The present invention relates to methods and tools making it possible to measure post-translational modifications of peptides or proteins in a cell environment.
Advances in cell and molecular biology are making it possible to study cell processes in a very detailed manner: thanks to molecular biology, it is now possible to isolate the molecules involved in a given cell process, study their interactions and their modes of operation in vitro. These techniques make it possible to test the effect of compounds capable of becoming future medicaments on signalling paths and protein targets potentially involved in diseases.
One of the key stages in research into new biologically active compounds thus involves bringing them into contact with a cell, and determining whether or not these compounds have an effect on this cell. For this purpose, the effect of these compounds on a mechanism for translation of a given signal is generally studied. In a schematic manner, it can be considered that a biologically active compound will bind to a molecule involved in a cell mechanism, and will modify its behaviour: such compounds can therefore be detected either by measuring their binding to said molecule involved in a cell mechanism, either by measuring the activation or the inhibition of the considered cell mechanism, in the presence or absence of the compound to be tested.
It is known that the mechanisms for translation of the signal in particular involve enzymes which will modify proteins in the cell. These modifications of the cell proteins are called post-translational modifications and involve the modification of the skeletal structure of the polypeptide originating from the ribosomal translation by adding or cutting chemical groups, changing the three-dimensional structure or cutting the protein chain. Such modifications include the addition of phosphate (phosphorylation), ADP ribosyl (ADP-ribosylation), a methyl (methylation) or acetyl (acetylation) group, carbohydrate (glycosylation), fatty acid (prenylation), ubiquitin (ubiquitination), SUMO (Sumoylation) or proteolytic cutting of the protein (proteolysis). Additional examples of post-translational modifications include hydroxylation, myristoylation, palmitoylation, neddylation, iodation, sulphation. A certain number of post-translational modifications do not involve enzymes: this is the case with nitration and glutathionylation.
These post-translational modifications are key elements which make it possible to modulate the function of the proteins and hence their role in the cell mechanisms.
These post-translational modifications affect the majority of the eukaryotic proteins. They make it possible for the cell, starting from a single gene, to produce several effectors depending on the modifications made to the protein skeletal structure.
The post-translational modifications determine the state of activation of an enzyme or of a protein, its intracellular location and/or its excretion, the interactions that it can have, its stability and its degradation. These mechanisms are very finely regulated, since they allow the cell to modify its behaviour and adapt to its environment. Frequently, the deregulation of one or more effectors responsible for the post-translational modifications leads to pathological states of the organism.
For these reasons the enzymes involved in the mechanisms of post-translational modifications represent major targets for the pharmaceutical industry. The availability of tools making it possible to study the post-translational modifications undergone by a target polypeptide under cell conditions therefore represents a particularly important consideration for research into new medicaments.
Most of the studies relating to the modulation of the post-translational modifications are carried out using biochemical assays based on the use of recombinant enzymes, purified from insect or mammal cell cultures. The technique most often described for the study of the modifications involving a transfer of a donor compound group to a polypeptide substrate, involves, in a first phase, mixing the enzyme catalyzing the post-translational modification, the donor compound and the polypeptide acceptor of the post-translational modification. In a second phase, a specific probe (i.e. capable of distinguishing the modified polypeptide from the non-modified polypeptide) is added to the mixture. This approach is very widely used in the field of potential drug screening. The methods differ mainly in the method for the detection and/or the technology which makes it possible to demonstrate the fixing of the specific probe to the modified polypeptide.
Other methods first cause the compound to be tested to act on living cells. After lysis of the cells and addition of the appropriate cofactors, the enzymatic activity is tested on a target polypeptide added to the measurement medium.
The biochemical assays of the prior art do not make it possible to study the processes of post-translational modification under conditions close to physiological intracellular conditions.
These assays in fact require the addition to the measurement medium of a certain number of cofactors and group donor compounds (in the case of post-translational modifications consisting of group transfer), the concentrations of which are different from those encountered in the cell under physiological conditions, which can modify the activity of the enzyme catalyzing the post-translational modification. Moreover, the presence in the measurement medium of high concentrations of group donor compounds prevents the detection of inhibitor compounds acting by competition mechanisms.
Moreover, in these assays, the enzyme added to the measurement medium is in general totally active, which is often very far from the physiological reality. In fact, within the cell only a part of the enzyme molecules are activated, or there are even different populations of molecules activated to different degrees. The biochemical assays of the prior art do not make it possible to work on these different populations to the extent that they are not implemented under physiological conditions. For the same reason, they no longer make it possible to identify allosteric modulators of these enzymes.
Finally, certain compounds to be tested can seem to modulate the post-translational modification reactions when they are identified by the biochemical technique of the prior art since they have, in fact, no effect under physiological conditions, either because they do not cross the plasmic membrane because they are sequestered in a cell compartment, or also because they are degraded by the cell. These same techniques can also lead to interest in compounds which ultimately prove toxic when they are used on living cells.
Several technological approaches now exist which make it possible to study and quantify the post-translational modifications involved in living cells, among which there can be mentioned:
Hideyoshi H et al. (FEBS Lett. 1997, 414: 55-60) describe the use of peptides coupled with 6-acryloyl-2-dimethlaminonaphthalene (Acrylodan) or N-(7-dimethylamino-4-methylcoumarinyl)maleimide (DACM) which are permeable at the cell membrane. In the intracellular medium, the phosphorylation of the peptides is followed by measuring the reduction in the fluorescence emitted at 524 nm (acrylodan) or at 475 nm (DACM) after excitation of the fluorophores.
Finally, Wouters et al. (Current Biology, 1999, 9:1127-1130, describe a method making it possible to measure the phosphorylation of the EGFR receptor: this receptor is expressed in the form of a fusion protein with green fluorescent protein (GFP). In the presence of antibodies specific to phosphotyrosine and conjugated to cyanine 3 (Cy-3), a FRET takes place between the GFP and Cy-3, and this FRET is measured by the “FLIM” technique (Fluorescence Lifetime Imaging Microscopy).
These techniques making it possible to study the processes of post-translational modification under intracellular conditions suffer from a certain number of limitations in their implementation:
A need therefore exists for a technique making it possible to study the post-translational modifications under the conditions closest to the natural cell environment, requiring a minimum of stages and, in particular, not using the tedious methods of separation and/or detection described in the prior art.
“Post-translational modification”: this term designates a chemical modification of a protein taking place after its translation, comprising the group transfer reactions on, or starting from, the protein or also of proteolysis. The following reactions are post-translational modification reactions: Mono ADP ribosylation; Poly ADP ribosylation; Acetylation; Glutathionylation; O-Glycosylation; N-Glycosylation; Methylation; Nitration; Phosphorylation; prenylation; Sumoylation; Ubiquitination; Proteolysis; Biotinylation; Glutamylation.
“Coupling domain/Coupling agent”: these terms designate a pair of compounds capable of establishing between them a covalent or non-covalent bond with high affinity in the cell. The Coupling domain/Coupling agent pairs can be constituted by the following pairs: peptide sequence/antibodies specific to this peptide sequence, “Tag”/anti-tag antibodies, suicide enzyme/suicide enzyme substrate, biotin/avidin.
