Patent Application
20170312274
The present invention generally relates to the treatment of brain tumours, and more particularly relates to modulation of dopamine receptors to treat brain tumours.
Glioblastoma (GBM) is the most common malignant primary brain tumour in adults and has proven resistant to all therapeutic strategies attempted to date. The median survival time for GBM patients is 15 months even with standard care of treatment including surgery, radiation and chemotherapy. The alkylating agent temozolomide (TMZ) is the only chemotherapeutic of any benefit, and it is effective only transiently in a subset of patients. Long-term treatment with TMZ causes secondary mutations in GBM and increases risks of hematological malignancies. Novel therapeutic approaches based on central nervous system (CNS)-accessible drugs, which might be used in combination with TMZ or other standard treatments, are thus urgently required.
GBM growth is initiated and maintained by small subpopulations of tumourigenic cells termed GBM stem cells, which have a phenotype similar to normal neural stem cells (NSCs). GBM stem cells contribute to tumour progression and resistance to therapy such that long-term disease control is likely to require elimination of this driver population, in addition to the more differentiated tumour bulk. A deeper understanding of the regulatory mechanisms that govern the proliferation and survival of GBM stem cells will be essential to developing rational new therapies.
Neurotransmitters are endogenous chemical messengers that mediate the synaptic function of differentiated neural cells in the mature CNS. Recent studies suggest an important role of neurochemicals, for example gamma-aminobutyric acid (GABA) and glutamate, in regulating NSC fate both in early development and in adult neurogenesis. GABA regulates adult mouse hippocampal NSCs by maintaining their quiescence through the GABAA receptor, yet can also promote embryonic NSC proliferation, suggesting context specific functions. These effects may reflect influences of local or more distant neuronal activity on the NSC niche. Consistent with this idea, dopamine afferents project to neurogenic zones and depletion of dopamine decreases the proliferation of progenitor cells in the adult subventricular zone (SVZ) through D2-like receptors. Dopamine is also present in early neuronal development in the lateral ganglionic eminence (LGE) and modulates LGE progenitor cell proliferation. Serotonin signaling similarly contributes to the SVZ NSC niche.
Neurochemicals and their receptors have also been implicated in the growth and progression of many non-CNS cancers. The mechanisms whereby neurochemicals affect cancer growth are not understood. Thus, it would be desirable to determine if neurochemicals and/or their receptors have an impact on CNS cancers such as brain tumours.
It has now been determined that dopamine receptor D4 (DRD4) antagonists exhibit selective growth inhibition of brain tumour stem cells such as glioblastoma stem cells, and thus, are useful to treat brain tumours.
Thus, in one aspect of the invention, a method of treating a brain tumour in a mammal is provided, comprising administering to the mammal a DRD4 antagonist.
In another aspect of the invention, a synergistic composition is provided comprising a DRD4 antagonist in combination with an anti-neoplastic alkylating agent.
These and other aspects of the invention are described herein by reference to the following figures.
A method of treating a brain tumour in a mammal is provided comprising administering to the mammal a dopamine receptor D4 antagonist (DRD4).
The term “brain tumour” is used herein to refer to glioblastoma multiforme, also known as grade IV astrocytoma or grade IV glioma; malignant astrocytoma (also called anaplastic astrocytoma, both considered grade III); oligodendroglioma, oligoastrocytoma, mixed glioma and malignant glioma. The brain tumour may be an adult or paediatric form. Brain tumour is also meant to include medulloblastoma.
The term “mammal” is used herein to encompass human and non-human mammals, including domesticated animals such as dogs, cats, horses and the like; and undomesticated animals.
The term “DRD4”, or dopamine receptor D4, is a G protein-coupled receptor. As with other dopamine receptor subtypes, the D4 receptor is activated by the neurotransmitter dopamine. The D4 receptor is D2-like in that the activated D4 receptor inhibits the enzyme adenylate cyclase, thereby reducing intracellular cAMP. The D4 receptor is encoded by the DRD4 gene (e.g.
Antagonists of the dopamine D4 receptor include compounds that inhibit or prevent the activity of the D4 receptor, for example, by inhibiting the interaction, such as binding interaction at a binding or active site, of the receptor with its endogenous ligand or substrate. Examples of dopamine D4 receptor antagonists include, but are not limited to, A-381393, L-745,870, L-750,667, L-741,742, S 18126, fananserin, clozapine, buspirone, FAUC 213, sonepiprazole, PD 168568 dihydrochloride and PNU 96415E. Preferred antagonists include antagonists which are specific for DRD4 such as L-741,742 and PNU 96415E.
