Patent Application
20220401428
This application contains a sequence listing submitted in accordance with 37 C.F.R. 1.821, named 13177N 2025US DESPA sequence listing.txt, created on Oct. 1, 2020, having a size of 2,146 bytes, which is incorporated herein by this reference.
The present invention relates to methods for treating a subject with Alzheimer's Disease, microhemorrhages, and neurological deficits. Some aspects of the present invention relates to methods for treating a subject with Alzheimer's Disease, microhemorrhages, and neurological deficits with a composition that increases epoxyeicosatrienoic acids. The present invention also relates to a method of treating or preventing Alzheimer's Disease comprising administering an agent that increases vascular LRP1 expression.
Alzheimer's disease (AD) is caused by an imbalance between production and clearance of aggregation-prone amyloid-β (Aβ) species linked to a genetic predisposition (i.e., familial AD; fAD) or pathologic aging processes (i.e., sporadic AD; sAD)1-4. Mechanisms underlying pathologic aging remain unknown. The endocrine hormone amylin modulates brain amyloid composition in both sporadic and familial forms of AD and that pancreatic overexpression of human amylin in a rat model of AD (rat amylin is non-amyloidogenic5) accelerates pathologic aging, whereas genetic or pharmacologic suppression of amylin expression is protective. By staining and imaging of amylin and Aβ in brain tissues from humans with and without fAD, AD rats expressing human amylin and AD rats expressing non-amyloidogenic rat amylin, amylin accumulated in small vessels, paired with Aβ in neuritic plaques and also formed independent neuritic plaques and space-filling lesion within neurons, independent of tau pathology. In cerebrospinal fluid (CSF), amylin and Aβ42 levels were inversely correlated with age in sAD, mild cognitive impairment and normal aging. A synergy between increased CSF amylin levels and AD pathology was seen in AD rats expressing human amylin. The mechanisms underlying accelerated aging and behavior changes in AD rats expressing human amylin involved hypoxic-ischemic brain injury leading to neurodegeneration. These pathological processes were reduced by pharmacological activation of protective mechanisms within endothelial cells, which lowered amylin deposition in brain capillaries. Genetic suppression of amylin in AD rats increased body weight, consistent with amylin's action as a satiety hormone6, but also reduced neurologic deficits. The results show that amylin dyshomeostasis is a causative mechanism of pathological aging and suggest that drugs reducing amylin deposition in brain capillaries or preventing amylin from interacting with Aβ pathology could provide benefit in AD.
Amylin is co-synthesized with insulin by pancreatic β-cells7 and normally crosses the blood-brain barrier participating in the central regulation of satiety6. It is degraded by the insulin degrading enzyme8, like insulin and Aβ. In patients with type-2 diabetes, amylin forms pancreatic amyloid7 (
Cerebral small vessel diseases are significant contributors to vascular cognitive impairment and dementia (VCID)1 and a common pathological finding in the brains of individuals with Alzheimer's disease (AD)2-4. Mechanisms underlying small vessel-type dysfunction include cerebral amyloid angiopathy (CAA) caused by vascular deposition of amyloid β (Aβ) protein, arteriolosclerosis associated with aging, hypertension, and cardiovascular risk factors'. In addition, accumulating evidence from clinical studies demonstrates that obesity, insulin resistance and diabetes are strong risk factors for cerebral microvascular dysfunction6 and the sporadic form of AD7-9. Correcting hyperglycemia, the hallmark of diabetic states, is not entirely effective at reestablishing vascular endothelial function10,11 nor reducing cognitive decline12-15. Thus, blood glucose levels per se may not be the correct target for cerebrovascular disease and cognitive decline risk reduction.
Recent reports from multiple laboratories16-21 show that vascular lesions and Aβ plaques in the brains of individuals with AD have abundant deposits of amylin, a ˜4 kDa hormone synthesized and co-secreted with insulin by pancreatic β-cells22. Amylin normally crosses the blood-brain barrier (BBB)23 and participates in the central regulation of satiation24, but it also forms pancreatic amyloid in patients with type-2 diabetes22. In patients with type-2 diabetes, aggregated amylin accumulates in the cardiovascular system (systemic amylin dyshomeostasis)25-27 and is associated with microcirculatory disturbances and activation of hypoxia signaling in kidneys through attachment to red blood cells27. To uncover cerebral effects associated with systemic pancreatic amylin dyshomeostasis, Rats that express human amylin in the pancreatic β-cells18,28, as amylin from rodents is non-amyloidogenic29 and less prone to deposition in blood vessels18 were previously studied. Human amylin-expressing rats slowly accumulate aggregated amylin in the brain microvasculature with aging (>12-month old rats) leading to microhemorrhages18 and late-onset behavioral changes18,28 that are similar to those in AD rat models. At the cellular and molecular levels, accumulation of aggregated amylin in brain capillaries is associated with astrocyte activation, neuroinflammation and oxidative stress18,28.