The Coupling domain/Coupling agent pairs are used in the invention for coupling a fluorescent compound with a protein substrate present in the cell, in other words for labelling a protein substrate with this fluorescent compound. “Measurement medium”: this term designates the container in which the test is carried out. It can be, for example, a microplate well or also a cell incubation chamber.
“Intact living cell”: this expression designates living cells the membrane and intracellular integrity of which is preserved. Cells containing one or more vector(s) for heterologous expression are intact living cells within the meaning of the invention.
“Method in homogeneous medium”: method carried out in a liquid medium, in the absence of a solid phase.
“Permeabilization”: within the meaning of the invention, the permeabilization of cells comprises any treatment applied to a cell making it possible for compounds not permeable to the plasmic membrane to enter the cell. The lysis of cells is included in this definition.
“Energy transfer between fluorescent molecules” or “Energy transfer by Förster type resonance” or “FRET” (for “Fluorescence Resonance Energy Transfer” or more strictly speaking “Förster Resonance Energy Transfer”): designates a quantum phenomenon being produced between two fluorescent molecules close to one another (distance comprised between ten and one hundred Angström) and the emission spectrum of one of which (the fluorescent donor compound) partially covers the excitation spectrum of the other (the fluorescent acceptor compound). When the fluorescent donor compound is excited by a photon, it can transmit its energy to the fluorescent acceptor compound which is then in an excited state and emits light.
“Pair of FRET partners”: this expression designates a pair constituted by a fluorescent donor compound and a fluorescent acceptor compound capable, when they are in proximity to one another and when they are excited at the excitation wavelength of the fluorescent donor compound, of emitting a FRET signal. It is known that in order for two fluorescent compounds to be FRET partners, the emission spectrum of the fluorescent donor compound must partially cover the excitation spectrum of the fluorescent acceptor compound. “FRET signal”: designates any measurable signal representative of a FRET between a fluorescent donor compound and a fluorescent acceptor compound. A FRET signal can therefore be a variation in the intensity or fluorescence lifetime of the fluorescent donor compound or the fluorescent acceptor compound.
The method for the detection of post-translational modifications according to the invention involves detecting by the FRET technique a protein or peptide substrate having undergone a post-translational modification in a functional living cell. Thus, with the exception of the protein substrate undergoing the post-translational modification, and optionally of the enzyme catalyzing this reaction, which are overexpressed in the cell, the method according to the invention does not require the addition of any co-factor involved in the reaction (for example the addition of high concentrations of ATP for the kinase assays), nor of stabilizing products which are necessary in the formats of the prior art (for example Mg2+ ions in the kinase activity assays). The method according to the invention, which is precise and adaptable to screening at high flow rates, therefore makes it possible to study the post-translational modifications and test compounds for their ability to modulate these reactions under conditions very close to physiological conditions. In the case where the enzyme is overexpressed, the method according to the invention also makes it possible to study only one given enzyme.
I.1 Simple Detection of a Post-Translational Modification
In a first implementation, the invention relates to a method in homogeneous medium making it possible to detect a post-translational modification of a protein substrate, the post-translational modification taking place in the intact living cells. This method is based on the heterologous expression by the cell of a fusion protein comprising said protein substrate and a first coupling domain, via an expression vector previously introduced into the cell.
The method according to the invention advantageously uses a pair of FRET partners in order to measure the protein substrate having undergone a post-translational modification: the labelling of the protein substrate having undergone the post-translational modification by the FRET partner fluorescent compounds is carried out on the one hand via a coupling domain/coupling agent pair as described below, and on the other hand by means of a binding domain specifically recognizing the site of the protein substrate having undergone the post-translational modification, according to the following diagram:
When the protein substrate undergoes a post-translational modification, the two fluorescent FRET partner compounds will be situated in proximity to one another and generate a FRET signal.
This method for detection in homogeneous medium of a post-translational modification of a protein substrate catalyzed by a cell enzyme is therefore characterized in that the post-translational modification reaction takes place in intact living cells, in that these cells comprise a heterologous expression vector coding for a fusion protein comprising the protein substrate and a first coupling domain and in that it comprises the following stages:
When at least one of the fluorescent compounds is not capable of passing through the plasmic membrane of the cells, a stage of permeabilization or lysis of the cells is implemented before Stage (ii) and/or (iii).
I.2. Detection of the Protein Substrate Having Undergone a Post-Translational Modification and Detection of the Total Protein Substrate in Two Different Measurement Media
The intensity of the signal measured when the preceding method is implemented of course depends on the quantity of protein substrate having undergone the post-translational modification, but also on the total quantity of protein substrate present in the measurement medium. Generally, the signal measured is all the more significant when there is protein substrate in the medium. When the signals specific to a post-translational modification obtained in different measurement media are to be compared, it becomes necessary to standardize these signals since, for example, different populations of cells can exhibit different levels of expression of the heterologous DNA coding for the protein substrate. Moreover, when the method according to the invention is used in order to determine the effect of a potential modulating agent of a post-translational modification (for example, in a medicament screening approach), the fact of measuring the total protein substrate makes it possible to verify that the product to be tested does not result in the death of the cell.
A particular implementation of the invention therefore involves measuring, in addition to the protein substrate having undergone the post-translational modification, a signal representative of the total quantity of protein substrate. This second signal can be used to standardize that corresponding to the protein substrate having undergone the post-translational modification, for example by calculating the following ratio: signal corresponding to the modified protein substrate/signal corresponding to the total protein substrate.
This implementation is based on the one hand on the use of two pairs of FRET partners, one making it possible to measure the signal corresponding to the modified protein substrate and the other making it possible to measure the signal corresponding to the total protein substrate, and on the other hand on the expression by the cell of a fusion protein comprising the protein substrate as well as two coupling domains.
In this implementation, a population of cells is distributed in two separate measurement media, for example in different wells of a multiwell plate, so as to be able to measure on the one hand the signal corresponding to the protein substrate having undergone the post-translational modification, and on the other hand the signal corresponding to the total quantity of protein substrate.
This implementation of the method for the detection in homogeneous medium of a post-translational modification of a protein substrate catalyzed by a cell enzyme is characterized in that the post-translational modification reaction takes place in intact living cells, in that these cells comprise a heterologous expression vector coding for a fusion protein comprising (1) the protein substrate, (2) a first coupling domain and (3) a second coupling domain, different from the first coupling domain, said second coupling domain not being affected by the post-translational modification, and in that it comprises the following stages:
When at least one of the fluorescent compounds is not capable of passing through the plasmic membrane of the cells, a stage of permeabilization of the cells or of lysis of the cells is implemented before Stage (ii) or before Stage (iii) and/or (vi).
It is understood that the measurements carried out in one or other measurement medium can be carried out in any order: they can be carried out in parallel on an automated system, or one after the other.
As the FRET measurements are carried out in different measurement media, the two pairs of FRET partners may or may not have the same spectroscopic characteristics. In other words, the second and third fluorescent compounds can be identical but each must be bonded to a different coupling agent.
This assay format illustrated by the diagram below can be, for example, implemented with the following reagents:
Starting from the cell lysate, the quantity of protein substrate having undergone a post-translational modification is measured in a first well using the antibody specific to the modified protein substrate coupled with the fluorescent donor compound (D1) as well as with the anti-tag 2 antibody coupled with the fluorescent acceptor compound A compatible with the fluorescent donor compound D1 for the establishment of a FRET.
