Patent Application
20240002915
The present application belongs to the technical field of gene engineering, and particularly relates to a method for detecting a target nucleic acid in a sample.
In 2006, Piepenburg et al. created a new whole-process isothermal amplification technology to open double-stranded DNA by using enzymes, which is called Recombinase Polymerase Amplification (hereinafter referred to as RPA). RPA refers to the T4 bacteriophage DNA replication system. In addition to a DNA polymerase that can work at room temperature, the reaction also comprises bacteriophage recombinase, accessory protein, and DNA binding protein. RPA is represented by products of TwistDx. Recombinase-aid Isothermal Amplification (hereinafter referred to as RAA) uses the recombinase obtained from bacteria or fungi to further improve the stability of the entire amplification system.
Both RPA and RAA have the ability to rapidly complete the amplification of nearly 10 orders of magnitude dynamic range at a single temperature step close to normal temperature (37-42° C.), and has the top reaction speed among various amplification technologies. In 10 minutes, it can complete the amount of amplification that an ordinary PCR will take nearly an hour to finish. Under ideal conditions, it can also achieve sensitivity close to that of QPCR, reaching the limit of 1-20 copies/reaction. Combined with various display technologies, such as a combination of exonuclease and reporter probe, it can replace traditional PCR to achieve real-time rapid detection of various microorganisms on a fluorescent platform or a lateral flow test strip platform.
In 2018, multiple R&D teams successively published technologies such as SHERLOCK, DETECTR, and HOLMES, all of which achieve real time rapid detection of microorganisms of pathogens based on isothermal amplification in combination with CRISPR-Cas system, further improving the application range of isothermal on-site amplification and steadily increasing the reaction speed, sensitivity, specificity of isothermal amplification and dependence on fluorescence reading instruments.
RPA/RAA technology is currently known polymerase amplification system with the fastest amplification speed, but it has disadvantages of longer primer probe and stronger fault tolerance, which result in low specificity in amplification and report, and are easy to producing mismatched amplification products. The recombinase of RPA/RAA technology itself depends on the ATP fuel, which makes the nonspecific product compete heavily for the fuel resource of the specific product. As a result, the specific amplification could not produce enough products to be submitted to the reporter system until the end of the amplification, thereby affecting the detection sensitivity. Especially in clinical diagnosis, the microenvironment of a sample is usually very complicated due to the interference background of proteins and nucleic acids. Although RPA/RAA reaction has a certain tolerance to interference factors such as proteins, the instability of sensitivity and specificity caused by the interference of nucleic acid background restricts the application and promotion of RPA/RAA used alone in clinical high-sensitivity and rapid diagnosis.
In combination with RPA/RAA technology, the trans-cleavage activity of Cas protein in CRISPR-Cas is applied to the downstream of RPA/RAA reaction, which can make up for insufficient signal caused by the insufficient specific amplification product mentioned above, and enable the high-sensitivity detection to be carried out in a more extensive environment with no need for too precise optical instrument and equipment. The Cas12b system-based CDetection system discovered and reported by Li Wei et al. has good tolerances for buffer system and temperature, and has been proven to have certain detection sensitivity in single tube step-by-step reactions. However, the issue of mutual interference between CDetection and RPA/RAA has not been resolved, and the reaction still needs to be carried out by two steps of isothermal amplification and CDetection, which cannot achieve synchronous reaction. There is no detailed external report on the mechanism leading to the difficulty, and the possibilities according to the reaction mechanism are as follows.
For addressing the shortcoming in the existing technology, the present application provides a method for detecting a target nucleic acid in a sample.
Particularly, the present application relates to the following aspects:
By ameliorating the mutual inhibition between recombinant polymerase amplification and sgRNA-Cas reaction, the present application can achieve that rapid and effective signal report of recombinant polymerase amplification and CDetection reaction with only one sample adding and mixing operation and a simple change of temperature, leaving out a sample adding and mixing operation of stopping the reaction midway to add components of the second step CDetection reaction. This greatly improves the convenience of operation, and reduces the aerosol pollution of recombinant polymerase amplification products generated by opening the reaction tube midway. Particularly, there are the following advantages.
The present application will be further described below in conjunction with examples, and it will be understood that the examples are only used to further describe and explain the present application, and are not intended to limit the present application.
Unless defined otherwise, the technical and scientific terms in the specification have the same meaning as commonly understood by those skilled in the art. Although similar or identical methods and materials described herein may be applied in the experiments or in the practical applications, the materials and methods are described below. In the case of a conflict, the present description, including the definitions therein, shall prevail. In addition, the materials, methods and examples are provided for illustrative purposes only and are not limiting. The present application is further described below in conjunction with specific examples, but not to limit the scope of the present application.