Cell responses to stress conditions involve reprograming gene expression through non-coding RNAs such as microRNAs (miRNAs)30. They inhibit protein synthesis by suppressing the translation of protein coding genes or by degrading the mRNA30. Paralog miRNAs miR-103 and miR-107 have previously been shown to be dysregulated in AD31. These miRNAs also appear to mediate stress-suppressed translation of the low-density lipoprotein receptor-related protein 1 (LRP1)32, an apolipoprotein E (APOE) receptor that binds and internalizes soluble Aβ at the abluminal side of the BBB33-35. Because amylin deposition in the brain microvasculature affects vascular endothelial cells (ECs)18, amylin stress dysregulates miR-103/107 impairing LRP1 synthesis and Aβ efflux across the BBB antagomirs against miR-103/107 modulate the amylin-mediated stress effect on LRP1.
To determine whether amylin deposition in the brain microvasculature is associated with impaired Aβ efflux, amylin-Aβ interaction in the human brain microvasculature was explored and carried out in vivo analyses of Aβ efflux across the BBB in rats that express amyloid-forming human amylin in pancreatic β-cells versus littermates that express non-amyloidogenic rat amylin. To further define the mechanism, an in vitro BBB model of Aβ transcytosis was used in which the EC monolayer was exposed to amylin-mediated stress; antisense microRNAs were used in an attempt to rescue endothelial LRP1 expression. The instant results provide a basis for targeting amylin-mediated cellular pathways at the blood-brain interface to reduce or prevent AD pathology.
The presently-disclosed subject matter meets some or all of the above-identified needs, as will become evident to those of ordinary skill in the art after a study of information provided in this document.
This Summary describes several embodiments of the presently-disclosed subject matter, and in many cases lists variations and permutations of these embodiments. This Summary is merely exemplary of the numerous and varied embodiments. Mention of one or more representative features of a given embodiment is likewise exemplary. Such an embodiment can typically exist with or without the feature(s) mentioned; likewise, those features can be applied to other embodiments of the presently-disclosed subject matter, whether listed in this Summary or not. To avoid excessive repetition, this Summary does not list or suggest all possible combinations of such features.
One embodiment of the present invention is a method of reducing the amount of systemic amylin comprising: administering to a subject in need thereof an effective amount of a composition that increases epoxyeicosatrienoic acids. In some embodiments of the present invention, the composition that increases epoxyeicosatrienoic acids is a soluble epoxide hydrolase inhibitor. In further embodiments of the present invention, the composition that increases epoxyeicosatrienoic acids is a soluble epoxide hydrolase inhibitor. In some embodiments, the soluble epoxide hydrolase inhibitor is 1-(1-propanoylpiperidin-4-yl)-3-[4-(trifluoromethoxy)phenyl]urea (TPPU). In other embodiments of the invention, TPPU is administered orally or intravenously. In further embodiments of the present invention, the subject is administered a dose of about 20 micrograms per kilogram TPPU.
Other embodiments of the present invention include a method of treating a subject diagnosed with a neurological disease or deficiency, said method comprising: identifying a subject diagnosed with a neurological disease or deficiency and administering an effective amount of a composition that increases epoxyeicosatrienoic acids. In further embodiments of the present invention, the composition that increases epoxyeicosatrienoic acids is a soluble epoxide hydrolase inhibitor. In some embodiments, the soluble epoxide hydrolase inhibitor is 1-(1-propanoylpiperidin-4-yl)-344-(trifluoromethoxy)phenyllurea (TPPU). In other embodiments of the invention, TPPU is administered orally or intravenously. In further embodiments of the present invention, the subject is administered a dose of about 20 micrograms per kilogram TPPU. In some embodiments of the instant invention, the neurological disease or deficiency is selected from: hypoxic-ischemic brain injury, Alzheimer's Disease, neurological deficits, brain microhemorrhages, or axonal degeneration.
