converted into overproduction of other desired L-amino acids.
The naturally occurring overproduction of L-alanine is presumably a result of a particularly highly efficient alanine dehydrogenase which has been found in C. humireducens. Alanine dehydrogenases have only been described to date for a few other Corynebacteria, but not for such an active alanine dehydrogenase whose presence already leads to an accumulation of L-alanine within the cell of the wild type.
The naturally occurring overproduction of L-glutamate is presumably a result of particularly highly efficient hut genes (“histidine utilization” genes). The hut cluster consists of the four genes hutU (urocanate hydratase), hutI (imidazolonepropionase), hutH (histidine ammonia-lyase) and hutG (formimidoylglutamase). hut Genes have only been described to date for a few other Corynebacteria, but not for such active hut genes whose presence already leads to an accumulation of L-glutamate within the cell of the wild type.
The present invention therefore firstly relates to a method for the overproduction of an L-amino acid, characterized in that an alkaliphilic bacterium, preferably an alkaliphilic coryneform bacterium, particularly an alkaliphilic Corynebacterium, particularly preferably C. humireducens, is used in said method.
Alkaliphilic bacteria according to the invention are preferably halotolerant and/or humic acid-reducing.
According to the invention, an “alkaliphilic bacterium” should be understood to mean a bacterium which is capable of growing at a pH of 8.5 to 11. Preferably, it should be understood to mean a bacterium which is also capable of growing at a pH of 9 to 10.5.
According to the invention, a “halotolerant bacterium” should be understood to mean a bacterium which is capable of growing at water activities of 0.6 to 0.98. Preferably, it should be understood to mean a bacterium which is also capable of growing at water activities of 0.75 to 0.9.
“L-amino acid” in accordance with the invention is understood to mean, in particular, the proteinogenic L-amino acids.
The L-amino acid is in this case preferably selected from L-alanine, L-valine, L-amino acids of the glutamate family, particularly L-glutamate, L-glutamine, L-proline and L-arginine, and L-amino acids of the aspartate family, particularly L-aspartate, L-asparagine, L-methionine, L-lysine, L-isoleucine and L-threonine. The L-amino acid is particularly preferably selected from L-alanine, L-valine, L-glutamate, L-methionine, L-lysine and L-threonine, especially from L-alanine, L-valine, L-glutamate and L-lysine.
The C. humireducens strain is described for the first time by Wu et al. (International Journal of Systematic and Evolutionary Microbiology (2011), 61, 882-887). Said strain was deposited in the DSMZ under the deposition number DSM 45392 and its 16S rRNA was deposited in the EMBL and has the accession number GQ421281. The starting strain is a halotolerant, alkaliphilic, humic acid-reducing bacterium.
Further information regarding C. humireducens are to be found in the following publications: Wu et al. (Microb. Biotechnol. (2013), 6(2), 141-149), Lin et al. (Bioresour. Technol. (2013), 136, 302-308).
Accordingly, the present invention also further relates to an alanine dehydrogenase (Ald), characterized in that said enzyme has a sequence identity of at least 85 or 90%, preferably at least 92, 94, 96 or 98%, especially 100%, to the sequence according to SEQ ID NO: 72.
Therefore, the present invention also further relates to a polynucleotide which codes for an alanine dehydrogenase according to the invention. Preference is given to a polynucleotide which has a sequence identity of at least 70 or 75%, preferably at least 80 or 85%, particularly preferably at least 90 or 95%, especially 100%, to the sequence of position 301 to 1365 according to SEQ ID NO: 71 and/or a polynucleotide which hybridizes under stringent conditions with a polynucleotide of which the sequence is complementary to the sequence of position 301 to 1365 according to SEQ ID NO: 71.
Therefore, the present invention also further relates to enzymes of the hut cluster, selected from
Therefore, the present invention also further relates to polynucleotides which code for the genes of the hut cluster according to the invention. In this case, preference is given to the following polynucleotides:
a) a polynucleotide, which codes for a urocanate hydratase (hutU), and has a sequence identity of at least 70 or 75%, preferably at least 80 or 85%, particularly preferably at least 90 or 95%, especially 100%, to the sequence of position 301 to 1983 according to SEQ ID NO: 189 and/or hybridizes under stringent conditions with a polynucleotide of which the sequence is complementary to the sequence of position 301 to 1983 according to SEQ ID NO: 189;
c) a polynucleotide, which codes for a histidine ammonia-lyase (hutH), and has a sequence identity of at least 70 or 75%, preferably at least 80 or 85%, particularly preferably at least 90 or 95%, especially 100%, to the sequence of position 301 to 1851 according to SEQ ID NO: 193 and/or hybridizes under stringent conditions with a polynucleotide of which the sequence is complementary to the sequence of position 301 to 1851 according to SEQ ID NO: 193; and
In accordance with the invention, “stringent conditions” is understood to mean washing at a salt concentration of 1×SSC and 0.1% by weight SDS at a temperature of 80° C.
The present invention likewise further relates to polynucleotides which are complementary to the coding polynucleotides according to the invention.
Accordingly, the present invention also further relates to vectors, in particular cloning and expression vectors, which comprise polynucleotides according to the invention. These vectors can be appropriately incorporated into microorganisms, particularly in coryneform bacteria, especially from the genus Corynbebacterium, or Enterobacteriaceae, especially from the genus Escherichia.