As one of skill in the art will appreciate, dopamine D4 receptor antagonists may be formulated for use to treat a brain tumour in accordance with the present invention. Thus, the selected antagonist may be formulated by combination with a pharmaceutically acceptable carrier. The expression “pharmaceutically acceptable” means acceptable for use in the pharmaceutical and veterinary arts, i.e. not being unacceptably toxic or otherwise unsuitable. As one of skill in the art will appreciate, the selected carrier will vary with the administrable route used. In this regard, the selected antagonist may be administered by any suitable route. In one embodiment, the selected antagonist is formulated for administration by infusion or injection, either subcutaneously or intravenously, and thus, may accordingly be utilized in combination with a medical-grade carrier, such as an aqueous solution in sterile and pyrogen-free form, optionally buffered or made isotonic. Thus, suitable carriers include distilled water or, more desirably, a sterile carbohydrate-containing solution (e.g. sucrose or dextrose) or a sterile saline solution comprising sodium chloride and optionally buffered. Suitable sterile saline solutions may include varying concentrations of sodium chloride, for example, normal saline (0.9%), half-normal saline (0.45%), quarter-normal saline (0.22%), and solutions comprising greater amounts of sodium chloride (e.g. 3%-7%, or greater). Saline solutions may optionally include additional components, e.g. carbohydrates such as dextrose and the like. Examples of saline solutions including additional components, include Ringer's solution, e.g. lactated or acetated Ringer's solution, phosphate buffered saline (PBS), TRIS (hydroxymethyl) aminomethane hydroxymethyl) aminomethane)-buffered saline (TBS), Hank's balanced salt solution (HBSS), Earle's balanced solution (EBSS), standard saline citrate (SSC), HEPES-buffered saline (HBS) and Gey's balanced salt solution (GBSS).
In other embodiments, the selected antagonist may be formulated for administration by routes including, but not limited to, oral, intraperitoneal, intranasal, enteral, topical, sublingual, intramuscular, intra-arterial, intramedullary, intrathecal, inhalation, ocular, transdermal, vaginal or rectal routes, and will be combined with appropriate carriers in each case. For example, compositions for oral administration via tablet, capsule or suspension may be prepared using adjuvants including sugars, such as lactose, glucose and sucrose; starches such as corn starch and potato starch; cellulose and derivatives thereof, including sodium carboxymethylcellulose, ethylcellulose and cellulose acetates; powdered tragancanth; malt; gelatin; talc; stearic acids; magnesium stearate; calcium sulfate; vegetable oils, such as peanut oils, cotton seed oil, sesame oil, olive oil and corn oil; polyols such as propylene glycol, glycerine, sorbital, mannitol and polyethylene glycol; agar; alginic acids; water; isotonic saline and phosphate buffer solutions. Wetting agents, lubricants such as sodium lauryl sulfate, stabilizers, tableting agents, anti-oxidants, preservatives, colouring agents and flavouring agents may also be present. Compositions for topical application may be prepared including appropriate carriers. Creams, lotions and ointments may be prepared for topical application using an appropriate base such as a triglyceride base. Such creams, lotions and ointments may also contain a surface active agent. Aerosol formulations may also be prepared in which suitable propellant adjuvants are used. Other adjuvants may also be added to the composition regardless of how it is to be administered, for example, anti-microbial agents may be added to the composition to prevent microbial growth over prolonged storage periods.
In the present method of treating a brain tumour such as glioblastoma, a dopamine D4 receptor antagonist is administered to a mammal in need of treatment. The terms “treat”, “treating” or “treatment” are used herein to refer to methods that favorably alter the target pathological condition, i.e. a brain tumour such as a glioblastoma, including those that moderate, reverse, reduce the severity of, or protect against, the progression of glioblastoma. Thus, for use to treat a brain tumour such as glioblastoma, a therapeutically effective amount of a dopamine D4 receptor antagonist is administered to a mammal in need of treatment. The term “therapeutically effective amount” is an amount of DRD4 antagonist required to treat the tumour, while not exceeding an amount which may cause significant adverse effects. DRD4 antagonist dosages that are therapeutically effective will vary on many factors including the individual being treated and the extent of the disease to be treated. In one embodiment, dosages within the range of about 0.1-100 mg/m2 are appropriate for use to treat a brain tumour such as glioblastoma, for example, a dosage in the range of 1-100 mg/m2, or 1-50 mg/m2.
