This invention relates to a protein with an activity of the glucanosyltransferase type, and more especially a β-(1-3)-glucanosyltransferase activity.
This invention also relates to oligonucleotides coding for this protein having an enzymatic activity.
It also relates to molecules having an effect on the activity of this enzyme.
Opportunistic fungal infections due to Candida, Aspergillus, Cryptococcus and Pneumocystis are responsible for the increase in morbidity and mortality among patients suffering from AIDS and other patients with clinically compromised immunity. In addition, the yeast Candida and the dermatophytes today remain a major medical problem amongst patients with adequate immunity. Despite the increase in the number of infections due to pathogenic and opportunistic fungi, therapy against mycoses has not improved in recent years. Two families of drugs are used: the azoles and Amphotericin B. These drugs have some disadvantages since treatment based on Amphotericin B is associated with nephrotoxicity and that based on azole is more fungistatic than fungicidal.
Fungi are microorganisms of the eukaryotic type which share the majority of their biochemical pathways with their hosts, with one important exception: the biosynthesis of the cell wall. The cell wall is a rigid envelope which protects the cell against the environment and mechanical stresses, but is also a dynamic structure which is involved in the transport of ions and macromolecules and in the localization of enzymes involved in fungal growth. In consequence, disorganization of the organization of the cell wall should be detrimental to fungi.
The skeleton of the fungal cell wall is mainly composed of polymers of the polysaccharide type (β(1-3) glucans, mannans, chitin) which are not found in humans. For this reason, the biosynthesis of the cell wall has been a target for research into new antifungal drugs. The penicillins and cephalosporins, which are both inhibitors of the bacterial cell wall, and potential antibiotics lend support to this hypothesis. Moreover, many molecules which inhibit the development of the fungal cell wall have antifungal properties (Debono and Gordee, 1994, Annu. Rev. Microbiol, 48, 471-497). Among these are:
The synthesis of β(1-3) glucan and chitin is under the control of enzyme complexes (glucan synthetase and chitin synthetase) which are localized in the plasma membrane. Once the polymers have been released into the periplasmic space, cross-links are created between the polymers and it is these which are responsible for the rigidity of the cell wall. The proteins and genes of the glucan and chitin synthetases are beginning to be fairly well understood.
However, the inhibition of the glucan and chitin synthetases by a molecule requires three steps: its transfer across the cell wall, crossing of the plasma membrane and transfer inside the cell to the target, each step representing a potential barrier for the enzymatic inhibitor from being an effective antifungal drug or a potential source of resistant strains against the drug.
The transferases which are responsible for creating the covalent bonds between the different polymers of the wall have been very little studied up till now.
These enzymes represent a better target than the chitin and glucan synthetase complexes since they are more easily accessible for a putative antifungal drug.
Nuoffer et al. (1991, Mol. Cell. Bio., 11, 27-37) have described a glycoprotein, named Gas1p, exposed on the surface of the yeast Saccharomyces cerevisiae. The genes coding for this protein have been cloned. The function of the Gaslp protein is not essential for the viability of the cell, and has not been determined.
Saporito-Irwing et al. (1995, Mol. Cell. Biol., 15, 601-613) have isolated a gene originating from the yeast Candida albicans, designated PHR1. The amino acid sequence determined for this protein PHR1 was 56% identical to that of the protein Gas1. The gene was regulated in response to the pH of the culture medium. As for the protein gas1p, no function has been determined.
It clearly emerges from this analysis of the prior art that there has been a problem in obtaining molecules with effective antifungal activity.
The inventors have solved this problem.
They have shown that the introduction of mutations into a glucanosyltransferase originating from Aspergillus fumigatus interferes with the development of this microorganism.
They have also determined the sequences of several of these enzymes.
The present invention thus relates to a first protein with an activity of the β(1-3)-glucanosyltransferase type characterized in that it has at least 50%, preferably 60%, and even more preferably 85% homology with proteins having the sequences, or a part of the sequences SEQ ID NO. 2 or SEQ ID NO. 3 as follows:
This protein preferably has a molecular weight of about 44 kD, or of about 49 kD if it carries at least one residue of the N-glycosyl type.
The present invention also relates to proteins with β-(1-3)-glucanosyltransferase activity characterized in that they have at least 50%, preferably 60% and even more preferably 85% homology with proteins having the sequences, or a part of the sequences SEQ ID NO. 10 or SEQ ID NO. 12 as follows:
The present invention also relates to fragments of these proteins.