Furthermore, for the purpose of expression of the encoded genes, a polynucleotide according to the invention can also be incorporated into the genome of microorganisms, in particular into the genome of coryneform bacteria, in particular those of the genus Corynebacterium, or into the genome of Enterobacteriaceae, in particular those of the genus Escherichia.
The present invention also further relates to corresponding recombinant microorganisms, preferably bacteria, particularly coryneform bacteria, especially those of the genus Corynebacterium, particularly preferably of the species C. humireducens or C. glutamicum, and also Enterobacteriaceae, especially those of the genus Escherichia, comprising one alanine dehydrogenase according to the invention and/or one or more, preferably all, enzymes of the hut cluster according to the invention and/or one or more polynucleotides according to the invention and/or vectors according to the invention.
A preferred object is, in this context, recombinant Corynebacteria, particularly of the species C. humireducens and the species C. glutamicum, comprising an alanine dehydrogenase according to the invention and/or a polynucleotide coding for said enzyme and/or at least one vector comprising said polynucleotide.
A further preferred object is, in this context, recombinant Corynebacteria, particularly of the species C. humireducens and the species C. glutamicum, comprising at least one, preferably all, enzyme(s) of the hut cluster and/or polynucleotides coding for said enzymes and/or at least one vector comprising said polynucleotides.
The present invention also particularly relates to recombinant microorganisms, preferably bacteria, particularly coryneform bacteria, especially those of the genus Corynebacterium, except for the species C. humireducens, in particular of the species C. glutamicum, comprising one alanine dehydrogenase according to the invention and/or one or more, preferably all, enzymes of the hut cluster according to the invention and/or one or more polynucleotides according to the invention and/or vectors according to the invention.
In accordance with the invention, “recombinant microorganism” or “recombinant bacterium” is understood to mean a microorganism or bacterium that has been subjected to at least one genetic engineering measure. The genetic engineering measure may in particular be, in this context, a targeted or random mutation, the incorporation of a foreign gene and/or the overexpression or attenuation of a host gene or foreign gene. A recombinant microorganism according to the invention or a recombinant bacterium according to the invention is preferably characterized by the overexpression or attenuation of at least one gene. In a particularly preferred embodiment, a microorganism according to the invention or a bacterium according to the invention here is characterized by the overexpression of the alanine dehdrogenase according to the invention or of the polynucleotide coding for said enzyme. In a further particularly preferred embodiment, a microorganism according to the invention or a bacterium according to the invention is characterized by the overexpression of at least one enzyme of the hut cluster according to the invention, particularly all enzymes of the hut cluster according to the invention or the corresponding polynucleotides coding for the enzymes.
Within the genus Corynebacterium, preference is given to strains according to the invention based on the following species: Corynebacterium efficiens, such as type strain DSM44549, Corynebacterium glutamicum, such as type strain ATCC13032 or the strain R, Corynebacterium ammoniagenes, such as type strain ATCC6871, Corynebacterium humireducens, such as the strain DSM 45392, and Corynebacterium pekinese, such as the strain CGMCC No. 5361.
Particular preference is given to the species Corynebacterium glutamicum and Corynebacterium humireducens. If, in the context of this application, the strain Corynebacterium humireducens is mentioned, said strain is preferably strain DSM 45392 or a strain derived therefrom.
Some representatives of the species Corynebacterium glutamicum are also known in the prior art under other names. These include for example: Corynebacterium acetoacidophilum ATCC13870, Corynebacterium lilium D5M20137, Corynebacterium melassecola ATCC17965, Brevibacterium flavum ATCC14067, Brevibacterium lactofermentum ATCC13869 and Brevibacterium divaricatum ATCC14020. The term “Micrococcus glutamicus” for Corynebacterium glutamicum has likewise been in use. Some representatives of the species Corynebacterium efficiens have also been referred to in the prior art as Corynebacterium thermoaminogenes, for example the strain FERM BP-1539.
Information on the taxonomic classification of strains of the group of the coryneform bacteria can be found, inter alia, in Seiler (Journal of General Microbiology 129, 1433-1477 (1983)), Kinoshita (1985, Glutamic Acid Bacteria, p 115-142. in: Demain and Solomon (ed), Biology of Industrial Microorganisms. The Benjamin/Cummins Publishing Co., London, UK), Kämpfer and Kroppenstedt (Canadian Journal of Microbiology 42, 989-1005 (1996)), Liebl et al (International Journal of Systematic Bacteriology 41, 255-260 (1991)), Fudou et al (International Journal of Systematic and Evolutionary Microbiology 52, 1127-1131 (2002)) and in U.S. Pat. No. 5,250,434.
Strains with the designation “ATCC” may be obtained from the American Type Culture Collection (Manassas, Va., USA). Strains with the designation “DSM” may be obtained from the Deutschen Sammlung von Mikroorganismen und Zellkulturen (German Microorganism and Cell Culture collection) (DSMZ, Braunschweig, Germany. Strains with the designation “NRRL” may be obtained from the Agricultural Research Service Patent Culture Collection (ARS, Peoria, Ill., US). Strains with the designation “FERM” may be obtained from the National Institute of Advanced Industrial Science and Technology (AIST Tsukuba Central 6, 1-1-1 Higashi, Tsukuba Ibaraki, Japan). Strains with the designation “CGMCC” may be obtained from the China General Microbiological Culture Collection Center (CGMCC, Beijing, China).