In a second well, the total quantity of protein substrate is measured using the anti-tag 1 antibody coupled with a fluorescent donor compound D, which may be D1, but which must be compatible with the fluorescent acceptor compound A for the establishment of a FRET, as well as with the anti-tag 2 antibody coupled with the fluorescent acceptor compound A.
The tags can also be contiguous:
I.3. Detection of the Protein Substrate Having Undergone a Post-Translational Modification and Detection of the Total Protein Substrate in a Single Measurement Medium (FRET Killer)
In a particularly advantageous alternative implementation, the protein substrate having undergone the post-translational modification and the total protein substrate are measured in the same measurement medium: this implementation makes it possible to standardize the variations that could be encountered from one measurement medium to the other in a very effective manner.
This implementation is based, on the one hand, on the use of two pairs of FRET partners—one making it possible to measure the signal corresponding to the modified protein substrate and the other making it possible to measure the signal corresponding to the total protein substrate—and, on the other hand, on the expression by the cell of a fusion protein comprising the protein substrate as well as two coupling domains, as in the preceding implementation. In order to be able to measure in the same well the two signals “modified protein substrate” and “total protein substrate”, a FRET signal suppressing agent is used. In practice, a first pair of FRET partners is introduced into the measurement medium (a pair specific to the total protein substrate or modified protein substrate, it does not matter which), then the FRET signal suppressing agent is in turn added to the medium, so as to “switch off” the first signal. The second pair of FRET partners is then formed in the measurement medium and the second signal can be measured.
The FRET signal suppressing agents are described below.
This implementation of the method for the detection in homogeneous medium of a post-translational modification of a protein substrate catalyzed by a cell enzyme is characterized in that the post-translational modification reaction takes place in intact living cells, in that these cells comprise a heterologous expression vector coding for a fusion protein comprising (1) the protein substrate, (2) a first coupling domain and (3) a second coupling domain different from the first coupling domain, said second coupling domain not being affected by the post-translational modification, and in that it comprises the following stages:
When at least one of the fluorescent compounds or the FRET suppressing agent is not capable of passing through the plasmic membrane, a stage of permeabilization of the cells or of lysis of the cells is implemented before Stage (ii), (iii), (v) or (vi).
It is evident that the order of measurement of the signals is not important: Stages (iii)-(iv) and (vi)-(vii) can be reversed in order to measure firstly the signal corresponding to the total protein substrate then the signal corresponding to the modified protein substrate, from the moment when the FRET signal suppressing agent specifically suppresses the first signal emitted in the measurement medium.
This format can be implemented, for example, with the following reagents:
Starting from the cell lysate, the quantity of protein substrate having undergone a post-translational modification is measured using the antibodies recognizing the modified protein substrate coupled with the fluorescent donor compound D1 and the anti-tag 2 antibody coupled with the fluorescent acceptor compound A.
After reading, the FRET suppressing agent, specific to D1 and suppressing the FRET between D1 and A, and the anti-tag 1 antibody, coupled with the fluorescent donor compound D2 are added to the same well. This second reading is representative of the total quantity of protein substrate.
II.1. The FRET
The method according to the invention makes it possible to adapt the FRET technique to the measurement of post-translational modifications in a cell context. The FRET phenomenon has been widely described in the literature and is a concept known to a person skilled in the art. It is a quantum phenomenon which is produced between two fluorescent molecules close to one another (distance comprised between ten and one hundred Angstrom) and the emission spectrum of one of which (the fluorescent donor compound) partially covers the excitation spectrum of the other (the fluorescent acceptor compound). When the fluorescent donor compound is excited by a photon, it can transmit its energy to the fluorescent acceptor compound which is then in an excited state and emits light.
A pair of FRET partners within the meaning of the invention is therefore constituted by a fluorescent donor compound the emission spectrum of which partially covers the excitation spectrum of the fluorescent acceptor compound. The concept of FRET partners is well known to a person skilled in the art who is capable, on the basis of the spectroscopic characteristics of the known fluorescent compounds, of selecting the pairs of fluorescent compounds compatible in terms of FRET. It may moreover refer to the work by Lakowicz (1999) Principles of fluorescence spectroscopy, 2nd edition, Kluwer academic/plenum publishers, NY. Moreover, the term FRET is used here in the broad sense and includes time-resolved FRET (TR-FRET).
The FRET phenomenon can be detected by the measurement of different parameters of the fluorescence signal emitted either by the fluorescent donor compound, or by the fluorescent acceptor compound, or by both compounds. Among the most common techniques, there can in particular be mentioned:
The expression “measurement of the FRET signal” used in the description of the invention designates any one of these techniques equally. The measurement of the fluorescence emitted by the fluorescent acceptor compound is nevertheless one of the preferred approaches for the implementation of the invention.
II.2. The Fluorescent Compounds
The fluorescent compounds can be chosen from the following group: the luminescent proteins such as green fluorescent protein (GFP) or its variants, fluorescent proteins extracted from corals, phycobiliproteins, such as B-phycoerythrin, R-phycoerythrin, C-phycocyanin, the allophycocyanins, in particular those known by the name XL665; the luminescent organic molecules such as the rhodamines, the cyanines, the squaraines, the fluorophores known by the name BODIPY, the fluoresceins, the compounds known by the name Alexa Fluor; the supra-molecular complexes such as the rare earth cryptates, the rare earth chelates (in particular europium, terbium, samarium, dysprosium, neodymium chelates and cryptates); luminescent inorganic particles such as nanocrystals (“quantum dots”). These fluorescent compounds can be used either as the fluorescent donor compounds or as the fluorescent acceptor compounds in a FRET system.
The rare earth complexes are known compounds which are described for example in the U.S. Pat. No. 4,761,481, U.S. Pat. No. 5,032,677, U.S. Pat. No. 5,055,578, U.S. Pat. No. 5,106,957, U.S. Pat. No. 5,116,989, U.S. Pat. No. 4,761,481, U.S. Pat. No. 4,801,722, U.S. Pat. No. 4,794,191, U.S. Pat. No. 4,637,988, U.S. Pat. No. 4,670,572, U.S. Pat. No. 4,837,169, U.S. Pat. No. 4,859,777. Other chelates are compounds of a nonadentate ligand such as terpyridine (EP 403 593, U.S. Pat. No. 5,324,825, U.S. Pat. No. 5,202,423, U.S. Pat. No. 5,316,909). The rare earth can be europium or terbium.
The rare earth cryptates are described in particular in the patents EP 0 180 492, EP 0 601 113 and the application WO 01/96 877.
Advantageously, the rare earth complex is a europium chelate or cryptate. When the rare earth is europium, the rare earth complex is preferably a rare earth cryptate with a pyridine unit, still more preferably with a trisbipyridine and pyridine-bipyridine unit.