Said invention is not limited to the proteins having the sequences SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 10 or SEQ ID NO. 12 but extends to any protein having sequences similar to those having the sequences SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 10 or SEQ ID NO. 12 and in particular having certain amino acid substitutions in which an amino acid is replaced by another amino acid having essentially the same physico-chemical properties. Lehninger's biochemistry manual (Flammarion Medecine-Science, 1977, or one of its more recent editions) distinguishes four groups of amino acids, based on their physico-chemical behavior: those with a non-polar or hydrophobic side-chain, those with an uncharged polar side-chain, those with a negatively charged side-chain, and those with a positively charged side-chain.
The present invention also relates to nucleotide sequences coding for proteins, or protein fragments such as those described above, and more particularly DNA sequences (cDNA or genomic DNA) or RNA sequences.
Such a DNA sequence may be that having at least 50%, preferably 60% and even more preferably 85% homology with the genomic sequence SEQ ID NO. 1, or a part of the sequence SEQ ID NO. 1 as follows:
This sequence has been included in a 2.2 kb fragment, which has itself been included in the X bal site of the pUC19 vector (Maniatis et al., 1989, Cold Spring Harbor Laboratories Press). The strain E. coli DH5α carrying this modified vector was deposited in the Collection Nationale de Culture de Micro-Organismes at the Institut Pasteur (CNCM) on the 26 Jul. 1996 under the number I-1763.
Such a sequence may also be that having at least 50%, preferably 60% and even more preferably 85% homology with the complementary DNA sequence comprised in a 1.4 kb fragment, which has been included in the pCRII vector (In Vitrogen). This, carried by the E. coli DH5α strain, was deposited in the Collection Nationale de Culture de Micro-Organismes at the Institut Pasteur (CNCM) on the 26 Jul. 1996 under the number I-1762.
These two strains are objects of the present invention.
Nucleotide sequences according to the present invention may also be those having at least 50%, preferably 60%, and even more preferably 85% homology with one of the DNA sequences SEQ ID NO. 9 or SEQ ID NO. 11 as follows:
These two sequences have been independently included in the pCRII vectors and introduced into the E. coli DH5α strain. These strains were deposited in the Collection Nationale de Culture de Micro-Organismes at the Institut Pasteur (CNCM) on the 22 Aug. 1997 under the numbers I-1914 and I-1913.
A further object of the present invention is a method for the detection of proteins with a strong homology with the sequence of the protein BGT2.
The present invention thus relates to a method for detecting a nucleotide sequence having at least 60% identity with the sequence SEQ ID NO. 1 in a biological sample containing nucleotide sequences, comprising the following steps:
a) placing the biological sample in contact with the nucleotide primers P3 and P4 having the sequences SEQ ID NO. 7 and SEQ ID NO. 8, respectively, as follows:
the nucleotide sequences contained in the sample having been if necessary put into a form enabling their hybridization under conditions enabling the hybridization of the primers with the nucleotide sequences.
The proteins according to the invention may be obtained by purification of an autolysate of Aspergillus fumigatus. The protein may be purified by four steps of ion-exchange chromatography and one step of gel filtration.
Said proteins may also be obtained by genetic engineering methods. For example, the sequence SEQ ID NO. 1, if possible without its C-terminal part, may be cloned in an appropriate vector, and expressed in an expression system, such as the Pichia pastoris system, marketed by In Vitrogen.
In this system, the sequence of the gene coding for the protein is cloned in an expression vector, then linearized. Protoplasts originating from P. pastoris are transformed with the linearized vector.
The clones, in which a recombination is performed and which replaces the aox1 sequence by the sequence of the gene of the protein which it is desired to produce, are selected for their capacity to grow in a histidine-deficient medium. A person skilled in the art may refer to “Manual of methods for expression of recombinant proteins in Pichia pastoris”, published by In Vitrogen.
The protein thus expressed, if possible secreted in the culture medium, is recovered by processes known to a person skilled in the art.
Such a protein may be used, in particular, for screening molecules to identify their antifungal activity.
Thus, another object of the present invention is a process for screening molecules to identify their antifungal activity comprising the following steps:
The determination of the effect of the molecules on said protein may be accomplished by measuring the activity of the β-(1-3) glucanosyltransferase (BGT2). Such activity may be determined by placing said protein in the presence of a substrate on which it has an effect, which may be composed of laminarioligosaccharides comprising at least 10 glucosyl radicals linked by β-(1-3) bonds. When the protein is active, it cleaves a part of the molecule and binds the fragment obtained onto the non-reducing terminal of an uncleaved substrate molecule.