Accordingly, the present invention also further relates to a method for the overproduction of an L-amino acid, characterized in that an alanine dehydrogenase according to the invention and/or at least one enzyme of the hut cluster according to the invention, preferably all enzymes of the hut cluster according to the invention, and/or at least one polynucleotide according to the invention and/or a recombinant microorganism according to the invention, preferably a recombinant bacterium according to the invention, particularly a recombinant coryneform bacterium according to the invention, particularly preferably a recombinant Corynebacterium according to the invention, especially a Corynebacterium of the species C. humireducens or C. glutamicum, is used in said method. In a preferred embodiment according to the invention, the at least one polynucleotide according to the invention or the polypeptide coded by said polynucleotide is used in this case in overexpressed form.
A preferred object of the present invention is in this case a method for the overproduction of an L-amino acid, characterized in that an alanine dehydrogenase according to the invention and/or at least one polynucleotide coding for said enzyme and/or at least one vector comprising said polynucleotide and/or a recombinant Corynebacterium, preferably of the species C. humireducens or C. glutamicum, which comprises an alanine dehydrogenase according to the invention and/or at least one polynucleotide coding for said enzyme and/or at least one vector comprising said polynucleotide, is used in said method.
A further preferred object of the present invention is therefore also a method for the overproduction of an L-amino acid, characterized in that at least one enzyme of the hut cluster according to the invention, preferably all enzymes of the hut cluster according to the invention, and/or at least one polynucleotide coding for said enzyme(s), preferably polynucleotides coding for all enzymes of the hut cluster according to the invention, and/or at least one vector comprising said polynucleotide(s) and/or a recombinant Corynebacterium, preferably of the species C. humireducens or C. glutamicum, which comprises at least one enzyme of the hut cluster according to the invention, preferably all enzymes of the hut cluster according to the invention, and/or at least one polynucleotide coding for said enzyme(s), preferably polynucleotides coding for all enzymes of the hut cluster according to the invention, and/or at least one vector comprising said polynucleotide(s), is used in said method.
The L-amino acid produced in accordance with the invention is in this case preferably selected from L-alanine, L-valine, L-amino acids of the glutamate family, particularly L-glutamate, L-glutamine, L-proline and L-arginine, and L-amino acids of the aspartate family, particularly L-aspartate, L-asparagine, L-methionine, L-lysine, L-isoleucine and L-threonine, particularly preferably selected from L-alanine, L-valine, L-glutamate, L-methionine, L-lysine and L-threonine, especially from L-alanine, L-valine, L-glutamate and L-lysine.
The Corynebacterium used in the production method according to the invention is preferably selected from C. humireducens and C. glutamicum.
“Overproduce” or “overproduction” in relation to the L-amino acids is understood to mean, in accordance with the invention, that the microorganisms produce the L-amino acids according to their own requirement, which either enrich in the cell or are secreted into the surrounding nutrient medium where they accumulate. In this case, the microorganisms preferably have the ability to enrich or accumulate in the cell or in the nutrient medium≧(at least) 0.25 g/l, ≧0.5 g/l, ≧1.0 g/l, ≧1.5 g/l, ≧2.0 g/l, ≧4 g/l or ≧10 g/l of the relevant L-amino acids in ≧(at most) 120 hours, ≧96 hours, ≧48 hours, ≧36 hours, ≧24 hours or ≧12 hours.
Recombinant microorganisms according to the invention, in which polynucleotides according to the invention and/or vectors according to the invention have been incorporated, already have the capability, in a preferred embodiment, to overproduce an L-amino acid before the incorporation of the polynucleotides and/or vectors according to the invention. The starting strains are preferably strains which have been produced by mutagenesis and selection, by recombinant DNA techniques or by a combination of both methods.
It is obvious and requires no further explanation, that a recombinant microorganism in accordance with the invention can also be thus produced, in which a wild strain, in which a polynucleotide according to the invention and/or a vector according to the invention is present or has been incorporated and by subsequent suitable further genetic engineering measures, causes the L-amino acid to be produced or the L-amino acid production to be increased.
The present invention further relates also to other polynucleotides from C. humireducens and also the polypeptides encoded by said polynucleotides. By means of overexpression of the relevant polynucleotides or polypeptides, the amino acid production of certain L-amino acids can be positively influenced.
The present invention therefore likewise relates to:
The present invention further relates also to vectors comprising the polynucleotides mentioned above and also recombinant microorganisms comprising the enzymes and/or polynucleotides and/or vectors mentioned above. In a preferred embodiment, the relevant polypeptide and/or polynucleotide is present in this case in the microorganism in overexpressed form. The recombinant microorganisms are preferably in this case coryneform bacteria, especially Corynebacteria, particularly those of the species C. humireducens or C. glutamicum.
The present invention therefore also further relates to a method for the overproduction of an L-amino acid, preferably selected from L-alanine, L-valine, L-amino acids of the glutamate family, particularly L-glutamate, L-glutamine, L-proline and L-arginine, and L-amino acids of the aspartate family, particularly L-aspartate, L-asparagine, L-methionine, L-lysine, L-isoleucine and L-threonine, particularly preferably selected from L-alanine, L-valine, L-glutamate, L-methionine, L-lysine and L-threonine, especially from L-alanine, L-valine, L-glutamate and L-lysine, in which at least one, preferably at least two, three or four, of the polynucleotides mentioned are present in overexpressed form, wherein the method is preferably carried out in Corynebacteria, particularly those of the species C. humireducens or C. glutamicum.