The present application provides a method for detecting a target nucleic acid in a sample.
The method comprises the following steps:
Particularly, the sgRNA (small guide RNA), i.e., single molecule guide RNA, is an important component of the CRISPR gene knockout and knockin system. Single molecule guide RNA acts in a post transcriptional modification process called RNA editing in the kinetoplastid. It is also a small non-coding RNA which can pair with pre-mRNA, and some uracil (U) may be inserted into it to produce functional mRNA. The RNA molecule edited by the guide RNA is approximately 60-80 nucleotides in length, it is transcribed by a single gene and has a tail of 3′ oligomeric U, a middle sequence fragment which is precisely complementary with the edited mRNA, and a 5′ end anchoring sequence which is complementary with the unedited mRNA sequence.
The Cas12b protein refers to a sequence-specific nuclease directed by RNA from microbial CRISPR system. Cas12b can target and cleave DNA target sequences under the direction of guide RNA to form DNA double-strand breaks, also known as classical dsDNA cleavage activity. More importantly, after recognizing and binding to the corresponding target DNA sequence, the complex of Cas12b and gRNA can activate its non-specific single-stranded DNA cleavage activity, also known as non-classical bypass ssDNA cleavage activity. Utilizing non-classical bypass ssDNA cleavage activity, a single stranded DNA reporter molecule is cleaved to generate a detectable signal, which can reflect the presence and/or amount of target DNA.
The Cas12b protein may be AaCas12b protein derived from Alicyclobacillus acidiphilus, AkCas12b protein derived from Alicyclobacillus kakegawensis, AmCas12b protein derived from Alicyclobacillus macrosporangiidus, BhCas12b protein derived from Bacillus hisashii, BsCas12b protein derived from the genus Bacillus, Bs3Cas12b protein derived from the genus Bacillus, DiCas12b protein derived from Desulfovibrio inopinatus, LsCas12b protein derived from Laceyell asediminis, SbCas12b protein derived from Spirochaetes bacterium, or TcCas12b protein derived from Tuberibacillus calidus.
The “single-strand DNA reporter molecule which produces a detectable signal after being cleaved” is used to indirectly reflect the amount of target nucleic acid contained in the sample. The single-stranded DNA reporter molecule may comprise a fluorophore and a quenching group thereof at both ends of the single-stranded DNA, respectively. When the single-strand DNA is not cleaved, the fluorophore does not fluoresce due to the presence of the quenching group. When the Cas12b-gRNA complex is activated by the target nucleic acid molecule, and the DNA single strand of the single-strand DNA reporter molecule is cleaved by its non-canonical bypass ssDNA cleavage activity, the fluorophore is released and thus fluoresce. The suitable fluorophore and its corresponding quenching group, as well as the method for labeling nucleic acid molecules thereof, are known in the art. The suitable fluorophore comprises, but is not limited to: FAM, TEX, HEX, Cy3, or Cy5. The suitable quenching group comprises, but is not limited to: BHQ1, BHQ2, BHQ3, or TAMRA. The suitable fluorophore-quenching group pair comprises, but is not limited to: FAM-BHQ1, TEX-BHQ2, Cy5-BHQ3, Cy3-BHQ1, or FAM-TAMRA. Therefore, in some embodiments, the detectable signal is a fluorescent signal. In some embodiments, the fluorophore is FAM, and the quenching group is BHQ1.
The length of the single-stranded DNA in the single-stranded DNA reporter molecule may be about 2-100 nucleotides, for example, 2-5, 2-10, 2-15, 2-20, 2-25, 2-30, 2-40, or 2 to more nucleotides. The single-stranded DNA in the single-stranded DNA reporter molecule may comprise any sequence. In some embodiments, the single-stranded DNA in the single-stranded DNA reporter molecule may be selected from polyA (polyadenylic acid), polyC (polycytidylic acid), or polyT (polythymidylic acid).
Recombinase Polymerase Amplification (RPA) is known as a nucleic acid detection technology that can replace PCR. RPA technology relies primarily on three enzymes: recombinases that can bind single-stranded nucleic acids (oligonucleotide primers), single-stranded DNA binding proteins (SSBs), and strand displacement DNA polymerases.
The protein-DNA complex formed by the combination of the recombinase and the primer can search for homologous sequences in double-stranded DNA. Once the primer locates the homologous sequence, a strand exchange reaction takes place to initiate DNA synthesis to amplify the target region on the template by strand displacement. The displaced DNA strand binds to SSB to form a stable single-stranded structure, waiting for a new primer synthesis reaction to proceed. In this system, primers anchored on complementary strands with 3′ tail to tail opposition are co-initialized to form a double-stranded amplicon, and this circulation goes on continuously. The whole process is carried out very fast, and generally a detectable level of amplification products can be obtained within ten minutes.
