METHOD FOR THE RECOMBINANT PRODUCTION OF 1,3-PROPANEDIOL

FIELD OF INVENTION

[0002] The present invention relates to the field of molecular biology and specifically to improved methods for the production of 1,3-propanediol in host cells. In particular, the present invention describes components of gene clusters associated with 1,3-propanediol production in host cells, including protein X, and protein 1, protein 2 and protein 3. More specifically the present invention describes the expression of cloned genes encoding protein X, protein 1, protein 2 and protein 3, either separately or together, for the enhanced production of 1,3-propanediol in host cells.

BACKGROUND

[0003] 1,3-Propanediol is a monomer having potential utility in the production of polyester fibers and the manufacture of polyurethanes and cyclic compounds.

[0004] A variety of chemical routes to 1,3-propanediol are known. For example ethylene oxide may be converted to 1,3-propanediol over a catalyst in the presence of phosphine, water, carbon monoxide, hydrogen and an acid, by the catalytic solution phase hydration of acrolein followed by reduction, or from hydrocarbons such as glycerol, reacted in the presence of carbon monoxide and hydrogen over catalysts having atoms from group VIII of the periodic table. Although it is possible to generate 1,3-propanediol by these methods, they are expensive and generate waste streams containing environmental pollutants.

[0005] It has been known for over a century that 1,3-propanediol can be produced from the fermentation of glycerol. Bacterial strains able to produce 1,3-propanediol have been found, for example, in the groups Citrobacter, Clostridium, Enterobacter, ilyobacter, Klebsiella, Lactobacillus, and Pelobacter. In each case studied, glycerol is converted to 1,3-propanediol in a two step, enzyme catalyzed reaction sequence. In the first step, a dehydratase catalyzes the conversion of glycerol to 3-hydroxypropionaldehyde (3-HP) and water (Equation 1). In the second step, 3-HP is reduced to 1,3-propanediol by a NAD+-linked oxidoreductase (Equation 2).

Glycerol®3-HP+H2O (Equation 1)

3-HP+NADH+H+®1,3-Propanediol+NAD+ (Equation 2)

[0006] The 1,3-propanediol is not metabolized further and, as a result, accumulates in high concentration in the media. The overall reaction consumes a reducing equivalent in the form of a cofactor, reduced b-nicotinamide adenine dinucleotide (NADH), which is oxidized to nicotinamide adenine dinucleotide (NAD+).

[0007] The production of 1,3-propanediol from glycerol is generally performed under anaerobic conditions using glycerol as the sole carbon source and in the absence of other exogenous reducing equivalent acceptors. Under these conditions, in for example, strains of Citrobacter, Clostridium, and Kiebsiella, a parallel pathway for glycerol operates which first involves oxidation of glycerol to dihydroxyacetone (DHA) by a NAD+-(or NADP+-) linked glycerol dehydrogenase (Equation 3). The DHA, following phosphorylation to dihydroxyacetone phosphate (DHAP) by a DHA kinase (Equation 4), becomes available for biosynthesis and for supporting ATP generation via, for example, glycolysis.

Glycerol+NAD+®DHA+NADH+H+ (Equation 3)

DHA+ATP)®DHAP+ADP (Equation 4)

[0008] In contrast to the 1,3-propanediol pathway, this pathway may provide carbon and energy to the cell and produces rather than consumes NADH.

[0009] In Klebsiella pneumoniae and Citrobacter freundii, the genes encoding the functionally linked activities of glycerol dehydratase (dhaB), 1,3-propanediol oxidoreductase (dha T), glycerol dehydrogenase (dhaD), and dihydroxyacetone kinase (dhaK) are encompassed by the dha regulon. The dha regulons from Citrobacter and Kiebsiella have been expressed in Eschelichia coli and have been shown to convert glycerol to 1,3-propanediol. Glycerol dehydratase (E.C. 4.2.1.30) and diol [1,2-propanediol] dehydratase (E.C. 4.2.1.28) are related but distinct enzymes that are encoded by distinct genes. In Salmonella typhimurium and Klebsiella pneumoniae, diol dehydratase is associated with the pdu operon, see Bobik et al., 1992, J. Bacteriol. 174:2253-2266 and U.S. Pat. No. 5,633,362. Tobimatsu, et al., 1996, J. Biol. Chem. 271: 22352-22357 disclose the K. pneumoniae gene encoding glycerol dehydratase protein X identified as ORF 4; Segfried et al., 1996, J. Bacteriol. 178: 5793-5796 disclose the C. freundii glycerol dehydratase gene encoding protein X identified as ORF Z. Tobimatsu et al., 1995, J. Biol. Chem. 270:7142-7148 disclose the diol dehydratase submits α, β and γ and illustrate the presence of orf 4. Luers (1997, FEMS Microbiology Letters 154:337-345) disclose the amino acid sequence of protein 1, protein 2 and protein 3 of Clostridium pasteurianum.

[0010] Biological processes for the preparation of glycerol are known. The overwhelming majority of glycerol producers are yeasts, but some bacteria, other fungi and algae are also known to produce glycerol. Both bacteria and yeasts produce glycerol by converting glucose or other carbohydrates through the fructose-1,6-bisphosphate pathway in glycolysis or by the Embden Meyerhof Parnas pathway, whereas, certain algae convert dissolved carbon dioxide or bicarbonate in the chloroplasts into the 3-carbon intermediates of the Calvin cycle. In a series of steps, the 3-carbon intermediate, phosphoglyceric acid, is converted to glyceraldehyde 3-phosphate which can be readily interconverted to its keto isomer dihydroxyacetone phosphate and ultimately to glycerol.

[0011] Specifically, the bacteria Bacillus licheniformis and Lactobacillus lycopersica synthesize glycerol, and glycerol production is found in the halotolerant algae Dunaliella sp. and Asteromonas gracilis for protection against high external salt concentrations (Ben-Amotz et al., Experientia 38, 49-52, (1982)). Similarly, various osmotolerant yeasts synthesize glycerol as a protective measure. Most strains of Saccharomyces produce some glycerol during alcoholic fermentation, and this can be increased physiologically by the application of osmotic stress (Albertyn et al., Mol. Cell. Biol. 14, 4135-4144, (1994)). Earlier this century commercial glycerol production was achieved by the use of Saccharomyces cultures to which “steering reagents” were added such as sulfites or alkalis. Through the formation of an inactive complex, the steering agents block or inhibit the conversion of acetaldehyde to ethanol; thus, excess reducing equivalents (NADH) are available to or “steered” towards DHAP for reduction to produce glycerol. This method is limited by the partial inhibition of yeast growth that is due to the sulfites. This limitation can be partially overcome by the use of alkalis which create excess NADH equivalents by a different mechanism. In this practice, the alkalis initiated a Cannizarro disproportionation to yield ethanol and acetic acid from two equivalents of acetaldehyde.

[0012] The gene encoding glycerol-3-phosphate dehydrogenase (DARI, GPD1) has been cloned and sequenced from S. diastaticus (Wang et al., J. Bact. 176, 7091-7095, (1994)). The DAR1 gene was cloned into a shuttle vector and used to transform E. coli where expression produced active enzyme. Wang et al. (supra) recognize that DAR1 is regulated by the cellular osmotic environment but do not suggest how the gene might be used to enhance 1,3-propanediol production in a recombinant organism.

[0013] Other glycerol-3-phosphate dehydrogenase enzymes have been isolated: for example, sn-glycerol-3-phosphate dehydrogenase has been cloned and sequenced from S. cerevisiae (Larason et al., Mol. Microbiol. 10, 1101, (1993)) and Albertyn et al., (Mol. Cell. Biol. 14, 4135, (1994)) teach the cloning of GPD1 encoding a glycerol-3-phosphate dehydrogenase from S. cerevisiae. Like Wang et al. (supra), both Albertyn et al. and Larason et al. recognize the osmo-sensitivity of the regulation of this gene but do not suggest howthte gene might be used in the production of 1,3-propanediol in a recombinant organism.

[0014] As with G3PDH, glycerol-3-phosphatase has been isolated from Saccharomyces cerevisiae and the protein identified as being encoded by the GPP1 and GPP2 genes (Norbeck et al., J. BioL Chem. 271, 13875,(1996)). Like the genes encoding G3PDH, it appears that GPP2 is osmosensitive.

[0015] Although biological methods of both glycerol and 1,3-propanediol production are known, it has never been demonstrated that the entire process can be accomplished by a single recombinant organism.

[0016] Neither the chemical nor biological methods described above for the production of 1,3-propanediol are well suited for industrial scale production since the chemical processes are energy intensive and the biological processes require the expensive starting material, glycerol. A method requiring low energy input and an inexpensive starting material is needed. A more desirable process would incorporate a microorganism that would have the ability to convert basic carbon sources such as carbohydrates or sugars to the desired 1,3-propanediol end-product.

[0017] Although a single organism conversion of fermentable carbon source other than glycerol or dihydroxyacetone to 1,3-propanediol would be desirable, it has been documented that there are significant difficulties to overcome in such an endeavor. For example, Gottschalk et al. (EP 373 230) teach that the growth of most strains useful for the production of 1,3-propanediol, including Citrobacter freundii, Clostridium autobutylicum, Clostridium butylicum, and Klebsiella pneumoniae, is disturbed by the presence of a hydrogen donor such as fructose or glucose. Strains of Lactobacillus brevis and Lactobacillus buchner, which produce 1,3-propanediol in cofermentations of glycerol and fructose or glucose, do not grow when glycerol is provided as the sole carbon source, and, although it has been shown that resting cells can metabolize glucose or fructose, they do not produce 1,3-propanediol. (Veiga DA Cunha et al., J. Bacteriol. 174, 1013 (1992)). Similarly, it has been shown that a strain of Ilyobacter polytropus, which produces 1,3-propanediol when glycerol and acetate are provided, will not produce 1,3-propanediol from carbon substrates other than glycerol, including fructose and glucose. (Steib et al., Arch. Microbiol. 140, 139 (1984)). Finally Tong et al. (Appl. Biochem. Biotech. 34, 149 (1992)) has taught that recombinant Escherichia coli transformed with the dha regulon encoding glycerol dehydratase does not produce 1,3-propanediol from either glucose or xylose in the absence of exogenous glycerol.

[0018] Attempts to improve the yield of 1,3-propanediol from glycerol have been reported where co-substrates capable of providing reducing equivalents, typically fermentable sugars, are included in the process. Improvements in yield have been claimed for resting cells of Citrobacter freundii and Klebsiella pneumoniae DSM 4270 cofermenting glycerol and glucose (Gottschalk et al., supra., and Tran-Dinh et al., DE 3734 764); but not for growing cells of Klebsiella pneumoniae ATCC 25955 cofermenting glycerol and glucose, which produced no 1,3-propanediol (I-T. Tong, Ph.D. Thesis, University of Wisconsin-Madison (1992)). Increased yields have been reported for the cofermentation of glycerol and glucose or fructose by a recombinant Escherichia coli; however, no 1,3-propanediol is produced in the absence of glycerol (Tong et al., supra.). In these systems, single organisms use the carbohydrate as a source of generating NADH while providing energy and carbon for cell maintenance or growth, These disclosures suggest that sugars do not enter the carbon stream that produces 1,3-propanediol. In no case is 1,3-propanediol produced in the absence of an exogenous source of glycerol. Thus the weight of literature clearly suggests that the production of 1,3-propanediol from a carbohydrate source by a single organism is not possible.

[0019] The weight of literature regarding the role of protein X in 1,3-propanediol production by a host cell is at best confusing. Prior to the availability of gene information, McGee et al., 1982, Biochem. Biophys. Res. Comm. 108: 547-551, reported diol dehydratase from K. pneumoniae ATCC 8724 to be composed of four subunits identified by size (60K, 51K, 29K, and 15K daltons) and N-terminal amino acid sequence. In direct contrast to MeGee, Tobimatsu et al.1995, supra, report the cloning, sequencing and expression of diol dehydratase from the same organism and find no evidence linking the 51K dalton polypeptide to dehydrase. Tobimatsu et al.1996, supra, conclude that the protein X polypeptide is not a subunit of glycerol dehydratase, in contrast to GenBank Accession Number U30903 where protein X is described as a large subunit of glycerol dehydratase. Seyfried et al., supra, report that a deletion of 192 bp from the 3′ end of orfZ (protein X) had no effect on enzyme activity and conclude that orfZ does not encode a subunit required for dehydratase activity. Finally, Skraly, F.A. (1997, Thesis entitiled “Metabolic Engineering of an Improved 1,3-Propanediol Fermentation”) disclose a loss of glycerol dehydratase activity in one experiment where recombinant ORF3 (proteinX) was disrupted creating a large fusion protein but not in another experiment where 1,3-propanediol production from glycerol was diminished compared to a control where ORF3 was intact.

[0020] The problem to be solved by the present invention is the biological production of 1,3-propanediol by a single recombinant organism from an inexpensive carbon substrate such as glucose or other sugars in commercially feasible quantities. The biological production of 1,3-propanediol requires glycerol as a substrate for a two step sequential reaction in which a dehydratase enzyme (typically a coenzyme B12-dependent dehydratase) converts glycerol to an intermediate, 3-hydroxypropionaldehyde, which is then reduced to 1,3-propanediol by a NADH- (or NADPH) dependent oxidoreductase. The complexity of the cofactor requirements necessitates the use of a whole cell catalyst for an industrial process which utilizes this reaction sequence for the production of 1,3-propanediol. Furthermore, in order to make the process economically viable, a less expensive feedstock than glycerol or dihydroxyacetone is needed and high production levels are desirable. Glucose and other carbohydrates are suitable substrates, but, as discussed above, are known to interfere with 1,3-propanediol production. As a result no single organism has been shown to convert glucose to 1,3-propanediol.

[0021] Applicants have solved the stated problem and the present invention provides for bioconverting a fermentable carbon source directly to 1,3-propanediol using a single recombinant organism. Glucose is used as a model substrate and the bioconversion is applicable to any existing microorganism. Microorganisms harboring the genes encoding protein X and protein 1, protein 2 and protein 3 in addition to other proteins associated with the production of 1,3-propanediol, are able to convert glucose and other sugars through the glycerol degradation pathway to 1,3-propanediol with good yields and selectivities. Furthermore, the present invention may be generally applied to include any carbon substrate that is readily converted to 1) glycerol, 2) dihydroxyacetone, or 3) C3 compounds at the oxidation state of glycerol (e.g., glycerol 3-phosphate) or 4) C3 compounds at the oxidation state of dihydroxyacetone (e.g., dihydroxyacetone phosphate or glyceraldehyde 3-phosphate).

SUMMARY OF THE INVENTION

[0022] The present invention relates to improved methods for the production of 1,3-propanediol from a single microorganism. The present invention is based, in part, upon the unexpected discovery that the presence of a gene encoding protein X in a microorganism containing at least one gene encoding a dehydratase activity and capable of producing 1,3-propanediol is associated with the in vivo reactivation of dehydratase activity and increased production of 1,3-propanediol in the microorganism. The present invention is also based, in part, upon the unexpected discovery that the presence of a gene encoding protein X and at least one gene encoding a protein selected from the group consisting of protein 1, protein 2 and protein 3 in host cells containing at least one gene encoding a dehydratase activity and capable of producing 1,3-propanediol is associated with ifn vivo reactivation of the dehydratase activity and increased yields of 1,3-propanediol in the microorganism.

[0023] Accordingly, the present invention provides an improved method for the production of 1,3-propanediol from a microorganism capable of producing 1,3-propanediol, said microorganism comprising at least one gene encoding a dehydratase activity, the method comprising the steps of introducing a gene encoding protein X into the organism to create a transformed organism; and culturing the transformed organism in the presence of at least one carbon source capable of being converted to 1,3 propanediol in said transformed host organism and under conditions suitable for the production of 1,3 propanediol wherein the carbon source is selected from the group consisting of monosaccharides, oligosaccharides, polysaccharides, and a one carbon substrate.

[0024] In a preferred embodiment, the method for improved production of 1,3-propanediol further comprises introducing at least one gene encoding a protein selected from the group consisting of protein 1, protein 2 and protein 3 into the organism. The microorganism may further comprise at least one of (a) a gene encoding a glycerol-3-phosphate dehydrogenase activity; (b) a gene encoding a glycerol-3-phosphatase activity; and (c) a gene encoding 1,3-propanediol oxidoreductase activity into the microorganism. Gene(s) encoding a dehydratase activity, protein X, proteins 1, 2 or 3 or other genes necessary for the production of 1,3-propanediol may be stably maintained in the host cell genome or may be on replicating plasmids residing in the host microorganism.

[0025] The method optionally comprises the step of recovering the 1,3 propanediol. In one aspect of the present invention, the carbon source is glucose.

[0026] The microorganism is selected from the group of genera consisting of Cifrobacter, Enterobacter, Clostridium, Klebsiella, Aerobacter, Lactobacillus, Aspergillus, Saccharomyces, Schizosaccharomyces, Zygosaccharomyces, Pichia, Kluyveromyces, Candida, Hansenula, Debaryomyces, Mucor, Torulopsis, Methylobacter, Escherichia, Salmonella, Bacillus, Streptomyces and Pseudomonas.

[0027] In one aspect, protein X is derived from a glyceol dehydratase gene cluster and in another aspect, protein X is derived from a diol dehydratase gene cluster. The gene encoding the dehydratase activity may be homologous to the microorganism or heterologous to the microorganism. In one embodiment, the glycerol dehydratase gene cluster is derived from an organism selected from the genera consisting of Klebsiella and Citrobactor. In another embodiment, the diol dehydratase gene cluster is derived from an organism selected from the genera consisting of Klebsiella, Clostridium and Salmonella.