The present invention further relates also to other polynucleotides from C. humireducens and also the polypeptides encoded by said polynucleotides. By means of deactivation or attenuation of the relevant polynucleotides or polypeptides, the amino acid production of certain L-amino acids can be positively influenced.
The present invention therefore likewise relates to:
The present invention further relates also to vectors comprising the polynucleotides mentioned above and also recombinant microorganisms comprising the enzymes and/or polynucleotides and/or vectors mentioned above. In a preferred embodiment, the relevant polypeptide and/or polynucleotide is present in this case in the microorganism in deactivated or attenuated form. The recombinant microorganisms are preferably in this case coryneform bacteria, especially Corynebacteria, particularly those of the species C. humireducens or C. glutamicum, especially of the species C. humireducens.
The present invention therefore also further relates to a method for the overproduction of an L-amino acid, preferably selected from L-alanine, L-valine, L-amino acids of the glutamate family, particularly L-glutamate, L-glutamine, L-proline and L-arginine, and L-amino acids of the aspartate family, particularly L-aspartate, L-asparagine, L-methionine, L-lysine, L-glutamate, L-methionine, L-lysine and L-threonine, especially from L-alanine, L-valine, L-glutamate and L-lysine, in which at least one, preferably at least two, three or four, of the polynucleotides mentioned are present in deactivated or attenuated form, wherein the method is preferably carried out in Corynebacteria, particularly those of the species C. humireducens or C. glutamicum. In a preferred embodiment, at least one, preferably at least two, three or four of the polynucleotides mentioned in the detailed list above is present at the same time in overexpressed form.
In a preferred embodiment, microorganisms or bacteria according to the invention, particularly Corynebacteria according to the invention, especially Corynebacteria according to the invention of the species C. humireducens or C. glutamicum, particularly L-valine overproduction strains according to the invention, have at least one, preferably at least 2 or 3, particularly preferably at least 4 or 5, of the following features:
The present invention further also relates accordingly to a method for the overproduction of an L-amino acid, particularly L-valine, in which such a microorganism or such a bacterium is used.
In a further preferred embodiment according to the invention, microorganisms or bacteria according to the invention, particularly Corynebacteria according to the invention, especially Corynebacteria according to the invention of the species C. humireducens or C. glutamicum, particularly L-glutamate overproduction strains according to the invention, have at least one, preferably at least two or three, particularly preferably at least four or five, of the following features, particularly preferably in combination with the overexpression of at least one hut gene according to the invention, particularly in combination with the overexpression of all hut genes according to the invention:
l) an overexpressed polynucleotide, which codes for an enolase, preferably for an enolase having a sequence identity of at least 90, 95 or 98%, preferably 100%, to the sequence according to SEQ ID NO: 146,
The present invention further relates accordingly also to a method for the overproduction of an L-amino acid, particularly L-glutamate, in which such a microorganism or such a bacterium is used.
In a further preferred embodiment according to the invention, microorganisms or bacteria according to the invention, particularly Corynebacteria according to the invention, especially Corynebacteria according to the invention of the species C. humireducens or C. glutamicum, particularly L-alanine overproduction strains according to the invention, have at least one, preferably at least two or three, particularly preferably at least four or five, of the following features, particularly preferably in combination with the overexpression of the aid gene according to the invention:
The present invention further relates accordingly also to a method for the overproduction of an L-amino acid, particularly L-alanine, in which such a microorganism or such a bacterium is used.
In a further preferred embodiment according to the invention, microorganisms or bacteria according to the invention, particularly Corynebacteria according to the invention, especially Corynebacteria according to the invention of the species C. humireducens or C. glutamicum, particularly L-methionine overproduction strains, have at least one, preferably at least two or three, particularly preferably at least four or five, of the following features:
The present invention further relates accordingly also to a method for the overproduction of an L-amino acid, particularly L-methionine, in which such a microorganism or such a bacterium is used.
In a further preferred embodiment, microorganisms or bacteria according to the invention, particularly Corynebacteria according to the invention, especially Corynebacteria according to the invention of the species C. humireducens or C. glutamicum, particularly L-lysine overproduction strains, have at least one, preferably at least 2 or 3, particularly preferably at least 4 or 5, of the following features:
The present invention further relates accordingly also to a method for the overproduction of an L-amino acid, particularly L-lysine, in which such a microorganism or such a bacterium is used.
The polynucleotides and polypeptides used or to be used in the method according to the invention mentioned above preferably originate from Corynebacteria, particularly from C. glutamicum or C. humireducens, particularly preferably from C. humireducens.
“Overexpression” in accordance with the invention is generally understood to mean an increase in the intracellular concentration or activity of a ribonucleic acid, a protein (polypeptide) or an enzyme, which are encoded by a corresponding DNA, in a microorganism, compared to the starting strain (parent strain) or wild-type strain. A starting strain (parent strain) means the strain on which the measure leading to overexpression has been carried out.
The increase in the concentration or activity can be achieved, for example, by increasing the copy number of the corresponding coding polynucleotides, chromosomally or extrachromosomally, by at least one copy.
