Patent Application
20170260568
The present invention relates to a method for the detection of the amplification of a target nucleic acid sequence in a liquid sample in which the presence of an amplification product is determined colorimetrically, by exploiting the known property of colloidal gold nanoparticles (AuNPs) to give rise to a visible colour change when, as a result of their aggregation, the interparticle distance becomes less than the size (diameter) of the particles (an effect due to plasmon coupling).
Nucleic acid amplification reactions, and in particular the PCR, are an extremely powerful tool that has revolutionized the molecular biology field in the last thirty years. These techniques allow for the rapid and sensitive identification of a target nucleic acid of interest, even if present in the sample in very low concentrations or diluted in an excess of interfering genetic material. The PCR, and the other known techniques for nucleic acid amplification allow to detect the presence of infectious agents or gene mutations or rearrangements in samples obtained from patients, or to detect the presence of pathogenic contaminants in food or water samples. They also find wide application in the scientific research field and are fundamental for the screening of populations of laboratory animals in order to identify transgenic subjects.
The standard procedure for the verification of the results of a PCR or other nucleic acid amplification technique comprises performing an agarose gel electrophoresis, staining the gel, and finally reading it with a scanner or reader equipped with an excitation lamp at an appropriate wavelength. The working time required for the entire procedure (which entails the preparation of the gel, the electrophoretic run, the staining and washing, the reading, and the interpretation of the results) is estimated at around at least 2-3 hours. The standard agarose gels allow for the analysis of up to 19 samples at a time, therefore, if there is a greater number of samples, the entire procedure must be performed on multiple gels in parallel, which multiplies costs and equipment, or it must be repeated several times, with a considerable increase in working times. Even if these procedures are extremely standardized, they still require expensive reagents, long processing times, and specific instrumentation. These methodologies can also become difficult to carry out in some high throughput applications, such as for example the identification of transgenic animals, in which a reduction in the time of analysis would have a major impact on cost reduction and mitigation of the suffering inflicted on the animals themselves, as well as in the clinical diagnostics field, in which emergency screenings for pathogens causing epidemics may be required.
Cross-linking experiments for colloidal gold nanoparticles (AuNPs) are described in the prior art, in which the AuNPs are functionalized with oligonucleotides and cross-linked by means of complementary oligonucleotides. These experiments exploit the known property of an AuNP solution of undergoing a visible change of colour (from red to blue) when the interparticle distance decreases.
Alivisatos P. A. et al., Organization of “Nanocrystal Molecules” Using DNA, Nature 1996, 6592, 609-611 describes the formation of dimers and trimers of colloidal gold nanoparticles (AuNPs) functionalized with a single-stranded oligonucleotide, through the use of a complementary oligonucleotide.
In Mirkin C. A. et al. A DNA-Based Method for Rationally Assembling Nanoparticles into Macroscopic Materials, Nature 1996, 6592, 607-609, a method is described which provides for the functionalization of two series of AuNPs with non-complementary DNA oligonucleotides bearing thiol groups, which bind to gold. A duplex oligonucleotide with free single-stranded ends (“sticky ends”), which are complementary to the two sequences with which the AuNPs are functionalized, is then added to the AuNP solution, which causes self assembly of the AuNPs into aggregates.
The scheme outlined above requires the functionalization of two series of AuNPs with two different oligonucleotide probes, each complementary to a portion of the target DNA, in such a way that the presence of the target induces AuNP cross-linking and the consequent change of colour of the solution. This scheme is suitable for the detection of short sequences of target DNA, but cannot be used as a universal detector for the amplification of nucleic acids, for the following reasons:
1) for each target, a pair of AuNPs functionalized with oligonucleotide probes specific for the target must be prepared; 2) the change in colour (from red to blue) is greatest with very small interparticle distances, but it gradually becomes less evident as the interparticle distances increase; however, most of the PCR amplification products are longer (typically >30 base pairs) than the cross-linking oligonucleotide probes which allow a proper plasmon coupling of the AuNPs and a noticeable colour change; 3) the PCR products are double-stranded and must be denatured before hybridization with the complementary oligonucleotide probes immobilized on the AuNPs; 4) even after denaturation, the complementary strand of the target competes with the oligonucleotide probes, which causes a marked reduction in the sensitivity of the assay.