[0028] In another aspect, the present invention provides a recombinant microorganism comprising at least one gene encoding a dehydratase activity; at least one gene encoding a glycerol-3-phosphatase; and at least one gene encoding protein X, wherein said microorganism is capable of producing 1,3-propanediol from a carbon source. The carbon source may be selected from the group consisting of monosaccharides, oligosaccharides, polysaccharides, and a one carbon substrate. In a further embodiment, the microorganism further comprises a gene encoding a cytosolic glycerol-3-phosphate dehydrogenase. In another embodiment, the recombinant microorganism further comprises at least one gene encoding a protein selected from the group consisting of protein 1, protein 2 and protein 3. The microorganism is selected from the group consisting of Citrobacter, Enterobacter, Clostridium, Klebsiella, Aerobacter, Lactobacillus, Aspergillus, Saccharomyces, Schizosaccharomyces, Zygosaccharomyces, Pichia, Kluyveromyces, Candida, Hansenula, Debaryomyces, Mucor, Torulopsis, Methylobacter, Escherichia, Salmonella, Bacillus, Streptomyces and Pseudomonas. In one aspect, protein X is derived from a glycerol dehydratase gene cluster. In another aspect, proteinX is.derived from a diol dehydratase gene cluster. In one aspect, the dehydratase activity is heterologous to said microorganism and in another aspect, the dehydratase activity is homologous to said microorganism.

[0029] The present invention also provides a method for the in vivo reactivation of a dehydratase activity in a microorganism capable of producing 1,3-propanedioi and containing at least one gene encoding a dehydratase activity, comprising the step of introducing a gene encoding protein X into said microorganism. The microorganism is selected from the group consisting of Citrobacter, Enterobacter, Clostridium, Klebsielia, Aerobacter, Lactobacilus, Aspergillus, Saccharomyces, Schizosaccharomyces, Zygosaccharomyces, Pichia, Kluyveromyces, Candida, Hansenula, Debaryomyces, Mucor, Torulopsis, Methylobacter, Escherichia, Salmonella, Bacillus, Streptomyces and Pseudomonas.

[0030] In one aspect, the gene encoding the dehydratase activity is heterologous to said microorganism and in another aspect, the gene encoding the dehydratase activity is homologous to said microorganism. In one embodiment, the gene encoding protein X is derived from a glycerol dehydratase gene cluster and in another embodiment, the gene encoding protein X is derived from a diol dehydratase gene cluster.

[0031] The present invention also provides expression vectors and host cells containing genes encoding protein X, protein 1, protein 2 and protein 3.

[0032] One advantage of the method of production of 1,3-propanediol according to the present invention is the unexpected increased production of 1,3-propanediol in a host cell capable of producing 1,3-propanediol in the presence of nucleic acid encoding protein X as compared to the host cell lacking nucleic acid encoding protein X. As demonstrated infra, a host cell containing nucleic acid encoding dhaB 1, 2 and 3 and protein X is able to produce significanty more 1,3-propanediol than a host cell containing nucleic acid encoding dhaB 1, 2 and 3 and lacking X.

[0033] Another advantage of the present invention as demonstrated infra, is that the presence of nucleic acid encoding protein X along with nucleic acid encoding at least one of protein 1, protein 2 and protein 3 in a host cell capable of producing 1,3-propanediol gives the unexpected result of increased production of 1,3-propanediol in the host cell over 1,3-propanediol production in the host cell lacing nucleic acid encoding protein X along with nucleic acid encoding at least one of protein 1, protein 2 and protein 3.

[0034] Yet another advantage of the method of production of the present invention as shown infra is the in vivo reactivation of the dehydratase activity in a microorganism that is associated with the presence of nucleic acid encoding protein X in the microorganism.

BRIEF DESCRIPTION OF THE DRAWINGS

[0035]
FIG. 1 illustrates components of the glycerol dehydratase gene, cluster from Klebsiella pneumoniae on plasmid pHK28-26 (SEQ ID NO:19). In this figure, orfY encodes protein 1, orfX encodes protein 2 and orfW encodes protein 3. DhaB-X refers to protein X.

[0036] FIGS. 2A-2G illustrates the nucleotide and amino acid sequence of Klebsiella pneumoniae glycerol dehydratase protein X (dhab4) (SEQ ID NO:59).

[0037]
FIG. 3 illustrates the amino acid alignment of Klebsielia pneumonia protein 1 (SEQ ID NO: 61) and Citrobacter freundi protein 1 (SEQ ID NO: 60) (designated in FIG. 3 as orfY).

[0038]
FIG. 4 illustrates the amino acid alignment of Klebsiella pneumonia protein 2 (SEQ ID NO: 63) and Citrobacter freundii protein 2 (SEQ ID NO: 62) (designated in FIG. 4 as orfX).

[0039]
FIG. 5 illustrates the amino acid alignment of Klebsiella pneumonia protein 3 (SEQ ID NO: 64) and Citrobacter freundii protein 3 (SEQ ID NO: 65) (designated in FIG. 5 as orfW).

[0040]
FIG. 6 illustrates the in situ reactivation comparison of plasmids pHK(28-26 (which contains dhab subunits 1, 2 and 3 as well as protein X and the open reading frames encoding protein 1, protein 2 and protein 3) vs. pDT24 (which contains dhab subunits 1, 2 and 3 as well as protein X) in E. coli DH5α cells.

[0041]
FIG. 7 illustrate the in situ reactivation comparison of plasmids pM7 (containing genes encoding dhaB subunits 1, 2 and 3 and protein X) vs. Plasmid pM11 (containing genes encoding dhab subunits 1, 2 and 3) in E. coli DH5α cells.

[0042] FIGS. 8A-8E illustrates the nucleic acid (SEQ ID NO: 66) and amino acid (SEQ ID NO: 67) sequence of K. pneumoniae diol dehydratase gene cluster protein X.

[0043]
FIG. 9 illustrates a standard 10 liter fermentation for 1,3 propandiol production using E. coli FM5/pDT24 (FM5 described in Amgen patent U.S. Pat. No. 5,494,816 , ATCC accession No. 5391 1).

[0044]
FIG. 10 illustrates a standard 10 liter fermentation for 1,3 propandiol production using E. coli DH5alpha/pHK28-26.

BRIEF DESCRIPTION OF BIOLOGICAL DEPOSITS AND SEQUENCE LISTING

[0045] The transformed E. coli W2042 (comprising the E. coli host W1485 and plasmids pDT20 and pAH42) containing the genes encoding glycerol-3-phosphate dehydrogenase (G3PDH) and glycerol-3-phosphatase (G3P phosphatase), glycerol dehydratase (dhaB), and 1,3-propanediol oxidoreductase (dha T) was deposited on 26 Sep. 26, 1996 with the ATCC under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for the Purpose of Patent Procedure and is designated as ATCC 98188.

[0046]

S. cerevisiae
YPH500 harboring plasmids pMCK10, pMCK17 17, pMCK30 and pMCK35 containing genes encoding glycerol-3-phosphate dehydrogenase (G3PDH) and glycerol-3-phosphatase (G3P phosphatase), glycerol dehydratase (dhaB), and 1,3-propanediol oxidoreductase (dha T) was deposited on Sep. 26, 1996 with the ATCC under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for the Purpose of Patent Procedure and is designated as ATCC 74392.

[0047]

E. coli
DH5α containing pKP1 which has about 35 kb of a Klebsiella genome which contains the glycerol dehydratase, protein X and proteins 1, 2 and 3 was deposited on I18 April 1995 with the ATCC under the terms of the Budapest Treaty and was designated ATCC 69789. E. coli DH5(X containing pKP4 containing a portion of the Klebsiella genome encoding diol dehydratase enzyme, including protein X was deposited on Apr. 18, 1995 with the ATCC under the terms of the Budapest Treaty and was designated ATCC 69790.

[0048] “ATCC” refers to the American Type Culture Collection international depository located at 12301 Parklawn Drive, Rockville, Md. 20852 U.S.A. The designations refer to the accession number of the deposited material.

DETAILED DESCRIPTION OF THE INVENTION

[0049] The present invention relates to the production of 1,3-propanediol in a single microorganism and provides improved methods for production of 1,3-propanediol from a fermentable carbon source in a single recombinant organism. The method incorporates a microorganism capable of producing 1,3-propanediol comprising either homologous or heterologous genes encoding dehydratase (dhaB), at least one gene encoding protein X and optionally at least one of the genes encoding a protein selected from the group consisting of protein 1, protein 2 and protein 3. Optionally, the microorganism contains at least one gene encoding glycerol-3-phosphate dehydrogenase, glycerol-3-phosphatase and 1, 3-propanediol oxidoreductase (dha T). The recombinant microorganism is contacted with a carbon substrate and 1,3-propanediol is isolated from the growth media.

[0050] The present method provides a rapid, inexpensive and environmentally responsible source of 1,3-propanediol monomer useful in the production of polyesters and other polymers.

[0051] The following definitions are to be used to interpret the claims and specification.

[0052] The term “dehydratase gene cluster” or “gene cluster” refers to the set of genes which are associated with 1,3-propanediol production in a host cell and is intended to encompass glycerol dehydratase gene clusters as well as diol dehydratase gene clusters. The dha regulon refers to a glycerol dehydratase gene cluster, as illustrated in FIG. 1 which includes regulatory regions.

[0053] The term “regenerating the dehydratase activity” or “reactivating the dehydratase activity” refers to the phenomenon of converting a dehydratase not capable of catalysis of a substrate to one capable of catalysis of a substrate or to the phenomenon of inhibiting the inactivation of a dehydratase or the phenomenon of extending the useful halflife of the dehydratase enzyme in vivo.

[0054] The terms “glycerol dehydratase” or “dehydratase enzyme” or “dehydratase activity” refer to the polypeptide(s) responsible for an enzyme activity that is capable of isomerizing or converting a glycerol molecule to the product 3-hydroxypropionaldehyde. For the purposes of the present invention the dehydratase enzymes include a glycerol dehydratase (GenBank U09771, U30903) and a diol dehydratase (GenBank D45071) having preferred substrates of glycerol and 1,2-propanediol, respectively. Glycerol dehydratase of K. pneumoniae ATCC 25955 is encoded by the genes dhaB1, dhaB2, and dhaB3 identified as SEQ ID NOS:1, 2 and 3, respectively. The dhaB1, dhaB2, and dhaB3 genes code for the a, b, and c subunits of the glycerol dehydratase enzyme, respectively.

[0055] The phrase “protein X of a dehydratase gene cluster” or “dhaB protein X” or “protein X” refers to a protein that is comparable to protein X of the Klebsiella pneumoniae dehydratase gene cluster as shown in FIG. 2 or alternatively comparable to protein X of Klebsiella pneumoniae diol dehydratase gene cluster as shown in FIG. 8. Preferably protein X is capable of increasing the production of 1,3-propanediol in a host organism over the production of 1,3-propanediol in the absence of protein X in the host organism. Being comparable means that DNA encoding the protein is either in the same structural location as DNA encoding Klebsiella protein X with respect to Klebsiella dhaB1, dhaB2 and dhaB3, i.e., DNA encoding protein X is 3′ to nucleic acid encoding dhaB1-B3, or that protein X has overall amino acid similarity to either Klebsiella diol or glycerol dehydratase protein X. The present invention encompasses protein X molecules having at least 50%; or at least 65%; or at least 80%; or at least 90% or at least 95% similarity to the protein X of K. pneumoniae glycerol or diol dehydratase or the C. freundii protein X.

[0056] Included within the term “protein X” is protein X, also referred to as ORF Z, from Citrobacter dha regulon (Segfried M. 1996, J. Bacteriol. 178: 5793:5796). The present invention also encompasses amino acid variations of protein X from any microorganism as long as the protein X variant retains its essential functional characteristics of increasing the production of 1,3-propanediol in a host organism over the production of 1,3-propanediol in the host organism in the absence of protein X.

[0057] A portion of the Klebsiella genome encoding the glycerol dehydratase enzyme activity as well as protein X was transformed into E. coli and the transformed E. coli was deposited on Apr. 18, 1995 with the ATCC under the terms of the Budapest Treaty and was designated as ATCC accession number 69789. A portion of the Klebsiella genome encoding the diol dehydratase enzyme activity as well as protein X was transformed into E. coli and the transformed E. coli was deposited on Apr. 18, 1995 with the ATCC under the terms of the Budapest Treaty and was designated as ATCC accession number 69790.

[0058] Klebsiella glycerol dehydratase protein X is found at bases 9749-11572 of SEQ ID NO:19, counting the first base of dhaK as position number 1. Citrobacter freundii (ATCC accession number CFU09771) nucleic acid encoding protein X is found between positions 11261 and 13072.

[0059] The present invention encompasses genes encoding dehydratase protein X that are recombinantly introduced and replicate on a plasmid in the host organism as well as genes that are stably maintained in the host genome. The present invention encompasses a method for enhanced production of 1,3-propanediol wherein the gene encoding protein X is transformed in a host cell together with genes encoding the dehydratase activity and/or other genes necessary for the production of 1,3-propanediol. The gene encoding protein X, dehydratase activity and/or other genes may be on the same or different expression cassettes. Alternatively, the gene encoding protein X may be transformed separately, either before or after genes encoding the dehydratase activity and/or other activities. The present invention encompasses host cell having endogenous nucleic acid encoding protein X as well as host cell lacking endogenous nucleic acid encoding protein X.

[0060] The terms “protein 1”, protein 2” and “protein 3” refer to the proteins encoded in a microorganism that are comparable to protein 1 (SEQ ID NO: 60 or SEQ ID NO: 61)(also referred to as orfY), protein 2 (SEQ ID NO: 62 or SEQ ID NO: 63) (also referred to as orfX) and protein 3 (SEQ ID NO: 64 or SEQ ID NO: 65) (also referred to as orfW), respectively.

[0061] Preferably, in the presence of protein X, at least one of proteins 1, 2 and 3 is capable of increasing the production of 1,3-propanediol in a host organism over the production of 1,3-propanediol in the absence of protein X and at least one of proteins 1, 2 and 3 in the host organism. Being comparable means that DNA encoding the protein is either in the same structural location as DNA encoding the respective proteins, as shown in FIG. 1, or that the respective proteins have overall amino acid similarity to the respective SEQ ID NOS shown in FIGS. 3, 4 and 5.

[0062] The present invention encompasses protein 1 molecules having at least 50%; or at least 65%; or at least 80%; or at least 90% or at least 95% similarity to SEQ ID NO: 60 or SEQ ID NO: 61. The present invention encompasses protein 2 molecules having at least 50%; or at least 65%; or at least 80%; or at least 90% or at least 95% similarity to SEQ ID NO: 62 or SEQ ID NO: 63. The present invention encompasses protein 3 molecules having at least 50%; or at least 65%; or at least 80%; or at least 90% or at least 95% similarity to SEQ ID NO: 64 or SEQ ID NO: 65.

[0063] Included within the terms “protein 1”, “protein 2” and “protein 3”, respectively, are orfY, orfX and orfW from Clostridium pasteurianum (Luers, et al., supra) as well as molecules having at least 50%; or at least 65%; or at least 80%; or at least 90% or at least 95% similarity to C. pasterudanum orfY, orfX or orfW. The present invention also encompasses amino acid variations of proteins 1, 2 and 3 from any microorganism as long as the protein variant, in combination with protein X, retains its essential functional characteristics of increasing the production of 1,3-propanediol in a host organism over the production of 1,3-propanediol in the host organism in their absence.

[0064] The present invention encompasses a method for enhanced production of 1,3-propanediol wherein the gene(s) encoding at least one of protein 1, protein 2 and protein 3 is transformed in a host cell together with genes encoding protein X, the dehydratase activity and/or other genes necessary for the production of 1,3-propanediol. The gene(s) encoding at least on of proteins 1, 2 and 3, protein X, dehydratase activity and/or other genes may be on the same or different expression cassettes. Alternatively, the gene(s) encoding at least one of proteins 1, 2 and 3 may be transformed separately, either before or after genes encoding the dehydratase activity and/or other activities. The present invention encompasses host cell having endogenous nucleic acid encoding protein 1, protein 2 or protein 3 as well as host cell lacking endogenous nucleic acid encoding the proteins.

[0065] The terms “oxidoreductase” or “1,3-propanediol oxidoreductase” refer to the polypeptide(s) responsible for an enzyme activity that is capable of catalyzing the reduction of 3-hydroxypropionaldehyde to 1,3-propanediol, 1,3-Propanediol oxidoreductase includes, for example, the polypeptide encoded by the dha T gene (GenBank U09771, U30903) and is identified as SEQ ID NO:4.

[0066] The terms “glycerol-3-phosphate dehydrogenase” or “G3PDH” refer to the polypeptide(s) responsible for an enzyme activity capable of catalyzing the conversion of dihydroxyacetone phosphate (DHAP) to glycerol-3-phosphate (G3P). In vivo G3PDH may be NADH-, NADPH-, or FAD-dependent. Examples of this enzyme activity include the following: NADH-dependent enzymes (EC 1.1.1.8) are encoded by several genes including GPD1 (GenBank Z74071x2) or GPD2 (GenBank Z35169x1) or GPD3 (GenBank G984182) or DAR1 (GenBank Z74071x2); a NADPH-dependent enzyme (EC 1.1.1.94) is encoded by gpsA (GenBank U32164, G466746 (cds 197911-196892), and L45246); and FAD-dependent enzymes (EC 1.1.99.5) are encoded by GUT2 (GenBank Z47047x23) or glpD (GenBank G147838) or glpABC (GenBank M20938).

[0067] The terms “glycerol-3-phosphatase” or “sn-glycerol-3-phosphatase” or “d,l-glycerol phosphatase” or “G3P phosphatase” refer to the polypeptide(s) responsible for an enzyme activity that is capable of catalyzing the conversion of glycerol-3-phosphate to glycerol. G3P phosphatase includes, for example, the polypeptides encoded by GPP1 (GenBank Z47047x125) or GPP2 (GenBank U18813x11).