A widespread method for increasing the copy number consists of incorporating the corresponding coding polynucleotide into a vector, preferably a plasmid, which is replicated from a microorganism, particularly a coryneform bacterium. Furthermore, transposons, insertion elements (IS elements) or phages can be used as vectors. An abundance of suitable vectors is described in the prior art.
Another widespread method for achieving overexpression is the method of chromosomal gene amplification. In this method, at least one additional copy of the polynucleotide of interest is inserted into the chromosome of a coryneform bacterium. Such amplification methods are described for example in WO 03/014330 or WO 03/040373.
A further method for achieving overexpression consists of linking the corresponding gene or allele in a functional manner (operably linked) to a promoter or an expression cassette. Suitable promoters for Corynebacterium glutamicum are described, for example, in FIG. 1 of the review article of Patek et al. (Journal of Biotechnology 104(1-3), 311-323 (2003)) and in comprehensive reviews such as the “Handbook of Corynebacterium glutamicum” (Eds.: Lothar Eggeling and Michael Bott, CRC Press, Boca Raton, US (2005)) or the book “Corynebacteria, Genomics and Molecular Biology” (Ed.: Andreas Burkovski, Caister Academic Press, Norfolk, UK (2008)). In the same way, variants of the dapA promoter, the promoter A25 for example, described in Vasicova et al (Journal of Bacteriology 181, 6188-6191 (1999)), may be used. Furthermore, the gap promoter of Corynebacterium glutamicum (EP 06007373) may be used. Finally, the well-known promoters T3, T7, SP6, M13, lac, tac and trc, described by Amann et al. (Gene 69(2), 301-315 (1988)) and Amann and Brosius (Gene 40(2-3), 183-190 (1985)), may be used. Such a promoter can be inserted, for example, upstream of the relevant gene, typically at a distance of about 1-500 nucleobases from the start codon.
The measures of overexpression increase the activity or concentration of the corresponding polypeptide preferably by at least 10%, 25%, 50%, 75%, 100%, 150%, 200%, 300%, 400% or 500%, preferably at most by 1000% or 2000%, based on the activity or concentration of said polypeptide in the strain prior to the measure resulting in overexpression.
The concentration of a protein may be determined via 1- and 2-dimensional protein gel fractionation and subsequent optical identification of the protein concentration by appropriate evaluation software in the gel. A customary method of preparing protein gels for coryneform bacteria and of identifying said proteins is the procedure described by Hermann et al. (Electrophoresis, 22:1712-23 (2001)). The protein concentration may likewise be determined by Western blot hybridization using an antibody specific for the protein to be detected (Sambrook et al., Molecular Cloning: a laboratory manual. 2nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989) and subsequent optical evaluation using corresponding software for concentration determination (Lohaus and Meyer (1998) Biospektrum 5:32-39; Lottspeich, Angewandte Chemie 38: 2630-2647 (1999)). The activity may be determined by means of a suitable enzyme assay.
“Attenuation” in accordance with the invention refers to a decrease in the intracellular concentration or activity of a ribonucleic acid, a protein (polypeptide) or an enzyme, which are encoded by a corresponding DNA, in a microorganism, compared to the starting strain (parent strain) or wild-type strain. The starting strain (parent strain) refers to the strain on which the measure for the attenuation was carried out.
The attenuation can be achieved by reducing the expression of a polypeptide, for example, by using a weak promoter or by using an allele coding for a polypeptide having a lower activity and optionally these measures may be combined. The attenuation can also be achieved by completely preventing the expression of the polypeptide, for example, by deactivating the coding gene.
The measure of attenuation decreases the activity or concentration of the corresponding polypeptide preferably by at least 10%, 25%, 50% or 75%, at most 100%, based on the activity or concentration of said polypeptide in the strain prior to the measure resulting in attenuation. In a preferred embodiment, the attenuation consists of completely deactivating the expression of the relevant polypeptide.
Feedback-resistant enzymes in connection with amino acid production is generally understood to mean enzymes which, compared to the wild form, have a lower sensitivity to inhibition by the L-amino acids and/or analogues thereof produced.
In particular, feedback-resistant aspartate kinases (LysCFBR) mean aspartate kinases which, by comparison with the wild form, show less sensitivity to inhibition by mixtures of lysine and threonine or mixtures of AEC (aminoethylcysteine) and threonine or lysine alone or AEC alone. For lysine production, corresponding strains are preferably used which comprise such feedback-resistant or desensitized aspartate kinases.
For example, the following feedback-resistant aspartate kinases from C. glutamicum are known from the literature: A279T, A279V, S301F, S301Y, T3081, T311I, R320G, G345D, S381F. With respect to feedback-resistant aspartate kinases from C. glutamicum, reference is also made to the following publications: JP1993184366-A, JP1994062866-A, JP1994261766-A, JP1997070291-A, JP1997322774-A, JP1998165180-A, JP1998215883-A, U.S. Pat. No. 5,688,671-A, EP0387527, WO00/63388, U.S. Pat. No. 3,732,144, JP6261766, Jetten et al. (1995; Applied Microbiology Biotechnology 43: 76-82). Feedback-resistant aspartate kinases from C. glutamicum are deposited in the NCBI GenBank under the following accession numbers: E05108, E06825, E06826, E06827, E08177, E08178, E08179, E08180, E08181, E08182, E12770, E14514, E16352, E16745, E16746, I74588, I74589, I74590, I74591, I74592, I74593, I74594, I74595, I74596, I74597, X57226, L16848, L27125.