Another embodiment of the present invention includes a method of treating Alzheimer's Disease comprising: administering an agent that increases LRP1 expression to a subject in need thereof. In some embodiments of the present invention, the upregulators of LRP1 are antagomirs against miRNAs. In further embodiments of the present invention, the administration occurs for at least 12 hours. In some embodiments of the present invention, the miRNA is miR-103 agcagcauuguacagggcuauga (SEQ ID NO: 5). In other embodiments of the present invention, the miRNA is miR-107 agcuucuuuacaguguugccuugu (SEQ ID NO: 6). In some embodiments of the present invention, the miRNA is administered to the subject at a concentration of about 100 nM. In further embodiments of the present invention, and further comprising administering both miRNA is miR-103 agcagcauuguacagggcuauga (SEQ ID No: 5) and miR-107 agcuucuuuacaguguugccuugu (SEQ ID NO: 6) to the subject.
The presently-disclosed subject matter will be better understood, and features, aspects and advantages other than those set forth above will become apparent when consideration is given to the following detailed description thereof. Such detailed description makes reference to the following drawings, wherein:
While the disclosure is susceptible to various modifications and alternative forms, specific embodiments thereof have been shown by way of example in the drawings and are herein described below in detail. It should be understood, however, that the description of specific embodiments is not intended to limit the disclosure to cover all modifications, equivalents and alternatives falling within the spirit and scope of the disclosure as defined by the appended claims.
The details of one or more embodiments of the presently-disclosed subject matter are set forth in this document. Modifications to embodiments described in this document, and other embodiments, will be evident to those of ordinary skill in the art after a study of the information provided in this document. The information provided in this document, and particularly the specific details of the described exemplary embodiments, is provided primarily for clearness of understanding and no unnecessary limitations are to be understood therefrom. In case of conflict, the specification of this document, including definitions, will control.
While the terms used herein are believed to be well understood by those of ordinary skill in the art, certain definitions are set forth to facilitate explanation of the presently-disclosed subject matter.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which the invention(s) belong.
All patents, patent applications, published applications and publications, GenBank sequences, databases, websites and other published materials referred to throughout the entire disclosure herein, unless noted otherwise, are incorporated by reference in their entirety.
Where reference is made to a URL or other such identifier or address, it understood that such identifiers can change and particular information on the internet can come and go, but equivalent information can be found by searching the internet. Reference thereto evidences the availability and public dissemination of such information.
As used herein, the abbreviations for any protective groups, amino acids and other compounds, are, unless indicated otherwise, in accord with their common usage, recognized abbreviations, or the IUPAC-IUB Commission on Biochemical Nomenclature (see, Biochem. (1972) 11(9):1726-1732).
Although any methods, devices, and materials similar or equivalent to those described herein can be used in the practice or testing of the presently-disclosed subject matter, representative methods, devices, and materials are described herein.
Following long-standing patent law convention, the terms “a”, “an”, and “the” refer to “one or more” when used in this application, including the claims. Thus, for example, reference to “a biomarker” includes a plurality of such biomarkers, and so forth.
Unless otherwise indicated, all numbers expressing quantities of ingredients, properties such as reaction conditions, and so forth used in the specification and claims are to be understood as being modified in all instances by the term “about”. Accordingly, unless indicated to the contrary, the numerical parameters set forth in this specification and claims are approximations that can vary depending upon the desired properties sought to be obtained by the presently-disclosed subject matter.
As used herein, the term “about,” when referring to a value or to an amount of mass, weight, time, volume, width, length, height, concentration or percentage is meant to encompass variations of in some embodiments ±10%, in some embodiments ±5%, in some embodiments ±1%, in some embodiments ±0.5%, and in some embodiments ±0.1% from the specified amount, as such variations are appropriate to perform the disclosed method.
As used herein, ranges can be expressed as from “about” one particular value, and/or to “about” another particular value. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. It is also understood that each unit between two particular units are also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.
As used herein, “optional” or “optionally” means that the subsequently described event or circumstance does or does not occur and that the description includes instances where said event or circumstance occurs and instances where it does not. For example, an optionally variant portion means that the portion is variant or non-variant.
As used herein, the term “subject” refers to a target of administration. The subject of the herein disclosed methods can be a mammal. Thus, the subject of the herein disclosed methods can be a human, non-human primate, horse, pig, rabbit, dog, sheep, goat, cow, cat, guinea pig or rodent. The term does not denote a particular age or sex. Thus, adult and newborn subjects, as well as fetuses, whether male or female, are intended to be covered. A “patient” refers to a subject afflicted with a disease or disorder. The term “patient” includes human and veterinary subjects.