An assay based on the implementation of an asymmetric PCR and hybridization with AuNP probes is described in the scientific literature (Deng H et al. Gold Nanoparticles with Asymmetric Polymerase Chain Reaction for Colorimetric Detection of DNA Sequence, Anal. Chem. 2012, 84, 1253-1258). However, this assay only overcomes the above-mentioned disadvantages in items 3) and 4), thanks to the use of an asymmetric PCR, but it still requires a target-specific functionalization of the AuNPs and only detects moderate colour changes (from red to light purple), probably because of steric hindrance of the relatively long PCR product, which interferes with the aggregation of the AuNPs.
In order to overcome these and other drawbacks of the prior art, the inventors developed methods and related kits as defined in the appended independent claims.
Specific embodiments of the invention are the subject of the dependent claims, the content of which is to be understood as an integral part of the description.
The invention which is the object of the present patent application solves the problems of the prior art by providing a universal detection system for nucleic acid amplification which requires neither specific equipment, nor long execution times, nor the design of oligonucleotide probes specific for the target.
Advantageously, the methods and kits of the invention provide for rapid detection of the amplification product (amplicon), which can be carried out with the naked eye generally within 3-20 minutes and requires no specific instruments or further sample manipulations. The operation is similar to that of a pH indicator. In the most simple embodiment of the invention, in fact, it is sufficient to add a small aliquot of the PCR reaction in a test tube containing a red solution and observe the result after approximately 3 minutes. If the solution remains red, this means that no amplicons, and therefore no targets, were present. On the contrary, if the PCR reaction contains the amplicon, the solution becomes violet/blue. This one-step one-tube procedure can also be performed by non-specialized personnel. If coupled with portable equipment and automated for PCR, it can be easily implemented in any context, even where there is no available laboratory equipment.
Further features and advantages of the invention will become apparent from the detailed description which follows, given purely by way of non-limiting example, with reference to the accompanying drawings, in which:
The method of the invention is performed on a sample resulting from a nucleic acid amplification reaction capable of generating a single-stranded, or alternatively a double-stranded, amplification product (also designated as “amplicon”), in which a universal tag sequence is incorporated (TAG). A single stranded amplicon incorporating a TAG is preferably obtained by asymmetric PCR; a double stranded amplicon incorporating a TAG is preferably obtained by standard PCR.
An asymmetric PCR reaction resulting in the incorporation of a universal tag sequence (TAG) in the amplification product is schematically illustrated in
10
a and 10b, respectively, indicate the coding strand and the non-coding strand of the target nucleic acid 10, i.e. the nucleic acid region that is to be amplified and detected. The target DNA generally has a length of between approximately 30 and approximately 100 base pairs.
The amplification is performed by means of a reverse primer 12 that hybridizes to the coding strand 10a of the target 10 and a forward primer 14 that hybridizes to the non-coding strand 10b of the target 10. The forward primer 14 comprises a region binding the target 14a, consisting of a nucleic acid sequence designed to hybridize with the non-coding strand 10b, and a region 14b that is complementary to a universal tag sequence 16, the said region 14b not being capable of hybridizing to the target. The region 14b is located at the 5′ end of the forward primer 14. As shown in
After the amplification reaction, the universal tag sequence 16 is detected by means of a method that constitutes the object of the present invention.
In the above-described embodiments, suitable to be used for the detection of products from asymmetric or symmetric PCR, the PCR negative control sample also acts as a control for the detection method, as it contains all the reaction constituents with the only exception of the universal tag sequence 16.