The following feedback-resistant aspartate kinases from C. humireducens according to the invention are preferably used: D274Y, A279E, S301Y, T308I, T311I, G359D.
For threonine production, preference is likewise given to using strains comprising a corresponding feedback-resistant homoserine dehydrogenase (HomFBR).
For isoleucine production and valine production, preference is likewise given to using strains comprising a corresponding feedback-resistant acetolactate synthase.
For leucine production, preference is likewise given to using strains comprising a corresponding feedback-resistant isopropylmalate synthase (LeuAFBR).
For proline production, preference is likewise given to using strains comprising a corresponding feedback-resistant glutamate-5-kinase (ProBFBR).
For arginine production, preference is likewise given to using strains comprising a corresponding feedback-resistant ornithine carbamoyltransferase (ArgFFBR).
For serine production, preference is likewise given to using strains comprising a corresponding feedback-resistant D-3-phosphoglycerate dehydrogenase (SerAFBR).
For methionine production, preference is likewise given to using strains comprising a corresponding feedback-resistant D-3-phosphoglycerate dehydrogenase (SerAFBR) and/or feedback-resistant pyruvate carboxylases (pycFBR).
For tryptophan production, preference is likewise given to using strains comprising a corresponding feedback-resistant phospho-2-dehydro-3-deoxyheptonate aldolase (AroGFBR or AroHFBR).
With regard to further more preferable properties of the L-amino acid-overproducing C. humireducens strain to be used in accordance with the invention, reference is made to the publication of Wu et al. (2011) cited above and the other publications mentioned above.
Microorganisms according to the invention, particularly bacteria of the genus Corynebacterium, may be cultured continuously—as described for example in WO 05/021772—or discontinuously in a batch process (batch cultivation or batch method) or in a fed batch or repeated fed batch process for the purpose of producing the L-amino acid. A general review of known cultivation methods is available in the textbook by Chmiel (Bioprozesstechnik 1. Einführung in die Bioverfahrenstechnik [Bioprocess Technology 1. Introduction to Bioprocess Technology] (Gustav Fischer Verlag, Stuttgart, 1991)) or in the textbook by Storhas (Bioreaktoren und periphere Einrichtungen [Bioreactors and Peripheral Devices] (Vieweg Verlag, Braunschweig/Wiesbaden, 1994)).
The culture medium or fermentation medium to be used has to satisfy the demands of the particular strains in a suitable manner. Descriptions of culture media of different microorganisms are present in the handbook “Manual of Methods for General Bacteriology”, of the American Society for Bacteriology (Washington D.C., USA, 1981). The terms culture medium and fermentation medium or medium are mutually interchangeable.
The carbon sources used may be sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, molasses, sucrose-containing solutions from sugarbeet or sugarcane production, starch, starch hydrolysate and cellulose, oils and fats such as soybean oil, sunflower oil, groundnut oil and coconut fat, fatty acids such as palmitic acid, stearic acid and linoleic acid, alcohols such as glycerol, methanol and ethanol and organic acids such as acetic acid or lactic acid.
It is possible to use, as nitrogen source, organic nitrogen-containing compounds such as peptones, yeast extract, meat extract, malt extract, corn steep liquor, soybean flour and urea, or inorganic compounds such as ammonium sulphate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate. The nitrogen sources may be used individually or as a mixture.
The phosphorus sources used may be phosphoric acid, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts.
The culture medium must additionally contain salts, for example in the form of chlorides or sulphates of metals such as sodium, potassium, magnesium, calcium and iron, for example magnesium sulphate or iron sulphate, which are needed for growth. Finally, essential growth factors such as amino acids, for example homoserine, and vitamins, for example thiamine, biotin or pantothenic acid, may be used in addition to the substances mentioned above.
The feedstocks mentioned may be added to the culture in the form of a single mixture or may be fed in during the cultivation in a suitable manner.
The pH of the culture can be controlled by employing basic compounds such as sodium hydroxide, potassium hydroxide, ammonia or aqueous ammonia, or acidic compounds such as phosphoric acid or sulphuric acid in a suitable manner. The pH is generally adjusted to a value of 6.0 to 9.0, preferably 6.5 to 8. To control the evolution of foam, it is possible to use antifoams, for example fatty acid polyglycol esters. To maintain the stability of plasmids, it is possible to add to the medium suitable selective substances such as, for example, antibiotics. In order to maintain aerobic conditions, oxygen or oxygenous gas mixtures, for example air, are introduced into the culture. The use of liquids enriched with hydrogen peroxide is likewise possible. If appropriate, the fermentation is conducted at elevated pressure, for example at a pressure of 0.03 to 0.2 MPa. The temperature of the culture is normally 20° C. to 45° C. and preferably 25° C. to 40° C. In batch processes, the cultivation is continued until a maximum of the desired L-amino acid has formed. This aim is normally achieved within 10 hours to 160 hours. In continuous processes, longer cultivation times are possible. The activity of the bacteria results in a concentration (accumulation) of the L-amino acid in the fermentation medium and/or in the bacterial cells.
Examples of suitable fermentation media are found, inter alia, in the patent specifications U.S. Pat. No. 5,770,409, U.S. Pat. No. 5,840,551 and U.S. Pat. No. 5,990,350 or U.S. Pat. No. 5,275,940.