[0068] The term “glycerol kinase” refers to the polypeptide(s) responsible for an enzyme activity capable of catalyzing the conversion of glycerol to glycerol-3-phosphate or glycerol-3-phosphate to glycerol, depending on reaction conditions. Glycerol kinase includes, for example, the polypeptide encoded by GUT1 (GenBank U11583x19).

[0069] The terms “GPD1”, “DAR1”, “OSG1”, “D2830”, and “YDL022W” will be used interchangeably and refer to a gene that encodes a cytosolic glycerol-3-phosphate dehydrogenase and characterized by the base sequence given as SEQ. ID. NO:5.

[0070] The term “GPD2” refers to a gene that encodes a cytosolic glycerol-3-phosphate dehydrogenase and characterized by the base sequence given as SEQ ID NO:6.

[0071] The terms “GUT2” and “YIL155C” are used interchangably and refer to a gene that encodes a mitochondrial glycerol-3-phosphate dehydrogenase and characterized by the base sequence given in SEQ ID NO:7.

[0072] The terms “GPP1”, “RHR2” and “YIL053W” are used interchangably and refer to a gene that encodes a cytosolic glycerol-3-phosphatase and characterized by the base sequence given as SEQ ID NO:8.

[0073] The terms “GPP2”, “HOR2” and “YER062C” are used interchangably and refer to a gene that encodes a cytosolic glycerol-3-phosphatase and characterized by the base sequence given as SEQ ID NO:9.

[0074] The term “GUT1” refers to a gene that encodes a cytosolic glycerol kinase and characterized by the base sequence given as SEQ ID NO:10.

[0075] The terms “function” or “enzyme function” refer to the catalytic activity of an enzyme in altering the energy required to perform a specific chemical reaction. It is understood that such an activity may apply to a reaction in equilibrium where the production of either product or substrate may be accomplished under suitable conditions.

[0076] The terms “polypeptide” and “protein” are used interchangeably.

[0077] The terms “carbon substrate” and “carbon source” refer to a carbon source capable of being metabolized by host organisms of the present invention and particularly carbon sources selected from the group consisting of monosaccharides, oligosaccharides, polysaccharides, and one-carbon substrates or mixtures thereof.

[0078] The terms “host cell” or “host organism” refer to a microorganism capable of receiving foreign or heterologous genes and of expressing those genes to produce an active gene product.

[0079] The terms “foreign gene”, “foreign DNA”, “heterologous gene” and “heterologous DNA” refer to genetic material native to one organism that has been placed within a host organism by various means. The gene of interest may be a naturally occurring gene, a mutated gene or a synthetic gene.

[0080] The terms “recombinant organism” and “transformed host” refer to any organism having been transformed with heterologous or foreign genes or extra copies of homolgous genes. The recombinant organisms of the present invention express foreign genes encoding glycerol-3-phosphate dehydrogenase (G3PDH) and glycerol-3-phosphatase (G3P phosphatase), glycerol dehydratase (dhaB), and 1,3-propanediol oxidoreductase (dha T) for the production of 1,3-propanediol from suitable carbon substrates.

[0081] “Gene” refers to a nucleic acid fragment that expresses a specific protein, including regulatory sequences preceding (5′ non-coding) and following (3′ non-coding) the coding region. The terms “native” and “wild-type” refer to a gene as found in nature with its own regulatory sequences.

[0082] The terms “encoding” and “coding” refer to the process by which a gene, through the mechanisms of transcription and translation, produces an amino acid sequence. It is understood that the process of encoding a specific amino acid sequence includes DNA sequences that may involve base changes that do not cause a change in the encoded amino acid, or which involve base changes which may alter one or more amino acids, but do not affect the functional properties of the protein encoded by the DNA sequence. It is therefore understood that the invention encompasses more than the specific exemplary sequences. Modifications to the sequence, such as deletions, insertions, or substitutions in the sequence which produce silent changes that do not substantially affect the functional properties of the resulting protein molecule are also contemplated. For example, alteration in the gene sequence which reflect the degeneracy of the genetic code, or which result in the production of a chemically equivalent amino acid at a given site, are contemplated. Thus, a codon for the amino acid alanine, a hydrophobic amino acid, may be substituted by a codon encoding another less hydrophobic residue, such as glycine, or a more hydrophobic residue, such as valine, leucine, or isoleucine. Similarly, changes which result in substitution of one negatively charged residue for another, such as aspartic acid for glutamic acid, or one positively charged residue for another, such as lysine for arginine, can also be expected to produce a biologically equivalent product. Nucleotide changes which result in alteration of the N-terminal and C-terminal portions of the protein molecule would also not be expected to alter the activity of the protein. In some cases, it may in fact be desirable to make mutants of the sequence in order to study the effect of alteration on the biological activity of the protein. Each of the proposed modifications is well within the routine skill in the art, as is determination of retention of biological activity in the encoded products. Moreover, the skilled artisan recognizes that sequences encompassed by this invention are also defined by their ability to hybridize, under stringent conditions (0.1X SSC, 0.1% SDS, 65° C.), with the sequences exemplified herein.

[0083] The term “expression” refers to the transcription and translation to gene product from a gene coding for the sequence of the gene product.

[0084] The terms “plasmid”, “vector”, and “cassette” refer to an extra chromosomal element often carrying genes which are not part of the central metabolism of the cell, and usually in the form of circular double-stranded DNA molecules. Such elements may be autonomously replicating sequences, genome integrating sequences, phage or nucleotide sequences, linear or circular, of a single- or double-stranded DNA or RNA, derived from any source, in which a number of nucleotide sequences have been joined or recombined into a unique construction which is capable of introducing a promoter fragment and DNA sequence for a selected gene product along with appropriate 3′ untranslated sequence into a cell. “Transformation cassette” refers to a specific vector containing a foreign gene and having elements in addition to the foreign gene that facilitate transformation of a particular host cell. “Expression cassette” refers to a specific vector containing a foreign gene and having elements in addition to the foreign gene that allow for enhanced expression of that gene in a foreign host.

[0085] The terms “transformation” and “transfection” refer to the acquisition of new genes in a cell after the incorporation of nucleic acid. The acquired genes may be integrated into chromosomal DNA or introduced as extrachromosomal replicating sequences. The term “transformant” refers to the product of a transformation.

[0086] The term “genetically altered” refers to the process of changing hereditary material by transformation or mutation.

[0087] The term “isolated” refers to a protein or DNA sequence that is removed from at least one component with which it is naturally associated.

[0088] The term “homologous” refers to a protein or polypeptide native or naturally occurring in a gram-positive host cell. The invention includes microorganisms producing the homologous protein via recombinant DNA technology.

CONSTRUCTION OF RECOMBINANT ORGANISMS

[0089] Recombinant organisms containing the necessary genes that will encode the enzymatic pathway for the conversion of a carbon substrate to 1,3-propanediol may be constructed using techniques well known in the art. As discussed in Example 9, genes encoding Klebsiella dhaB1, dhaB2, dhaB3 and protein X were used to transform E. coli DH5a and in Example 10, genes encoding at least one of Klebsiella proteins 1, 2 and 3 as well as at least one gene encoding protein X was used to transform E. coli.

[0090] Genes encoding glycerol-3-phosphate dehydrogenase (G3PDH), glycerol-3-phosphatase (G3P phosphatase), glycerol dehydratase (dhaB), and 1,3-propanediol oxidoreductase (dha T) were isolated from a native host such as Klebsiella or Saccharomyces and used to transform host strains such as E. coli DH5a, ECL707, AA200, or W1485; the Saccharomyces cerevisiae strain YPH500; or the Klebsiella pneumonfiae strains ATCC 25955 or ECL 2106.

Isolation of Genes

[0091] Methods of obtaining desired genes from a bacterial genome are common and well known in the art of molecular biology. For example, if the sequence of the gene is known, suitable genomic libraries may be created by restriction endonuclease, digestion and may be screened with probes complementary to the desired gene sequence. Once the sequence is isolated, the DNA may be amplified using standard primer directed amplification methods such as polymerase chain reaction (PCR) (U.S. Pat. No. 4,683,202) to obtain amounts of DNA suitable for transformation using appropriate vectors.

[0092] Alternatively, cosmid libraries may be created where large segments of genomic DNA (35-45 kb) may be packaged into vectors and used to transform appropriate hosts. Cosmid vectors are unique in being able to accommodate large quantities of DNA. Generally, cosmid vectors have at least one copy of the cos DNA sequence which is needed for packaging and subsequent circularization of the foreign DNA. In addition to the cos sequence these vectors will also contain an origin of replication such as ColEl and drug resistance markers such as a gene resistant to ampicillin or neomycin. Methods of using cosmid vectors for the transformation of suitable bacterial hosts are well described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbon, N.Y. (1989).

[0093] Typically to clone cosmids, foreign DNA is isolated and ligated, using the appropriate restriction endonucleases, adjacent to the cos region of the cosmid vector. Cosmid vectors containing the linearized foreign DNA is then reacted with a DNA packaging vehicle such as bacteriophage I. During the packaging process the cos sites are cleaved and the foreign DNA is packaged into the head portion of the bacterial viral particle. These particles are then used to transfect suitable host cells such as E. coli. Once injected into the cell, the foreign DNA circularizes under the influence of the cos sticky ends. In this manner large segments of foreign DNA can be introduced and expressed in recombinant host cells.

[0094] Isolation and cloning of genes encoding glycerol dehydratase (dhaB) and 1 3-propanediol oxido-reductase (dha T)

[0095] Cosmid vectors and cosmid transformation methods were used within the context of the present invention to clone large segments of genomic DNA from bacterial genera known to possess genes capable of processing glycerol to 1,3-propanediol. Specifically, genomic DNA from K. pneumoniae ATCC 25955 was isolated by methods well known in the art and digested with the restriction enzyme Sau3A for insertion into a cosmid vector Supercos 1 and packaged using GigapackII packaging extracts. Following construction of the vector E. coli XL1-Blue MR cells were transformed with the cosmid DNA. Transformants were screened for the ability to convert glycerol to 1,3-propanediol by growing the cells in the presence of glycerol and analyzing the media for 1,3-propanediol formation.

[0096] Two of the 1,3-propanediol positive transformants were analyzed and the cosmids were named pKP1 and pKP2. DNA sequencing revealed extensive homology to the glycerol dehydratase gene (dhaB) from C. freundii, demonstrating that these transformants contained DNA encoding the glycerol dehydratase gene. Other 1,3-propanediol positive transformants were analyzed and the cosmids were named pKP4 and pKP5. DNA sequencing revealed that these cosmids carried DNA encoding a diol dehydratase gene.

Isolation of Genes Encoding Protein X, Protein 1, Protein 2 and Protein 3

[0097] Although the instant invention utilizes the isolated genes from within a Klebsiella cosmid, alternate sources of dehydratase genes and protein X and protein 1, protein 2 and protein 3 include, but are not limited to, Citrobacter, Clostridia, and Salmonella. Tobimatsu, et al., 1996, J. Biol. Chem. 271: 22352-22357 disclose the K. pneumoniae glycerol dehydratase operon where protein X is identified as ORF 4; Segfried et al., 1996, J. Bacteriol. 178: 5793-5796 disclose the C. freundii glycerol dehydratase operon where protein X is identified as ORF Z. FIG. 8 discloses Klebsiella diol dehydratase protein X and FIGS. 3, 4 and 5 disclose amino acid sequences of proteins 1, 2 and 3 from Klebsiella and Citrobacter.

Genes Encoding G3PDH and G3P Phosphatase

[0098] The present invention provides genes suitable for the expression of G3PDH and G3P phosphatase activities in a host cell.

[0099] Genes encoding G3PDH are known. For example, GPD1 has been isolated from Saccharomyces and has the base sequence given by SEQ ID NO:5, encoding the amino acid sequence given in SEQ ID NO:11 (Wang et al., supra). Similarly, G3PDH activity is has also been isolated from Saccharomyces encoded by GPD2 having the base sequence given in SEQ ID NO:6, encoding the amino acid sequence given in SEQ ID NO:12 (Eriksson et al., Mol. Microbiol. 17, 95, (1995).

[0100] It is contemplated that any gene encoding a polypeptide responsible for G3PDH activity is suitable for the purposes of the present invention wherein that activity is capable of catalyzing the conversion of dihydroxyacetone phosphate (DHAP) to glycerol-3-phosphate (G3P). Further, it is contemplated that any gene encoding the amino acid sequence of G3PDH as given by any one of SEQ ID NOS:11, 12, 13, 14, 15 and 16 corresponding to the genes GPD1, GPD2, GUT2, gpsA, glpD, and the a subunit of glpABC, respectively, will be functional in the present invention wherein that amino acid sequence encompasses amino acid substitutions, deletions or additions that do not alter the function of the enzyme. It will be appreciated by the skilled person that genes encoding G3PDH isolated from other sources are also be suitable for use in the present invention. For example, genes isolated from prokaryotes include GenBank accessions M34393, M20938, L06231, U12567, L45246, L45323, L45324, L45325, U32164, and U39682; genes isolated from fungi include GenBank accessions U30625, U30876 and X56162; genes isolated from insects include GenBank accessions X61223 and X14179; and genes isolated from mammalian sources include GenBank accessions U12424, M25558 and X78593.

[0101] Genes encoding G3P phosphatase are known. For example, GPP2 has been isolated from Saccharomyces cerevisiae and has the base sequence given by SEQ ID NO:9 which encodes the amino acid sequence given in SEQ ID NO:17 (Norbeck et al., J. Biol. Chem. 271, p. 13875, 1996).

[0102] It is contemplated that any gene encoding a G3P phosphatase activity is suitable for the purposes of the present invention wherein that activity is capable of catalyzing the conversion of glycerol-3-phosphate to glycerol. Further, it is contemplated that any gene encoding the amino acid sequence of G3P phosphatase as given by SEQ ID NOS:33 and 17 will be functional in the present invention wherein that amino acid sequence encompasses amino acid substitutions, deletions or additions that do not alter the function of the enzyme. It will be appreciated by the skilled person that genes encoding G3P phosphatase isolated from other sources are also suitable for use in the present invention. For example, the dephosphorylation of glycerol-3-phosphate to yield glycerol may be achieved with one or more of the following general or specific phosphatases: alkaline phosphatase (EC 3.1.3.1) [GenBank M19159, M29663, U02550 or M33965]; acid phosphatase (EC 3.1.3.2) [GenBank U51210, U19789, U28658 or L20566]; glycerol-3-phosphatase (EC 3.1.3.-) [GenBank Z38060 or U18813x11]; glucose-1-phosphatase (EC 3.1.3.10) [GenBank M338071; glucose-6-phosphatase (EC 3.1.3.9) [GenBank U00445]; fructose-1,6-bisphosphatase (EC 3.1.3.11) [GenBank X12545 or J032071 or phosphotidyl glycero phosphate phosphatase (EC 3.1.3.27) [GenBank M23546 and M23628].

[0103] Genes encoding glycerol kinase are known. For example, GUT1 encoding the glycerol kinase from Saccharomyces has been isolated and sequenced (Paviik et al., Curr. Genet. 24, 21, (1993)) and the base sequence is given by SEQ ID NO:10 which encodes the amino acid sequence given in SEQ ID NO:18. It will be appreciated by the skilled artisan that although glycerol kinase catalyzes the degradation of glycerol in nature the same enzyme will be able to function in the synthesis of glycerol to convert glycerol-3-phosphate to glycerol under the appropriate reaction energy conditions. Evidence exists for glycerol production through a glycerol kinase. Under anaerobic or respiration-inhibited conditions, Trypanosoma brucei gives rise to glycerol in the presence of Glycerol-3-P and ADP. The reaction occurs in the glycosome compartment (D. Hammond, J. Biol. Chem. 260, 15646-15654, (1985)).

Host Cells

[0104] Suitable host cells for the recombinant production of 1,3-propanediol may be either prokaryotic or eukaryotic and will be limited only by the host cell ability to express active enzymes. Preferred hosts will be those typically useful for production of glycerol or 1,3-propanediol such as Citrobacter, Enterobacter, Clostridium, KJebsiella, Aerobacter, Lactobacilmus, Aspergillus, Saccharomyces, Schizosaccharomyces, Zygosaccharomyces, Pichia, Kluyveromyces, Candida, Hansenula, Debaryomyces, Mucor, Torulopsis, Methylobacter, Escherichia, Salmonella, Bacillus, Streptomyces and Pseudomonas. Most preferred in the present invention are E. coli, Kiebsiella species and Saccharomyces species.

[0105] Adenosyl-cobalamin (coenzyme B12) is an essential cofactor for glycerol dehydratase activity. The coenzyme is the most complex non-polymeric natural product known, and its synthesis in vivo is directed using the products of about 30 genes. Synthesis of coenzyme B12 is found in prokaryotes, some of which are able to synthesize the compound de novo, while others can perform partial reactions. E coli, for example, cannot fabricate the corrin ring structure, but is able to catalyze the conversion of cobinamide to corrinoid and can introduce the 5′-deoxyadenosyl group.