II.3. Fluorescent Compound/Coupling Agent or Fluorescent Compound/Binding Domain Conjugates
In order that a pair of FRET partners can emit a signal in the presence of a protein substrate having undergone a post-translational modification, one of these partners must be conjugated, preferably covalently bonded, to an element recognizing said protein substrate having undergone the post-translational modification. In the case in point, one of the fluorescent compounds, either the fluorescent donor compound or the fluorescent acceptor compound, is covalently bonded to a binding domain (antibody, aptamer etc.) capable of recognizing the site of the protein substrate having undergone the post-translational modification. The other member of the pair of FRET partners is covalently bonded to a coupling agent capable of binding, covalently or non-covalently, to a coupling domain present on the protein substrate (protein tag, suicide enzyme etc.).
The binding domain capable of recognizing the site of the protein substrate having undergone the post-translational modification can be variable in nature: it can be, for example, an antibody, an antibody fragment or an aptamer binding specifically to the site of the protein substrate having undergone the post-translational modification.
The production of antibodies specific to a post-translational modification forms part of the general knowledge of a person skilled in the art and is in particular described in “Antibodies: a laboratory manual” (Ed. Harlow D. Lane, Cold Spring Harbor Laboratory, 1988). It is based on the immunization of a mammal with an antigen comprising the site of the protein substrate as present in the cell after post-translational modification. A useful antibody in the invention can be a complete antibody, or an antibody fragment which can be a Fab or F(ab)′2 or single-chain Fv fragment. The antibody can be recombinant or non-recombinant. In the case of a protein substrate undergoing a group transfer, for example the phosphorylation of an amino acid (serine, threonine or tyrosine), the antigen used for the immunization will comprise a sequence of 5 to 100 amino acids, or 5 to 50 or 5 to 15 amino acids one of which is a phosphorylated serine, or threonine, or tyrosine.
Numerous antibodies specific to post-translational modifications are commercially available. They are, for example, antibodies specific to phospho-serine, phospho-tyrosine, phospho-threonine (Upstate Biologicals, new England Biolabs etc.).
The aptamers which are polynucleotide by nature are single-strand oligonucleotides which have been selected for their ability to bind specifically to a given molecule, in the case in point to a domain of a protein substrate having undergone a post-translational modification. The methods for the preparation and selection are known and in particular described in the U.S. Pat. No. 5,567,588 (SELEX method).
The aptamers which are peptidic by nature are constituted by a short sequence of 10 to 20 amino acids (“variable” domain conferring the specificity of the aptamer for a given target), the two ends of which are linked to a “scaffold”, protein thus creating a structural constraint participating in the specificity of the peptidic aptamer. The methods for the selection and production of these aptamers are also known and described in the prior art.
Depending on the post-translational modifications studied, other binding domains can recognize the sites of the modified protein substrate: in the case where the post-translational modification is a glycosylation, the binding domain can be a lectin such as WGA (“Wheat Germ Agglutinin”).
The phosphate groups present on the proteins having undergone a phosphorylation can be recognized by microbeads onto which metallic ions have been grafted. In this case, the binding domain specific to the modified substrate is therefore a microbead (technology known by the name of “IMAP” for “Immobilized Metal Ion Affinity”).
In the case of glutathionylation of a protein substrate, GST can be used as a specific binding domain recognizing the glutathione group grafted to the protein substrate.
In the case where the total protein substrate is also to be measured, i.e. in order for a pair of FRET partners to be able to emit a FRET signal in the presence of a protein substrate (whether or not it has undergone a post-translational modification), each of the members of the pair of FRET partners is conjugated, preferably covalently bonded, to a coupling agent (antibody, suicide enzyme substrate etc.) capable of binding, covalently or non-covalently, to a coupling domain present on the protein substrate (protein tag, suicide enzyme etc.). This means, in the case where the total protein substrate is to be measured, that the protein substrate comprises two different coupling domains, one for the fluorescent donor compound and one for the fluorescent acceptor compound.
A person skilled in the art is able to prepare such fluorescent compound/coupling agent or fluorescent compound/binding domain conjugates by the standard conjugation technique using standard reaction groups such as those described, for example, in: “Bioconjugate Techniques”, G. T. Hermanson, Academic Press, 1996.
As mentioned above, the cells on which the method according to the invention is carried out include an expression vector comprising a nucleic sequence coding for a fusion protein constituted by the protein substrate capable of undergoing the post-translational modification that is being studied, and at least one coupling domain which is recognized by the coupling agent bonded to one of the FRET partners.
The choice of the protein substrate depends on the post-translational modification that is to be studied and a person skilled in the art can easily make this choice. By way of information, Table 2 provides a few examples of protein substrates depending on the post-translational modifications studied.
The protein substrate can have the same sequence as the “natural” substrate of the enzyme involved in the reaction that is to be studied: the expression vector can therefore contain a nucleic acid sequence coding for example for a protein receptor, a protein enzyme such as for example a kinase which can undergo a post-translational phosphorylation etc.
The protein substrate can also be constituted by a fragment of the natural substrate, providing that this fragment comprises the domain recognized by the enzyme and the domain undergoing the post-translational modification.
Finally, the protein substrate can be an artificial peptide substrate, such as for example the substrates described in the Application WO03/087400.
In a first implementation, the coupling domain fused with the protein substrate is a protein tag and the coupling agent is an antibody, an antibody fragment or also an aptamer specific to said tag. The tag can be any peptide sequence of 4 to 250 amino acids, preferably 4 to 50, and still more preferably 4 to 15 amino acids, providing that this tag does not impede the recognition of the substrate by the enzyme catalyzing the post-translational modification reaction. This tag can be naturally present in the protein substrate capable of undergoing the post-translational modification or be added as described in the experimental part. In particular, this protein tag is chosen from: glutathione S-transferase, avidin, a peptide constituted by 6 histidines, a peptide constituted by the amino acids 410-419 of the human Myc protein (EQKLISEEDL), a FLAG peptide with the sequence DYKDDDK, an influenza hemaglutinin epitope with the sequence YPYDVPDYA.
In a second embodiment, the coupling domain fused to the protein substrate is a suicide enzyme and the coupling agent is a substrate of this enzyme.
The suicide enzymes are proteins which have an enzymatic activity modified by specific mutations which confers upon them an ability to bind rapidly and covalently to a substrate. These enzymes are designated suicide enzymes as each one can bind only to one single fluorescent molecule, the activity of the enzyme being blocked by the fixing of the substrate.
At present, two families of known suicide enzymes allow this type of labelling:
In a third embodiment, the coupling domain is the enzyme Dihydrofolate reductase and the coupling agent is a Dihydrofolate reductase inhibitor, such as the antibiotic Trimethoprim or 5-(3,4,5-trimethoxybenzyl)pyrimidine-2,4-diamine (technology marketed under the name of “LigandLink” by Active Motif).
The expression vector present in the cell, coding for a fusion protein and comprising at least one coupling domain is produced according to the technique known to a person skilled in the art. More precisely, this expression vector can be a plasmid into which there have been inserted, using restriction enzymes and ligases, the nucleic acid sequences coding for the fusion protein which is to be expressed by the cell. These sequences are integrated into the plasmid downstream of a promoter and in the same reading frame. Numerous expression vectors are commercially available.
Similarly, the protocols for the transfection of cells by an expression vector come within the routine techniques described in the literature.
The expression of this fusion protein by the cell can be stable or transitory, according to whether or not the expression vector is integrated into the cell DNA.