Conventional PCR must go through three steps of denaturation, annealing and extension, and the PCR machine is essentially a device that controls the rise and fall of temperature. The RPA reaction has the optimum temperature of 37-42° C., and can be carried out at room temperature without denaturation. This undoubtedly greatly speeds up PCR. In addition, since no temperature control equipment is required, RPA can truly realize portable rapid nucleic acid detection.
The RPA detection is of very high sensitivity, and it can amplify a trace amount of nucleic acid (especially DNA) template to a detectable level, and an amplification product with a length of about 1012 can be obtained from a single template molecule. Moreover, RPA does not require complicated sample processing, and is suitable for field detection where nucleic acid cannot be extracted.
RPA can amplify both DNA and RNA, thus it is no need for additional cDNA synthesis step. Not only endpoint detection can be performed on amplification products, but also an amplification process can be monitored in real time, and even the results can be read with test strips (lateral flow chromatography test strips LFD).
Similar to RPA, Recombinase-aid Isothermal Amplification (hereinafter referred to as RAA) uses the recombinase obtained from bacteria or fungi to further improve the stability of the entire amplification system. As described in the “background art” section, in the prior art some people have tried to combine the recombinase-aid isothermal amplification system and the sgRNA-Cas system for nucleic acid detection. However, it is essentially a two-step, two-pot reaction, firstly the nucleic acid in the sample is amplified by the recombinase-aid isothermal amplification system, and then the sgRNA-Cas system is used to detect the amount of nucleic acid. In view of various problems existing in the prior art, by forming a mixed reaction system with the sgRNA-Cas system and the recombinase-aid isothermal amplification system, and optimizing the reaction conditions of the mixed reaction system, the present application realizes one-step detection of the nucleic acid in a sample.
In the above mixed reaction system, the contents of the sgRNA, primer, and single-stranded DNA reporter molecule can be adjusted according to actual needs.
In a particular embodiment, the concentration of the sgRNA in the mixed reaction system is 2-80 ng/μl for example, 2-80 ng/μl 10-70 ng/μl 20-60 ng/μl 30-50 ng/μl, 2 ng/μl, 4 ng/μl, 10 ng/μl, 20 ng/μl, 30 ng/μl, 40 ng/μl, 50 ng/μl, 60 ng/μl, 70 ng/μl, or 80 ng/μl.
In a particular embodiment, the concentration of the primer in the mixed system is 300-1200 nM; for example, 300-1200 nM, 400-1100 nM, 500-1000 nM, 600-900 nM, 700-800 nM, 300 nM, 400 nM, 500 nM, 600 nM, 700 nM, 800 nM, 900 nM, 1000 nM, 1100 nM, or 1200 nM.
In a particular embodiment, the concentration of the single-stranded DNA reporter molecule is 200-2000 nM, preferably 700-1500 nM. For example, it may be 200-2000 nM, 300-1900 nM, 400-1800 nM, 500-1700 nM, 600-1600n, 700-1500 nM, 800-1400 nM, 900-1300 nM, 1000-1200 nM, 200-700 nM, 1500-2000 nM, 200 nM, 400 nM, 500 nM, 600 nM, 700 nM, 800 nM, 900 nM, 1000 nM, 1100 nM, 1200 nM, 1300 nM, 1400 nM, 1500 nM, 1600 nM, 1700 nM, 1800 nM, 1900 nM, or 2000 nM.
In the present application, the one-step reaction is realized by precisely controlling the concentration of the single-stranded DNA reporter molecule in the reaction system. By in-depth research, the inventors of the present application found that the reaction time is subject to the intensity of signal generated. By increasing the concentration of the substrate (i.e., single-stranded DNA reporter molecule) in the trans-cleavage reaction, the intensity of the generated fluorescence can reach the detection sensitivity of the instrument in a shorter time, and sufficient signals can also be generated when the number of target DNA fragments in the system is low.
Further, the reaction is performed at a first temperature, and is inactivated at a second temperature, wherein the second temperature is higher than the first temperature, i.e., the temperature used for inactivation is higher than the temperature during the reaction. In a particular embodiment, the second temperature is greater than 47° C., for example, it may be 48° C., 50° C., 55° C., 65° C., 70° C., 75° C., 80° C., or 85° C.
Further, the mixed reaction system further comprises a divalent cation, and the concentration of the divalent cation is 8-25 mM; for example, may be 8-25 mM, 10-20 mM, 12-18 mM, 8 mM, 9 mM, 11 mM, 12 mM, 13 mM, 14 mM, 15 mM, 16 mM, 17 mM, 18 mM, 19 mM, 20 mM, 21 mM, 22 mM, 23 mM, 24 mM, or 25 mM.