In an embodiment of the invention, the DRD4 antagonist may be used to treat a tumour such as glioblastoma together with an anti-neoplastic alkylating or alkylating-like agent, i.e. an agent that disrupts DNA (tumour cell DNA), for example by attachment of the agent or an alkyl group from the agent to the DNA, e.g. to the guanine base of DNA at the number 7 nitrogen atom of its purine ring. Examples of such alkylating agents include, but are not limited to, nitrogen mustards such as cyclophosphamide, chlorambucil, uramustine, ifosfamide, melphalan and bendamustinetriazenes; nitrosoureas such as carmustine, lomustine, semustine, ethylnitrosourea (ENU) and streptozocin; alkyl sulfonates such as busulfan; procarbazine, altretamine and triazines such as dacarbazine, mitozolomide and temozolomide; and platinum-based chemotherapeutic agents such as cisplatin, carboplatin, nedaplatin, oxaliplatin, satraplatin and triplatin tetranitrate.
The DRD4 antagonist may be administered in conjunction with an alkylating agent, either together with the alkylating agent or separately, simultaneously or at different times. The use of a DRD4 antagonist with the alkylating agent has been found to have a synergistic effect, i.e. an effect that is greater than the expected additive effect of the DRD4 antagonist and the alkylating agent on a brain tumour such as glioblastoma. The DRD4 antagonist and the alkylating agent may be administered in any suitable administrable form. Preferred routes of administration include orally and by injection. Generally, the dosages of each of the DRD4 antagonist and the alkylating agent will be decreased when used in combination due to the synergy of the combination, in comparison to the dosages of each when used alone to treat a brain tumour. Thus, therapeutically effective dosages of DRD4 antagonist and the alkylating agent for use in a combination treatment include DRD4 antagonist in a dosage range of about 0.1-50 mg/m2, for example, 0.5-10 mg/m2, such 1-5 mg/m2, and the alkylating agent such as temozolomide, in a dosage range of about 1-250 mg/m2, for example, 50-150 mg/m2, such as 60-80 mg/m2, e.g. 75 mg/m2, or a dosage of the alkylating agent such as temozolomide which is less than 100 mg/m2.
In another aspect of the invention, a synergistic composition is provided comprising a DRD4 antagonist in combination with an antineoplastic alkylating agent such as one of a nitrogen mustard such as cyclophosphamide, chlorambucil, uramustine, ifosfamide, melphalan and bendamustinetriazenes; a nitrosourea such as carmustine, lomustine, semustine, ethylnitrosourea (ENU) and streptozocin; an alkyl sulfonate such as busulfan; procarbazine, altretamine or a triazine such as dacarbazine, mitozolomide and temozolomide; or a platinum-based chemotherapeutic agent such as cisplatin, carboplatin, nedaplatin, oxaliplatin, satraplatin or triplatin tetranitrate. The combination may additionally include pharmaceutically acceptable carriers as described, which are appropriate with respect to the administrable form of the composition. The combination includes suitable dosages of each of the DRD4 antagonist and the alkylating agent also as described.
Embodiments of the present invention are illustrated in the following specific example which is not to be construed as limiting.
GNS and NS lines were grown as an adherent monolayer culture in serum free medium as described previously (Pollard et al. 2009. Cell stem cell 4, 568-580). Primary tumour cells were freshly dissociated from the patient sample in artificial cerebrospinal fluid followed by treatment with an enzyme cocktail at 37° C. (Singh et al. 2003. Cancer research 63, 5821-5828). BJ fibroblast, Daoy and C8-D1A and U-2 0S (ATCC) were maintained in DMEM with 10% FBS.
The neurotransmitter library was purchased from BIOMOL international (now integrated into Enzo Life Sciences). The library contains 680 compounds covering thirteen classes of neurochemicals. The compounds were supplied in DMSO at 10 mM concentration in 96-well medium deep plates and stored at −80° C. All compounds for retest were purchased from Tocris Bioscience.
Cells were seeded in laminin-coated 384 well plates at a density of 2000 cells per well. Compounds were added at a concentration of approximately 5 μM and incubated with cells for five days at 37° C. Cell viability was assessed by measuring Alamar Blue incorporation according to the manufacturer's protocol (Invitrogen). Percent growth inhibition was calculated relative to the control DMSO wells.