The method according to the invention has the advantage of allowing the detection of a post-translational modification taking place in a living cell, under conditions very close to physiological conditions. Nevertheless, once the post-translational modification reaction has taken place, it may be necessary to permeabilize the cell membrane prior to the addition of the FRET partner compounds in order to allow them to reach their target in the cell. The permeabilization of the cell membrane can be carried out by any appropriate method (Goncalves et al. (2000) Neurochem. Res. 25: 885-8). These methods include the addition of a detergent (for example: CHAPS, cholic acid, deoxycholic acid, digitonin, n-dodecyl-, 8-D-maltoside, lauryl sulphate, glycodeoxycholic acid, n-lauroylsarcosine, saponin or triton X-100) or of an organic alcohol (such as methanol or ethanol) to the culture medium. Other permeabilization techniques involve the use of peptides or toxins (Aguilera et al. (1999) FEBS Lett. 462: 273-277; Bussing et al. (1999) Cytometry 37: 133-139).
A person skilled in the art is able to choose the permeabilizing agent and adapt the experimental conditions (in particular its concentration and duration of incubation) in order to permeabilize the cells satisfactorily, i.e. in such a manner that the pairs of FRET partners can penetrate into the cell.
Within the meaning of the invention, permeabilization includes the lysis of the cells: once the post-translational modification has taken place in a cell context, it is no longer necessary to maintain the integrity of these cells. The addition of the FRET partners allowing the detection of the protein substrate having undergone the modification and/or optionally those allowing the detection of the total protein substrate, can be carried out on a cell lysate and not necessarily on a population of intact living cells.
Alternatively, it is also possible to use within the scope of the invention fluorescent conjugates which are capable of passing through the plasmic membrane, either because they are “naturally” capable of this because of their chemical structure, or because they comprise a domain allowing them to pass through the cell membrane.
The following techniques can be used in order to make the fluorescent compounds capable of passing through the plasmic membrane:
1) Use of esters which mask the charged groups during the passage through the lipid bilayer. These esters come within the category of the compounds named “pro-drugs” and refer to compounds which are rapidly transformed in vivo in order to produce the “parent” compound following hydrolysis under physiological conditions (T. Higuchi and V. Stella (1975) in “Pro-drugs as Novel Delivery Systems”, Vol. 14 of the A.C.S. Symposium Series, American Chemical Society). Examples include mainly the pivaloyl-oxymethyl, acetoxymethyl groups as well as the glycol esters (Nielsen and Bundgaard (1984) Int. J. of Pharmacy 39: 75-85). When this technique is used, one of these esters is grafted covalently onto the fluorescent compound.
2) Use of viral peptides grafted covalently onto the fluorescent compound. Certain viral peptides make it possible to convey the fluorescent compound through the cell membrane. As examples of such viral peptides, there can be mentioned the analogues of “penetratin” and “transportan” (Lange) et al. (2000) Bioconj. Chem. 11: 619-626), the poly-Arginines (Wender et al. (2003) Org. Lett. 5(19): 3459-3462), the peptoids (analogues of peptides carrying guanidine groups (Wender et al. (2000) Proc. Natl. Acad. Sci. USA, 13003-8)), or also the non-hydrolyzable derivatives with tetraguanidinium units (Fernandez-Carneado et al. (2005) J. Am. Chem. Soc. 127: 869-874).
3) Modification of the lipophily and polarity of the fluorescent compounds by adding side chains containing cholesterol molecules, vitamin E or aliphatic chains which interact with the cell membranes by using the illustrated approach on oligonucleotides using undecyl- or 1,2-di-O-hexadecyl-glycerol chains (Rait et al. (2000) Bioconj. Chem. 11: 153-160). These modifications are more effective than the cationic surfactants (cationic “lipids”) which form supramolecular complexes with the nucleic acids and increase endocytosis but which are toxic and damage the cell membranes.
As a result, in the process according to the invention, at least one fluorescent compound comprises a domain allowing it to pass through the plasmic membrane, this unit being selected from the following groups: esters such as pivaloyl-oxymethyl ester, acetoxymethyl ester, or glycol esters; viral peptides carried by membrane transporters such as penetratin and its analogues, transportan and its analogues, the polyarginine groups, the peptoids carrying guanidine groups, such as the oligoguanidinium groups; cholesterol groups, vitamin E or aliphatic chains such as undecyl or 1,2-di-O-hexadecyl-glycerol chains.
A particularly advantageous implementation of the invention involves measuring the signal corresponding to the protein substrate having undergone a post-translational modification and the signal corresponding to the total protein substrate in the same measurement medium. For this purpose, a FRET suppressing agent is used as described above.
By FRET signal suppressing agent is meant a compound which causes a FRET signal reduction of at least 70% relative to the signal measured in the absence of this compound. The FRET signal suppressing agents causing a FRET reduction of at least 80%, or of at least 90%, are preferred.
The FRET signal suppressing agents used in the method according to the invention do not disturb the biological event studied (post-translational modification) to the extent that they act at the level of one of the fluorescent compounds involved in the FRET, and not at the level of the biological event studied. They have no effect on the distance separating the molecules involved in the biological event.
In order to determine whether a compound is a FRET signal suppressor within the meaning of the invention, it can be placed in contact with a pair of FRET partner fluorescent conjugates emitting a FRET signal, for example two fluorescent conjugates recognizing the same molecule, or also two fluorescent conjugates one of which comprises a biotin and the other streptavidin. The FRET signal emitted by the reaction medium is measured in the presence and in the absence of said compound, the FRET signal suppressors being those which lead to a reduction in signal of at least 70%. This simple test allows a person skilled in the art to isolate FRET suppressing agents within the meaning of the invention.
These FRET suppressing agents can be different in nature and have different functions, but they make it possible, in all cases, to suppress the FRET signal emitted by a given donor-acceptor pair. The FRET suppressing agents can be of four types.
In general, the agents modifying a fluorescent compound emission or absorption spectrum, or also those inhibiting fluorescence can be used in the methods according to the invention, providing that they effectively cause a suppression of the FRET signal within the meaning of the invention. This characteristic can be tested simply as mentioned above.
In a particular implementation of the invention, the enzyme catalyzing the post-translational modification is expressed by an expression vector integrated by the cell in a stable or transitory manner. The sequences of these enzymes are available in the literature and their expression comes within the routine techniques for a person skilled in the art. This implementation makes it possible to overexpress the enzyme involved and therefore to amplify the signal measured since a larger quantity of protein substrate is potentially modified. Moreover, the overexpression of the enzyme increases the specificity of the signal with respect to the other cell enzymes and therefore allows the study of a given enzyme. This implementation also makes it possible to control the expression of the enzyme if the expression vector comprises a regulation domain such as an inducible promoter or an “enhancer” sequence. The use of a system allowing the expression of inducible enzymes makes it possible to detect the allosteric inhibitors which act directly on the enzyme by stabilizing the latter in its inactive form.
It is important to note that, even in the case where the enzyme is overexpressed, the post-translational modification reaction always takes place in an environment close to physiological conditions, in particular in the case of the reactions involving a group transfer since the group donor is present in the cell at physiological concentrations.
Certain enzymes catalyzing a post-translational modification are not constitutively active and must be activated. The methods according to the invention can therefore comprise an additional stage of activation of the enzyme involved in the reaction studied.