The product resulting from the activity of the protein is in the form of coupling products of two laminarioligosaccharides. This product may be detected by any process allowing the separation of oligosaccharides with different degrees of polymerization, in particular by chromatographic methods, such as high-pressure liquid chromatography, (HPLC) or thin-layer chromatography (TLC). Ths latter method, although less precise than the first, is the easier to use.
For the use of these chromatographic methods, a person skilled in the art may consult the following manual: Carbohydrate analysis:a practical approach. Chaplin and Kennedy, 1986 IRC Press, Oxford.
This detection method enables determination as to whether the molecules detected have antifungal activity.
These molecules having antifungal activity show effects on the β-(1-3)glucanosyltransferase activity of said proteins. These effects may be for example the inhibition of this activity.
The present invention also relates to molecules having an effect on said proteins, which may be detected by the process as described above, as well as the use of these molecules to prepare a drug, or for the treatment of diseases related to fungi, in vertebrates and plants.
One of the advantages of the use of these molecules lies in the low frequency of appearance of resistant strains of the fungi, in contrast to other known antifungal molecules.
The present invention is illustrated, without being limited, by the following examples:
c are comparisions of the sequences of the protein with sequence SEQ ID NO. 2 and the five following proteins: Phr 1p, Gas 2p, Gas 3p, Gas 4p and Gas 5p.
Experimental Procedures
1. Preparation of the Cell Wall and Autolysis.
The strain CBS 144-89 of type A. fumigatus (available from the Collection Centralbureau voor Schimmelculture) was grown in a 15 L fermenter in 2% glucose, 1% mycopeptone (Biokar Diagnostics) plus 0.1% silicone antifungal 426R (Rhodorsil) at 25° C. (agitation at 500 r.p.m., aeration 0.5 vol.vol−1. min−1. for 42 h). A culture which had grown for 3 days in a 2 L fermenter under the same conditions was used as the inoculum (8%(v/v)). The mycelia were collected by filtration under vacuum and ruptured by passing through a Dyno type mixer in the presence of glass beads (W. A. Bachofen A G, Basel, Switzerland) (0.5-0.75 mm diameter). The progression of the disruption of the cells was monitored microscopically. The suspension of the ruptured mycelia was centrifuged (8000 g, 15 min) and the residue containing the cell walls was washed 3 times with water and once with 50 mM Na acetate, pH 5.6 containing 5 mM Na azide, then resuspended in the same buffer (250 g wet weight per L of buffer) and incubated (agitation 200 r.p.m.) at 37° C. After 72 h, the suspension was centrifuged (10000 g, 15 min) and the supernatant was placed in a dialysis tube, concentrated 5 to 10 times with polyethylene glycol 20000, dialyzed against 5 mM Na acetate, pH 5.6, recentrifuged (10000 g, 15 min) and filtered (0.45 μm filter). This preparation is subsequently referred to as the autolysate.
2. Enzyme Purification
The fractions collected during each step of the chromatography were tested for enzymatic activity using the non-radioactive transferase test (see below). The dialyzed and concentrated autolysate was applied to a 4×18 cm DEAE-SEPHAROSE FAST-FLOW column (Pharmacia) equilibrated with 5 mM Na acetate, pH 5.6, and the column was eluted with a linear gradient up to 1M NaCl (2000 ml) at a flow rate of 240 ml.h−1. The fractions containing transferase activity were collected, dialyzed against a buffer containing 10 mM β-mercaptoethanol, 5 mM EDTA, 10 mM Na acetate, pH 4.0, applied to a MONO S column (HR 5/5 Pharmacia), and eluted with a linear gradient of NaCl (0 to 300 mM in 40 min) at a flow rate of 0.8 ml.min−1. The fraction containing transferase activity was collected, dialyzed against 10 mM Tris/HCl, pH 7.0, and applied to a DEAE-5PW column (8×75 mm, TosoHaas), and eluted with a linear gradient up to NaCl (0 to 300 mM in 60 min) with a flow rate of 0.75 ml.min−1. The fractions containing transferase activity were collected, dialyzed against a buffer containing 10 mM β-mercaptoethanol, 5 mM EDTA 10 mM EDTA, 10 mM Na acetate, pH 4.0, and applied to a CM-5PW column (8×75 mm, TosoHaas), and eluted with a linear gradient of NaCl (0 to 300 mM in 60 min) with a flow rate of 0.8 ml.min−1. The fractions containing transferase activity were collected and concentrated by a speed-vac and fractionated on a SUPERDEX HR75 column (Pharmacia) equilibrated with 10 mM Tris/HCl, pH 7.0 containing 150 mM NaCl, at a flow rate of 0.75 ml.min−1. The fractions containing purified transferase were collected, dialyzed against 5 mM Na citrate, pH 5.0, concentrated by speed-vac and stored at −20° C. until used.