[0106] Eukaryotes are unable to synthesize coenzyme B12 de novo and instead transport vitamin B12 from the extracellular milieu with subsequent conversion of the compound to its functional form of the compound by cellular enzymes. Three enzyme activities have been described for this series of reactions. 1) aquacobalamin reductase (EC 1.6.99.8) reduces Co(III) to Co(II); 2) cob(II)alamin reductase (EC 1.6.99.9) reduces Co(II) to Co(I); and 3) cob(I)alamin adenosyltransferase (EC 2.5.1.17) transfers a 5′deoxyadenosine moiety from ATP to the reduced corrinoid. This last enzyme activity is the best characterized of the three, and is encoded by cobA in S. typhimurium, btuR in E. coli and cobO in P. denitrificans. These three cob(i)alamin adenosyltransferase genes have been cloned and sequenced. Cob(I)alamin adenosyltransferase activity has been detected in human fibroblasts and in isolated rat mitochondria (Fenton et al., Biochem. Biophys. Res. Commun. 98, 283-9, (1981)). The two enzymes involved in cobalt reduction are poorly characterized and gene sequences are not available. There are reports of an aquacobalamin reductase from Euglena gracilis (Watanabe et al., Arch. Biochem. Biophys. 305, 421-7, (1993)) and a microsomal cob(III)alamin reductase is present in the microsomal and mitochondrial inner membrane fractions from rat fibroblasts (Pezacka, Biochim. Biophys. Acta, 1157, 167-77, (1993)).

[0107] Supplementing culture media with vitamin B12 may satisfy the need to produce coenzyme B12 for glycerol dehydratase activity in many microorganisms, but in some cases additional catalytic activities may have to be added or increased in vivo. Enhanced synthesis of coenzyme B12 in eukaryotes may be particularly desirable. Given the published sequences for genes encoding cob(I)alamin adenosyltransferase, the cloning and expression of this gene could be accomplished by one skilled in the art. For example, it is contemplated that yeast, such as Saccharomyces, could be constructed so as to contain genes encoding cob(I)atamin adenosyltransferase in addition to the genes necessary to effect conversion of a carbon substrate such as glucose to 1,3-propanediol. Cloning and expression of the genes for cobalt reduction requires a different approach. This could be based on a selection in E. coli for growth on ethanolamine as sole N2 source. In the presence of coenzyme B12 ethanolamine ammonia-lyase enables growth of cells in the absence of other N2 sources. If E. coli cell contain a cloned gene for cob(I)alamin adenosyltransferase and random cloned DNA from another organism, growth on ethanolamine in the presence of aquacobalamin should be enhanced and selected for if the random cloned DNA encodes cobalt reduction properties to facilitate adenosylation of aquacobalamin.

[0108] Glycerol dehydratase is a multi-subunit enzyme consisting of three protein components which are arranged in an a2b2g2 configuration (M. Seyfried et al, J. Bacteriol., 5793-5796 (1996)). This configuration is an inactive apo-enzyme which binds one molecule of coenzyme B2 to become the catalytically active holo-enzyme. During catalysis, the holo-enzyme undergoes rapid, first order inactivation, to become an inactive complex in which the coenzyme B12 has been converted to hydroxycobalamin (Z. Schneider and J. Pawelkiewicz, ACTA Biochim. Pol. 311-328 (1966)). Stoichiometric analysis of the reaction of glycerol dehydratase with glycerol as substrate revealed that each molecule of enzyme catalyzes 100,000 reactions before inactivation (Z. Schneider and J. Pawelkiewicz, ACTA Biochim. Pol. 311-328 (1966)). In vitro, this inactive complex can only be reactivated by removal of the hydroxycobalamin, by strong chemical treatment with magnesium and sulfite, and replacement with additional coenzyme B12 (Z. Schneider et al., J. Biol. Chem. 3388-3396 (1970)). Inactivated glycerol dehydratase in wild type Klebsiella pneumoniae can be reactivated in situ (toluenized cells) in the presence of coenzyme B12, adenosine 5′-triphosphate (ATP), and manganese (S. Honda et al, J. Bacteriol. 1458-1465 (1980)). This reactivation was shown to be due to the ATP dependent replacement of the inactivated cobalamin with coenzyme B12 (K. Ushio et al., J. Nutr. Sci. Vitaminol. 225-236 (1982)). Cell extract from toluenized cells which in situ catalyze the ATP, manganese, and coenzyme B12 dependent reactivation are inactive with respect to this reactivation. Thus, without strong chemical reductive treatment or cell mediated replacement of the inactivated cofactor, glycerol dehydratase can only catalyzed 100,000 reactions per molecule.

[0109] The present invention demonstrates that the presence of protein X is important for in vivo reactivation of the dehydratase and the production of 1,3-propanediol is increased in a host cell capable of producing 1,3-propanediol in the presence of protein X. The present invention also discloses that the presence of protein 1, protein 2 and protein 3, in combination with protein X, also increased the production of 1,3-propanediol in a host cell capable of producing 1,3-propanediol.

[0110] In addition to E. coli and Saccharomyces, Klebsiella is a particularly preferred host. Strains of Klebsiella pneumoniae are known to produce 1,3-propanediol when grown on glycerol as the sole carbon. It is contemplated that Klebsiella can be genetically altered to produce 1,3-propanediol from monosaccharides, oligosaccharides, polysaccharides, or one-carbon substrates.

[0111] In order to engineer such strains, it will be advantageous to provide the Klebsiella host with the genes facilitating conversion of dihydroxyacetone phosphate to glycerol and conversion of glycerol to 1,3-propanediol either separately or together, under the transcriptional control of one or more constitutive or inducible promoters. The introduction of the DAR1 and GPP2 genes encoding glycerol-3-phosphate dehydrogenase and glycerol-3-phosphatase, respectively, will provide Klebsiella with genetic machinery to produce 1,3-propanediol from an appropriate carbon substrate.

[0112] The genes encoding protein X, protein 1, protein 2 and protein 3 or other enzymes associated with 1,3-propanediol production (e.g., G3PDH, G3P phosphatase, dhab and/or dha T) may be introduced on any plasmid vector capable of replication in K. pneumoniae or they may be integrated into the K. pneumoniae genome. For example, K. pneumoniae ATCC 25955 and K. pneumoniae ECL 2106 are known to be sensitive to tetracycline or chloramphenicol; thus plasmid vectors which are both capable of replicating in K. pneumoniae and encoding resistance to either or both of these antibiotics may be used to introduce these genes into K. pneumoniae. Methods of transforming Klebsiella with genes of interest are common and well known in the art and suitable protocols, including appropriate vectors and expression techniques may be found in Sambrook, supra.

Vectors and Expression Cassettes

[0113] The present invention provides a variety of vectors and transformation and expression cassettes suitable for the cloning, transformation and expression of protein X, protein 1, protein 2 and protein 3 as well as other proteins associated with 1,3-propanediol production, e.g., G3PDH and G3P phosphatase into a suitable host cell. Suitable vectors will be those which are compatible with the bacterium employed. Suitable vectors can be derived, for example, from a bacteria, a virus (such as bacteriophage T7 or a M-13 derived phage), a cosmid, a yeast or a plant. Protocols for obtaining and using such vectors are known to those in the art. (Sambrook et al., Molecular Cloning: A Laboratory Manual—volumes 1,2,3 (Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., (1989)).

[0114] Typically, the vector or cassette contains sequences directing transcription and translation of the relevant gene, a selectable marker, and sequences allowing autonomous replication or chromosomal integration. Suitable vectors comprise a region 5′ of the gene which harbors transcriptional initiation controls and a region 3′ of the DNA fragment which controls transcriptional termination. It is most preferred when both control regions are derived from genes homologous to the transformed host cell although it is to be understood that such control regions need not be derived from the genes native to the specific species chosen as a production host.

[0115] Initiation control regions or promoters, which are useful to drive expression of the protein x and protein 1, protein 2 or protein 3 in the desired host cell, are numerous and familiar to those skilled in the art. Virtually any promoter capable of driving these genes is suitablefor the present invention including but not limited to CYC1, HIS3, GAL1, GAL10, ADH1, PGK, PHO5, GAPDH, ADC1, TRP1, URA3, LEU2, ENO, TPI (useful for expression in Saccharomyces); AOX1 (useful for expression in Pichia); and lac, trp, IPL, IPR, T7, tac, and trc (useful for expression in E. coli).

[0116] Termination control regions may also be derived from various genes native to the preferred hosts. Optionally, a termination site may be unnecessary, however, it is most preferred if included.

[0117] For effective expression of the instant enzymes, DNA encoding the enzymes are linked operably through initiation codons to selected expression control regions such that expression results in the formation of the appropriate messenger RNA.

Transformation of Suitable Hosts and Expression of Genes for the Production of 1,3-Propanediol

[0118] Once suitable cassettes are constructed they are used to transform appropriate host cells. Introduction of the cassette containing dhaB activity, dhaB protein X and at least one of protein 1, protein 2 and protein 3 and optionally 1,3-propanediol oxidoreductase (dha T), either separately or together, into the host cell may be accomplished by known procedures such as by transformation (e.g., using calcium-permeabilized cells, electroporation) or by transfection using a recombinant phage virus. (Sambrook et al., supra.). In the present invention, E. coli DH5a was transformed with dhaB subunits 1, 2 and 3 and dha protein X.

[0119] Additionally, E. coli W2042 (ATCC 98188) containing the genes encoding glycerol-3-phosphate dehydrogenase (G3PDH) and glycerol-3-phosphatase (G3P phosphatase), glycerol dehydratase (dhaB), and 1,3-propanediol oxidoreductase (dha T) was created. Additionally, S. cerevisiae YPH500 (ATCC 74392) harboring plasmids pMCK10, pMCK17, pMCK30 and pMCK35 containing genes encoding glycerol-3-phosphate dehydrogenase (G3PDH) and glycerol-3-phosphatase (G3P phosphatase), glycerol dehydratase (dhaB), and 1,3-propanediol oxidoreductase (dha T) was constructed. Both the above-mentioned transformed E. coli and Saccharomyces represent preferred embodiments of the invention.

Media and Carbon Substrates

[0120] Fermentation media in the present invention must contain suitable carbon substrates. Suitable substrates may include but are not limited to monosaccharides such as glucose and fructose, oligosaccharides such as lactose or sucrose, polysaccharides such as starch or cellulose, or mixtures thereof, and unpurified mixtures from renewable feedstocks such as cheese whey permeate, cornsteep liquor, sugar beet molasses, and barley malt. Additionally, the carbon substrate may also be one-carbon substrates such as carbon dioxide, or methanol for which metabolic conversion into key biochemical intermediates has been demonstrated. Glycerol production from single carbon sources (e.g., methanol, formaldehyde, or formate) has been reported in methylotrophic yeasts (Yamada et al., Agric. Biol. Chem., 53(2) 541-543, (1989)) and in bacteria (Hunter et.al., Biochemistry, 24, 4148-4155, (1985)). These organisms can assimilate single carbon compounds, ranging in oxidation state from methane to formate, and produce glycerol. The pathway of carbon assimilation can be through ribulose monophosphate, through serine, or through xylulose-momophosphate (Gottschalk, Bacterial Metabolism, Second Edition, Springer-Verlag: New York (1986)). The ribulose monophosphate pathway involves the condensation of formate with ribulose-5-phosphate to form a 6 carbon sugar that becomes fructose and eventually the three carbon product glyceraldehyde-3-phosphate. Likewise, the serine pathway assimilates the one-carbon compound into the glycolytic pathway via methylenetetrahydrofolate.

[0121] In addition to utilization of one and two carbon substrates, methylotrophic organisms are also known to utilize a number of other carbon-containing compounds such as methylamine, glucosamine and a variety of amino acids for metabolic activity. For example, methylotrophic yeast are known to utilize the carbon from methylamine to form trehalose or glycerol (Bellion et al., Microb. Growth C1 Compd., Int. Symp.], 7th (1993), 415-32. Editor(s): Murrell, J. Collin; Kelly, Don P. Publisher: Intercept, Andover, UK). Similarly, various species of Candida will metabolize alanine or oleic acid (Sulter et al., Arch. Microbiol., 153(5), 485-9 (1990)). Hence, the source of carbon utilized in the present invention may encompass a wide variety of carbon-containing substrates and will only be limited by the requirements of the host organism.

[0122] Although it is contemplated that all of the above mentioned carbon substrates and mixtures thereof are suitable in the present invention, preferred carbon substrates are monosaccharides, oligosaccharides, polysaccharides, and one-carbon substrates. More preferred are sugars such as glucose, fructose, sucrose and single carbon substrates such as methanol and carbon dioxide. Most preferred is glucose.

[0123] In addition to an appropriate carbon source, fermentation media must contain suitable minerals, salts, cofactors, buffers and other components, known to those skilled in the art, suitable for the growth of the cultures and promotion of the enzymatic pathway necessary for glycerol production. Particular attention is given to Co(II) salts and/or vitamin B12 or precursors thereof.

Culture Conditions

[0124] Typically, cells are grown at 30° C. in appropriate media. Preferred growth media in the present invention are common commercially prepared media such as Luria Bertani (LB) broth, Sabouraud Dextrose (SD) broth or Yeast Malt Extract (YM) broth. Other defined or synthetic growth media may also be used and the appropriate medium for growth of the particular microorganism will be known by someone skilled in the art of microbiology or fermentation science. The use of agents known to modulate catabolite repression directly orindirectly, e.g., cyclic adenosine 2′:3′-monophosphate or cyclic adenosine 2′:5′-monophosphate, may also be incorporated into the reaction media. Similarly, the use of agents known to modulate enzymatic activities (e.g., sulphites, bisulphites and alkalis) that lead to enhancement of glycerol production may be used in conjunction with or as an alternative to genetic manipulations.

[0125] Suitable pH ranges for the fermentation are between pH 5.0 to pH 9.0, where pH 6.0 to pH 8.0 is preferred as range for the initial condition.

[0126] Reactions may be performed under aerobic or anaerobic conditions where anaerobic or microaerobic conditions are preferred.

Batch and Continuous Fermentations

[0127] The present process uses a batch method of fermentation. A classical batch fermentation is a closed system where the composition of the media is set at the beginning of the fermentation and not subject to artificial alterations during the fermentation. Thus, at the beginning of the fermentation the media is inoculated with the desired organism or organisms and fermentation is permitted to occur adding nothing to the system. Typically, however, a batch fermentation is “batch” with respect to the addition of the carbon source and attempts are often made at controlling factors such as pH and oxygen concentration. The metabolite and biomass compositions of the batch system change constantly up to the time the fermentation is stopped. Within batch cultures cells moderate through a static lag phase to a high growth log phase and finally to a stationary phase where growth rate is diminished or halted. If untreated, cells in the stationary phase will eventually die. Cells in log phase generally are responsible for the bulk of production of end product or intermediate.

[0128] A variation on the standard batch system is the Fed-Batch fermentation system which is also suitable in the present invention. In this variation of a typical batch system, the substrate is added in increments as the fermentation progresses. Fed-Batch systems are useful when catabolite repression is apt to inhibit the metabolism of the cells and where it is desirable to have limited amounts of substrate in the media. Measurement of the actual substrate concentration in Fed-Batch systems is difficult and is therefore estimated on the basis of the changes of measurable factors such as pH, dissolved oxygen and the partial pressure of waste gases such as CO2. Batch and Fed-Batch fermentations are common and well known in the art and examples may be found in Brock, supra.

[0129] It is also contemplated that the method would be adaptable to continuous fermentation methods. Continuous fermentation is an open system where a defined fermentation media is added continuously to a bioreactor and an equal amount of conditioned media is removed simultaneously for processing. Continuous fermentation generaily maintains the cultures at a constant high density where cells are primarily in log phase growth.

[0130] Continuous fermentation allows for the modulation of one factor or any number of factors that affect cell growth or end product concentration. For example, one method will maintain a limiting nutrient such as the carbon source or nitrogen level at a fixed rate and allow all other parameters to moderate. In other systems a number of factors affecting growth can be altered continuously while the cell concentration, measured by media turbidity, is kept constant. Continuous systems strive to maintain steady state growth conditions and thus the cell loss due to media being drawn off must be balanced against the cell growth rate in the fermentation. Methods of modulating nutrients and growth factors for continuous fermentation processes as well as techniques for maximizing the rate of product formation are well known in the art of industrial microbiology and a variety of methods are detailed by Brock, supra.

[0131] The present invention may be practiced using either batch, fed-batch or continuous processes and that any known mode of fermentation would be suitable. Additionally, it is contemplated that cells may be immobilized on a substrate as whole cell catalysts and subjected to fermentation conditions for 1,3-propanediol production.

Alterations in the 1,3-Propanediol Production Pathway

[0132] Representative enzyme pathway. The production of 1,3-propanediol from glucose can be accomplished by the following series of steps. This series is representative of a number of pathways known to those skilled in the art. Glucose is converted in a series of steps by enzymes of the glycolytic pathway to dihydroxyacetone phosphate (DHAP) and 3-phosphoglyceraldehyde (3-PG). Glycerol is then formed by either hydrolysis of DHAP to dihydroxyacetone (DHA) followed by reduction, or reduction of DHAP to glycerol 3-phosphate (G3P) followed by hydrolysis. The hydrolysis step can be catalyzed by any rnber of cellular phosphatases which are known to be specific or non-specific with respect to their substrates or the activity can be introduced into the host by recombination. The reduction step can be catalyzed by a NAD+ (or NADP+) linked host enzyme or the activity can be introduced into the host by recombination. It is notable that the dha regulon contains a glycerol dehydrogenase (E.C. 1.1.1.6) which catalyzes the reversible reaction of Equation 3.

Glycerol®3-HP+H2O (Equation 1)

3-HP+NADH+H+®1,3-Propanediol+NAD+ (Equation 2)

Glycerol+NAD+®DHA+NADH+H+ (Equation 3)

[0133] Glycerol is converted to 1,3-propanediol via the intermediate 3-hydroxypropionaldehye (3-HP) as has been described in detail above, The intermediate 3-HP is produced from glycerol (Equation 1) by a dehydratase enzyme which can be encoded by the host or can introduced into the host by recombination. This dehydratase can be glycerol dehydratase (E.C. 4.2.1.30), diol dehydratase (E.C. 4.2.1.28), or any other enzyme able to catalyze this transformation. Glycerol dehydratase, but not diol dehydratase, is encoded by the dha regulon. 1,3-Propanediol is produced from 3-HP (Equation 2) by a NAD+-(or NADP+) linked host enzyme or the activity can introduced into the host by recombination. This final reaction in the production of 1,3-propanediol can be catalyzed by 1,3-propanediol dehydrogenase (E.C. 1.1.1.202) or other alcohol dehydrogenases.