This stimulation can be: an osmotic shock, thermal shock, oxidative stress induced by a chemical compound (for example by the addition of H2O2 or diamine to the culture medium). Carcinogenic compounds, heavy metals (for example mercury, cadmium etc.) or pollutants can also be used as chemical activators.
This stimulation can also be biochemical in nature by the addition, to the culture medium, of growth factors (such as the EGFs, the FGFs, the CSFs, the HGFs, IGFs, ILGFs, NGFs, PDGFs, VEGFs), cytokines (such as the interleukins IL-1, IL-2, IL-6, IL-8), the interferons IFN-α and IFN-β, TNFα, TNFβ, growth hormones (such as PL, GH, Prl) or neuromediators (such as acetylcholine, glycine, glutamate, GABA, dopamine, noradrenaline, histamine).
A person skilled in the art is able to assess in which cases these post-translational modification stimulating agents must be used, depending on the enzyme involved.
In an alternative implementation, the method according to the invention is implemented using cells expressing a protein involved in the activation cascade leading to the post-translational modification. These proteins can, for example, be a transmembrane receptor, such as a receptor coupled to G protein, or an enzyme producing an intracellular messenger (such as adenylate cyclase) the activation of which results, via an intracellular signalling cascade, in the modification of the protein substrate capable of undergoing the post-translational modification.
According to this implementation, the cells contain an expression vector integrated into the cell in a stable or transitory manner, and coding for a protein involved in the activation route leading to the post-translational modification. Depending on the post-translational modification studied, a person skilled in the art is able to choose the protein in question. This implementation is particularly useful, for example, for studying the effect of candidate compounds capable of acting on said protein involved in the activation route of the post-translational modification.
The invention also relates to cells suited to the implementation of the methods according to the invention.
These cells suited to the study of a post-translational modification are characterized in that they comprise:
a) an expression vector coding for a fusion protein comprising the protein substrate and one or two coupling domains; and
b) an expression vector comprising the nucleic acid sequence coding for the enzyme catalyzing said post-translational modification or for a protein involved in the activation cascade leading to the post-translational modification.
The protein involved in the activation cascade leading to the post-translational modification is, preferably, a membrane receptor or an enzyme producing an intracellular massager.
As mentioned above, these expression vectors can for example be plasmids. The cells can in particular be cells of mammals, in particular human cells.
In a particular implementation, the expression vectors are integrated into the cellular DNA. In a preferred implementation the expression vectors are integrated into the cellular DNA and the cells are immortalized cells, which makes it possible to obtain stable cell lines, which are particularly advantageous for studying a post-translational modification under easily reproducible conditions.
Although the cells according to the invention have never been described, the co-transfection of expression vectors into a cell and the obtaining of immortal cell lines expressing “exogenous” proteins in a stable manner (in the case in point the protein substrate comprising at least one binding domain and the enzyme catalyzing the post-translational modification studied or a protein involved in the activation cascade leading to the post-translational modification) are techniques known to a person skilled in the art.
The method according to the invention could not be limited to a given post-translational modification. In fact, the work carried out by the Applicant can be easily transposed to the majority of post-translational modifications involving a group transfer onto a protein substrate, a group cleavage present on a protein substrate, or also a protein substrate cleavage.
The method according to the invention is particularly suited to the study of the following post-translational modifications:
The mono ADP ribosylation plays a fundamental role in the cell signalling, as well as in the modification of the cytoskeleton by targeting the actin as well as the desmin filaments.
The poly-ADP ribosylation of nuclear proteins by the Poly ADP ribose polymerases (PARP) constitutes one of the cell's responses to DNA lesion.
Sumoylation plays an important role in the nuclear location of the proteins, their DNA repair activity, their transcriptional activity. Sumoylation can also play an antagonistic role as regards ubiquitination.
In all cases, the method of study of post-translational modifications according to the invention is implemented on cells expressing a protein substrate capable of undergoing the post-translational modification studied, this protein substrate comprising at least one coupling domain allowing its detection by a FRET technique.
Table 2 illustrates a certain number of post-translational modifications which can be studied using the method according to the invention: in the case of the modifications involving a group transfer catalyzed by an enzyme expressed by the cell (column 2) from a donor group (column 3) to an amino acid (column 4) present on the protein substrate expressed in a stable or transitory manner by the cell (column 5), one of the fluorescent compound members of a pair of FRET partners is covalently bonded to a binding domain specific to the post-translational modification (column 6). The coupling of fluorescent compound with the specific binding domain is carried out by the standard technique conjugation based on the use of rectional groups, well known to a person skilled in the art and described in “Bioconjugate Techniques”, G. T. Hermanson, Academic Press, 1996.
S/T-PX-K/R domain recognized by the Cyclin dependent
K-X and R-X domains recognized by the
The method according to the invention is particularly useful for testing the ability of certain so-called “candidate” compounds to modulate post-translational modifications. For this purpose, the detection method according to the invention is implemented in the presence and in the absence of such compounds and the signals obtained are compared. These signals can also be compared with the signals obtained by incubating the cells with known modulators—inhibitors or activators.
The compounds which are potentially modulators of post-translational modifications can act according to several mechanisms:
The method according to the invention makes it possible to exclude the “non-physiological” false positives obtained during the implementation of the in vitro technique of the prior art: these compounds are those which have an effect in vitro but are, in fact, incapable of reaching their target under physiological conditions.
Another aspect of the invention relates to a cell suited to the study of a post-translational modification as described previously characterized in that it comprises:
According to a preferred aspect, the cell according to the invention is characterized in that said expression vectors are integrated into the cellular DNA.
The cell according to the invention is, preferably, an immortalized cell.
The cell according to the invention can be of any kind. It is preferably a mammal cell, in particular a human cell.
Plasm. Sub=plasmid substrate=plasmid coding for the substrate.
Detection of the phosphorylated substrate by using either the antibody STK-europium cryptate as donor compound and anti-Flag-XL665 as FRET acceptor compound, or the antibody STK-europium cryptate as donor compound and a suicide enzyme Snaptag and increasing concentrations of its substrate Benzyl Guanine (BG) conjugated to the fluorescent acceptor compound Dy647.
This example illustrates the use of the method described in the invention for measuring the phosphorylation of a protein substrate by a homogeneous TR-FRET technique. This example also underlines the importance of the co-transfection of the cells with, on the one hand, a plasmid coding for an enzyme inducing a post-translational modification, and on the other hand a target peptide sequence.
Protocol
Preparation of the Plasmid Coding for the Substrate:
The following sequence represents the sense strand (5′-3′) coding for a fusion protein comprising: the c-myc tag (underlined), a generic substrate recognized by the serine/threonine kinases (in bold) and the FLAG tag (dotted underlining), flanked in position 5′ by part of the restriction site of BamH1 and in position 3′ by part of the restriction site of Xho1:
ACGCTGAGCTTCGCAGAGCCTGGC
GTA
The double-strand oligonucleotide is obtained by hybridizing the following two oligomers:
and by carrying out a PCR reaction with the programme: 95° C. for 10 min/90° C., 5 min/85° C., 5 min/80° C. 15 min/75° C. 60 min/70° C. 15 min/65° C. 10 min/60° C. 5 min/55° C., 5 min/50 min/45° C. 5 min/35° C. 10 min/25° C. 15 min/15° C. 5 min/4° C. The sequence is inserted into the pSEMS plasmid (from Covalys) by mixing 1 μl of Quick T4 DNA ligase (New England Biolabs Cat No M2200S), 1 μl of hybridized oligonucleotides and 50 ng of plasmid previously digested with the restriction enzymes BamH1 and Xho1 for 10 min at ambient temperature.