As used herein, the term “treatment” or “treating” refers to the medical management of a subject with the intent to cure, ameliorate, stabilize, or prevent a disease, pathological condition, or disorder. This term includes active treatment, that is, treatment directed specifically toward the improvement of a disease, pathological condition, or disorder, and also includes causal treatment, that is, treatment directed toward removal of the cause of the associated disease, pathological condition, or disorder. In addition, this term includes palliative treatment, that is, treatment designed for the relief of symptoms rather than the curing of the disease, pathological condition, or disorder; preventative treatment, that is, treatment directed to minimizing or partially or completely inhibiting the development of the associated disease, pathological condition, or disorder; and supportive treatment, that is, treatment employed to supplement another specific therapy directed toward the improvement of the associated disease, pathological condition, or disorder.
As used herein, the term “prevent” or “preventing” refers to precluding, averting, obviating, forestalling, stopping, or hindering something from happening, especially by advance action. It is understood that where reduce, inhibit or prevent are used herein, unless specifically indicated otherwise, the use of the other two words is also expressly disclosed. As will be understood by those of ordinary skill in the art, when the term “prevent” or “prevention” is used in connection with a prophylactic treatment, it should not be understood as an absolute term that would preclude any modicum of pain in a subject. Rather, as used in the context of prophylactic treatment, the term “prevent” can refer to inhibiting the development of or limiting the severity of, arresting the development of pain, and the like.
As used herein, the terms “administering” and “administration” refer to any method of providing a pharmaceutical preparation to a subject. Such methods are well known to those skilled in the art and include, but are not limited to, oral administration, transdermal administration, administration by inhalation, nasal administration, topical administration, intravaginal administration, ophthalmic administration, intraaural administration, intracerebral administration, rectal administration, and parenteral administration, including injectable such as intravenous administration, intra-arterial administration, intramuscular administration, and subcutaneous administration. Administration can be continuous or intermittent. In various aspects, a preparation can be administered therapeutically; that is, administered to treat an existing disease or condition. In further various aspects, a preparation can be administered prophylactically; that is, administered for prevention of a disease or condition.
As used herein, the term “neurological disease or deficiency” refers broadly to diseases of the nervous system including the brain, spinal cord, and nerves. Neurological disease or deficiency may include for example: hypoxic-ischemic brain injury, Alzheimer's Disease, behavioral deficits, brain microhemorrhages, or axonal degeneration.
As used herein, the term “neurological deficits” refers broadly to deficiencies with neurological function. Neurological deficits may refer to a reduction or loss of a behavior or skill as compared to normal subjects. Neurological deficits may occur in balancing ability, motor coordination, reaction time, speed, short-term memory recognition, memory recall, and the like. Deficits in these abilities are readily ascertainable by those skilled in the art.
The term “effective amount” refers to an amount that is sufficient to achieve the desired result or to have an effect on an undesired condition. For example, a “therapeutically effective amount” refers to an amount that is sufficient to achieve the desired therapeutic result or to have an effect on undesired symptoms, but is generally insufficient to cause adverse side effects. The specific therapeutically effective dose level if or any particular patient will depend upon a variety of factors including the disorder being treated and the severity of the disorder; the specific composition employed; the age, bodyweight, general health, sex and diet of the patient; the time of administration; the route of administration; the rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed and like factors well known in the medical arts. For example, it is well within the skill of the art to start doses of a compound at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. If desired, the effective daily dose can be divided into multiple doses for purposes of administration. Consequently, single dose compositions can contain such amounts or submultiples thereof to make up the daily dose. The dosage can be adjusted by the individual physician in the event of any contraindications. Dosage can vary, and can be administered in one or more dose administrations daily, for one or several days. Guidance can be found in the literature for appropriate dosages for given classes of pharmaceutical products.
Human samples: The protocol concerning the use of biopsy from patients was approved in agreement with Institutional Review Board approval and informed consent was obtained prospectively. Human brain tissues and cerebrospinal fluid (CSF) samples were used in this study. Brain sections from familial Alzheimer's disease (fAD) patients, and age-matched cognitively normal (CN) individuals (temporal cortex areas) were provided by Queen College of London, United Kingdom. Frozen brain tissue and sections from fAD patients (temporal cortex areas) were provided by King's College of London, United Kingdom. Brain tissues from sporadic AD patients (sAD) and age-matched CN individuals (Brodmann areas 9 and 21/22) were provided by the Alzheimer's Disease Center at the University of Kentucky, USA. Brain samples from CN individuals were used as controls. Frozen brain tissues from fAD patients and controls were used for biochemical analyses. For immunohistochemistry, formalin fixed, paraffin embedded brain tissues from sAD patients, fAD patients and age-matched controls were used. CSF samples from AD patients and CN individuals were provided by the University of Gothenburg, Sweden. CSF samples from patients with mild cognitive impairment (MCI) and from CN individuals were provided by the University of Kentucky, University of Washington and Wake Forest University, USA. Data on CSF Aβ42 were provided by the study centers. CSF Aβ levels in samples from the University of Gothenburg, University of Kentucky, University of Washington, and Wake Forest University were measured with the INNO-BIA AlzBio3 multiplex assay (FujiRebio). Details on patient information can be found in Table 5.