The potency and selectivity of hits from the primary screen was tested in 8-point two-fold dilution series ranging from 50 μM-0.39 μM concentrations with more lines of GNS, NS and fibroblast. Experimental conditions were the same as in primary screen. IC50 was calculated based on an approximate observed value. Fold selectivity was calculated as IC50 of BJ/IC50 of any GNS cells with lowest IC50.
All mouse procedures were approved by the Hospital for Sick Children's Animal Care Committee. To validate the in vivo effect of L-741,742 and PNU 96415E, 2×105 GNS cells in 200 μl of PBS and matrigel (1:1) were injected subcutaneously into flanks of non-obese diabetic/severe combined immunodeficient (NOD/SCID) female mice. 8 mice (2 tumours per mouse except for one mouse in control group that has one tumour) were maintained for each group; control (15 tumours), L-741,742 (16 tumours) and PNU 96415E (16 tumours). L-741,742 and PNU 96415E were dissolved in 40% 2 hydroxy β-cyclodextrin (Sigma). Mice were treated three days after tumour implantation. Both L-741,742 and PNU 96415E were injected (20 mg/kg) i.p for 5 days on two days off until the end point. Control group was injected with 40% 2 hydroxy β-cyclodextrin. Tumour growth was monitored with microcalipers until tumour volume reached 17 mm in any one tumour from any group and all mice were sacrificed at the same end point. Dissected tumour volume was measured and mass was determined by weighing.
cAMP Assay
cAMP levels were measured with an ELISA-based cAMP assay kit purchased from Cell Signaling (#4439). GNS (G362) cells were seeded overnight in a 96 well plate and treated with forskolin (30 μM) for 15 minutes, or pretreated with DRD4 agonist A412997 (30 μM) for 15 minutes followed by forskolin treatment. Cells were lysed and processed as per manufacturer's protocol.
All grouped data are presented as mean±SEM unless otherwise stated in figure legends. Statistical significance difference between groups was assessed by Student's I-test,
The GenBank accession number for the PNU 96415E treated GNS microarray data described in this manuscript is GSE62714.
GNS cells (G362 and G411) were treated with PNU 96415E (25 μM) for 0 h (Control), 24 h and 48 h, and cells were lysed for RNA at each time point using RNeasy kit (Qiagen). RNA extracted from the samples was hybridized on Affymetrix Human Gene 1.0 ST arrays using standard protocol (TCAG, Toronto, Ontario, Canada). RMA background correction, quantile normalization and log 2 transformation were applied to the CEL files using the Bioconductor affy package (R 3.0.1, affy package version 1.38.1). Batch correction was applied using ComBat function from sva (3.6.0) and gene annotations were retrieved using hugene10sttranscriptcluster.db (8.0.1). Genes were ranked based on the average log fold change (log FC) of the 2 treated GNS (G411 and G362) at 24 h or 48 h to vehicle (0 h) samples. The data were analyzed using GSEA (Subramanian et al., Proc. Natl. Acad. Sci. 2005. 102(43), 15545-15550) with parameters set to 2000 gene-set permutations and gene-sets size between 8 and 500. The gene-sets included in the GSEA analyses were obtained from KEGG, MsigDB-c2, NCI, Biocarta, JOB, Netpath, HumanCyc, Reactome and the Gene Ontology (GO) databases, updated Oct. 14, 2013 (http://baderlab.org/GeneSets). An enrichment map (version 1.2 of Enrichment Map software (Merico et al., 2010. PLoS One 5(11), e13984) was generated for each comparison using enriched gene-sets with a False Discovery Rate<0.02% and the overlap coefficient set to 0.5.
Limiting dilution assay was performed as described previously (Tropepe et al., 1999. Developmental Biology 208, 166-188). Primary tumours were dissociated into single cell suspension and seeded into a 96-well plate with 10 point-2 fold serial dilution starting from 2000 cells to 4 cells/well, 6 wells for each dilution per plate. Each well was scored for neurosphere formation after 14 days of incubation. Percent of wells not containing spheres for each cell density was calculated and plotted against the cells per well, regression lines were plotted and x-intercept value at 0.37 was calculated at 95% confidence interval using Sigma Plot, which gives the number of cells required to form at least one neurosphere.