[0134] Mutations and transformations that affect carbon channeling. A variety of mutant organisms comprising variations in the 1,3-propanediol production pathway will be useful in the present invention. The introduction of a triosephosphate isomerase mutation (tpi-) into the microorganism is an example of the use of a mutation to improve the performance by carbon channeling. Alternatively, mutations which diminish the production of ethanol (adh) or lactate (Idh) will increase the availability of NADH for the production of 1,3-propanediol. Additional mutations in steps of glycolysis after glyceraldehyde-3-phosphate such as phosphoglycerate mutase (pgm) would be useful to increase the flow of carbon to the 1,3-propanediol production pathway. Mutations that effect glucose transport such as PTS which would prevent loss of PEP may also prove useful. Mutations which block alternate pathways for intermediates of the 1,3-propanediol production pathway such as the glycerol catabolic pathway (glp) would also be useful to the present invention. The mutation can be directed toward a structural gene so as to impair or improve the activity of an enzymatic activity or can be directed toward a regulatory gene so as to modulate the expression level of an enzymatic activity.

[0135] Alternatively, transformations and mutations can be combined so as to control particular enzyme activities for the enhancement of 1,3-propanediol production. Thus it is within the scope of the present invention to anticipate modifications of a whole cell catalyst which lead to an increased production of 1,3-propanediol.

Identification and Purification of 1,3-Propanediol

[0136] Methods for the purification of 1,3-propanediol from fermentation media are known in the art. For example, propanediols can be obtained from cell media by subjecting the reaction mixture to extraction with an organic solvent, distillation and column chromatography (U.S. Pat. No. 5,356,812). A particularly good organic solvent for this process is cyclohexane (U.S. Pat. No. 5,008,473).

[0137] 1,3-Propanediol may be identified directly by submitting the media to high pressure liquid chromatography (HPLC) analysis. Preferred in the present invention is a method where fermentation media is analyzed on an analytical ion exchange column using a mobile phase of 0.01 N sulfuric acid in an isocratic fashion.

Identification and Purification of G3PDH and G3P Phosphatase

[0138] The levels of expression of the proteins G3PDH and G3P phosphatase are measured by enzyme assays, G3PDH activity assay relied on the spectral properties of the cosubstrate, NADH, in the DHAP conversion to G-3-P. NADH has intrinsic UV/vis absorption and its consumption can be monitored spectrophotometrically at 340 nm. G3P phosphatase activity can be measured by any method of measuring the inorganic phosphate liberated in the reaction. The most commonly used detection method used the visible spectroscopic determination of a blue-colored phosphomolybdate ammonium complex.

EXAMPLES

General Methods

[0139] Procedures for phosphorylations, ligations and transformations are well known in the art. Techniques suitable for use in the following examples may be found in Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989).

[0140] Materials and methods suitable for the maintenance and growth of bacterial cultures are well known in the art. Techniques suitable for use in the following examples may be found as set out in Manual of Methods for General Bacteriology (Phillipp Gerhardt, R. G. E. Murray, Ralph N. Costilow, Eugene W. Nester, Willis A. Wood, Noel R. Krieg and G. Briggs Phillips, eds), American Society for Microbiology, Washington, D.C. (1994)) or by Thomas D. Brock in Biotechnology: A Textbook of Industrial Microbiology, Second Edition, Sinauer Associates, Inc., Sunderland, Mass. (1989). All reagents and materials used for the growth and maintenance of bacterial cells were obtained from Aldrich Chemicals (Milwaukee, Wis.), DIFCO Laboratories (Detroit, Mich.), GIBCO/BRL (Gaithersburg, Md.), or Sigma Chemical Company (St. Louis, Mo.) unless otherwise specified.

[0141] The meaning of abbreviations is as follows: “h” means hour(s), “min” means minute(s), “sec” means second(s), “d” means day(s), “mL” means milliliters, “L” means liters.

Enzyme Assays

[0142] Glycerol dehydratase activity in cell-free extracts was determined using 1,2-propanediol as substrate. The assay, based on the reaction of aldehydes with methylbenzo-2-thiazolone hydrazone, has been described by Forage and Foster (Biochim. Biophys. Acta, 569, 249 (1979)). The activity of 1,3-propanediol oxidoreductase, sometimes referred to as 1,3-propanediol dehydrogenase, was determined in solution or in slab gels using 1,3-propanediol and NAD+ as substrates as has also been described. Johnson and Lin, J. Bacteriol., 169, 2050 (1987). NADH or NADPH dependent glycerol 3-phosphate dehydrogenase (G3PDH) activity was determined spectrophotometrically, following the disappearance of NADH or NADPH as has been described. (R. M. Bell and J. E. Cronan, Jr., J. Biol. Chem. 250:7153-8 (1975)).

[0143] Honda et al. (1980, In Situ Reactivation of Glycerol-Inactivated Coenzyme B12-Dependent Enzymes, Glycerol Dehydratase and Diol Dehydratase. Journal of Bacteriology 143:1458-1465) disclose an assay that measures the reactivation of dehydratases.

Assay for Glycerol-3-Phosphatase, GPP

[0144] The assay for enzyme activity was performed by incubating the extract with an organic phosphate substrate in a bis-Tris or MES and magnesium buffer, pH 6.5. The substrate used was I-a-glycerol phosphate; d,l-a-glycerol phosphate. The final concentrations of the reagents in the assay are: buffer (20 mM, bis-Tris or 50 mM MES); MgCl2 (10 mM); and substrate (20 mM). if the total protein in the sample was low and no visible precipitation occurs with an acid quench, the sample was conveniently assayed in the cuvette. This method involved incubating an enzyme sample in a cuvette that contained 20 mM substrate (50 mL, 200 mM), 50 mM MES, 10 mM MgCl2, pH 6.5 buffer. The final phosphatase assay volume was 0.5 mL. The enzyme-containing sample was added to the reaction mixture; the contents of the cuvette were mixed and then the cuvette was placed in a circulating water bath at T=37° C. for 5 to 120 min—depending on whether the phosphatase activity in the enzyme sample ranged from 2 to 0.02 U/mL. The enzymatic reaction was quenched by the addition of the acid molybdate reagent (0.4 mL). After the Fiske SubbaRow reagent (0.1 mL) and distilled water (1.5 mL) were added, the solution was mixed and allowed to develop. After 10 min, the absorbance of the samples was read at 660 nm using a Cary 219 UV/Vis spectophotometer. The amount of inorganic phosphate released was compared to a standard curve that was prepared by using a stock inorganic phosphate solution (0.65 mM) and preparing 6 standards with final inorganic phosphate concentrations ranging from 0.026 to 0.130 mmol/mL.

Isolation and Identification 1,3-Propanediol

[0145] The conversion of glycerol to 1,3-propanediol was monitored by HPLC. Analyses were performed using standard techniques and materials available to one skilled in the art of chromatography. One suitable method utilized a Waters Maxima 820 HPLC system using UV (210 nm) and RI detection. Samples were injected onto a Shodex SH-1011 column (8 mm×300 mm, purchased from Waters, Milford, Mass.) equipped with a Shodex SH-1011 P precolumn (6 mm×50 mm), temperature controlled at 50° C., using 0.01 N H2SO4 as mobile phase at a flow rate of 0.5 mL/min. When quantitative analysis was desired, samples were prepared with a known amount of trimethylacetic acid as external standard. Typically, the retention times of glycerol (RI detection), 1,3-propanediol (RI detection), and trimethylacetic acid (UV and RI detection) were 20.67 min, 26.08 min, and 35.03 min, respectively.

[0146] Production of 1,3-propanediol was confirmed by GC/MS. Analyses were performed using standard techniques and materials available to one of skill in the art of GC/MS. One suitable method utilized a Hewlett Packard 5890 Series II gas chromatograph coupled to a Hewlett Packard 5971 Series mass selective detector (EI) and a HP-INNOWax column (30 m length, 0.25 mm i.d., 0.25 micron film thickness). The retention time and mass spectrum of 1,3-propanediol generated were compared to that of authentic 1,3-propanediol (m/e: 57, 58).

[0147] An alternative method for GC/MS involved derivatization of the sample. To 1.0 mL of sample (e.g., culture supernatant) was added 30 uL of concentrated (70% v/v) perchloric acid. After mixing, the sample was frozen and lyophilized. A 1:1 mixture of bis(trimethylsilyl)trifluoroacetamide:pyridine (300 uL) was added to the lyophilized material, mixed vigorously and placed at 65° C. for one h. The sample was clarified of insoluble material by centrifugation. The resulting liquid partitioned into two phases, the upper of which was used for analysis. The sample was chromatographed on a DB-5 column (48 m, 0.25 mm I.D., 0.25 um film thickness; from J&W Scientific) and the retention time and mass spectrum of the 1,3-propanediol derivative obtained from culture supernatants were compared to that obtained from authentic standards. The mass spectrum of TMS-derivatized 1,3-propanediol contains the characteristic ions of 205, 177, 130 and 115 AMU.

EXAMPLE 1

Cloning and Transformation of E. coli Host Cells with Cosmid DNA for the Expression of 1,3-Propanediol

[0148] Media

[0149] Synthetic S12 medium was used in the screening of bacterial transformants for the ability to make 1,3-propanediol. S12 medium contains: 10 mM ammonium sulfate, 50 mM potassium phosphate buffer, pH 7.0, 2 mM MgCl2, 0.7 mM CaCl2, 50 uM MnCl2, 1 uM FeCl3, 1 uM ZnCl, 1.7 uM CuSO4, 2.5 uM CoCl2, 2.4 uM Na2MoO4, and 2 uM thiamine hydrochloride.

[0150] Medium A used for growth and fermentation consisted of: 10 mM ammonium sulfate; 50 mM MOPS/KOH buffer, pH 7.5; 5 mM potassium phosphate buffer, pH 7.5; 2 mM MgCl2; 0.7 mM CaCl2; 50 uM MnCl2; 1 uM FeCl3; 1 uM ZnCl; 1.72 uM CuSO4; 2.53 uM COCl2; 2.42 uM Na2MoO4; 2 uM thiamine hydrochloride; 0.01% yeast extract; 0.01% casamino acids; 0.8 ug/mL vitamin B12; and 50 ug/mL amp. Medium A was supplemented with either 0.2% glycerol or 0.2% glycerol plus 0.2% D-glucose as required.

[0151] Cells:

[0152]

Klebsiella pneumoniae
ECL2106 (Ruch et al., J. Bacteriol., 124, 348 (1975)), also known in the literature as K. aerogenes or Aerobacter aerogenes, was obtained from E. C. C. Lin (Harvard Medical School, Cambridge, Mass.) and was maintained as a laboratory culture.

[0153] Klebsiella pneumoniae ATCC 25955 was purchased from American Type Culture Collection (Rockville, Md.).

[0154]

E. coli
DH5a was purchased from Gibco/BRL and was transformed with the cosmid DNA isolated from Klebsiella pneumoniae ATCC 25955 containing a gene coding for either a glycerol or diol dehydratase enzyme. Cosmids containing the glycerol dehydratase were identified as pKP1 and pKP2 and cosmid containing the diol dehydratase enzyme were identified as pKP4. Transformed DH5a cells were identified as DH5a-pKP1, DH5a-pKP2, and DH5a-pKP4.

[0155]

E. coli
ECL707 (Sprenger et al., J. Gen. Microbiol., 135, 1255 (1989)) was obtained from E. C. C. Lin (Harvard Medical School, Cambridge, Mass.) and was similarly transformed with cosmid DNA from Klebsiella pneumoniae. These transformants were identified as ECL707-pKP1 and ECL707-pKP2, containing the glycerol dehydratase gene and ECL707-pKP4 containing the dioi dehydratase gene.

[0156]

E. coli
AA200 containing a mutation in the tpi gene (Anderson et al., J. Gen MicrobioL, 62, 329 (1970)) was purchased from the E. coli Genetic Stock Center, Yale University (New Haven, Conn.) and was transformed with Klebsielia cosmid DNA to give the recombinant organisms A200-pKP1 and A200-pKP2, containing the glycerol dehydratase gene, and AA200-pKP4, containing the diol dehydratase gene.

[0157] DH5a:

[0158] Six transformation plates containing approximately 1,000 colonies of E. coli XL1-Blue MR transfected with K. pneumoniae DNA were washed with 5 mL LB medium and centrifuged. The bacteria were pelleted and resuspended in 5 mL LB medium+glycerol. An aliquot (50 uL) was inoculated into a 15 mL tube containing S12 synthetic medium with 0.2% glycerol+400 ng per mL of vitamin B12+0.001% yeast extract+50 amp. The tube was filled with the medium to the top and wrapped with parafilm and incubated at 30° C. A slight turbidity was observed after 48 h. Aliquots, analyzed for product distribution as described above at 78 h and 132 h, were positive for 1,3-propanediol, the later time points containing increased amounts of 1,3-propanediol.

[0159] The bacteria, testing positive for 1,3-propanediol production, were serially diluted and plated onto LB-50 amp plates in order to isolate single colonies. Forty-eight single colonies were isolated and checked again for the production of 1,3-propanediol. Cosmid DNA was isolated from 6 independent clones and transformed into E. coli strain DH5a. The transformants were again checked for the production of 1,3-propanediol. Two transformants were characterized further and designated as DH5a-pKP1 and DH5a-pKP2.

[0160] A 12.1 kb EcoRI-SaII fragment from pKP1, subcloned into pIBI31 (IBI Biosystem, New Haven, Conn.), was sequenced and termed pHK28-26 (SEQ ID NO:19). Sequencing revealed the loci of the relevant open reading frames of the dha operon encoding glycerol dehydratase and genes necessary for regulation. Referring to SEQ ID NO:19, a fragment of the open reading frame for dhaK encoding dihydroxyacetone kinase is found at bases 1-399; the open reading frame dhaD encoding glycerol dehydrogenase is found at bases 983-217; theopen reading frame dhaR encoding the repressor is found at bases 2209-4134; the open reading frame dha T encoding 1,3-propanediol oxidoreductase is found at bases 5017-6180; the open reading frame dhaBI encoding the alpha subunit glycerol dehydratase is found at bases 7044-8711; the open reading frame dhaB2 encoding the beta subunit glycerol dehydratase is found at bases 8724-9308; the open reading frame dhaB3 encoding the gamma subunit glycerol dehydratase is found at bases 9311-9736; and the open reading frame dhaBX, encoding a protein of unknown function is found at bases 9749-11572.

[0161] Single colonies of E. coli XL1-Blue MR transfected with packaged cosmid DNA from K. pneumoniae were inoculated into microtiter wells containing 200 uL of S15 medium (ammonium sulfate, 10 mM; potassium phosphate buffer, pH 7.0, 1 mM; MOPS/KOH buffer, pH 7.0, 50 mM; MgCl2, 2 mM; CaCl2, 0.7 mM; McCl2, 50 uM; FeCl3, 1 uM; ZnCl, 1 uM; CuSO4, 1.72 uM; CoCl2, 2.53 uM; Na2MoO4, 2.42 μM; and thiamine hydrochloride, 2 uM)+0.2% glycerol +400 ng/mL of vitamin B12+0.001% yeast extract+50 ug/mL ampicillin. In addition to the microtiter wells, a master plate containing LB-50 amp was also inoculated. After 96 h, 100 uL was withdrawn and centrifuged in a Rainin microfuge tube containing a 0.2 micron nylon membrane filter. Bacteria were retained and the filtrate was processed for HPLC analysis. Positive clones demonstrating 1,3-propanediol production were identified after screening approximately 240 colonies. Three positive clones were identified, two of which had grown on LB-50 amp and one of which had not. A single colony, isolated from one of the two positive clones grown on LB-50 amp and verified for the production of 1,3-propanediol, was designated as pKP4. Cosmid DNA was isolated from E. coli strains containing pKP4 and E. coli strain DH5a was transformed. An independent transformant, designated as DH5a-pKP4, was verified for the production of 1,3-propanediol.

[0162] ECL707:

[0163]

E. coli
strain ECL707 was transformed with cosmid K. pneumoniae DNA corresponding to one of pKP1, pKP2, pKP4 or the Supercos vector alone and named ECL707-pKP1, ECL707-pKP2, ECL707-pKP4, and ECL707-sc, respectively. ECL707 is defective in glpK, gld, and ptsD which encode the ATP-dependent glycerol kinase, NAD+-linked glycerol dehydrogenase, and enzyme II for dihydroxyacetone of the phosphoenolpyruvate-dependent phosphotransferase system, respectively.

[0164] Twenty single colonies of each cosmid transformation and five of the Supercos vector alone (negative control) transformation, isolated from LB-50 amp plates, were transferred to a master LB-50 amp plate. These isolates were also tested for their ability to convert glycerol to 1,3-propanediol in order to determine if they contained dehydratase activity. The transformants were transferred with a sterile toothpick to microtiter plates containing 200 uL of Medium A supplemented with either 0.2% glycerol or 0.2% glycerol plus 0.2% D-glucose After incubation for 48 hr at 30° C., the contents of the microtiter plate wells were filtered through an 0.45 micron nylon filter and chromatographed by HPLC. The results of these tests are given in Table 1.