Genetic analysis. The specific association of genetic variants in LAPP identified by the International Genomics of Alzheimer's Project (IGAP) consortium was analyzed. These results correspond to the meta-analysis of genotyped and imputed data (7,055,881 SNPs, 1000G phase 1 alpha imputation, Build 37, Assembly Hg19) of 17,008 Alzheimer's disease cases and 37,154 controls. To assess rare genetic variants in IAPP (ENST00000240652) in Alzheimer's disease, the exome sequencing data from a UK cohort of 331 AD cases was analyzed. The variability of the IAPP gene in a cohort of healthy elderly samples from the Healthy Exomes (HEX) database was also analyzed. HEX includes data corresponding to the exome sequencing of from 468 individuals categorized as cognitively healthy and neuropathologically normal [REF Guerreiro]. Given the finding of p.Asn64fs in a healthy sample aged >90 years, loss of function variants described in gnomAD and the respective available information for age was examined (Tables 2 and 3).
Experimental animals: This investigation conforms to the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85-23, revised 2011) and was approved by the Institutional Animal Care and Use Committees at University of Kentucky. Alzheimer's disease (AD) rats (TgF344-19, provided by Charles River Laboratory) are Fischer rats that express human Aβ (A4) precursor protein (hAPP) gene with the Swedish mutation (K595N/M596L), and presenilin 1 (PSEN1) gene with a deletion of exon 9, driven by mouse prion promoter (Prp)28. HIP rats (provided by Charles River Laboratory) are Sprague-Dawley rats that overexpress (3-fold) human amylin in the pancreatic β-cells29. The AD rats were crossbred with HIP rats to generate rats that are triple transgenic for human amylin, APP, and PSEN1 (ADHIP rat). ADHIP, AD and wild-type (WT) (n=17/group; n=51 rats in total) were used in behavior testing and physiological analyses. Amylin knock-out in AD model (AD-AKO) was generated by crossbreeding AD rats with AKO rats (the generation of AKO rat model was described previously15). AD and AD-AKO littermates (n=6/group; n=12 rats in total) were used for behavior testing and physiological analyses. Blood glucose and weights were measured monthly in all rats.
Antibodies and reagents The following primary antibodies were used: Amylin (1:200, T-4157, Bachem-Peninsula Laboratories), human Aβ (1:300, clone 6E10, Biolegend), Ibal (1:300, 019-19741, Wako), CD68 (1:200, MCA341GA, Biorad), myelin basic protein (1:5,000, AMAB91064, clone CL2829, Sigma), phosphorylated Tau (1:400, clone ATB, MN1020, Pierce). The following secondary antibodies were used: Biotinylated anti-mouse IgG (1:300, BA-2000, Vector), anti-rabbit IgG (1:300, BA-1100, Vector), AP-conjugated anti-mouse IgG (1:100, A3562, Sigma), Alexa Fluor 568 anti-rabbit IgG plus (A11036) and Alexa Fluor 647 anti-mouse IgG plus (A21236), Alexa Fluor 488 anti-mouse IgG (A11029) and Alexa Fluor 488 anti-rabbit IgG (A11034) from ThermoFisher. The following reagents were used: DAB (3,3′-diaminobenzidine tetrahydrochloride) chromogen substrate (ab64238, Abcam), AEC (3-amino-9-ethylcarbazole) chromogen substrate (SK-4200, Vector), StayGreen/AP chromogen substrate (ab156428, Abcam), Luxol fast blue dye (AC212170250, Acros Organics), potassium ferrocyanide (AC211095000, Acros Organics), Congo Red (C580-25, Fisher), citrate buffer (S1699, Dako), Thioflavin S (1326-12-1, Sigma), Sudan black (4197-25-5, Sigma), lyophilized amidated human amylin peptide (AS-64451-05, Anaspec), BCA (23225, ThermoFisher) and Micro-BCA (23235, ThermoFisher) protein assays, DNA purification kit (K0512, ThermoFisher), Sybr green qPCR mix (1725150, Biorad). Primers were from IDT.