Importantly, all the embodiments of the detection method of the invention employ a universal detector, i.e., the universal tag sequence 16, and are therefore also suitable for use in multi-well formats for simultaneous detection of a plurality of samples, even if they contain different target sequences. In the case of detection of different target sequences, as a preliminary control only the first time that the amplification is performed, it is sufficient to check on a gel that the amplification product is of the expected length and that there are no unspecific products.
The size (diameter) of the AuNP colloidal gold particles used in the detection methods according to the invention is generally comprised between 1 nm and 500 nm, preferably between 15 nm and 80 nm. Their density of functionalization with the oligonucleotide probes is preferably comprised between 2×10−4 and 2×10−1/nm2, more preferably between 1×10−3/nm2 and 8×10−2/nm2.
In some embodiments, the oligonucleotide probes may include a spacer sequence that is not complementary to the universal tag sequence 16 and that serves to optimize the efficiency of the reaction. The total length of the oligonucleotide probes may range from 5 nucleotides (nt) to 80 nt, preferably from 15 nt to 40 nt. The length of the universal tag sequence 16 may range from 5 nt to 60 nt, preferably from 8 nt to 30 nt; further preferred lengths are 5 nt to 30 nt, 8 to 60 nt, 10 to 40 nt, 5 to 35 nt.
A preferred minimum length is 5, 6, 7, 8, 9 or 10 nucleotides. A preferred maximum length is 30, 35, 40, 50, 55 or 60 nucleotides. All the above minimum and maximum length values can be combined with each other to give a preferred length range.
It should be noted that a limited length of the tag, which is shorter than the typical short amplification product of a PCR (amplicon), causes a significant and advantageous increase in the sensitivity of the assay. The use of short universal tag sequences also allows for a more rapid colour change, which is critical for rapid and accurate detection to the naked eye.
It should also be noted that, although in principle colloidal gold particles functionalized with oligonucleotides complementary to respective regions of the target could hybridize at internal positions of the amplicon (in order to reduce the inter-particle distance and therefore maximize plasmon coupling), in practice this is not feasible because of the steric hindrance of the terminal regions of the amplicon. The free ends of the amplicon interfere with the hybridization of the AuNPs in the internal regions of the amplicon.
Preferred examples of the universal tag sequence 16 are:
Preferred examples of the first oligonucleotide probe are:
Preferred examples of the second oligonucleotide probe are:
In the experimental section that follows, which is provided by way of illustration only, detection experiments are described which were carried out using the beta-actin gene as the target nucleic acid sequence. For the embodiment shown in
An asymmetric PCR was carried out using the forward primer: ACATCAGAGTTTCCAGCACAATGAAGATCA (SEQ ID NO:10) and the reverse primer: AGGAAAGACACCCACCT (SEQ ID NO:11).
These primers amplify a portion of 35 nucleotides of the gene encoding beta actin.
The reaction mixture contained 500 nM reverse primer, 25 nM forward primer, 1 μl of Taq polymerase, 0.2 mM dNTP mix, 1× Taq reaction buffer, 2.5 mM MgCl2 and 100 ng of genomic DNA extracted from HeLa cell cultures, in a total volume of 50 μl. A sample designated as the negative control was prepared in the same way, with the exception of the genomic DNA, which was absent in the negative control. After 35 rounds of PCR, an aliquot of each reaction was run on an 18% native polyacrylamide gel to verify the formation of the single-stranded amplification product. After that, an aliquot of the asymmetric PCR reaction (from 5 to 10 μl) was added to a 1:1 mixture of colloidal gold nanoparticles functionalized with a first and a second oligonucleotide probe respectively (named AuNPs-1 and AuNPs-2 respectively). First oligonucleotide probe: 5′ TTTTTATCATCATACATCA 3′ (SEQ ID NO:4); second oligonucleotide probe: 5′ GAGTTTACCAAGTATTTTTTTTTT 3′ (SEQ ID NO:7). The AuNP-1 and AuNP-2 mixture had a final concentration of 1 nM. After the addition of the PCR product, in a few minutes a change in colour could be observed, which was caused by the cross-linking of the two types of nanoparticles on the target through the universal tag sequence.