3. Transferase Assays
The enzyme fractions were assayed for transferase activity by incubation in 50 mM Na citrate, pH 5.0 at 37° C. (10 μl volume per assay) with a laminarioligosaccharide reduced with borohydride (8 mM final) of at least size G10. Samples (3 μl) were taken at different times, 50 mM NaOH cooled in ice (47 μl) was added to terminate the reaction, and the mixture was frozen until analyzed by high-performance anion-exchange chromatography (HPAEC). Since the peak intensities detected by Pulsed Electrochemical Detector (PED) varied from day to day, the transferase activity was quantified by use of reduced laminarioligosaccharides marked with 3H as substrates and measurement of the appearance of the marking in the products after separation by HPAEC chromatography, using the on-line Radiomatic 150TR scintillation rate analysis apparatus (Packard). Except where otherwise mentioned, the assays for the enzyme characterization studies were performed as above with 0.25 μg of purified transferase.
4. Colorimetric Determinations
The β-glucanase activity was measured in the protein fractions by a sugar reduction test using the reagent hydroxybenzoic acid hydrazide with laminarin reduced by borohydride instead of carboxymethyl pachyman as substrate (Ram et al., 1988, Life Sci Adv., 7, 379-383). The exo-β-glucanase/β-glucosidase activities were measured by incubating the enzyme fractions with p-nitrophenyl-β-D-glucopyranoside (Hartland et al., 1991, Proc. R. Soc. London B, 246, 155-160). The quantity of the proteins was estimated using the Biorad protein test according to the manufacturer's instructions, with bovine serum albumin as standard.
5. High-Performance Anion-Exchange Chromatography
The samples from the transferase tests were analyzed on a Dionex CARBOPAC PA1 analytical column (4×250 mm) (with a PA1 reference column) on a Dionex HPAEC-type system with pulsed electrochemical detection (PED-2 cell), fitted with a combination of pH-Ag/AgCl reference electrodes and using a potential of 0.4 V for the first 0.5 s of detection. The oligosaccharides were eluted under the following conditions: flow rate 1 ml/min, buffer A: 50 mM NaOH; buffer B: 500 mM sodium acetate in 50 mM NaOH; gradient 0 to 2 min, 98% A 2% B (isocratic), 2 to 15 min 75% A 25% B (linear), 15 to 45 min 60% A 40% B (linear). The laminarioligosaccharide standards were obtained from Seikagaku (Japan).
6. Thin-Layer Chromatography (TLC)
The laminarioligosaccharides were revealed by thin-layer chromatography on silica gel 60 (Kieselgel, Merck) using n-butanol/acetic acid/water (2/1/1.5) as eluant and sulfuric orcinol coloration. The degree of polymerization (dp) of the oligosaccharides was also determined by HPAE-type chromatography using a pulsed electrochemical detector and an anion-exchange column (CARBO6PAC PA1, 4.6×250 mm, Dionex).
7. Preparation of Reduced Substrates
The laminarioligosaccharides were obtained by partial acid hydrolysis (6.5 M TFA, 15 min, 100° C., followed by 1 M TFA, 45 min, 100° C.) of curdlan (Serva). The TFA was removed by rotary evaporation in the presence of methanol. The oligosaccharides were reduced overnight with NaBH4 (1:0.5 (w/w) in 0.1 M NaOH at room temperature). The reduced ends of the laminarioligosaccharides marked with 3H were similarly prepared by reduction with NaB3H4 (Amersham, 20-40 Ci/mmol, 10 mCi per mg of oligosaccharide) overnight followed by a subsequent reduction by NaBH4 as before. The excess of NaBH4, was destroyed by addition of acetic acid up to pH 5-6, and the borate salts were removed by rotary evaporation in the presence of methanol. The reduced oligosaccharides were desalted by gel filtration on a SEPHADEX G15 column (1.2×80 cm, 8 ml.h1−, equilibrated in water) and collected after detection by the orcinol-sulfuric acid method (Ashwell, 1966, Methods Enzymol, 8, 85-95). The laminarioligosaccharides were separated by HPAEC on a CARBOPAC PA1 preparative column (9×250 mm, Dionex) with a Na acetate gradient 15 to 350 mM in 50 mM NaOH (45 min) at a flow rate of 4 ml.min−1. The oligosaccharide fractions collected were neutralized with acetic acid, desalted by gel filtration on a SEPHADEX G15 column as described above, then lyophilized. The laminarin (Sigma) was reduced in the same way, but desalted by dialysis against 0.5% acetic acid, followed by dialysis against water, then lyophilized. The gentiooligosaccharides were prepared as above (without reduction) from pulsatin (Calbiochem) which had been finely divided with a pestle and mortar. The maltoheptaose and cellopentaose were from Boehringer Mannheim and Sigma, respectively. The chitohexaose was a gift from Dr. A Domard (Université Claude Bernard, Villeurbanne, France). G10 reduced with borohydride containing a β-(1-6) intrachain bond at the sixth link from the reduced end (rG10*) was obtained by incubating the reduced laminarihexose (rG6) with an enzyme homologous with the BGT1 enzyme from Candida purified from A. fumigatus. The product from the transferase rG10* was separated and purified as for the laminarioligosaccharides above.