The divalent cation is one or more selected from the group consisting of: magnesium ion, calcium ion, manganese ion, cesium ion, nickel ion, iron ion, and cobalt ion.
The target nucleic acid in the present application may comprise DNA or RNA, wherein when the target nucleic acid is RNA, the mixed reaction system further comprises suramin and/or tRNA, i.e., it may comprise suramin, tRNA, or both suramin and tRNA.
When the mixed reaction system comprises suramin, the concentration of the suramin in the mixed reaction system is 3-30 ng/μl, preferably 3-12 ng/μl. For example, it may be 3-30 ng/μl, 3-12 ng/μl, 12-30 ng/μl, 5-25 ng/μl, 10-20 ng/μl, 3 ng/μl, 5 ng/μl, 8 ng/μl, 10 ng/μl, 12 ng/μl, 15 ng/μl, 18 ng/μl, 20 ng/μl, 22 ng/μl, 25 ng/μl, 28 ng/μl, or 30 ng/μl.
In the present application, the one-step reaction is realized by precisely controlling the concentration of suramin in the reaction system. Through in-depth research, the inventors of the present application found that suramin is a repressor of the hydrolysis center of the triphosphate bonds of some enzymes, and polymerase, RT enzyme, and recombinase etc. comprised in the recombinase-aid amplification system (RT-RAA) rely on the hydrolysis of triphosphate bonds to generate activity. By adjusting the concentration of the suramin, the order of various enzyme reactions in the reaction system can be coordinated. In the present application, 3-30 ng/μl suramin is used to inhibit the overactive DNA polymerase and recombinase, so that the RT enzyme can combine with a RNA template-primer complex earlier to generate cDNA template, and thus the whole tandem reaction system can proceed smoothly.
When the mixed reaction system comprises tRNA, the concentration of the tRNA in the mixed reaction system is 10-20 ng/μl. For example, it may be 10-20 ng/μl, 12-18 ng/μl, 10 ng/μl, 12 ng/μl, 13 ng/μl, 14 ng/μl, 15 ng/μl, 16 ng/μl, 17 ng/μl, 18 ng/μl, 19 ng/μl, or 20 ng/μl.
In the present application, the one-step reaction is realized by precisely controlling the concentration of tRNA in the reaction system. In many reports, the addition of a certain amount of background RNA can improve the sensitivity of RT-PCR, which mainly is due to the fact that improvement of the structural diversity of template RNA helps to unravel part of the higher-order structures and enable trace templates to reduce the nonspecific adsorption to other substances, thereby further facilitating its amplification reaction. Also in RT-RAA, the inventors of the present application found that the addition of the additive can also have a relatively significant effect in the case of insufficient RT enzyme activity.
To sum up, by regulating the concentration of the sgRNA in the reaction system to be 2-80 ng/μl, the concentration of the primer to be 300-1200 nM, the concentration of the single-stranded DNA reporter molecule to be 200-2000 nM and the likes, the present application can improve the mutual inhibition between recombinant polymerase amplification and the sgRNA-Cas reaction, the recombinant polymerase amplification and CDetection reaction may achieve fast and effective signal reporting only by one sample addition and mixing and simple change of temperature, thereby greatly improving the convenience of operation and reducing the pollution.
The sample described in the present application may be selected from the group consisting of: whole blood, plasma, serum, cerebrospinal fluid, urine, feces, buccal swab, nasopharyngeal swab, saliva, cell or tissue extract.
1. Pre-Preparation of a sgRNA-Cas Pre-Preparation System (C Mixture)
The sgRNA-Cas pre-preparation system was prepared according to the dosage of each component in Table 1 below, then placing at room temperature for use after the preparation was completed.
1The sequence of the single molecule guide RNA is: 5′-GUCUAAAGGACAGAAUUUUUCAACGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAAAGCCCGUUGAACUUCAAGCGAAGUGGCACACUCAAUACUUGAGCACACU-3′ (SEQ ID NO: 1).
2The sequence of the reporter probe is: 5′-FAM-TTTTTTT-BHQ1-3′, in which the reporter probe is the single-stranded DNA reporter molecule described in the present application.
3The RNA nuclease inhibitor was purchased from promega, with the catalog number N2515.
4The AaCas12b protease was purchased from Nanjing Vazyme Biotech Co., Ltd. with the catalog number EN311-PE.
The concentration of the single molecule guide RNA in this example is 20 ng/μl, 80 ng/μl and 240 ng/μl, respectively, in which 1 μl of the nuclease-free water was used to replace the single molecule guide RNA.