Assessment on animal health Animals in study groups (n=17/group) were followed longitudinally. Animals were considered unhealthy when animals display any sign of lethargy, sarcopenia, respiratory distress, gait abnormality or dehydration. Percentage of healthy animals vs age was then analyzed using Log-rank test.
Bio-fluids collection from animals Bio-fluids were collected from animals every two months. The collection was performed in isoflurane-anesthetized animals. CSF was collected by inserting needles through the cisterna magna without making any incision at this region. Protocol was described in Ref 30. CSF was drawn by simple syringe aspiration. The yielded fluid volume did not exceed 120 μL per each collection. Blood was collected by inserting needles through the tail vein. Blood was drawn by simple syringe aspiration. EDTA was added to blood samples to prevent coagulation. The collection volume did not exceed 500 μL per each collection. Red blood cells and plasma were separated by centrifugation at 1,000×g for 10 minutes at 4° C. Samples were stored in −80° C.
Pharmacological treatment on animals To increase plasma eicosanoids levels, the animals were treated with TPPU (1-Trifluoromethoxyphenyl-3-(1-propionylpiperidin-4-yl) urea, N-[1-(1-Oxopropyl)-4-piperidinyl]-N′-[4-(trifluoromethoxy)phenyl]-urea), a soluble epoxide hydrolase inhibitor (sEHi) (HY-101294, MedChem Express). Treatment with sEHi has been shown to lower the level of circulating amylin24. 12 months old (n=5; early-stage) and 16 months old (n=6; late stage) animals were subjected to treatment with sEHi. For treatment at early-stage, the drug was administered through drinking water (3 mg/L, daily) and intravenous injection (20 μg/kg, once a week) to ensure equal intake for each animal. For treatment at late-stage, the drug was administered through and intravenous injection (20 μg/kg, daily, 1 month) and then through drinking water (3 mg/L, daily, 1 month). Amount of water intake was measured daily.
Behavior testing Forelimb use test/Cylinder test, inclined plane, hind limb clasping test. The protocol for these behavioral tests were described previously15. Animal forelimb deficit was evaluated by forelimb-to-wall contact time in cylinder test. Animal balancing ability was tested by the angle at which the animal started to free-fall on the raising inclined plane. Abnormalities in the animal hind limbs were assessed by scoring the severity of hind limb clasping.
Rotarod assessment Motor coordination and balance were tested by the rotarod (Rotamex 5, Columbus Instrument, OH) test27. Animals were acclimatized to the static rod 2 days prior to testing. On the testing day, the speed of the rotarod was increased from 0 rpm to 40 rpm within 2 minutes. Each rat was tested on the rotarod for a total of 4 trials per day over 5 consecutive days. For each training day, the smallest value of latency-to-fall for each rat was discarded. The remaining read-outs were averaged, and a group average was calculated for each genotype.
Novel Object Recognition (NOR) The NOR test was used to test for short-term recognition, as previously described27.
Morris Water Maze Spatial learning and long-term memory retention were tested in a 1.5 m diameter Morris Water Maze, as previously described15. Animals were given 4 learning trials per day for four consecutive days using random starting locations. Animals were allowed to stand on the platform for 30 seconds after the first trial and 15 seconds after each additional trial. If the animals failed to locate the platform, they were picked up and put on the platform for 15 seconds. To assess reference memory, a probe trial was given 24 hours after the fourth acquisition day. Trials were recorded by EthoVision XT software (Noldus, VA).
Composite z-score analysis for behavior tests The composite z-score analysis method was previously described31. For each behavior test, mean and standard deviation were calculated from individual variables collected at 12 months and 16 months old animals across the experimental groups. Z-score for each animal in each behavior test was calculated using the following equation:
The composite score for each animal was calculated by averaging z-score from each behavior test.
Histology and demyelination scoring Myelination in rat brains was analyzed by staining with Luxol fast blue (LFB) dye. Scoring analysis method was performed as described previously15. Microhemorrhages in rat brains were stained with Prussian blue dye and analyzed as described previously15. Congo red staining was performed on the human brains as previously11 described.