Analysis of L-amino acids to determine the concentration at one or more time(s) during the fermentation can take place by separating the L-amino acids by means of ion exchange chromatography, preferably cation exchange chromatography, with subsequent post-column derivatization using ninhydrin, as described in Spackman et al. (Analytical Chemistry 30: 1190-1206 (1958)). It is also possible to employ ortho-phthalaldehyde rather than ninhydrin for post-column derivatization. An overview article on ion exchange chromatography can be found in Pickering (LC•GC (Magazine of Chromatographic Science) 7(6), 484-487 (1989)).
It is likewise possible to carry out a pre-column derivatization, for example using ortho-phthalaldehyde or phenyl isothiocyanate, and to fractionate the resulting amino acid derivates by reversed-phase chromatography (RP), preferably in the form of high-performance liquid chromatography (HPLC). A method of this type is described, for example, in Lindroth et al. (Analytical Chemistry 51: 1167-1174 (1979)).
Detection is carried out photometrically (absorption, fluorescence).
A review regarding amino acid analysis can be found inter alia in the textbook “Bioanalytik” from Lottspeich and Zorbas (Spektrum Akademischer Verlag, Heidelberg, Germany 1998).
Accordingly, the invention relates also to a method for producing an L-amino acid, characterized in that the following steps are carried out:
A product containing L-amino acid is then provided or produced or recovered in liquid or solid form.
The fermentation measures result in a fermentation broth which comprises the relevant L-amino acid.
A fermentation broth means a fermentation medium or nutrient medium in which a microorganism has been cultivated for a certain time and at a certain temperature. The fermentation medium or the media used during the fermentation comprises/comprise all of the substances or components which ensure propagation of the microorganism and formation of the desired L-amino acid.
When the fermentation is complete, the resulting fermentation broth accordingly comprises
The organic by-products include substances which are produced by the microorganisms employed in the fermentation in addition to the desired L-amino acid and are optionally secreted. These also include sugars such as, for example, trehalose.
The fermentation broth is removed from the culture vessel or fermentation tank, collected where appropriate, and used for providing an L-amino acid-containing product, in liquid or solid form. The expression “recovering the L-amino acid-containing product” is also used for this. In the simplest case, the L-amino acid-containing fermentation broth itself constitutes the recovered product.
One or more of the measures selected from the group consisting of
The partial (>0% to <80%) to complete (100%) or virtually complete (≧80% to <100%) removal of the water (measure a)) is also referred to as drying.
Complete or virtually complete removal of the water, of the biomass, of the organic by-products and of the unconsumed constituents of the fermentation medium employed results in pure (≧80% by weight, ≧90% by weight) or high-purity (≧95% by weight, ≧97% by weight, ≧99% by weight) product forms of the L-amino acid. An abundance of technical instructions for measures a), b), c) and d) is available in the prior art.
For the L-alanine/L-valine performance assay, the type strain C. humireducens (DSM 45392) was cultured in a shaking flask batch. For this purpose, the C. humireducens strain was incubated in 10 ml of BHI liquid medium (Brain Heart Infusion; Merck) (37 g/l of H2O) at 37° C. at 200 rpm for 24 h as preculture. 10 ml of shaking flask medium were then inoculated to an OD660 of 0.2 and cultured at 37° C. at 200 rpm for 48 h. To prepare said medium, 20 g of ammonium sulphate, 0.4 g of MgSO4*7H2O, 0.6 g of KH2PO4 and 10 g of yeast extract were dissolved in 750 ml of H2O. The pH of the solution was adjusted to 7.8 with 20% NH4OH and the solution was then autoclaved. 4 ml of a vitamin solution (pH 7 with NH4OH), consisting of 0.25 g/l of thiamine, 50 mg/l of cyanocobalamin, 25 mg/l of biotin and 1.25 g/l of pyridoxine, were then added. In addition, 140 ml of a sterile-filtered 50% glucose solution and 50 g of dry autoclaved CaCO3 were added and the medium subsequently made up to one litre.
After culturing, the supernatant of four parallel cultures was in each case analysed by HPLC to determine the alanine and valine content with a detection limit of 0.01 g/l.
The type strain C. humireducens after culturing for 48 h in shaking flask medium at 37° C., 200 rpm at a shaking flask scale produces around 0.81 g/l of alanine (net yield: 0.011 galanine/gglucose) and 1.6 g/l of valine (net yield: 0.022 gvaline/gglucose) (Tab. 1).
C. humireducens
For the L-glutamate performance assay, the type strain C. humireducens (DSM 45392) was cultured in a shaking flask batch. For this purpose, the C. humireducens strain was incubated in 10 ml of BHI liquid medium (Brain Heart Infusion; Merck) (37 g/l of H2O) at 37° C. at 200 rpm for 24 h as preculture. 10 ml of shaking flask medium were then inoculated to an OD660 of 0.2 and cultured at 37° C. at 200 rpm for 48 h. To prepare said medium, 20 g of ammonium sulphate, 0.4 g of MgSO4*7H2O, 0.6 g of KH2PO4 and 10 g of yeast extract were dissolved in 750 ml of H2O. The pH of the solution was adjusted to 7.8 with 20% NH4OH and the solution was then autoclaved. 4 ml of a vitamin solution (pH 7 with NH4OH), consisting of 0.25 g/l of thiamine, 50 mg/l of cyanocobalamin, 25 mg/l of biotin and 1.25 g/l of pyridoxine, were then added. In addition, 140 ml of a sterile-filtered 50% glucose solution and 50 g of dry autoclaved CaCO3 were added. 5 ml of a 400 mM sterile-filtered threonine stock solution were then added and the medium was subsequently made up to one litre.