Western blots were performed using the following antibodies; anti-DRD4 antibody at 1:750 (Millipore# MABN125), anti-activated MAPK at 1:2500 (Promega#V803A), anti-ERK1/2 at 1:2000 (Promega#V114A), anti-βactin at 1:10,000 (Sigma), anti-LC3B at 1:1000 (Cell Signaling #3868), anti-p62 at 1:1000 (BD Bioscience), anti-LAMP1 at 1:2000 (Developmental Studies Hybridoma Bank), anti-mono and polyubiquitinylated protein conjugates (FK2) at 1:1000 (Enzo Life Sciences).
5 μg of short hairpin targeting DRD4 (RHS4533-EG1815; TRCN0000014453; Thermo Scientific) or control shRNA construct targeting eGFP (RHS4459; Thermo Scientific) were transfected in 1×106 GNS cells using the Amaxa Nucleofector kit (VPG-1004) and Nucleofector II electroporator (Amaxa Biosystem) according to manufacturer's protocol. After 24 h transfection, cells were briefly selected with puromycin for 48 h and seeded for proliferation assay without selection. Two wells from each transfection were maintained after electroporation; one well was lysed to check for knockdown by western blot and the other well was seeded for proliferation assay.
Analysis was performed at the Bioimaging facility at Mt Sinai Hospital, Toronto. Cells were harvested, pelleted and fixed in 2% glutaraldehyde in 0.1M sodium cacodylate buffer, rinsed in buffer, post-fixed in 1% osmium tetroxide buffer, dehydrated in a graded ethanol series followed by propylene oxide, and embedded in EMBed 812 resin. Sections 100 nm thick were cut on an RMC MT6000 ultramicrotome, stained with uranyl acetate and lead citrate and viewed in an FEI Tecnai 20 TEM.
A human phospho-kinase antibody array was purchased from R&D systems (Cat# ARY003). This array contains capture antibodies for 43 kinases in duplicate on nitrocellulose membrane. GNS (G362) and NS (hf5205) lines were treated with L-741,742 (10 μM) and PNU 96415E (25 μM) along with a DMSO control for 24 h, and cells were then processed according to the manufacturer's protocol. Signal intensity was quantified using ImageJ.
2000 GNS cells (G362 and G481) were seeded in a 96 well plate and treated with a combination of 6-point 2-fold dose series of either L-741,742 (6.25 μM-0.39 μM) or PNU 96415E (25 μM-1.56 μM) with 10-point 2-fold dose series of temozolomide (100 μM-0.39 μM) in 60 point combination doses. The cells were incubated with a combination of the two drugs for five days and then checked for cell viability using the alamar blue assay. Combination index (CI) plot and CI value was calculated for 5 point dose series in each combination using the programme COMPUSYN. Data points taken for COMPUSYN analysis are temozolomide (100, 50, 25, 12.5 and 6.25 μM) in combination with either L-741,742 (6.25, 3.12, 1.56, 0.78 and 0.39 μM) or PNU 96415E (25, 12.5, 6.25, 3.12 and 1.56 μM).
To identify compounds that selectively inhibit the growth of GBM-derived neural stem cells (GNS), proliferation assays were established for three different cell types: GNS cells, normal human fetal neural stem cells (NS) and the BJ human fibroblast cell line. GNS cells were patient-derived tumour cells established and maintained as an adherent monolayer in serum-free medium with epidermal growth factor (EGF) and basic fibroblast growth factor (FGF); these cell lines retain tumour-initiating potential and regeneration of tumour cellular hierarchies when implanted into immunocompromised mice. GNS cells display many characteristics of normal NS cells including expression of the markers, Nestin and SOX2, and the ability to self-renew and to partially differentiate. Thus, NS cells serve as a well-matched control for their neoplastic GNS counterparts. To eliminate compounds with non-specific cytotoxic effects, NS-selective hits were defined as those that target both NS and GNS cells, but not fibroblasts. Compounds were then filtered for those that showed more activity towards GNS cells compared to NS cells, and these were termed ‘GNS-selective’ compounds.