1TABLE 1Conversion of glycerol to 1,3-propanediol by transformed ECL707TransformantGlycerol*Glycerol plus Glucose*ECL707-pKP119/2019/20ECL707-pKP218/2020/20ECL707-pKP4 0/2020/20ECL707-sc0/50/5*(Number of positive isolates/number of isolates tested)

[0165] AA200:

[0166]

E. coli
strain A200 was transformed with cosmid K. pneumoniae DNA corresponding to one of pKP1, pKP2, pKP4 and the Supercos vector alone and named M200-pKPI, AA200-pKP2, AA200-pKP4, and AA200-sc, respectively. Strain AA200 is defective in triosephosphate isomerase (tpi).

[0167] Twenty single colonies of each cosmid transformation and five of the empty vector transformation were isolated and tested for their ability to convert glycerol to 1,3-propanediol as described for E. coli strain ECL707. The results of these tests are given in Table 2.

2TABLE 2Conversion of glycerol to 1,3-propanediol by transformed AA200TransformantGlycerol*Glycerol plus Glucose*AA200-pKP117/2017/20AA200-pKP217/2017/20AA200-pKP4 2/2016/20AA200-sc0/50/5*(Number of positive isolates/number of isolates tested)

EXAMPLE 2

Conversion of D-Glucose to 1,3-Propanediol by Recombinant E. coli using DAR1, GPP2, dhaB, and dha T

[0168] Construction of general purpose expression plasmids for use in transformation of Escherichia coli

[0169] The expression vector pTaclQ

[0170] The E. coli expression vector, pTaclQ, contains the laclq gene (Farabaugh, Nature 274, 5673 (1978)) and tac promoter (Amann et al., Gene 25, 167 (1983)) inserted into the EcoRI of pBR322 (Sutcliffe et al., Cold Spring Harb. Symp. Quant. Biol. 43, 77 (1979)). A multiple cloning site and terminator sequence (SEQ ID NO:20) replaces the pBR322 sequence from EcoRI to SphI.

[0171] Subcloning the glycerol dehydratase genes (dhaB1,2,3)

[0172] The open reading frame for dhaB3 gene (incorporating an EcoRI site at the 5′ end and a XbaI site at the 3′ end) was amplified from pHK28-26 by PCR using primers (SEQ ID NOS:21 and 22). The product was subcloned into pLitmus29 (New England Biolab, Inc., Beverly, Mass.) to generate the plasmid pDHAB3 containing dhaB3.

[0173] The region containing the entire coding region for the four genes of the dhaB operon from pHK28-26 was cloned into pBluescriptll KS+(Stratagene, La Jolla, Calif.) using the restriction enzymes KpnI and EcoRI to create the plasmid pM7.

[0174] The dhaBX gene was removed by digesting the plasmid pM7, which contains dhaB(1,2,3,4), with ApaI and XbaI (deleting part of dhaB3 and all of dhaBX). The resulting 5.9 kb fragment was purified and ligated with the 325-bp ApaI-XbaI fragment from plasmid pDHAB3 (restoring the dhaB3 gene) to create pM11, which contains dhaB(1,2,3).

[0175] The open reading frame for the dhaB1 gene (incorporating a HindIII site and a consensus RBS ribosome binding site at the 5′ end and a XbaI site at the 3′ end) was amplified from pHK28-26 by PCR using primers (SEQ ID NO:23 and SEQ ID NO:24). The product was subcloned into pLitmus28 (New England Biolab, Inc.) to generate the plasmid pDT1 containing dhaB1.

[0176] A NotI-XbaI fragment from pM 11 containing part of the dhaB1 gene, the dhaB2 gene and the dhaB3 gene was inserted into pDT1 to create the dhaB expression plasmid, pDT2. The HindIII-XbaI fragment containing the dhaB(1,2,3) genes from pDT2 was inserted into pTacIQ to create pDT3.

[0177] Subcloning the 1,3-propanediol dehydrogenase gene (dha T)

[0178] The KpnI-SacI fragment of pHK28-26, containing the complete 1,3-propanediol dehydrogenase (dha T) gene, was subcloned into pBluescriptil KS+ creating plasmid pAH1. The dha T gene (incorporating an XbaI site at the 5′ end and a BamHI site at the 3′ end) was amplified by PCR from pAH1 as template DNA using synthetic primers (SEQ ID NO:25 with SEQ ID NO:26). The product was subcloned into pCR-Script (Stratagene) at the SrfI site to generate the plasmids pAH4 and pAH5 containing dha T. The plasmid pAH4 contains the dha T gene in the correct orientation for expression from the lac promoter in pCR-Script and pAH5 contains the dha T gene in the opposite orientation. The XbaI-BamHI fragment from pAH4 containing the dha T gene was inserted into pTaclQ to generate plasmid pAH8. The HindIII-BamHI fragment from pAH8 containing the RBS and dha T gene was inserted into pBluescriptll KS+ to create pAHI11. The HindIII-SaII fragment from pAH8 containing the RBS, dha T gene and terminator was inserted into pBluescriptII SK+ to create pAH12.

[0179] Construction of an expression cassette for dhaB(1,2,3) and dha T

[0180] An expression cassette for the dhaB(1,2,3) and dha T was assembled from the individual dhaB(1,2,3) and dha T subclones described above using standard molecular biology methods. The SpeI-KpnI fragment from pAH8 containing the RBS, dha T gene and terminator was inserted into the XbaI-KpnI sites of pDT3 to create pAH23. The SmaI-EcoRI fragment between the dhaB3 and dha T gene of pAH23 was removed to create pAH26. The SpeI-NotI fragment containing an EcoRI site from pDT2 was used to replace the Spel-Notl fragment of pAH26 to generate pAH27.

[0181] Construction of expression cassette for dha T and dhaB(1,2,3)

[0182] An expression cassette for dha T and dhaB(1,2,3) was assembled from the individual dhaB(1,2,3) and dha T subclones described previously using standard molecular biology methods. A SpeI-SacI fragment containing the dhaB(1,2,3) genes from pDT3 was inserted into pAH11 at the SpeI-SacI sites to create pAH24.

[0183] Cloning and expression of glycerol 3-phosphatase for increased glycerol production in E. coli

[0184] The Saccharomyces cerevisiae chromosome V lamda clone 6592 (Gene Bank, accession #U18813×11) was obtained from ATCC. The glycerol 3- phosphate phosphatase (GPP2) gene (incorporating an BamHI-RBS-Xbal site at the 5′ end and a SmaI site at the 3′ end) was cloned by PCR cloning from the lamda clone as target DNA using synthetic primers (SEQ ID NO:27 with SEQ ID NO:28). The product was subcloned into pCR-Script (Stratagene) at the SrfI site to generate the plasmids pAH15 containing GPP2. The plasmid pAH15 contains the GPP2 gene in the inactive orientation for expression from the lac promoter in pCR-Script SK+. The BamHI-SmaI fragment from pAH15 containing the GPP2 gene was inserted into pBlueScriptII SK+ to generate plasmid pAH19. The pAH19 contains the GPP2 gene in the correct orientation for expression from the lac promoter. The XbaI-PstI fragment from pAH19 containing the GPP2 gene was inserted into pPHOX2 to create plasmid pAH21.

[0185] Plasmids for the expression of dha T, dhaB(1,2,3) and GPP2 genes

[0186] A SalI-EcoRI-XbaI linker (SEQ ID NOS:29 and 30) was inserted into pAH5 which was digested with the restriction enzymes, SalI-XbaI to create pDT16. The linker destroys the XbaI site. The 1 kb SaII-MIuI fragment from pDT16 was then inserted into pAH24 replacing the existing SaII-MIuI fragment to create pDTI8.

[0187] The 4.1 kb EcoRI-XbaI fragment containing the expression cassette for dha T and dhaB(1,2,3) from pDT18 and the 1.0 kb XbaI-SaII fragment containing the GPP2 gene from pAH21 was inserted into the vector pMMB66EH (Fuste et al., GENE, 48, 119 (1986)) digested with the restriction enzymes EcoRI and SaII to create pDT20.

[0188] Plasmids for the over-expression of DAR1 in E. coli

[0189] DAR1 was isolated by PCR cloning from genomic S. cerevisiae DNA using synthetic primers (SEQ ID NO:46 with SEQ ID NO:47). Successful PCR cloning places an Ncol site at the 5′ end of DAR1 where the ATG within NcoI is the DAR1 initiator methionine. At the 3′ end of DAR1 a BamHI site is introduced following the translation terminator. The PCR fragments were digested with NcoI+BamHI and cloned into the same sites within the expression plasmid pTrc99A (Pharmacia, Piscataway, N.J.) to give pDAR1A.

[0190] In order to create a better ribosome binding site at the 5′ end of DAR1, a SpeI-RBS-NcoI linker obtained by annealing synthetic primers (SEQ ID NO:48 with SEQ ID NO:49) was inserted into the NcoI site of pDARIA to create pAH40. Plasmid pAH40 contains the new RBS and DAR1 gene in the correct orientation for expression from the trc promoter of Trc99A (Pharmacia). The NcoI-BamHI fragment from pDAR1A and a second set of SpeI-RBS-NcoI linker obtained by annealing synthetic primers (SEQ ID NO:31 with SEQ ID NO:32) was inserted into the SpeI-BamHI site of pBluescript II-SK+ (Stratagene) to create pAH41. The construct pAH41 contains an ampicillin resistance gene. The NcoI-BamHI fragment from pDAR1A and a second set of SpeI-RBS-NcoI linker obtained by annealing synthetic primers (SEQ ID NO:31 with SEQ ID NO:32) was inserted into the SpeI-BamHI site of pBC-SK+ (Stratagene) to create pAH42. The construct pAH42 contains a chloroamphenicol resistance gene.

[0191] Construction of an expression cassette for DAR1 and GPP2

[0192] An expression cassette for DAR1 and GPP2 was assembled from the individual DAR1 and GPP2 subclones described above using standard molecular biology methods. The BamHI-PstI fragment from pAH19 containing the RBS and GPP2 gene was inserted into pAH40 to create pAH43. The BamHI-PstI fragment froin pAH19 containing the RBS and GPP2 gene was inserted into pAH41 to create pAH44. The same BamHI-PstI fragment from pAH19 containing is the RBS and GPP2 gene was also inserted into pAH42 to create pAH45.

[0193] The ribosome binding site at the 5′ end of GPP2 was modified as follows. A BamHI-RBS-SpeI linker, obtained by annealing synthetic primers GATCCAGGAAACAGA with CTAGTCTGTTTCCTG to the XbaI-PstI fragment from pAH19 containing the GPP2 gene, was inserted into the BamHI-Pstl site of pAH40 to create pAH48. Plasmid pAH48 contains the DAR1 gene, the modified RBS, and the GPP2 gene in the correct orientation for expression from the trc promoter of pTrc99A (Pharmacia, Piscataway, N.J.).

[0194]

E. coli
strain construction

[0195]

E. coli
W1485 is a wild-type K-12 strain (ATCC 12435). This strain was transformed with the plasmids pDT20 and pAH42 and selected on LA (Luria Agar, Difco) plates supplemented with 50 mg/mL carbencillim and 10 mg/mL chloramphenicol.

[0196] Production of 13-propanediol from glucose

[0197]

E. coli
W1485/pDT20/pAH42 was transferred from a plate to 50 mL of a medium containing per liter: 22.5 g glucose, 6.85 g K2HPO4, 6.3 g (NH4)2SO4, 0.5 g NaHCO3, 2.5 g NaCI, 8 g yeast extract, 8 g tryptone, 2.5 mg vitamin B12, 2.5 mL modified Balch's trace-element solution, 50 mg carbencillim and 10 mg chloramphenicol, final pH 6.8 (HCl), then filter sterilized. The composition of modified Balch's trace-element solution can be found in Methods for General and Molecular Bacteriology (P. Gerhardt et al., eds, p. 158, American Society for Microbiology, Washington, D.C. (1994)). After incubating at 37° C., 300 rpm for 6 h, 0.5 g glucose and IPTG (final concentration=0.2 mM) were added and shaking was reduced to 100 rpm. Samples were analyzed by GC/MS. After 24 h, W1485/pDT20/pAH42 produced 1.1 g/L glycerol and 195 mg/L 1,3-propanediol.

EXAMPLE 3

Cloning and Expression of dhaB and dha T in Saccharomyces cerevisiae

[0198] Expression plasmids that could exist as replicating episomal elements were constructed for each of the four dha genes. For all expression plasmids a yeast ADH 1 promoter was present and separated from a yeast ADH1 transcription terminator by fragments of DNA containing recognition sites for one or more restriction endonucleases. Each expression plasmid also contained the gene for b-lactamase for selection in E. coli on media containing ampicillin, an origin of replication for plasmid maintenance in E. coli, and a 2 micron origin of replication for maintenance in S. cerevisiae. The selectable nutritional markers used for yeast and present on the expression plasmids were one of the following: HIS3 gene encoding imidazoleglycerolphosphate dehydratase, URA3 gene encoding orotidine 5′-phosphate decarboxylase, TRP1 gene encoding N-(5′-phosphoribosyl)-anthranilate isomerase, and LEU2 encoding b-isopropylmalate dehydrogenase.

[0199] The open reading frames for dha T, dhaB3, dhaB2 and dhaB1 were amplified from pHK28-26 (SEQ ID NO:9) by PCR using primers (SEQ ID NO:38 with SEQ ID NO:39, SEQ ID NO:40 with SEQ ID NO:41, SEQ ID NO:4 with SEQ ID NO:43, and SEQ ID NO:44 with SEQ ID NO:45 for dha T, dhaB3, dhaB2 and dhaB1, respectively) incorporating EcoR1 sites at the 5′ ends (10 mM Tris pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.0001% gelatin, 200 mM dATP, 200 mM dCTP, 200 mM dGTP, 200 mM dTTP, 1 mM each primer, 1-10 ng target DNA, 25 units/mL Amplitaqä DNA polymerase (Perkin-Elmer Cetus, Norwalk Conn.)). PCR parameters were 1 min at 94° C., 1 min at 55° C., 1 min at 72° C., 35 cycles. The products were subcloned into the EcoRl site of pHIL-D4 (Phillips Petroleum, Bartlesville, Okla.) to generate the plasmids pMP13, pMP14, pMP20 and pMP15 containing dha T, dhaB3, dhaB2 and dhaB1, respectively.

[0200] Construction of dhaB1 expression plasmid pMCK10

[0201] The 7.8 kb replicating plasmid pGADGH (Clontech, Palo Altos Calif.) was digested with HindIII, dephosphorylated, and ligated to the dhaB1 HindIII fragment from pMP15. The resulting plasmid (pMCK10) had dhaB1 correctly oriented for transcription from the ADH1 promoter and contained a LEU2 marker.

[0202] Construction of dhaB2 expression plasmid pMCK17

[0203] Plasmid pGADGH (Clontech, Palo Alto, Calif.) was digested with HindIII and the single-strand ends converted to EcoRI ends by ligation with HindIII-XmnI and EcoRI-XmnI adaptors (New England Biolabs, Beverly, Mass.). Selection for piasmids with correct EcoRI ends was achieved by ligation to a kanamycin resistance gene on an EcoRI fragment from plasmid pUC4K (Pharmacia Biotech, Uppsala), transformation into E. coli strain DH5a and selection on LB plates containing 25 mg/mL kanamycin. The resulting plasmid (pGAD/KAN2) was digested with SnaBI and EcoRI and a 1.8 kb fragment with the ADH1 promoter was isolated. Plasmid pGBT9 (Clontech, Palo Alto, Calif.) was digested with SnaBI and EcoRI, and the 1.5 kb ADH1/GAL4 fragment replaced by the 1.8 kb ADH1 promoter fragment isolated from pGAD/KAN2 by digestion with SnaBI and EcoRI. The resulting vector (pMCK11) is a replicating plasmid in yeast with an ADH1 promoter and terminator and a TRP1 marker, Plasmid pMCK11 was digested with EcoRI, dephosphorylated, and ligated to the dhaB2 EcoRI fragment from pMP20. The resulting plasmid (PMCK17) had dhaB2 correctly oriented for transcription from the ADH1 promoter and contained a TRP1 marker.

[0204] Construction of dhaB3 expression plasmid pMCK30

[0205] Plasmid pGBT9 (Clontech) was digested with NaeI and PvuII and the 1 kb TRP1 gene removed from this vector. The TRPI gene was replaced by a URA3 gene donated as a 1.7 kb AatII/NaeI fragment from plasmid pRS406 (Stratagene) to give the intermediary vector pMCK32. The truncated ADH1 promoter present on pMCK32 was removed on a 1.5 kb SnaBI/EcoRI fragment, and replaced with a full-length ADH1 promoter on a 1.8 kb SnaBI/EcoRI fragment from plasmid pGAD/KAN2 to yield the vector pMCK26. The unique EcoRI site on pMCK26 was used to insert an EcoRI fragment with dhaB3 from plasmid pMPt4 to yield pMCK30. The pMCK30 replicating expression plasmid has dhaB3 orientated for expression from the ADH1 promoter, and has a URA3 marker.

[0206] Construction of dha Texpression plasmid pMCK35

[0207] Plasmid pGBT9 (Clontech) was digested with NaeI and PvuII and the 1 kb TRP1 gene removed from this vector. The TRPI gene was replaced by a HIS3 gene donated as an XmnI/NaeI fragment from plasmid pRS403 (Stratagene) to give the intermediary vector pMCK33. The truncated ADHI promoter present on pMCK33 was removed on a 1.5 kb SnaBi/EcoRI fragment, and replaced with a full-length ADH1 promoter on a 1.8 kb SnaBI/EcoRI fragment from plasmid pGAD/KAN2 to yield the vector pMCK31. The unique EcoR] site on pMCK31 was used to insert an EcoRI fragment with dha Tfrom plasmid pMP13 to yield pMCK35., The pMCK35 replicating expression plasmid has dha T orientated for expression from the ADHI promoter, and has a HIS3 marker.