7. Electrophoresis on SDS-Polyacrylamide Gel
The protein samples were analyzed by SDS-PAGE (Laemmli, 1970, Nature, 227, 680-685) using 10% separation gels and 4% stacked gels. The protein bands were revealed by coloration with Coomassie blue. The N-glycosylation of the glycoproteins was performed using the recombinant N-glucosidase F (Oxford GlycoSystems) according to the manufacturer's instructions.
8. 1H NMR Spectroscopy
Two samples were analyzed: the reduced laminarioligosaccharide G10 used as standard and a reduced oligosaccharide G16 obtained after incubation of rG10 with the transferase and purified by HPAEC. The deuterium in the samples dried by lyophilization was replaced by dissolution in D2O (99.95%, Solvents Documentation Synthese, France). The spectra were recorded at 300 K and 318 K on Variant Unity 500 spectrometer operating at a proton frequency of 500 MHz. The OH resonance of the residual water was removed by selective radiation during the relaxation time. Sodium 3-trimethylsilylpropionic acid was used as external standard.
A high-performance anion-exchange chromatography (HPAEC) test using laminarioligosaccharides reduced with borohydride as substrates was developed to study the activities of the β-glucanosyl transferase associated with the cell wall of A. fumigatus. A new β-(1-3)-glucosyl transferase activity was detected in the semi-purified fractions from the autolysate of the cell wall of A. fumigatus, which remained associated with a 49 kDa protein throughout its purification.
The protein was purified to apparent homogeneity with four steps of ion-exchange chromatography and one gel filtration step.
The activity of the transferase was clearly detectable after only the second chromatography step (MONO S). The analysis by SDS-PAGE of the purified fraction showed a main band at 49 kDa (
HPAEC analysis of the products resulting from the incubation of the 49 kDa protein with a laminarioligosaccharide reduced with borohydride (rGn) of size G10 or larger led to the characterization of a new activity of glucanosyl transferase type.
The principal initial products arising from the incubation with rG11 were rG6 and rG16; rG12 gave rG6+rG7 and rG17+rG18, rG13 gave rG6 to rG8 and rG18 to rG20, and rG14 gave rG6 to rG9 and rG19 to rG22 (
The profile of the products obtained (
E+rG11→E.G5+rG6
E.G5+rG11→E+rG16
where E represents the enzyme. The transferase cleaves rG12 in two different places, leading to two different transferase-type products:
E+rG12→E.G6+rG6
→E.G5+rG7
E.G6+rG12→E+rG18
E.G5+rG12→E+rG17
Similarly with rG13 and rG14, the transferase cleaves in three or four different places, respectively, each time transferring the part of the non-reduced end to another acceptor molecule rG13 or rG14.
Additional analyses of incubations of the 49 kDa transferase with reduced or smaller laminarioligosaccharides showed that the reaction with rG10 gave rG5+rG6 and rG14+rG15, as initial major products, while the reaction with rG9 was extremely slow, forming small peaks of rG5 to rG8 and rG10 to rG13. No products were detected after incubation with laminarioligosaccharides of size G8 or smaller.
In order to determine the relative reaction rate of the enzymes with laminarioligosaccharides of variable sizes, the 49 kDa enzyme (0.25 μg) was incubated with 8 mM of rG10 to rG15 marked with 3H and the rate of formation of the marked products was measured. The rate with rG10 (328 nmol.min−1) was approximately equal to 50% of that with the larger substrates and there was no significant difference between the reaction rates for rG11 to rG15 (648±46 nmol.min−1.mg protein−1).