A BIOMOL library of 680 neuroactive compounds were screened against three GNS lines (GliNS1, G179 and G144), two NS lines (hf5205, hf5281) and the BJ fibroblast line at a concentration of 5 μM for five days (
Twenty nine compounds that showed a selective effect on GNS and NS cells compared to fibroblasts were selected for further study. The 29 compounds were retested in a dose response series (0.39-50 μM) in the same cell populations as in the primary screen. From this secondary screen, ten compounds were selected that showed more than 8-fold selectivity towards GNS and NS cells compared to fibroblasts. Fold selectivity was calculated as IC50 of BJ/IC50 of any of the NS or GNS lines that showed the lowest IC50. These ten NS-selective compounds were PNU-96415E, L-741,742, Ifenprodil tartrate, LY-165,163, MDL-72222, Tropanly 3,5-dimethylbenzoate, N,N-Diethyl-2-(4-(phenylmethyl)phenoxy)ethanamine, (±)-Tropanyl-2-(4-chlorophenoxy)butanoate, MG-624 and Ivermectin. One compound, cis-(±)-N-Methyl-N-[2-(3,4-dichlorophenyl)ethyl]-2-(1-pyrrolidinyl)cyclohexamine 2HBr that showed 8-fold selectivity was not available for further study. The ten NS-selective compounds were enriched for dopaminergic, serotonergic and cholinergic classes (
PNU 96145E and L-741,742 were retested alongside a panel of other commercially available DRD4 antagonists (L-745,870 and PD 168568) to determine whether they showed a similar effect on growth inhibition of GNS cells. When tested against six GNS and four NS lines, all DRD4 antagonists showed selectivity toward ONS cells with differing potency (IC50), in the order of L-741,742 (1.5-6.2 μM)>L-745,870 (3.1-6.2 μM)>PNU 96415E (6.25 μM)>PD168568 (25-50 μM). L-741,742 and PNU 96415E are specific DRD4 antagonists and showed the greatest selectivity towards GNS cells (
To confirm that the effect of DRD4 antagonism was not merely specific to GNS cell lines, L-741,742 and PNU 96415E were tested in freshly isolated primary GBM patient tumour cells (n=3) using a primary in vitro limiting dilution assay (
To test the effects of L-741,742 and PNU 96415E in vivo, GNS cells were subcutaneously injected into the flanks of immuno-compromised NOD scid gamma (NSG) mice followed by treatment with an intraperitoneal injection of PNU 96415E (20 mg/kg), L-741,742 (20 mg/kg), or vehicle, with a dosing regimen of five days on and two days off until tumours reached the institutional volumetric cutoff of 17 mm in any one mouse (
To determine if DRD4 antagonists exert their effects directly through the DRD4 receptor, it was first confirmed that DRD4 was expressed in both GNS and NS cells by western blot (
To validate DRD4 as a therapeutic target in GBM and determine if loss of its function phenocopies the effect of PNU 96415E and L-741,742, shRNA-mediated knockdown experiments were performed and the effect on cell proliferation was measured. Five lentiviral shRNA constructs from The RNAi Consortium (TRC) against human DRD4 were tested using shRNA-eGFP as a positive control. Only one out of five shRNA-DRD4 constructs (shRNA-DRD4-4: TTGAGGCCGCACAGTACGGGC (SEQ ID NO: 3)) caused consistent knockdown at 72 hours post transfection. Reduced DRD4 expression after transduction of the shRNA-DRD4 construct was confirmed in two separate GNS lines (
The mechanism of action for a DRD4 antagonist was then characterized through global gene expression profiles. Two GNS lines (G362 and G411) were treated with PNU 96415E (25 μM) for 24 h and 48 h and analyzed for differential effects of PNU 96415E on gene expression by microarray analysis. Gene set enrichment analysis (GSEA) was used to identify pathways enriched in differentially regulated genes upon PNU 96415E treatment. Genes were ranked based on the average log-fold change of PNU96415E treated GNS cells at 2411 or 48 h compared to control. Gene-sets (pathways) with a false discovery rate (FDR) equal to or less than 0.2% (0.002) were considered significantly altered upon PNU 96415E treatment (
Prompted by the pronounced up-regulation of autophagy genes in response to DRD4 inhibition, autophagy status in GNS cells was assessed using the autophagy marker LC3-II. When autophagy is induced, the cytoplasmic form of LC3-I (microtubule associated protein 1 light chain3-I) is conjugated to phosphatidylethanolamine (PE) to form LC3-II, which then translocates to the autophagosome membrane. This conversion of LC3-I to LC3-II serves as a hallmark for autophagosome formation and can be measured as a molecular mass shift in western blots and as LC3+ puncta by immunocytochemical staining. L-741,742 (10 μM) and PNU 96415E (25 μM) treatment in GNS cells (G411 and G362) caused an increase in levels of LC3B-II consistent with accumulation of autophagosomes (