[0208] Transformation of S. cerevisiae with dha expression plasmids

[0209]

S. cerevisiae
strain YPH500 (ura3-52 lys2-801 ade2-101 trp1-D63 his3-D200 leu2-D1) (Sikorski R. S. and Hieter P., Genetics 122, 19-27, (1989)) purchased from Stratagene (La Jolla, Calif.) was transformed with 1-2 mg of plasmid DNA using a Frozen-EZ Yeast Transformation Kit (Catalog #T2001) (Zymo Research, Orange, Calif.). Colonies were grown on Supplemented Minimal Medium (SMM-0.67% yeast nitrogen base without amino acids, 2% glucose) for 3-4 d at 29° C. with one or more of the following additions: adenine sulfate (20 mg/L), uracil (20 mg/L), L-tryptophan (20 mg/L), L-histidine (20 mg/L), L-leucine (30 mg/L), L-lysine (30 mg/L). Colonies were streaked on selective plates and used to inoculate liquid media.

[0210] Screening of S. cerevisiae transformants for dha genes Chromosomal DNA from URA+, HIS+, TRP+, LEU+ transformants was analyzed by PCR using primers specific for each gene (SEQ ID NOS:38-45). The presence of all four open reading frames was confirmed.

[0211] Expression of dhaB and dha T activity in transformed S. cerevisiae

[0212] The presence of active glycerol dehydratase (dhaB) and 1,3-propanediol oxido-reductase (dha T) was demonstrated using in vitro enzyme assays. Additionally, western blot analysis confirmed protein expression from all four open reading frames.

[0213] Strain YPH500, transformed with the group of plasmids pMCK10, pMCK17, pMCK30 and pMCK35, was grown on Supplemented Minimal Medium containing 0.67% yeast nitrogen base without amino acids 2% glucose 20 mg/L adenine sulfate, and 30 mg/L L-lysine. Cells were homogenized and extracts assayed for dhaB activity. A specific activity of 0.12 units per mg protein was obtained for glycerol dehydratase, and 0.024 units per mg protein for 1,3-propanediol oxido-reductase.

EXAMPLE 4

Production of 1,3-Propanediol from D-Glucose using Recombinant Saccharomyces cerevisiae

[0214]

S. cerevisiae
YPH500, harboring the groups of plasmids pMCK10, pMCK17, pMCK30 and pMCK35, was grown in a BiostatB fermenter (B Braun Biotech, Inc.) in 1.0 L of minimal medium initially containing 20 g/L glucose, 6.7 g/L yeast nitrogen base without amino acids, 40 mg/L adenine sulfate and 60 mg/L L-lysine HCl. During the course of the growth, an additional equivalent of yeast nitrogen base, adenine and lysine was added. The fermenter was controlled at pH 5.5 with addition of 10% phosphoric acid and 2 M NaOH, 30° C., and 40% dissolved oxygen tension through agitation control. After 38 h, the cells (OD600=5.8 AU) were harvested by centrifugation and resuspended in base medium (6.7 g/L yeast nitrogen base without amino acids, 20 mg/L adenine sulfate, 30 mg/L L-lysine HCl, and 50 mM potassium phosphate buffer, pH 7.0).

[0215] Reaction mixtures containing cells (OD600=20 AU) in a total volume of 4 mL of base media supplemented with 0.5% glucose, 5 ug/mL coenzyme B12 and 0, 10, 20, or 40 mM chloroquine were prepared, in the absence of light and oxygen (nitrogen sparging), in 10 mL crimp sealed serum bottles and incubated at 30° C. with shaking. After 30 h, aliquots were withdrawn and analyzed by HPLC. The results are shown in the Table 3.

3TABLE 3Production of 1,3-propanediol using recombinant S. cerevisiaechloroquine1,3-propanediolreaction(mM)(mM)1 00.22100.23200.34400.7

EXAMPLE 5

Use of a S. cerevisiae Double Transformant for Production of 1,3-Propanediol from D-Glucose where dhaB and dha T are Integrated into the Genome

[0216] Example 5 prophetically demonstrates the transformation of S. cerevisiae with dha1, dhaB2, dhaB3, and dha T and the stable integration of the genes into the yeast genome for the production of 1,3-propanediol from glucose.

[0217] Construction of expression cassettes

[0218] Four expression cassettes (dhaB1, dhaB2, dhaB3, and dha T) are constructed for glucose-induced and high-level constitutive expression of these genes in yeast, Saccharomyces cerevisiae. These cassettes consist of: (i) the phosphoglycerate kinase (PGK) promoter from S. cerevisiae strain S288C; (ii) one of the genes dhaB1, dhaB2, dhaB3, or dha T; and (iii) the PGK terminator from S. cerevisiae strain S288C. The PCR-based technique of gene splicing by overlap extension (Horton et al., BioTechniques, 8:528-535, (1990)) is used to recombine DNA sequences to generate these cassettes with seamless joints for optimal expression of each gene. These cassettes are cloned individually into a suitable vector (pLITMUS 39) with restriction sites amenable to multi-cassette cloning in yeast expression plasmids.

[0219] Construction of yeast integration vectors

[0220] Vectors used to effect the integration of expression cassettes into the yeast genome are constructed. These vectors contain the following elements: (i) a polycloning region into which expression cassettes are subcloned; (ii) a unique marker used to select for stable yeast transformants; (iii) replication origin and selectable marker allowing gene manipulation in E. coli prior to transforming yeast. One integration vector contains the URA3 auxotrophic marker (Ylp352b), and a second integration vector contains the LYS2 auxotrophic marker (pKP7).

[0221] Construction of yeast expression plasmids

[0222] Expression cassettes for dhaB1 and dhaB2 are subcloned into the polycloning region of the Ylp352b (expression plasmid #1), and expression cassettes for dhaB3 and dha T are subcdoned into the polycloning region of pKP7 (expression plasmid #2).

[0223] Transformation of yeast with expression plasmids

[0224]

S. cerevisiae
(ura3, lys2) is transformed with expression plasmid #1 using Frozen-EZ Yeast Transformation kit (Zymo Research, Orange, Calif.), and transformants selected on plates lacking uracil. Integration of expression cassettes for dhaB1 and dhaB2 is confirmed by PCR analysis of chromosomal DNA. Selected transformants are re-transformed with expression plasmid #2 using Frozen-EZ Yeast Transformation kit, and double transformants selected on plates lacking lysine. Integration of expression cassettes for dhaB3 and dha T is confirmed by PCR analysis of chromosomal DNA. The presence of all four expression cassettes (dhaB1, dhaB2, dhaB3, dha T) in double transformants is confirmed by PCR analysis of chromosomal DNA.

[0225] Protein production from double-transformed yeast

[0226] Production of proteins encoded by dhaB1, dhaB2, dhaB3 and dha Tfrom double-transformed yeast is confirmed by Western blot analysis.

[0227] Enzyme activity from double-transformed yeast

[0228] Active glycerol dehydratase and active 1,3-propanediol dehydrogenase from double-transformed yeast is confirmed by enzyme assay as described in General Methods above.

[0229] Production of 1 3-propanediol from double-transformed yeast

[0230] Production of 1,3-propanediol from glucose in double-transformed yeast is demonstrated essentially as described in Example 4.

EXAMPLE 6

Construction of Plasmids Containing DAR1/GPP2 or dha T/dhaB1-3 and Transformation into Klebsiella Species

[0231]

K. pneumoniae
(ATCC 25955), K. pneumoniae (ECL2106), and K. oxytoca (ATCC 8724) are naturally resistant to ampicillin (up to 150 ug/mL) and kanamycin (up to 50 ug/mL), but sensitive to tetracycline (10 ug/mL) and chloramphenicol (25 ug/mL). Consequently, replicating plasmids which encode resistance to these latter two antibiotics are potentially useful as cloning vectors for these Klebsielfa strains. The wild-type K. pneumoniae (ATCC 25955), the glucose-derepressed K. pneumonia (ECL2106), and K. oxytoca (ATCC 8724) were successfully transformed to tetracycline resistance by electroporation with the moderate-copy-number plasmid, pBR322 (New England Biolabs, Beverly, Mass.). This was accomplished by the following procedure: Ten mL of an overnight culture was inoculated into 1 L LB (1% (w/v) Bacto-tryptone (Difco, Detroit, Mich.), 0.5% (w/v) Bacto-yeast extract (Difco) and 0.5% (w/v) NaCl (Sigma, St. Louis, Mo.) and the culture was incubated at 37° C. to an OD600 of 0.5-0.7. The cells were chilled on ice, harvested by centrifugation at 4000 x g for 15 min, and resuspended in 1 L ice-cold sterile 10% glycerol. The cells were repeatedly harvested by centrifugation and progressively resuspended in 500 mL, 20 mL and, finally, 2 mL ice-cold sterile 10% glycerol. For electroporation, 40 μL of cells were mixed with 1-2 uL DNA in a chilled 0.2 cm cuvette and were pulsed at 200Ω, 2.5 kV for 4-5 msec using a BioRad Gene Pulser (BioRad, Richmond, Calif.). One mL of SOC medium (2% (w/v) Bacto-tryptone (Difco), 0.5% (w/v) Bacto-yeast extract (Difco), 10 mM NaCl, 10 mM MgCl2, 10 mM MgSO4, 2.5 mM KCl and 20 mM glucose) was added to the cells and, after the suspension was transferred to a 17 x 100 mm sterile polypropylene tube, the culture was incubated for 1 hr at 37° C., 225 rpm. Aliquots were plated on selective medium, as indicated. Analyses of the plasmid DNA from independent tetracycline-resistant transformants showed the restriction endonuclease digestion patterns typical of pBR322, indicating that the vector was stably maintained after overnight culture at 37° C. in LB containing tetracycline (10 ug/mL). Thus, this vector, and derivatives such as pBR329 (ATCC 37264) which encodes resistance to ampicillin, tetracycline and chloramphenicol, may be used to introduce the DAR1/GPP2 and dha T/dhaB1-3 expression cassettes into K. pneumoniae and K. oxytoca.

[0232] The DAR1 and GPP2 genes may be obtained by PCR-mediated amplification from the Saccharomyces cerevisiae genome, based on their known DNA sequence. The genes are then transformed into K. pneumoniae or K. oxytoca under the control of one or more promoters that may be used to direct their expression in media containing glucose. For convenience, the genes were obtained on a 2.4 kb DNA fragment obtained by digestion of plasmid pAH44 with the PvuII restriction endonuclease, whereby the genes are already arranged in an expression cassette under the control of the E. coli lac promoter. This DNA fragment was ligated to PvuII-digested pBR329, producing the insertional inactivation of its chloramphenicol resistance gene. The ligated DNA was used to transform E. coli DH5α (Gibco, Gaithersberg, Md.). Transformants were selected by their resistance to tetracycline (10 ug/mL) and were screened for their sensitivity to chloramphenicol (25 ug/mL). Analysis of the plasmid DNA fromitetracycline-resistant, chloramphenicol-sensitive transformants confirmed the presence of the expected plasmids, in which the Plac-dar1-gpp2 expression cassette was subcloned in either orientation into the pBR329 PvuII site. These plasmids, designated pJSP1A (clockwise orientation) and pJSP1B (counterclockwise orientation), were separately transformed by electroporation into K. pneumonia (ATCC 25955), K. pneumonia (ECL2106) and K. oxytoca (ATCC 8724) as described. Transformants were selected by their resistance to tetracycline (10 ug/mL) and were screened for their sensitivity to chloramphenicol (25 ug/mL). Restriction analysis of the plasmids isolated from independent transformants showed only the expected digestion patterns, and confirmed that they were stably maintained at 37° C. with antibiotic selection. The expression of the DAR1 and GPP2 genes may be enhanced by the addition of IPTG (0.2-2.0 mM) to the growth medium.

[0233] The four K. pneumoniae dhaB(1-3) and dha T genes may be obtained by PCR-mediated amplification from the K pneumoniae genome, based on their known DNA sequence. These genes are then transformed into K pneumoniae under the control of one or more promoters that may be used to direct their expression in media containing glucose. For convenience, the genes were obtained on an approximately 4.0 kb DNA fragment obtained by digestion of plasmid pAH24 with the KpnI/SacI restriction endonucleases, whereby the genes are already arranged in an expression cassette under the control of the E. coli lac promoter. This DNA fragment was ligated to similarly digested pBC-KS+ (Stratagene, LaJolla, Calif.) and used to transform E. coli DH5α. Transformants were selected by their resistance to chloramphenicol (25 ug/mL) and were screened for a white colony phenotype on LB agar containing X-gal. Restriction analysis of the plasmid DNA from chloramphenicol-resistant transformants demonstrating the white colony phenotype confirmed the presence of the expected plasmid, designated pJSP2, in which the dha T-dhaB(1-3) genes were subcdoned under the control of the E. coli lac promoter.

[0234] To enhance the conversion of glucose to 1,3-propanediol, this plasmid was separately transformed by electroporation into K. pneumoniae (ATCC 25955) (pJSP1A), K. pneumoniae (ECL2106) (pJSP1A) and K. oxytoca (ATCC 8724) (pJSPIA) already containing the Plac-dar1-gpp2 expression cassette. Cotransformants were selected by their resistance to both tetracycline (10 ug/mL) and chloramphenicol (25 ug/mL). Restriction analysis of the plasmids isolated from independent cotransformants showed the digestion patterns expected for both pJSP1A and pJSP2. The expression of the DAR1, GPP2, dhaB(1-3), and dha T genes may be enhanced by the addition of IPTG (0.2-2.0 mM) to the medium.

EXAMPLE 7

Production of 1,3 Propanediol from Glucose by K. pneumoniae

[0235]

Klebsiella pneumoniae
strains ECL 2106 and 2106-47, both transformed with pJSP1A, and ATCC 25955,transformed with pJSP1A and pJSP2, were grown in a 5 L Applikon fermenter under various conditions (see Table 4) for the production of 1,3-propanediol from glucose. Strain 2104-47 is a fluoroacetate-tolerant derivative of ECL 2106 which was obtained from a fluoroacetate/lactate selection plate as described in Bauer et al., Appl. Environ. Microbiol. 56, 1296 (1990). In each case, the medium used contained 50-100 mM potassium phosphate buffer, pH 7.5, 40 mM (NH4)2SO4, 0.1% (w/v) yeast extract, 10 μM CoCl2, 6.5 μM CuCl2, 100 μM FeCl3, 18 μM FeSO4, 5 μM H3BO3, 50 μM McCl2, 0.1 μM Na2MoO4, 25 μM ZnCl2, 0.82 mM MgSO4, 0.9 mM CaCl2, and 10-20 g/L glucose. Additional glucose was fed, with residual glucose maintained in excess. Temperature was controlled at 37° C. and pH controlled at 7.5 with 5N KOH or NaOH. Appropriate antibiotics were included for plasmid maintenance; IPTG (isopropyl-b-D-thiogalactopyranoside) was added at the indicated concentrations as well. For anaerobic fermentations, 0.1 vvm nitrogen was sparged through the reactor; when the dO setpoint was 5%, 1 vvm air was sparged through the reactor and the medium was supplemented with vitamin B12. Final concentrations and overall yields (g/g) are shown in Table 4.

4TABLE 4Production of 1,3 propanediol from glucose by K. pneumoniaeIPTGvitamin B12,Yield,OrganismdOmMmg/LTiter, g/Lg/g25955[pJSP1A/pJS0 0.508.116%P2]25955[pJSP1A/pJS5%0.20.55.2 4%P2]2106[pJSP1A]0 004.917%2106[pJSP1A]5%056.512%2106-47[pJSP1A]5%0.20.510.912%

EXAMPLE 8

Conversion of Carbon Substrates to 1,3-Propanediol by Recombinant K. pneumoniae Containing dar1, qpp2, dhaB, and dha T

[0236] A. Conversion of D-fructose to 1,3-propanediol by various K. pneumoniae recombinant strains:

[0237] Single colonies of K. pneumoniae (ATCC 25955 pJSP1A), K. pneumoniae (ATCC 25955 pJSP1A/pJSP2), K. pneumoniae (ATCC 2106 pJSP1A), and K. pneumoniae (ATCC 2106 pJSP1A/pJSP2) were transferred from agar plates and in separate culture tubes were subcultured overnight in Luria-Bertani (LB) broth containing the appropriate antibiotic agent(s). A 50-mL flask containing 45 mL of a steri-filtered minimal medium defined as LLMM/F which contains per liter: 10 g fructose; 1 g yeast extract; 50 mmoles potassium phosphate, pH 7.5; 40 mmoles (NH4)2SO4; 0.09 mmoles calcium chloride; 2.38 mg CoCl2.6H2O; 0.88 mg CuCl2.2H2O; 27 mg FeCl3.6H2O; 5 mg FeSO4.7H2O; 0.31 mg H3BO3; 10 mg McCl2.4H2O; 0.023 mg Na2MoO4.2H2O; 3.4 mg ZnCl2; 0.2 g MgSO4.7H2O. Tetracycline at 10 ug/mL was added to medium for reactions using either of the single plasmid recombinants; 10 ug/mL tetracycline and 25 ug/mL chloramphenicol for reactions using either of the double plasmid recombinants. The medium was thoroughly sparged with nitrogen prior to inoculation with 2 mL of the subculture. IPTG (I) at final concentration of 0.5 mM was added to some flasks. The flasks were capped, then incubated at 37° C., 100 rpm in a New Brunswick Series 25 incubator/shaker. Reactions were run for at least 24 hours or until most of the carbon substrate was converted into products. Samples were analyzed by HPLC. Table 5 describes the yields of 1,3-propanediol (3G) produced from fructose by the various Klebsiella recombinants.