Immunohistochemistry. Formalin fixed, paraffin embedded brain and pancreas tissues from humans, ADHIP, AD, WT, and AD-AKO rats were used. Tissues were processed as previously described11,14,15,27. After tissue rehydration, the endogenous peroxidase was quenched in 3% H2O2 in methanol for 30 minutes. For amylin and Aβ antigen retrieval, sections were treated with 100% formic acid for 5 minutes, followed by 0.5% pepsin digestion in 5 mM HCl for 20 minutes at 37° C. To retrieve intra-neuronal amylin antigen (rat brains) as well as other antigens, tissue sections were heated in citrate buffer for 30 minutes. Non-specific antibody binding was blocked by 15% horse serum for 1 hour at room temperature (RT). Primary antibodies against amylin, human Aβ, Iba1, CD68 or myelin basic protein (MBP) was incubated on slides overnight at 4° C. Sections were then washed and incubated with secondary antibodies. Signal was developed with DAB or AEC peroxidase substrate. For co-staining with two antibodies, after the signal was developed for the first antibody, sections were then rinsed in water. Non-specific antibody binding was blocked with 10% normal goat serum, and the sections were incubated with the second primary antibody overnight at 4° C. Sections were then washed and incubated with AP-conjugated secondary antibody, and developed with StayGreen/AP chromogen substrate. Sections were mounted with aqueous mounting medium. The specificity of the amylin antibody in both human and rat brain tissues was established in previous studies11,14,15,27.
Imaging analysis Wide-field images of stained tissue sections were generated by stitching images obtained from the 10× objective lens (Nikon NIS-Element Software). Higher magnification images for specific tissue area were obtained using the 40× objective lens. The immunoreactivity signal for each antibody was analyzed by ImageJ. Clearly defined-signal pixels were selected to establish the RGB profile of the color of interest. The threshold for each color signal was adjusted to reduce background noise. The established RGB profile and threshold were applied to a Macro script command, using Color Deconvolution plugin in ImageJ. The staining area was calculated using the following equation:
The imaging pixels area is 1280×1024. μm2 per pixels2 is 0.84 for 10× objective lens and 0.05 for 40× objective lens. The staining area (μm2) was normalized to the total area of the tissue section.
Immunofluorescence staining Immunofluorescence staining for brain tissue sections was previously described14,15 with modifications. Antigen retrieval for amylin and Aβ was described in the immunohistochemistry session above. Primary antibodies are amylin, human Aβ and phosphorylated Tau. For Thioflavin S staining, after secondary antibody incubation, slides were incubated in 0.5% Thioflavin S for 15 minutes at room temperature. Slides were then incubated for 3 minutes in 70% ethanol, 3 minutes in 0.2% Sudan black and 3 minutes in 70% ethanol, before washing and mounting.
Magnetic resonance imaging (MRI) MRI scans were performed on ADHIP, AD and WT littermate rats using a horizontal 7T nuclear MRI scanner (ClinScan, Brucker BioSpin MRI, Ettlingen, Germany) as previously described15. Coronal T2-weighted images were obtained using generic parameters: field of view (FOV) 40 mm, repetition time (TR) 3000 ms, echo time (TE) 24 ms, slice thickness 1 mm, inter-slice gap 1 mm, 7 slices. Ventricular hyperintensities volume was calculated by the method described previously15.
Amylin aggregation and injection Lyophilized amidated human amylin peptide was dissolved in PBS pH 7.4 to the concentration of 50 μM. The mixture was incubated in 37° C. for 72 hours with occasional shaking to allow amylin to form aggregates. Every 3 days, aggregated human amylin solution was injected into 7 months old AD rat via tail vein (60 μg/kg). The age-matched AD control group received the same volume of PBS per injection without aggregated human amylin. The animals received injections for 60 days. Bio-fluids from each animal were collected before- and post-injection.
Isolation of rat brain capillaries Rat brain capillaries were isolated following the protocol described previously15. For quality control, capillaries were stained with Texas red dye and were examined under the confocal microscope. Freshly isolated brain was snapped frozen, crushed and homogenized in homogenate buffer (150 mM NaCl, 50 mM Tris-HCl, 50 mM NaF, 2% Triton X-100, 0.1% SDS, 1% (v/v) protease and phosphatase inhibitors, pH 7.5). Homogenates were centrifuged at 17,000×g for 30 minutes at 4° C. The supernatant was separated from pellet after centrifugation and were then used for all experiments.