A standard symmetric PCR was carried out using the following primers: forward: 5′ TTGGTACCTGGTGAATTCCTTCCCTCCTCAGATCATTG 3′ (SEQ ID NO:12) and reverse: 5′ GATCCACACGGAGTACTTG 3′ (SEQ ID NO:13).
These primers amplify a portion of 52 nucleotides (nt) of the gene encoding beta actin.
The reaction mixture contained 500 nM reverse primer, 500 nM forward primer, 1 μl of Taq polymerase, 0.2 mM dNTP mix, 1× Taq reaction buffer, 2.5 mM MgCl2 and 100 ng of genomic DNA extracted from HeLa cell cultures, in a total volume of 50 μl. A sample designated as the negative control was prepared in the same way, with the exception of the genomic DNA, which was absent in the negative control. After 35 rounds of PCR, an aliquot of each reaction was run on an 18% denaturing polyacrylamide gel to verify the formation of the amplification product of the desired length. A small aliquot of the PCR reaction (from 5 to 10 μl) was mixed with 1 μl of EcoRI-HF and 1 μl of Kpnl-HF, in the presence or absence of the specific enzyme buffer, and incubated for 10 minutes at 37° C. Thereafter, an aliquot (from 5 to 10 μl) of the enzymatic digestion reaction was added to a 1:1 mixture of colloidal gold nanoparticles functionalized with two separate oligonucleotide probes (referred to respectively as AuNP-3 and AuNP-4). AuNP-3 oligonucleotide probe: 5′ TTTTTATCATCTGTACCTG 3′ (SEQ ID NO:5); AuNP-4 oligonucleotide probe: 5′ GTGAATTACAAGTATTTTT 3′ (SEQ ID NO:8). The AuNP-3 and AuNP-4 mixture had a final concentration of 1 nM. After a few minutes from the addition of the PCR product, a change in colour could be observed, which was caused by the cross-linking of the two types of nanoparticles through the linker formed by digestion of the amplification product with the restriction enzymes.
An asymmetric PCR was carried out using the forward primer 5′ ACATCAGAGTCACTTCCCTCCTCAGATCATTG 3′ (SEQ ID NO:14) and the reverse primer 5′ GATCCACACGGAGTACTTG 3′ (SEQ ID NO:15).
These primers amplify a portion of 52 nt of the gene encoding beta actin.
The reaction mixture contained 500 nM reverse primer, 25 nM forward primer, 1 μl of Taq polymerase, 0.2 mM dNTP mix, 1× Taq reaction buffer, 2.5 mM MgCl2 and 100 ng of genomic DNA extracted from HeLa cell cultures, in a total volume of 50 μl. A sample designated as the negative control was prepared in the same way, with the exception of the genomic DNA, which was absent in the negative control. After 35 rounds of PCR, one aliquot of each reaction was run on an 18% native polyacrylamide gel to verify the formation of the single-stranded amplification product. Thereafter, one aliquot (from 5 to 10 μl) of the asymmetric PCR reaction was added to AuNP-5 nanoparticles functionalized with the oligo probe 5′ ACATCAGAGTCAACATTTTTTTTTT 3′ (SEQ ID NO:6) and incubated for 10 minutes. Then, AuNP-6 nanoparticles functionalized with the oligo probe 5′ TGTTGACTCTTTTTTTTTTT 3′ (SEQ ID NO:9) were added to the mixture. The final concentration of AuNP-5 and AuNP-6 was 1 nM. After a few minutes a change in colour could be observed, which in this case indicated the absence of the target sequence (thus, it was only seen in the negative control).
| Number | Date | Country | Kind |
|---|---|---|---|
| TO2014A001037 | Dec 2014 | IT | national |
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/IB2015/059546 | 12/11/2015 | WO | 00 |