2. Preparation of a Recombinase-Aid Isothermal Amplification System (A Mixture)
The recombinase-aid amplification system was prepared according to the dosage of each component in Table 2 below, then placing at room temperature for use after the preparation was completed.
1Amplification buffer A is 20% PEG35K purchased from sigma-aldrich with catalog number 818892, and was diluted to 20% for use.
2Magnesium acetate solution was purchased from sigma-aldrich with the catalog number 63052, and was diluted to 280 mM for use.
3The sequence of the forward primer is: 5′-GTTGTAGCTTGTCACACCGTTTCTATAGATTAGC-3′ (SEQ ID NO: 2). The sequence of the reverse primer is: 5′-CCTGGTTTAACATATAGTGAACCGCCACACAT-3′ (SEQ ID NO: 3).
3. Mix of the Systems
1 μl of viral nucleic acid sample (2019-nCoV RdRP pseudovirus, the nucleic acid was extracted with Magen nucleic acid extraction kit, IVD5412, and after the extraction it was diluted to 500 copies per microliter for use) was added into 45 μl of A mixture, followed by adding 9.8 μl of C mixture. Particularly, the 2019-nCoV RdRP gene pseudovirus was purchased from Xiamen Zeesan Biotechnology Co., Ltd with the catalog number JBD249.
The above mixture was added to the enzyme dry powder (RT-RAA dry powder, purchased from Hangzhou ZC Bio-Sci&Tech Co., Ltd., with the catalog number S00040ZC) to incubate at 42° C. for 1 min×60 cycles, collecting fluorescence once per minute.
In this method, the FAM group was used as the reporter group, and the presence or absence of the target nucleic acid was judged according to the relative fluorescence signal intensity of the FAM group at 30 min.
The addition amount of the sgRNA is 0 ng, 20 ng sgRNA, 80 ng sgRNA, and 240 ng sgRNA, respectively, and the corresponding final molar concentration in the mixed reaction system is 0, 5.84 nM, 23.36 nM, and 70.08 nM, respectively.
The obtained detection result is shown in
It can be seen from
Due to the complex internal structure of the sgRNA, some wrong structures may occur during folding, so that part of the added sgRNA becomes invalid sgRNA that cannot form a complex with the AaCas12b protein. In this application, the addition amount of the sgRNA is increased to make up for the invalid sgRNA in the system, thereby increasing the number of sgRNA-AaCas12b complexes to increase the signal intensity within a specific reaction time.
1. Pre-preparation of a sgRNA-Cas pre-preparation system
The sgRNA-Cas pre-preparation system was prepared according to the dosage of each component in Table 3 below, then placing at room temperature for use after the preparation is complete.
2. Preparation of a Recombinase-Aid Isothermal Amplification System (A Mixture)
The recombinase-aid isothermal amplification system was prepared according to the dosage of each component in Table 4 below, then placing at room temperature for use after the preparation was completed.
3. Mix of the Systems
45 μl of A mixture and 1 μl of viral nucleic acid sample (2019-nCoV RdRP pseudovirus, the nucleic acid was extracted with Magen nucleic acid extraction kit, IVD5412, and after the extraction it was diluted to 50,000 copies per microliter and 5,000 copies permicroliter for use), and 5 μl of C mixture were added into an empty tube. Particularly, the 2019-nCoV RdRP gene pseudovirus was purchased from Xiamen Zeesan Biotechnology Co., Ltd. with the catalog number JBD249.
51 μl of the above system was added into the enzyme dry powder (RT-RAA dry powder, purchased from Hangzhou ZC Bio-Sci&Tech Co., Ltd. with catalog number S0040ZC), then shaking for 8-10 seconds to mix well.
The above system was placed in a real-time fluorescence quantitative PCR instrument, the incubation program was: 45° C., 1 min×60 cycles, collecting fluorescence once per minute. In this method, the FAM group was used as the reporter group, and the presence or absence of the target nucleic acid was judged according to its relative fluorescence signal intensity at 60 min.
The obtained detection result is shown in
As shown in
1. Pre-Preparation of a sgRNA-Cas Pre-Preparation System (C Mixture)
The sgRNA-Cas pre-preparation system was prepared according to the dosage of each component in Table 5 below, then placing on ice for use after the preparation was completed.
The concentration X of the single molecule guide RNA is 10 ng/μl, 50 ng/μl, 100 ng/μl and 200 ng/μl, respectively.
2. Preparation of a Recombinase-Aid Isothermal Amplification System (A Mixture)
The recombinase-aid isothermal amplification system was prepared according to the dosage of each component in Table 6 below, then placing at room temperature for use after the preparation was completed.
The addition amount of magnesium acetate solution in the above system is 1.429 μl and 2.5 μl, respectively.