The plasmid is then incubated with One Shot® TOP10 competent cells (Invitrogen Corp. Cat No C4040-06) for 1 hour at 37° C. then the cells are plated on plates containing ampicillin.
After 1 night at 37° C., 6 colonies are selected, amplified and their identity is confirmed by sequencing.
Transfection of the Cells:
8000 HEK293 cells (ATCC) are either transfected with increasing quantities of plasmid coding for the substrate alone, or co-transfected with the same quantities of plasmid coding for the substrate and 25 ng of Akt1-pcDNA 3.1 (Invitrogen Corp. Cat No V790-20) The co-transfection is carried out in the presence of Lipofectamine 2000 (Invitrogen corp. Cat No 11668-019) and OPTI-MEM medium (Gibco Cat No 31985).
The cells are then cultured for 48 hours at 37° C. in 25 μl of DMEM medium (Gibco Cat No 11965-092), to which 10% FCS (Hyclone Cat No SV30014-03) and 1% antibiotic and antifungal (Gibco Cat No 15240-062) are added in 384-well plates (Proxiplate 384, Perkin-Elmer Cat No 6006280).
The cells are lysed in 50 mM Hepes buffer, pH7, containing 0.1% BSA, 20 mM EDTA, 0.8 M potassium fluoride and 2% triton X100. This same buffer contains 1.8 ng of phosphospecific antibodies (STK antibody, Upstate Cat No 35-002) conjugated with the donor (europium cryptate) and 40 ng of anti-FLAG conjugated with the acceptor (cross-linked allophycocyanin, XL 665, CIS bio international Cat No 61FG2XLA).
The plate is incubated for 1 hour at ambient temperature before time-resolved reading.
Analysis of the TR-FRET Signal:
The FRET signals are measured on an Acquest 384 fluorimeter (Molecular Device) in TR-FRET mode at 620 nm (emission wavelength of rare earth cryptate) and 665 nm (emission wavelength of allophycocyanin) after excitation by a flash lamp with a bandwidth comprised between 330 and 380 nm. The ratio between the fluorescence emitted at 665 nm (fluorescence of the acceptor) and the fluorescence emitted at 620 nm (fluorescence of the donor) (Ratio 665/620) is representative of the FRET occurring between the donor (europium cryptate) and the acceptor (Allophycocyanin). This FRET is proportional to the spatial proximity between the donor and the acceptor.
The delta F (%) (DF) corresponds to:
The negative control signal corresponds to the signal obtained with the non-transfected cells.
Results
The cells are transfected with the plasmid coding for the substrate alone or co-transfected with this same plasmid coding for the substrate and a plasmid coding for Akt1. After lysis of the cells, the phosphorylation of the substrate is detected using a phosphospecific antibody coupled with europium cryptate (donor) (Ref. CIS biointernational, standard tris bipy extinguished by the FRET killer), and an anti-FLAG antibody coupled with allophycocyanin (Ref. XL665 CIS bio international). The FRET measured is proportional to the spatial proximity between the donor and the acceptor. This proximity results from the fixing of the phosphospecific antibodies to the phosphorylated protein substrate on the one hand and the fixing of the anti-FLAG to the FLAG sequence on the other hand.
In the cell, the same protein substrate can in general be phosphorylated by several kinases. The co-transfection of the kinase and its substrate makes it possible to detect the contribution of this particular kinase to the phosphorylation of the protein substrate, and thus to study the effect of (potentially inhibiting) compounds on this kinase.
Under cell conditions, a kinase is not permanently active, even if the molecules of a population of kinase can be at different levels of activation. This is the case with the Cam kinase II studied in this example, which is here activated by the addition of ionomycin to the medium. This example shows that the method according to the invention can be used with success to detect an intracellular modification (here, phosphorylation of a protein substrate by the Cam kinase II) resulting from an extracellular stimulation (here, chemical stimulation by ionomycin).
Protocol
8000 cells HEK293 are either transfected with increasing quantities of plasmid coding for the substrate alone (Identical to Example 1), or co-transfected with the same quantities of plasmid coding for the substrate and 25 ng of CamKII δ-pcDNA 3.1 (plasmid coding for Cam kinase II). The transfection is carried out as described in Example 1.
The cells are then cultured for 48 hours at 37° C. in DMEM medium, comprising 10% fœtal calf serum and 1% antibiotic and antifungal, then for 16 hours in the same medium without serum.
The cells are stimulated for 5 min in the presence of ionomycin 1 μM (Sigma), and lysed as described above.
The phosphorylation of the protein substrate is detected as described in Example 1.
Results
On the other hand, in the presence of ionomycin, the signal measured is much greater than in its absence. Moreover, this signal is positively correlated with the quantity of plasmid coding for the transfected substrate in the cell.
In order to detect compounds capable of activating Cam kinase II, the ionomycin can be replaced with a compound to be tested and the signals obtained in the absence and in the presence of this compound can be compared.
Certain inhibitor compounds, in particular the allosteric inhibitors, become fixed to the inactive kinase and stabilize it in this state. These same compounds have little or no activity on the kinase when it is active. The method according to the invention makes it possible, by adding a compound to be tested (potential allosteric inhibitor) to the measurement medium before the addition of ionomycin, to detect such allosteric inhibitors.
Example 3 shows that the method of the invention makes it possible to test the ability of a compound to inhibit a kinase.
Protocol
The cells are co-transfected and cultured as described in Example 1. After culture for 48 hours, they are incubated for 1 hour in the presence of increasing concentrations of staurosporine, an known kinase Akt1 inhibitor. The cells are then lysed and the phosphorylated protein substrate detected as described in Example 1.
In parallel, in a second well, cells are treated in identical manner. After lysis, the total quantity of protein substrate is measured using an anti-c-myc antibody coupled with europium cryptate (2.9 ng/well) (CIS bio international Cat No 61MYCKLA) and an anti-FLAG antibody coupled with allophycocyanin (40 ng/well).
Results
The peptide sequence target is inserted between two peptide sequence tags (c-myc and FLAG). The expressed quantity of these two sequences is therefore equivalent to the expressed quantity of protein substrate. The measurement of the FRET occurring between an c-myc antibody coupled with a donor and an anti-FLAG antibody coupled with an acceptor is therefore representative of the total quantity of protein substrate expressed by the cell.
The method according to the invention therefore makes it possible to assert that the reduction in the signal corresponding to the phosphorylated protein substrate is linked to the action of the inhibitor and not to a reduction in the quantity of protein substrate expressed in the cell.
Moreover, if the staurosporine is replaced by a compound to be tested, the method according to the invention makes it possible to detect an inhibitor of the post-translational modification studied (here phosphorylation by Akt1).
Example 4 is an illustration of the method according to the invention which allows the detection of the protein substrate having undergone a post-translational modification and the detection of the total protein substrate in a single measurement medium (FRET killer).