Analysis of longer incubations of the purified enzymes with reduced laminarioligosaccharides of size at least G10 showed that the products from the initial transferase could be re-used either as donors or as acceptors, leading to the formation of products of increasing size, until they are eliminated from the solution because of their insolubility in the aqueous buffer. An incubation of 30 min with rG16 (containing some contaminating rG15) led to the formation of reduced initial major products of sizes G6 to G11 and G21 to G26 (
In order to determine the smallest laminarioligosaccharide which could act as acceptor, the purified transferase was incubated with 4 mM of rG11 as donor and 16 mM of rG8 or smaller as acceptor. Analyses of the incubations of rG11 rG4 or smaller showed the formation of rG6 and rG16 as the only initial major products, showing that only rG11 had been used as acceptor. However, incubations containing rG11 and rG5 to rG8 showed additional transferase products consistent with the use of the latter oligosaccharides as acceptors. For example, the reaction of rG11 and rG7 led to the initial formation of rG6, rG12 and rG16 consistent with:
E+rG11→E.G5+rG6
E.G5+rG11→E+rG16
E.G5+rG7→E+rG12
The relative rate of the reaction with the acceptors was determined by using 2 mM of rG11 as donor and 32 mM of reduced acceptor marked with 3H and measuring the formation of marked transferase product (
The transferase showed no activity towards the gentiooligosaccharides (size G3-8), chitohexaose, cellopentaose or maltoheptaose, either in the presence or absence of rG11, suggesting that the enzyme exclusively uses a β-(1-3) glucan as donor. This was demonstrated by using a reduced branched G10 (rG10*) similar to the laminaridecaose, except that the sixth link from the reduced end is a β-(1-6)-type link. Incubation of the 49 kDa enzyme with 8 mM of rG10* gave no products, showing that it was not a donor. However, a similar incubation in the presence of 2 mM of rG11 led to the formation of rG6 and an elution peak in the position of rG15 as initial major products, showing that rG10* can act as an acceptor.
In order to determine if the 49 kDa transferase had produced a new type of bond during the transfer, the product rG16 of the transferase was purified from the incubation medium of the transferase with rG11. Approximately 300 μg of the product were analyzed by 1H NMR. The 1D spectrum of the product rG16 of the transferase showed three chemical shifts in the anomeric region:
δ=4.68 ppm corresponding to the glucose residue linked to the glucitol group;
δ=4.75 ppm corresponding to the glucose residue of the non-reduced end;
δ=4.80 ppm corresponding to the intrachain residues of glucose, linked β-(1-3).
The relative intensities of the anomeric signals showed 1, 1 and 13 protons respectively. Since the glucitol gives no signals in the anomeric region, this confirms the length of the oligosaccharide (16 residues), The coupling constants measured for these signals were in agreement with β-linked glucose residues (3J1,2=7.9 Hz). The presence of a single unit of the glucose type at the non-reduced end indicates that the 49 kDa protein had been transferred to the non-reduced end of the β-(1-3) glucan acceptor.
The 1D spectrum of the product rG16 was identical, except for the relative intensity of the 4.80 ppm signal compared to that of the rG10 laminarioligosaccharide standard. In addition, no chemical shift characteristic of a glucose residue linked (1-2), (1-4) or (1-6) was visible, confirming that the rG16 product was a laminari-hexadecaose. The conjoint elution of the rG16 product with the rG16 reference on HPAEC and the insolubility of the larger product are in agreement with the production of a β-(1-3)-type bond during the transfer.
In order to determine whether the concentration decreasing of acceptors stimulated the hydrolysis reactions, the 49 kDa transferase was incubated with 3 μl of [3H]-rG11 and decreasing quantities of unmarked rG11. A shift from the transfer (i) to the hydrolysis (ii) was observed (
E+[3H]-rG11→E.G5+[3H]-rG6
(i)→E.G5+[3H]-rG11→E+[3H]-rG16
(ii)→E.G5+H2O→E+G5
The percentage of transfer was determined by measuring the formation of marked rG16 (transfer only) compared with that of marked rG6 (transfer plus hydrolysis) in the reaction. At an rG11 concentration of 3 mM, only transfer was detected. As the substrate concentration reduced to 18 μM, the percentage of transfer leveled out at about 35% and did not decrease significantly with a low substrate concentration (3 μM) (
The 49 kDa enzyme was tested at different pH values, the storage stability was verified and the activity of the N-glycosylated enzyme was tested. The enzyme was active over a wide range of acid pH, showing an activity of more than 50% of its maximum between pH 2.5 and 6.0. The enzyme showed a pH optimum of about 5.0 in citrate buffer (
The 49 kDa enzyme catalyzed its transferase-type reaction by a bi-reaction type mechanism (two steps) with an initial hydrolysis of the substrate to liberate the portion of the reduced end, and a subsequent transfer of the remainder of the non-reduced end to a substrate molecule playing the role of an acceptor molecule.