Particularly, the sequence of the single-molecule guide RNA, the sequence of the reporter probe, and the sequences of the forward and reverse primers are the same as those in Example 1. The sources of components such as the amplification buffer A, magnesium acetate solution, the RNA nuclease inhibitor, and the AaCas12b protease are the same as those in Example 1, and the transfer RNA was purchased from Invitrogen with the catalog number AM7119.
3. Mix of the Systems
44 μl of A mixture, 1 μl of viral nucleic acid sample (2019-nCoV RdRP pseudovirus, the nucleic acid was extracted with Magen nucleic acid extraction kit, IVD5412, and after the extraction it was diluted to 100 copies per microliter for use), and 5 μl of C mixture were added into an empty tube. Particularly, the 2019-nCoV RdRP gene pseudovirus was purchased from Xiamen Zeesan Biotechnology Co., Ltd. with the catalog number JBD249.
50 μl of the above system was added into the enzyme dry powder (RT-RAA dry powder, purchased from Hangzhou ZC Bio-Sci&Tech Co., Ltd. with catalog number S0040ZC), then shaking for 8-10 seconds to mix well.
The above system was placed in a real-time fluorescence quantitative PCR instrument, the incubation program was: 45° C. or 42° C., 1 min×60 cycles, collecting fluorescence once per minute. In this method, the FAM group was used as the reporter group, and the presence or absence of the target nucleic acid was judged according to its relative fluorescence signal intensity at 60 min.
The obtained detection result is shown in
It can be seen from the above data that, when a higher CDetection reaction temperature is used, the specificity of the system tends to increase, which is reflected in the fact that the signal value of the negative reaction is sustained or decreased; at the same time, the positive signal is about 3.4 times higher than that of low temperature reaction in the case that the sgRNA is used in the normal dosage of the system (200 ng).
1. Preparation of the Reaction System According to the Following Table
1 Transfer RNA was purchased from invitrogen with the catalog number AM7119.
2 50× TET buffer is a self-prepared buffer (100 mM Tris pH 8.0, 5 mM EDTA, 0.5% Tween 20).
3 Evagreen dye (20x) was purchased from Biotium.
2. Loading Samples for Detection
After adding 1 μl of pseudovirus nucleic acid sample (100 copies per microliter) to the above mixed solution, then placing in a real-time fluorescence quantitative PCR instrument to incubate for 1 min×60 cycles at 45° C. to observe the profile of the amplification curve.
The Evagreen dye was used to replace the FAM reporter group to characterize the amplification behavior of the target gene in the system, and the results are shown in
As shown in the above figure, under the reaction condition of 45° C. in the one-step reaction system, the reaction entered the linear amplification stage after 5-7 amplification cycles.
According to the results in the above figure, under the reaction condition of 45° C. in the one-step reaction system, the reaction entered the linear amplification stage after 5-7 amplification cycles. At the same time, the Cas enzyme AaCas12b used in this method can maintain an optimal nuclease activity in a very wide temperature range (31-59° C.). Therefore, under the consideration of not affecting the accumulation of RT-RAA reaction products, we kept the reaction conditions for the first 7 min at 45° C., and then the reaction temperature for 8-60 min was adjusted to 52° C. The key enzymes of RT-RAA were inactivated to exclude the effect of RT-RAA reaction components on the cleavage process, meanwhile the kinetics of the cleavage reaction was improved by increasing the temperature of the cleavage reaction, thereby accelerating the signal accumulation rate of the reporter group.
Reverse Transcription Inhibition is Relieved by Using Additive.
1. Pre-Preparation of a sgRNA-Cas Pre-Preparation System (C Mixture)
The sgRNA-Cas pre-preparation system was prepared according to the dosage of each component in Table 10 below, then placing on ice for use after the preparation was completed.
2. Pre-Preparation of a Recombinase-Aid Isothermal Amplification System (A Mixture)
The recombinase-aid isothermal amplification system was prepared according to the dosage of each component in Table 11 below, then placing at room temperature for use after the preparation was completed.
Particularly, the sequence of the single-molecule guide RNA, and the sequences of the forward and reverse primers are the same as those in Example 1. The sources of components such as the amplification buffer A, magnesium acetate solution, the RNA nuclease inhibitor, the AaCas12b protease are the same as those in Example 1. The transfer RNA was purchased from Invitrogen with the catalog number AM7119.