An increase in LC3-II levels, and autophagosome number, can result from either the induction of autophagy or the inhibition of autophagic flux at a late stage. Autophagic flux is defined as the complete process of autophagy from the formation of phagophore to the fusion of autophagosome with lysosomes and subsequent degradation of autophagic cargo. This flux can be measured by assessing LC3-II turnover in the presence or absence of inhibitors of lysosomal degradation such as chloroquine, which prevents acidification of lysosomes and subsequent degradation of autolysosome contents. In chloroquine treated cells, an autophagy inducer will increase LC3-II levels, where as an autophagy blocker will not change LC3-II levels. In the presence of chloroquine, L-741,742 and PNU 96415E treatment did not increase LC3-II levels compared to control, despite the fact both drugs increased LC3-II levels when administered alone (
Clearance of the autophagy-specific substrate p62, which reflects autophagy turnover, was then assessed. As predicted for a block in autophagic flux, p62 accumulated along with the increase in LC3B-II in L-741,742 or PNU 96415E treated GNS cells (
To confirm that the impairment of the autophagy/lysosomal degradation pathway induced by L-741,742 and PNU 96415E was due to inhibition of DRD4, autophagic flux was assessed after shRNA knockdown of DRD4 in GNS cells. Increased levels of LC3-II in DRD4 knockdown cells was observed compared to sh-eGFP transduced controls (
DRD4 Antagonists Trigger a G0/G1 Phase Arrest
As DRD4 antagonists inhibit proliferation of GNS cells accompanied by decreased expression of DNA replication and cell cycle genes, the effect of DRD4 antagonists on the cell cycle was then assessed. Flow cytometric analysis of DNA content in G411 and G362 cells treated with either L-741,742 or PNU 96415E revealed a G0/G1 arrest and a reduction S phase and G2/M phase cells in a time dependent manner (
To determine how DRD4 receptor antagonism in GNS cells may mediate growth inhibition, the phosphorylation status of 43 kinases and substrates implicated in various signaling pathways in GNS cells versus NS cells was determined using a dot blot assay. Cells were treated with L-741,742 (10 μM) and PNU 96145E (25 μM) for a period of 24 h and protein lysates were harvested and assessed with a phosphoprotein antibody array (
The effect of DRD4 antagonism on ERK1/2 phosphorylation in GNS and NS cells was validated by western blot at various time intervals and a decrease in ERK1/2 phosphorylation over time in GNS cells but not in NS cells was observed (
DRD4 Antagonists are Synergistic with TMZ
The effect of DRD4 antagonists in conjunction with the conventional chemotherapeutic agent, temozolomide (TMZ) was evaluated to assess the clinical potential of this drug pair combination. Synergy in both G362 and G481 cells using the combination of TMZ with either L-741,742 or PNU 96415E was assessed. Both L-741,742 and PNU 9641E exhibited striking synergism with TMZ in vitro (
This study represents the first systematic interrogation of all neurochemical classes on human GNS cell growth and proliferation. Of the 13 neurochemical classes tested, it was found that modulation of dopaminergic, serotonergic and cholinergic pathways predominantly affected GNS cells. It was further shown that DRD4 antagonists selectively inhibit the growth of GNS cells and reduce the colony forming potential of freshly dissociated GBM cells, both in vitro and in an in vivo patient-derived xenograft model. The selectivity of DRD4 antagonists such as L-741,742 and PNU 96415E for GNS cells is mediated by on-target inhibition of the DRD4 receptor, which is expressed in both GNS cells and primary glioblastoma patient samples, and concomitant suppression of the downstream effectors ERK1/2. At a cell biological level, DRD4 antagonism impairs a late step in the autophagy/lysosomal degradation pathway, resulting in massive accumulation of autophagic vacuoles, lysosomal cargo, and non-degraded ubiquitinated substrates. This effect is accompanied by a G0/G1 cell cycle arrest and non-apoptotic cell death.
Relevant portions of references referred to herein are incorporated by reference.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/CA2015/051185 | 11/13/2015 | WO | 00 |
| Number | Date | Country | |
|---|---|---|---|
| 62079759 | Nov 2014 | US |