By using rG11 as substrate, it was impossible to calculate an apparent Km corresponding to the two steps of the reaction. In order to determine a Km for the donor site, we used an acceptor which was not a donor. We used [3H]-rG7 (1×106 cpm) as acceptor at a high concentration (64 mM) with different concentrations of rG11 kept below 8 mM. Under these conditions, the reaction took place with rG11 as donor and rG7 was used rather than rG11 as acceptor, as determined by the absence of formation of the transferase product rG16. The initial reaction rate was determined by measuring the appearance of marked rG12.
An apparent Km of 5.3 mM was obtained from reciprocal double spots (value of r2=0.997).
Two amino acid sequences were obtained from the purified BGT2 protein. The NH2 terminal sequence was DVTPITVKGNAFFKGDERFY (SEQ ID NO: 20) and an internal sequence was DAPNWDVDNDALP (SEQ ID NO: 21). An oligonucleotide of 38 units on the N-terminal part having the following sequence SEQ ID NO: 4:
The transfer was performed on membranes of the ZETAPROBE type. The membranes were pre-hybridized and hybridized at 50° C. in a solution containing SSC 5×, Na2HPO4 20 mM, pH7, SDS 7%, Denhard 10× and 1% salmon sperm. The membranes were washed twice at 42° C. in a solution containing SSC 3×, Denhard 10×, SDS 5%, Na2HPO4 25 mM, and twice in an SDS solution with 1% SSC 1×.
The cloning and sequencing of the gene coding for the BGT2 protein showed significant homologies with the genes PHR1 and GAS1 previously identified in C. albicans and S. cerevisiae respectively (Saporito Irwin and Coll. (1995) Mol. Cell Biol., 15, 601-613; Nuoffer and Coll., J. Biol. Chem., (1991), 226, 19, 12242-12248) (
The disruption of the BGT2 gene was carried out by using the vector pAN7-1 (Punt and Coll. (1987) Gene 56, 117-124) supplied by P. Punt (TNO, Rijinsik). This vector was modified as pN4 (Paris and Coll. (1993) FEMS Microbiol. Lett. 111, 31-36) by the replacement of a restriction site HindIII by a Smal site. About 50% of the open reading frame of BGT2 was replaced by pN4 at an EcoRV restriction site. A complete transformation was performed as previously described (Paris, (1994) Isolation of protease negative mutants of Aspergillus fumigatus by insertion of a disrupted gene, p. 49-55. Mol. Biology of pathogenic fungi, B. Maresca and G. S. Kobayashi) by using protoplasts produced by Novozyme and the linearized plasmid in the presence of PEG.
The Δ49 mutant from A. fumigatus obtained was deposited on 30 Jul. 1996 at the CNCM under the deposit number I-1764.
It showed no phenotype distinct from the wild strain, except for a total inhibition of the growth in the fermenter after 24 hours growth.
The cDNA of BGT2 was obtained by amplification with two primers of cDNA type 5′ GAATTCGACGACGTTACTCCCATCACT 3′ (SEQ ID NO: 5) of P1 and 5′ TCTAGAGGGTATGAGAAGAACAAATCA 3′ (SEQ ID NO: 6) of P2 obtained from 10 ng of cDNA, 1 U of taq polymerase, 200 mM of each primer. 30 Amplification cycles were performed, comprising 1 minute at 95° C., one minute at 55° C. and one minute at 72° C.
The amplified preparation was then cloned in a vector using a TA Cloning kit (In Vitrogen).
Experiments using Triton X114 divisions with or without treatment with GPI-, phospholipase C showed that the protein BGT2 from A. fumigatus was attached to the plasma membrane by a GPI residue.
The attachment of the protein to the membrane was not necessary for retention of enzymatic activity. We showed that in A. fumigatus the same activity was present when the protein was either free in the culture medium (in the absence of the GPI bond) or attached to the plasma membrane.