3. Mix of the Systems
45 μl of A mixture, 1 μl of viral nucleic acid sample (RNA sample was from 2019-nCoV RdRP pseudovirus and was extracted with Magen nucleic acid extraction kit, IVD5412, and after the extraction it was diluted to 50000 copies per microliter and 500 copies per microliter for use; DNA sample was a plasmid containing the 2019-nCovRdRP gene), and 5 μl of C mixture were added into an empty tube. Particularly, the 2019-nCoV RdRP gene pseudovirus was purchased from Xiamen Zeesan Biotechnology Co., Ltd. with the catalog number JBD24; the 2019-nCovRdRP gene plasmid was purchased from GenScript Biotech Corp. (a chemical synthetic product without catalog number).
51 μl of the above system was added into the enzyme dry powder (RT-RAA dry powder, purchased from ZC Bio-Sci&Tech Co., Ltd. with catalog number S0040ZC), then shaking for 8-10 seconds to mix well.
The above system was placed in a real-time fluorescence quantitative PCR instrument, the incubation program was: 45° C., 1 min×60 cycles, collecting fluorescence once per minute. In this method, the FAM group was used as the reporter group, and the presence or absence of the target nucleic acid was judged according to its relative fluorescence signal intensity at 60 min.
The results are shown in
When 200 ng of suramin and 500 ng of tRNA were added at the same time, the separation degree data of negative and positive after reacting for 30 min obtained by using the detection method of the present application was shown in Table 12.
As shown in the above data, when suramin and tRNA were used as the additives in the mixed reaction system, and RNA was added as the substrate, there is a significant separation degree from the negative reaction, which relieves the inhibition effect of the one-step detection system of the present application on the reverse transcription reaction to a certain extent.
1. Pre-Preparation of a sgRNA-Cas Pre-Preparation System (C Mixture)
The sgRNA-Cas pre-preparation system was prepared according to the dosage of each component in Table 13 below, then placing on ice for use after the preparation was completed.
2. Preparation of a Recombinase-Aid Isothermal Amplification System (A Mixture)
The recombinase-aid isothermal amplification system was prepared according to the dosage of each component in Table 14 below, then placing at room temperature for use after the preparation was completed.
Particularly, the sequence of the single-molecule guide RNA, the sequences of the forward and reverse primers and the sequence of the reporter probe are the same as those in Example 1. The sources of components such as the amplification buffer A, magnesium acetate solution, the RNA nuclease inhibitor, the AaCas12b protease are the same as those in Example 1. In this example, the final concentration experimental gradient of the probe was set as follows: 200 nM, 400 nM, 700 nM, 1000 nM, 1500 nM and 2000 nM, and the corresponding addition volumes (X) in the system are: 0.1 μl, 0.4 μl, 0.7 μl, 1 μl, 1.5 μl, and 2 μl respectively.
3. Mix of the Systems
10 μl of sample (a total of 2 samples were used in this experiment, one was water as the negative control, and the other was the positive sample of 8 copies/microlitre, wherein the positive sample was from 2019-nCoV RdRP Pseudovirus and was extracted with the Magen nucleic acid extraction kit, IVD5412, and after the extraction it was respectively diluted to 8 copies per microliter), and 33 μl of A mixture were respectively added into a tube containing the amplification reaction enzyme dry powder. 7 μl of C mixture was added into the corresponding tube cap, and then the tube cap was fastened. The above systems were fully shaken to mix well and centrifuged, and after the centrifugation it was shaken to mix well and centrifuged again. After the centrifugation, it was loaded on the detection instrument as soon as possible for fluorescence signal detection. Particularly, the 2019-nCoV RdRP gene pseudovirus was purchased from Xiamen Zeesan Biotechnology Co., Ltd. with the catalog number JBD249. The 2019-nCovRdRP gene plasmid was purchased from GenScript Biotech Corp. (a chemical synthetic product without catalog number).
The above system was placed in a real-time fluorescence quantitative PCR instrument, and the incubation program was: 45° C. for 7 min, collecting fluorescence once, (52° C. for 1 min)×22 cycles, collecting fluorescence once every minute, and 52° C. for 1 min, collecting fluorescence once. In this method, the FAM group was used as the reporter group, and the presence or absence of the target nucleic acid was judged according to the relative fluorescence signal intensity at 30 min. The reaction results are shown in
In this example, two biological replicates were performed for each probe concentration and each sample. The results shown in
According to the effect analysis of the above factors, the following conditions were used to detect the target nucleic acid in the sample.
1. Pre-Preparation of a sgRNA-Cas Pre-Preparation System (C Mixture)
The sgRNA-Cas pre-preparation system was prepared according to the dosage of each component in Table 16 below, then placing on ice for use after the preparation was completed.
2. Preparation of a Recombinase-Aid Isothermal Amplification System (A Mixture)
The recombinase-aid isothermal amplification system was prepared according to the dosage of each component in Table 17 below, then placing at room temperature for use after the preparation was completed.