This example also underlines the importance of standardizing the quantity of phosphorylated protein substrate relative to the quantity of total protein substrate.
Protocol
The cells are co-transfected with, on the one hand, a plasmid coding for the protein substrate labelled by the c-myc and flag tags and, on the other hand, a plasmid coding for Akt1, as described in Example 1. The cells are then treated as described previously with straurosporine. Measurement of the FRET signals corresponding to the phosphorylated protein substrate and to the total protein substrate is carried out either:
480 ng of an antibody specific to the tris-bipyridine europium cryptate not recognizing the trisbipyridine pentacid cryptate, (formulae below), capable of blocking the FRET between the phosphospecific antibodies and allophycocyanin, as well as an anti-c-myc antibody coupled with a donor (trisbipyridine pentacid cryptate, 1.1 ng) not sensitive to the FRET suppressing agent and compatible with allophycocyanin are then added to the well. After 1 hour, the signal corresponding to the total protein substrate is measured by TR-FRET.
Bis-Bipyrine Europium and Trisbipyridine Pentacid Cryptates
Results
In order to have an exact idea of the quantity of modified protein substrate in a cell, it is therefore necessary to relate this quantity of modified protein substrate to the total quantity of protein substrate contained in the same sample.
In
This example illustrates the use of the method according to the invention for measuring the level of phosphorylation and the quantity of substrate expressed after co-transfection in the cells of the plasmid coding for the protein substrate and of the plasmid coding for the Akt kinase.
This example illustrates in particular the use of a suicide enzyme as a coupling domain, in this case O(6)-alkylguanine-DNA alkyltransferase (Snaptag), for labelling the substrate with a coupling agent, in this case a Benzylguanine-Dy647 conjugate as a fluorescent acceptor compound. This implementation is an excellent alternative to the use of tag/antitag systems for labelling the substrate by one of the FRET partner components, in this case the Dy647 acceptor.
Protocol
Preparation of the Plasmid Coding for the Substrate:
The following sequence represents the sense strand (5′-3′) coding for a fusion protein comprising: the c-myc tag (underlined), a generic substrate recognized by the serine/threonine kinases (in bold) and the FLAG tag (dotted underlining), flanked in position 5′ by part of the restriction site of BamH1 and in position 3′ by part of the restriction site of Xho1:
ACGCTGAGCTTCGCAGAGCCTGGC
GTA
The double-strand oligonucleotide is obtained by hybridizing the following two oligomers:
and by carrying out a PCR reaction with the programme: 95° C. for 10 min/90° C., 5 min/85° C., 5 min/80° C. 15 min/75° C. 60 min/70° C. 15 min/65° C. 10 min/60° C. 5 min/55° C., 5 min/50 min/45° C. 5 min/35° C. 10 min/25° C. 15 min/15° C. 5 min/4° C. The sequence is inserted into the pSEMS plasmid (from Covalys) by mixing 1 μl of Quick T4 DNA ligase (New England Biolabs Cat No M2200S), 1 μl of hybridized oligonucleotides and 50 ng of plasmid previously digested with the restriction enzymes BamH1 and Xho1 for 10 min at ambient temperature.
The plasmid is then incubated with One Shot® TOP10 competent cells (Invitrogen Corp. Cat No C4040-06) for 1 hour at 37° C. then the cells are plated on plates containing ampicillin.
After 1 night at 37° C., 6 colonies are selected, amplified and their identity is confirmed by sequencing.
Transfection of the Cells:
80000 HEK293 cells (ECACC) are either co-transfected with 31.25 ng of plasmid coding for the substrate and 250 ng Akt1-pcDNA 3.1 (Invitrogen Corp. Cat No V790-20) or by 280 ng of empty pcDNA3.1 plasmid (Invitrogen Corp. Cat No V790-20). The co-transfection is carried out in the presence of Lipofectamine 2000 (Invitrogen corp. Cat No 11668-019) and OPTI-MEM medium (Gibco Cat No 31985).
The cells are then cultured for 24 h at 37° C. in 100 μl of DMEM medium (Gibco Cat No 11965-092), to which are added 10% FCS (Hyclone Cat No SV30014-03) and 1% antibiotic and antifungal (Gibco Cat No 15240-062) in 96-well assay plates (Cellstar black).
The cells are lysed in 50 mM Hepes buffer, pH 7, containing 0.1% BSA, 0.4 M potassium fluoride, 1 mM de DTT, 1% triton X100, 20 mM EDTA, 1× ser/thre phosphatase inhibitors (sigma) under 50 μl after aspiration of the 150 μl transfection medium. In a 50 mM Hepes buffer pH 7.2 containing 0.1% BSA, 0.4M potassium fluoride, 1 mM DTT the following are added (under 50 μL) 5.4 ng phosphospecific antibodies (STK antibody, Upstate Cat No 35-002) conjugated with the donor (europium cryptate) and 60 ng anti-FLAG conjugated with the acceptor (cross-linked allophycocyanin XL 665, CIS bio international Cat No 61FG2XLA) or increasing quantities (3.12 nM to 100 nM) of benzylguanine BG conjugated with the acceptor BG-Dy647 (Dyomics) to measure the level of phosphorylation.
This same buffer contains 5.4 ng anti-c myc antibody (Cisbio CIS bio international Cat No 61MYCKLA) conjugated with the donor (europium cryptate) and 60 ng anti-FLAG conjugated with the acceptor (cross-linked allophycocyanin, XL 665, CIS bio international Cat No 61FG2XLA) or increasing quantities (3.12 nM to 100 nM) of benzylguanine BG conjugated with the acceptor BG-Dy647 (Dyomics GmbH) to measure the level of expression of the substrate.
The plate is incubated for up to 20 h at ambient temperature before time-resolved reading.
Analysis of the TR-FRET Signal:
The FRET signals are measured on a Rubystar at 620 nm (emission wavelength of rare earth cryptate) and 665 nm (emission wavelength of allophycocyanin and DY647) after excitation by a laser at 330 nm. The ratio between the fluorescence emitted at 665 nm (fluorescence of the acceptor) and the fluorescence emitted at 620 nm (fluorescence of the donor) (Ratio 665/620) is representative of the FRET occurring between the donor (europium cryptate) and the acceptor (Allophycocyanin Dy647). This FRET is proportional to the spatial proximity between the donor and the acceptor.
The delta F (%) (DF) corresponds to:
The negative control signal corresponds to the signal obtained with the cells transfected by an empty pcDNA3.1 plasmid.
Results
The cells are transfected with the empty plasmid pcDNA3.1 or co-transfected by the plasmids coding for the substrate and the Akt kinase. After lysis of the cells, the level of expression and the phosphorylation of the substrate are detected by using:
The results obtained confirm that
This example demonstrates that the labelling of the substrate (whether or not it has undergone a post-translational modification) can be carried out equally well with tag/anti-tag systems or by suicide enzymes of the Snaptag type.
Filing Document | Filing Date | Country | Kind | 371c Date |
---|---|---|---|---|
PCT/IB07/04341 | 11/27/2007 | WO | 00 | 5/26/2009 |
Number | Date | Country | |
---|---|---|---|
60861085 | Nov 2006 | US |