These results suggested that the expression of the glucanosyltransferase could be performed in vectors by a secreted expression. The Pichia pastoris expression system from In Vitrogen was selected. This system bad been previously used for another 88 kDA protein from A. fumigatus and it was confirmed that Pichia preserved the glycosylation site of the native protein very well.
The vector used was pPICZα (In Vitrogen) for the secretion with a myc epitope and six histidine residues in tandem for easy purification. The C-terminal sequence responsible for the attachment by GPI was removed before the sub-cloning in pPICZα so as to obtain an enzymatically active truncated secreted protein.
This recombinant protein was used for the detection of antifungal drugs. The inhibition of the enzymatic activity may be measured by an HPLC-type detection in the absence of cleavage and an additional elongation of any β-(1-3) laminarioligosaccharides with dp>10 in the presence of p49 from A. fumigatus.
The absence of motility of the laminarioligosaccharide measured by thin-layer chromatography by conventional techniques or directly after marking of the reduced end with a chromogenic or fluorogenic radical could be a fundamental technique for performing detection automatically.
Since the product from the β-(1-3) glucanosyltransferase becomes insoluble in an aqueous medium, because of the elongation of the β-glucan chain, the absence of precipitation of any product after prolonged incubation using a radioactively marked substrate could also be used for drug detection.
Degenerate oligonucleotide primers corresponding to the regions retained in the sequence in
SEQ ID NO. 7 (P3): 5′GSYTTCTTCKCYGGCAACGAGGTT 3′
SEQ ID NO. 8 (P4′): 5′GTTGCAGCCGWATTCGGASAYGAA 3′ in which Y is C or T
K is T or G
S is C or G
W is A or T.
PCR reactions were carried out in a volume of 100 μl containing 1.5 mM MgCl2, 50 mM Kcl, 10 mM TrisCl (pH 8), 250 μM of dATP, dGTP, dCTP and dTTP (Pharmacia), 1 μM of each primer, 2.5 units of AMPLITAQ DNA polymerase (Pharmacia) and 50 ng of genomic DNA. The amplification was performed in an OmniGene apparatus initially for 5 min at 93° C., then for 30 cycles of 1 min at 93° C., then for 1 min at 50° C. and 1 min at 72° C. The products from the PCR reaction were analyzed by electrophoresis on 1% agarose gel, then revealed by ultraviolet after coloration with ethidium bromide.
The fragments resulting from the PCR reaction were ligatured in pCR2.1 (TA cloning kit, In Vitrogen). The recombinant plasmid inserts were sequenced by the dideoxy chain termination method (Sanger et al., 1977) using SEQUENASE, Version 2 (US Biochemicals) according to the manufacturer's instructions.
Two nucleotide sequences were thus amplified: sequences SEQ ID NO. 9 and SEQ ID NO. 11. The amino acid sequences deduced from the nucleotide sequences were sequences SEQ ID NO. 10 and SEQ ID NO. 12, corresponding to the genes named BGT4 and BGT3.
These sequences are in particular described in the list below. They have identity percentages with BGT2 of 41% and 37% respectively.
Restriction maps of the two sequences SEQ ID NO. 10 and SEQ ID NO. 12 are represented respectively in
The sequences SEQ ID NO. 9 and SEQ ID NO. 11 were inserted into the plasmid PCRII which was introduced into E. coli. These bacteria were deposited on the 22 Aug. 1997 at the CNCM under numbers I-1914 and I-1913 respectively.
Reaction of the transferase with an initial rate of formation of the transfer product Transferase reaction Transfer rate (nmol.min−1.mg proteins−1) rG11+[3H]−rG5- →RG6+[3H]rG10 203 rG11+[3H]−rG6→RG6+[3H]−rG11 387 rG11+[3H]-rG7→RG6+[3H]-rG12 484 rG11+[3H]−rG8→RG6+[3H]−rG13 586
This is a division of application Ser. No. 10/347,252, filed Jan. 21, 2003, which is a division of application Ser. No. 09/242,913, filed Oct. 13, 1999, now U.S. Pat. No. 6,551,811, which is a Section 371 application of PCT/FR97/01540, filed Aug. 29, 1997, and further claims the benefit of U.S. Provisional Application No. 60/024,910, filed Aug. 30, 1996, the disclosures of all of which are incorporated herein by reference.
Number | Date | Country | |
---|---|---|---|
60024910 | Aug 1996 | US |
Number | Date | Country | |
---|---|---|---|
Parent | 10347252 | Jan 2003 | US |
Child | 11326609 | Jan 2006 | US |
Parent | 09242913 | Oct 1999 | US |
Child | 10347252 | Jan 2003 | US |