Particularly, the sequence of the single-molecule guide RNA, the sequence of the reporter probe and the sequences of the forward and reverse primers are the same as those in Example 1. The sources of components such as the amplification buffer A, magnesium acetate solution, the RNA nuclease inhibitor, the AaCas12b protease are the same as those in Example 1. The transfer RNA was purchased from Invitrogen with the catalog number AM7119.
3. Mix of Systems
10 μl of the extracted pseudovirus nucleic acid (2019-nCoV RdRP gene pseudovirus, purchased from Xiamen Zeesan Biotechnology Co., Ltd with the catalog number JBD249, the nucleic acid was extracted with Magaen nucleic acid extraction kit, IVD5412, and after the extraction it was diluted to 10 copies or more per microliter for use) was taken to add into the ready-to-use reaction well. Then 35 μl of A mixture of and 5 μl of C mixture the recombinase-aid isothermal amplification system were respectively added into that well. 50 μl of the above mixed solution was added into enzyme dry powder (RT-RAA dry powder, S0040ZC) to incubate at 45° C. for 7 min, and then incubate at 52° C. for 1 min×23 cycles. In this method, the FAM group was used as the reporter group, and the presence or absence of the target nucleic acid was judged according to the relative fluorescence signal intensity at 30 min.
The obtained detection results are shown in
On the ABI 7500 real-time fluorescence quantitative PCR instrument, the sample with the relative fluorescence signal intensity of the reporter group at 30 min was judged whether there was a target nucleic acid, according to experience of the previous test data and CDetection reaction characteristics.
The gene target POP7 is often used as an internal reference for CRISPR-Cas related detection methods (James P. Broughton, 2020), and the test results of the second target POP7 gene (NM 005837.3) by the same method were provided in this Test Example, to verify the versatility of the method described in this application in the detection of different species and different targets.
1. Pre-Preparation of a sgRNA-Cas Pre-Preparation System (C Mixture)
The sgRNA-Cas pre-preparation system was prepared according to the dosage of each component in Table 18 below, then placing on an ice box or in a 4° C. refrigerator for use after the preparation was completed.
1AaCas12b protease was purchased from Nanjing Vazyme Biotech Co.,Ltd. with the catalog number EN311-PE.
2RNA nuclease inhibitor was purchased from Promega, with the catalog number N2515.
3The sequence of the single guide RNA is: 5′-GAGUCCUUUGGGCUUCCAGGCAACGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAAAGCCCGUUGAACUUCAAGCGAAGUGGCACACUCAAUACUUGAGCACACU-3′ (SEQ ID NO: 4)
2. Preparation of a Recombinase-Aid Isothermal Amplification System (A Mixture)
The recombinase-aid isothermal amplification system was prepared according to the dosage of each component in Table 19 below, then placing at room temperature for use after the preparation was completed.
1Amplification buffer A is 4x RT-RAA buffer A purchased from sigma-aldrichwith the catalog number818892, and it was diluted to 20% for use.
2Magnesium acetate solution was purchased from sigma-aldrich with the catalog number 63052, and it was diluted to 280 mM for use.
3The sequence of the forward primer is: 5′-TGAGTACTGGACCTCGGACCAGAGCCATGTAAGAA-3′ (SEQ ID NO: 5), and the sequence of the reverse primer sequence is 5′-GCCCACCAAGAGACAATTACCCCCACCCTCAATGC-3′ (SEQ ID NO: 6).
4The sequence of the reporter probe is: 5′-FAM-TTTTTTT-BHQ1-3′.
3. Mix of the Systems
10 μl of POP7 nucleic acid sample (human 293T cell transcriptome, after extraction it was diluted to 10 ng/μl, 10 μl per reaction) was added into 35 μl of A mixture, followed by adding 5 μl of C mixture.
The above mixture was added to the enzyme dry powder (RT-RAA dry powder, purchased from Hangzhou ZC Bio-Sci&Tech Co., Ltd. with catalog number S0040ZC) to incubate at 45° C. for 7 minutes, and then incubate at 52° C. for 1 minute×23 cycles, collecting fluorescence once per minute.
In this method, the FAM group was used as the reporter group, and the presence or absence of the target nucleic acid was judged according to the relative fluorescence signal intensity of the FAM group at 30 minutes. The results are shown in
1 Relative fluorescence intensity = fluorescence intensity at 32 minutes - initial fluorescence intensity.
2 Separation degree of negative and positive = the average relative fluorescence intensity of the sample/the average relative fluorescence intensity of 0.01% Tween 20.
| Number | Date | Country | Kind |
|---|---|---|---|
| 202011278709X | Nov 2020 | CN | national |
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/CN2021/118280 | 9/14/2021 | WO |