After culturing, the supernatant of four parallel cultures was in each case analysed by HPLC to determine the glutamate content with a detection limit of 0.01 g/l.
The type strain C. humireducens after culturing for 48 h in shaking flask medium at 37° C., 200 rpm at a shaking flask scale produced 1.8 (+/−0.6) g/l of L-glutamate. The initial concentration of L-glutamate in the medium was 0.78 (+/−0.1) g/l.
Ten individual clones of the wild-type strain C. humireducens (DSM 45392) were each cultured in 10 ml of BHI liquid medium (Brain Heart Infusion; Merck) (37 g/l of H2O) in shaker flasks overnight at 37° C. and 200 rpm. Next in each case 100 μl of the overnight culture was plated out onto minimal medium agar plates with 25 mM S-2-aminoethyl-L-cysteine (AEC) (MW=164 g/mol) and incubated for three days at 37° C. For the production of the minimal medium, 5 g of (NH4)2SO4, 5 g of urea, 2 g of KH2PO4, 2 g of K2HPO4 and 10 g of MOPS were dissolved in 750 ml of H2O, the pH adjusted to 7.6 with 1 M KOH and the mixture autoclaved. The remaining components were made up and sterile-filtered separately. For this, 20 ml of 50% (w/v) glucose, 1 ml of 1% (w/v) CaCl2, 1 ml of 1 M MgSO4, 1 ml of 0.02% biotin and 1 ml of trace element solution (1 g of FeSO4×7 H2O, 1 g of MnSO4×7 H2O, 0.1 g of ZnSO4×7 H2O, 0.021 g of CuSO4×5 H2O and 0.002 g of NiCl2×6 H2O per 100 ml of H2O) were added to the medium and then made up to 1000 ml with sterile H2O. For the culturing on solid medium plates, 15 g/l agar-agar (Merck) was added to the medium. Visible individual colonies were again plated out onto fresh minimal medium agar plates with 25 mM AEC and 12.5 mM threonine as a fractionated smear and incubated for three days at 37° C. Then in each case 10 ml of BHI liquid medium (Brain Heart Infusion; Merck) (37 g/l of H2O) in the shaker flask were inoculated with a single clone and incubated overnight at 37° C. shaking at 200 rpm, then treated with 10% glycerine and stored at −80° C. as reference samples.
Sequence Analysis of the lysC Sequence Region
For the analysis of the lysC sequence regions of the isolated individual clones, the relevant gene region of lysC was amplified by means of primers (lysC_for: 5″AGACGAAAGGCGGCCTACAC3″ and lysC_rev: 5″TCCAGGATCGAGCGCATCAC3″) and the PCR technique. The DNA sequences obtained were analysed by means of the software Clone Manager. Through the analysis of the lysC sequence of the isolated AEC+threonine resistant C. humireducens clones, the following point mutations were identified:
C. humireducens clones and amino acid substitutions caused thereby.
C. humireducens clones
C. humireducens AEC Thr r#1
C. humireducens AEC Thr r#2
C. humireducens AEC Thr r#3
C. humireducens AEC Thr r#4
C. humireducens AEC Thr r#5
C. humireducens AEC Thr r#6
C. humireducens AEC Thr r#7
C. humireducens AEC Thr r#9
C. humireducens AEC Thr r#10
The type strain C. humireducens and the isolated individual clones from the AEC+threonine screening were cultured in shaker flasks and subjected to a performance assay as regards their lysine synthesis on the shaker flask scale. For this, the C. humireducens strain and the isolated AEC+threonine resistant C. humireducens clones were incubated in 10 ml of BHI liquid medium (Brain Heart Infusion; Merck) (37 g/l of H2O) as a preculture at 37° C. and 200 rpm for 24 hrs. 10 ml of shaking flask medium were then inoculated to an OD660 of 0.2 and cultured at 37° C. at 200 rpm for 48 h. For the preparation of this medium 7.5 g of corn steep liquor (50%), 20 g of morpholinopropanesulphonic acid (MOPS), 25 g of (NH4)2SO4, 0.1 g of KH2PO4, 1 g of MgSO4*7H2O, 0.01 g of CaCl2*2H2O, 0.01 g of FeSO4*7H2O and 0.005 g of MnSO4*H2O were dissolved in 750 ml of H2O, the pH was adjusted to 7.0 with aqueous ammonia and the mixture autoclaved. Next, 25 g of dry autoclaved CaCO3 were added. The remaining components were made up and sterile-filtered separately. For this, 90 ml of 50% (w/v) glucose and 10 ml of a solution of 30 mg/l thiamine and 20 mg/l biotin were added to the medium and then made up to 1000 ml with sterile H2O.
After the culturing, in each case from the supernatant of two parallel cultures, an HPLC analysis was performed for determination of the L-lysine contents with a detection limit of ≧0.01 g/l. The lysine end titres and yields of the cultures are shown in the following table.
| Number | Date | Country | Kind |
|---|---|---|---|
| 102014208199.8 | Apr 2014 | DE | national |
| 14166633.9 | Apr 2014 | EP | regional |
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/EP2015/058307 | 4/16/2015 | WO | 00 |