5TABLE 5Production of 1,3-propanediol from D-fructose usingrecombinant Klebsiella[3G]YieldKiebsiella StrainMediumConversion(g/L)Carbon (%)2106 pBR329LLMM/F100002106 pJSP1ALLMM/F 500.6815.52106 pJSP1ALLMM/F + 11000.111.42106LLMM/F 580.265pJSP1A/pJSP225955 pBR329LLMM/F1000025955 pJSP1ALLMM/F1000.3425955 pJSP1ALLMM/F + 11000.15225955LLMM/F1000.911pJSP1A/pJSP225955LLMM/F + 1 621.020pJSP1A/pJSP2

[0238] B. Conversion of various carbon substrates to 1,3-propanediol by K. pneumoniae (ATCC 25955pJSP1A/pJSP2):

[0239] An aliquot (0.1 mL) of frozen stock cultures of K. pneumoniae (ATCC 25955 pJSP1A/pJSP2) was transferred to 50 mL Seed medium in a 250 mL baffled flask. The Seed medium contained per liter: 0.1 molar NaK/PO4 buffer, pH 7.0; 3 g (NH4)2SO4; 5 g glucose, 0.15 g MgSO4.7H2O, 10 mL 10X Trace Element solution, 25 mg chloramphenicol, 10 mg tetracycline, and 1 g yeast extract. The 100X Trace Element contained per liter: 10 g citric acid, 1.5 g CaCl2.2H2O, 2.8 g FeSO4.7H2O, 0.39 g ZnSO4.7H2O, 0.38 g CuSO4.5H2O, 0.2 g CoCl2.6H2O, and 0.3 g MnCl2.4H2O. The resulting solution was titrated to pH 7.0 with either KOH or H2SO4. The glucose, trace elements, antibiotics and yeast extracts were sterilized separately. The seed inoculum was grown overnight at 35° C. and 250 rpm.

[0240] The reaction design was semi-aerobic. The system consisted of 130 mL Reaction medium in 125 mL sealed flasks that were left partially open with aluminum foil strip. The Reaction Medium contained per liter: 3 g (NH4)2SO4; 20 g carbon substrate; 0.15 molar NaK/PO4 buffer, pH 7.5; 1 g yeast extract; 0.15 g MgSO4.7H2O; 0.5 mmoles IPTG; 10 mL 100X Trace Element solution; 25 mg chloramphenicol; and 10 mg tetracycline. The resulting solution was titrated to pH 7.5 with KOH or H2SO4. The carbon sources were: D-glucose (Glc); D-fructose (Frc); D-lactose (Lac); D-sucrose (Suc); D-maltose (Mal); and D-mannitol (Man). A few glass beads were included in the medium to improve mixing. The reactions were initiated by addition of seed inoculum so that the optical density of the cell suspension started at 0.1 AU as measured at I600 nm. The flasks were incubated at 35° C.: 250 rpm. 3G production was measured by HPLC after 24 hr. Table 6 describes the yields of 1,3-propanediol produced from the various carbon substrates.

6TABLE 6Production of 1,3-propanediol from various carbon substratesusing recombinant Klebsiella 25955 pJSP1A/pJSP21,3-Propanediol (g/L)Carbon SubstrateExpt. 1Expt. 2Expt 3Glc0.8911.6Frc0.190.230.24Lac0.150.580.56Suc0.880.62Mal0.050.030.02Man0.030.050.04

EXAMPLE 9

Improvement of 1,3-Propanediol Production using dhaBX Gene

[0241] Example 9 demonstrates the improved production of 1,3-propanediol in E. coli when a gene encoding a protein X is introduced.

[0242] Construction of expression vector pTacIQ

[0243] The E. coli expression vector, pTacIQ containing the lacIq gene (Farabaugh, P. J. 1978, Nature 274 (5673) 765-769) and tac promoter (Amann et al, 1983, Gene 25, 167-178) was inserted into the restriction endonuclease site EcoRI of pBR322 (Sutcliffe, 1979, Cold Spring Harb. Symp. Quant. Biol. 43, 77-90). A multiple cloning site and terminator sequence (SEQ ID NO:50) replaces the pBR322 sequence from EcoRI to Sphl.

[0244] Subcloning the glycerol dehydratase genes (dhaB1,2,3,X)

[0245] The region containing the entire coding region for Klebsiella dhaB1, dhaB2, dhaB3 and dhaBX of the dhaB operon from pHK28-26 was cloning into pBluescriptIIKS+ (Stratagene) using the restriction enzymes KpnI and EcoRI to create the plasmid pM7.

[0246] The open reading frame for dhaB3 gene was amplified from pHK 28-26 by PCR using primers (SEQ ID NO:51 and SEQ ID NO:52) incorporating an EcoRl site at the 5′ end and a XbaI site at the 3′ end. The product was subcloned into pLitmus29(NEB) to generate the plasmid pDHAB3 containing dhaB3.

[0247] The dhaBXgene was removed by digesting plasmid pM7 with ApaI and XbaI, purifying the 5.9 kb fragment and ligating it with the 325-bp ApaI-XbaI fragment from plasmid pDHAB3 to create pM11 containing dhaB1, dhaB2 and dhaB3.

[0248] The open reading frame for the dhaB1 gene was amplified from pHK28-26 by PCR using primers (SEQ ID NO:53 and SEQ ID NO:54) incorporating HindIII site and a consensus ribosome binding site at the 5′ end and a XbaI site at the 3′ end. The product was subcdoned into pLitmus28(NEB) to generate the plasmids pDT1 containing dhaB1.

[0249] A NotI-XbaI fragment from pM11 containing part of the dhaB1 gene, the dhaB2 gene and the dhaB3 gene with inserted into pDT1 to create the dhaB expression plasmid, pDT2. The HinDIII-XbaI fragment containing the dhaB(1,2,3) genes from pDT2 was inserted into pTacIQ to create pDT3.

[0250] Subcdoning the TMG dehydrogenase gene (dha T)

[0251] The KpnI-SacI fragment of pHK28-26, containing the TMG dehydrogenase (dha T) gene, was subcloned into pBluescriptII KS+ creating plasmid pAH1. The dha T gene was cloned by PCR from pAH1 as template DNA and synthetic primers (SEQ ID NO:55 with SEQ ID NO:56) incorporating an XbaI site at the 5′ end and a BamHI site at the 3′ end. The product was subcloned into pCR-Script(Stratagene) at the SrfI site to generate the plasmids pAH4 and pAH5 containing dha T. The pAH4 contains the dha T gene in the right orientation for expression from the lac promoter in pCR-Script and pAH5 contains dha T gene in the opposite orientation. The XbaI-BamHI fragment from pHA4 containing the dha T gene was inserted into pTacIQ to generate plasmid, pAH8. The HindII-BamHI fragment from pAH8 containing the RBS and dha T gene was inserted into pBluescriptIIKS+ to create pAH11.

[0252] Construction of an expression cassette for dha T and dhaB(1,2,3)

[0253] An expression cassette for dha T and dhaB(1,2,3) was assembled from the individual dhaB(1,2,3) and dha T subclones described previously using standard molecular biology methods. A SpeI-SacI fragment containing the dhaB(1,2,3) genes from pDT3 was inserted into pAH11 at the SpeI-SacI sites to create pAH24. A SaII-XbaI linker (SEQ ID NO 57 and SEQ ID NO 58) was inserted into pAH5 which was digested with the restriction enzymes SaII-XbaI to create pDT16. The linker destroys the XbaI site. The 1 kb SaII-MIuI fragment from pDT16 was then inserted into pAH24 replacing the existing SaII-MIuI fragment to create pDT18.

[0254] Plasmid for the over-expression of dha T and dhaB(1,2,3,X) in E. coli

[0255] The 4.4 kb NotI-XbaI fragment containing part of the dhaB1 gene, dhaB2, dhaB3 and dhaBX from plasmid pM7 was purified and ligated with the 4.1 Kb NotI-XbaI fragment from plasmid pDT18 (restoring dhaB1) to create pM33 containing the dhaB1, dhaB2, dhaB3 and dhaBX.

[0256]

E. coli
strain

[0257]

E. coli
DH5a was obtained from BRL (Difco). This strain was transformed with the plasmids pM7, pM11, pM33 or pDt18 and selected on LA plates containing 100 ug/ml carbenicillin.

[0258] Production of 1,3-propanediol

[0259]

E. coli
DH5a, containing plasmid pM7, pM11, pM33 or pDT18 was grown on LA plates plus 100 ug/ml carbenicillin overnight at 37° C. One colony from each was used to inoculate 25 ml of media (0.2 M KH2PO4, citric acid 2.0 g/L, MgSO4*7H2O2.0 g/L, H2SO4 (98%) 1.2 ml/L, Ferric ammonium citrate 0.3 g/L, CaCl2*2H2O0.2 gram, yeast extract 5 g/L, glucose 10 g/L, glycerol 30 g/L,) plus Vitamine B12 0.005 g/L, 0.2 mM IPTG, 200 ug/ml carbenicillin and 5 ml modified Balch's trace-element solution (the composition of which can be found in Methods for General and Molecular Bacteriology (P. Gerhardt et el., eds, p 158, American Society for Microbiology, Washington, D.C. 1994), final pH 6.8 (NH4OH), then filter-sterilized in 250 ml erlenmeyers flasks. The shake flasks were incubated at 37° C. with shaking (300 rpm) for several days, during which they were sampled for HPLC analysis by standard procedures. Final yields are shown in Table 4.

[0260] Overall, as shown in Table 7, the results indicate that the expression of dhaBX in plasmids expressing dhaB(1,2,3) or dha T-dhaB(1,2,3) greatly enhances the production of 1,3-propanediol.

7TABLE 7Effect of dhaBX expression on the production of 1,3-propanediolby E. coil1,3-propanediolStrainTime (days)(mg/L)*DH5a/pM7 (dhaB1,2,3,X)1150022700DH5a/pM11 (dhaB1,2,3)1<200μg2<200μgDH5a/pM33 (dhaT-dhaB1,2,3,X)21200DH5a/pDTI8 (dhaT-dhaB1,2,3)288*Expressed as an average from several experiments.

[0261] Primers:

8SEQ ID NO: 50- MCS-TERMINATOR:5 AGCTTAGGAGTCTAGAATATTGAGCTCGAATTCCCGGGCATGCGGTACCGGATCCAGAAAAAAGCCCGCACCTGACAGTGCGGGCTTTTTTTTT 3′SEQ ID NO: 51 -dhaB3-5′ end. EcoRIGGAATTCAGATCTCAGCAATGAGCGAGAAAACCATGCSEQ ID NO 52: dhaB3-3′ end XbaIGCTCTAGATTAGCTTCCTTTACGCAGCSEQ ID NO 53: dhaB1 5′ end-HindIII-SD5′ GGCCAAGCTTAAGGAGGTTAATTAAATGAAAAG 3′SEQ ID NO 54: dhaB1 3′ end-XbaI5′ GCTCTAGATTATTCAATGGTGTCGGG 3′SEQ ID NO 55: dha T 5′ end-XbaI5′ GCGCCGTCTAGAATTATGAGCTATCGTATGTTTGATTATCTG 3′SEQ ID NO 56: dha T 3′ end-BamHI5′ TCTGATACGGGATCCTCAGAATGCCTGGCGGAAAAT 3′SEQ ID NO 57: pUSH Linker1:5′ TCGACGAATTCAGGAGGA 3′SEQ ID NO 58: pUSH Linker2:5′ CTAGTCCTCCTGAATTCG 3′

EXAMPLE 10

Reactivation of the Glycerol Dehydratase Activity

[0262] Example 10 demonstrates the in vivo reactivation of the glycerol dehydratase activity in microorganisms containing at least one gene encoding protein X.

[0263] Plasmids pM7 and pM11 were constructed as described in Example 9 and transformed into E. coli DH5α cells. The transformed cells were cultured and assayed for the production of 1,3-propanediol according to the method of Honda et al. (1980, In Situ Reactivation of Glycerol-Inactivated Coenzyme B12-Dependent Enzymes, Glycerol Dehydratase and Diol Dehydratase. Journal of Bacteriology 143:1458-1465).

Materials and methods

[0264] Toluenization of Cells

[0265] The cells were grown to mid-log phase and were harvested by centrifugation at room temperature early in growth, i.e. 0.2>OD600<0.8. The harvested cells were washed 2x in 50 mM KPO4 pH8.0 at room temperature. The cells were resuspended to OD60020-30 in 50 mM KPO4 pH8.0. The absolute OD is not critical. A lower cell mass is resuspend in less volume. If coenzyme B12 is added at this point, the remainder of the steps are performed in the dark. Toluene is added to 1% final volume of cell suspension and the suspension is shaked vigorously for 5 minutes at room temperature. The suspension is centrifuged to pellet the cells. The cells are washed 2x in 50 mM KPO4 pH8.0 at room temperature (25 mls each). The cell pellet is resuspended in the same volume as was used prior to toluene addition and transfer to fresh tubes. The OD600 for the toluenized cells was measured and recorded and stored at 4 degrees C.

[0266] Whole Cell Glycerol Dehydratase Assay

[0267] The toluene treated cells were assayed at 37 degrees C for the presence of dehydratase activity. Three sets of reactions were carried out as shown below: no ATP, ATP added at 0 time, and ATP added at 10 minutes.

9No ATP:100ul 2M Glycerol100ul150 uM CoB12700ulBuffer (0.03M KPO4/0.5M KCl,pH 8.0)T = 0 minute ATP100ul 2M Glycerol100ul150 uM CoB12600ulBuffer (0.03M KPO4/0.5M KCl,pH 8.0)100ul 30 mM ATP/30 mM MnCl2T = 10 minute ATP100ul 2M Glycerol100ul150 uM CoB12700ulBuffer (0.03M KPO4/0.5M KCl,pH 8.0)

[0268] Controls were prepared for each of the above conditions by adding 100 uls buffer instead of CoB12. The tubes were mixed. 50 uls MBTH (3-Methyl-2-Benzo-Thiazolinone Hydrazone) (6 mg/ml in 375 mM Glycine/HCl pH2.7) was added to each of these tubes and continue incubation in ice water. The reaction tubes were placed in a 37 degree C water bath for a few minutes to equilibrate to 37 degree C. A tube containing enough toluenized cells for all assay tubes was placed into the 37 degree C water bath for a few minutes to equilibrate to 37 degree C. A tube containing 2.5 fold diluted (in assay buffer) 30 mM ATP/30 mM McCl2 (12 mM each) was placed into the 37 degree C water bath for a few minutes to equilibrate to 37 degree C. A 100 ul cell suspension was added to all tubes and samples were taken at 0,1,2,3,4,5,10,15,20 and 30 minutes. At every timepoint, 100 uls of reaction was withdrawn and immediately added to 50 uls ice cold MBTH, vortexed, and placed in an ice water bath. At T=10 minutes, a sample was withdrawn and added to MBTH, then 100 uls of the 2.5 fold diluted ATP/Mn was added as fast as is possible. When all samples were collected, the sample tube rack was added to a boiling water bath and boiled for three minutes. The tubes were chilled in an ice water bath for 30 seconds. 500 uls of freshly prepared 3.3 mg/ml FeCl3.6H2O, was added to the tubes and the tubes vortexed. The tubes were incubated at room temperature for 30 minutes, diluted 10 x in H2O, and then centrifuged to collect the cells and particulates. The absorbance was measured at 670 nM and the cells were diluted to keep OD under 1.0.

[0269] Example of Calculation of Activity

[0270] The observed OD670 was multiplied by the dilution factor to determine absorbance. The blank absorbance was substracted for that reaction series and the T0 A670 nM was substracted. The absolute A67OnM was divided by 53.4 (mM extinction coefficient for 30H-propioaldehyde) and the mM concentration was multiplied by any dilution of reaction during timecourse. Because 1 ml reaction was used, the concentration (umoles/m) of 30H-propionaldehyde was divided by the mgs dry weight used in the assay (calculated via OD600 and 1 OD 600=0.436 mgs dry weight) to get umoles aldehyde per mg dry weight cells.

Results

[0271] As shown in FIG. 6, whole E. coli cells were assayed for reactivation of glycerol dehydratase in the absence and presence of added ATP and Mn++. The results indicate that cells containing a plasmid carrying dhaB 1, 2 and 3 as well as protein X have the ability to reactivate catalytically inactivated glycerol dehydrogenase. Cells containing protein 1, protein 2 and protein 3 have increased ability to reactivate the catalytically inactivated glycerol dehydratase.

[0272] As shown in FIG. 7, whole E. coli cells were assayed for reactivation of glycerol-inactivated glycerol dehydratase in the absence and in the presence of added ATP and Mn++. The results show that cells containing dhaB subunits 1, 2 and 3 and X have the ability to reactivate catalytically inactivated glycerol dehydratase. Cell lacking the protein X gene do not have the ability to reactivate the catalytically inactivated glycerol dehydratase.

[0273]
FIGS. 9 and 10 illustrate that host cells containing plasmid pHK 28-26 (FIG. 1), when cultured under conditions suitable for the production of 1,3-propanediol, produced more 1,3-propanediol than host cells transformed with pDT24 and cultured under conditions suitable for the production of 1,3-propanediol. Plasmid pDT24 is a derivative of pDT18 (described in Example 9) and contains dha T, dhaB 1, 2, 3 and protein X, but lacks proteins 1, 2 and 3.

METHOD FOR THE RECOMBINANT PRODUCTION OF 1,3-PROPANEDIOL

Information

Publication Number

Date Filed

Date Published

Inventors

CPC

US Classifications

International Classifications

Abstract

Description

Claims

RELATED APPLICATIONS

PCT Information