Protein extraction Frozen human brain tissues were homogenized in homogenate buffer (150 mM NaCl, 50 mM Tris-HCl, 50 mM NaF, 2% Triton X-100, 0.1% SDS, 1% (v/v) protease and phosphatase inhibitors, pH 7.5). Homogenates were centrifuged at 17,000×g for 30 minutes at 4° C. The supernatant was separated from pellet after centrifugation and was then used for all experiments. For rat brain tissue, half hemisphere was used for histological analyses, and the other half was used for brain capillary isolation and other protein extractions. Rat brain tissues were subjected to serial extraction method. Frozen brain samples were homogenized with 1% Triton buffer (25 times tissue volume) containing 20 mM Tris, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100 (v/v), 1% (v/v) protease and phosphatase inhibitors, pH 7.5. The homogenates were left on ice for 15 minutes. The homogenates were centrifuged at 15,000 rpm for 15 minutes at 4° C. The supernatant (Triton-soluble fraction) was separated from the pellet. 5 M Guanidine HCl (with 50 mM Tris, pH 8.0) solution was added to the pellet (10 times the pellet volume). Homogenates were rocked for 3-4 hours at room temperature. The samples were stored at −80° C. until analysis. Before analysis, the Guanidine HCl (GuHCl) samples were diluted at 1:10 ratio with lysate buffer (1% NP-40 (v/v), 150 mM NaCl, 10 mM Tris, 2 mM EGTA, 50 mM NaF). The samples were centrifuged at 16,000×g for 20 minutes at 4° C. The supernatant (GuHCl-soluble fraction) was separated from the pellet. BCA protein estimation was performed for Triton-soluble fractions. MicroBCA protein estimation was performed for GuHCl fractions.
Enzyme-linked immune absorbance assay (ELISA) Levels of amylin in human brain samples were measured using sandwich amylin ELISA from Millipore (EZHA-52K). Levels of amylin in human CSF and animal samples were measured using amylin sandwich ELISA from R&D system (EIA-AMY). Aβ levels in animal CSF were measured using high sensitivity electrochemiluminescence ELISA (MSD 6E10, K15200G-2, Meso Scale Discovery). Hypoxia-inducible transcription factor 1α and hypoxia-inducible transcription factor 2α (MBS764727, MBS2601406, MyBioSource), arginase-1 and arginase-2 (MBS289817, MBS7216305 MyBioSource), rat erythropoietin (EPO) ELISA (442807, Biolegend) and VCAM-1 (LS-F24285; LS Bio) were performed according to the manufacturers protocol.
Arginase activity Arginase activity in rat brain capillaries were measured using arginase activity kit (MAK112, Sigma). Experimental protocol and analysis were performed according to manufacture instruction.
Mitochondria DNA extraction and analysis Protocol for quantifying mitochondrial DNA content was described in Ref 32. DNA was extracted from frozen rat brain tissues using genomic DNA purification kit, following manufactures protocol. DNA purity was assessed by ensuring the A260/A280 ratio was >1.8. Mitochondrial DNA (mtDNA) content was measured using Sybr green based real-time (RT) qPCR. The primers were specific for the regions of mitochondrial gene 16S rRNA (forward: 5′-TCCCAATGGTGCAGAAGCTATTA-3′(SEQ ID NO: 1); reverse: 5′-AAGGAGGCTCCATTTCTCTTGTC-3′(SEQ ID NO: 2). House-keeping gene primers were specific for beta actin (forward: 5′-CTAAAGGTGACCAATGCTGGAGG-3′(SEQ ID NO: 3); reverse: 5′-TGGCATAGAGGTCTTTACGGATG-3′(SEQ ID NO: 4)). 3. The RT-qPCR thermocycling conditions were 3 minutes at 98° C., 30 seconds at 95° C., and 40 cycles of 30 seconds denaturation at 95° C., 30 seconds annealing at 60° C. and 30 seconds extension at 72° C. The fluorescence signal intensities of the PCR products were recorded in Biorad CFX96 RT-qPCR system. Final data was analyzed with Biorad CFX manager 2.1 software and Excel. The relative mtDNA copy number was calculated as the difference in the numbers of threshold cycles (Cq) between the nuclear gene and the mtDNA gene (ACq), in which the amount of mtDNA was calculated per cell, 2(2-ΔCq), accounts for the 2 beta actin copies in each cell nucleus.
Statistical analysis Gaussian distribution of the data was tested with D′Agostino-Pearson and Kolmogorov-Smirnov test. Parametric comparison between two groups was performed using two-tailed Student's t tests. Non-parametric comparisons between two groups was performed using Mann-Whitney U-tests. Relationships between two variables was analyzed by correlation analysis. Z-scores and data from the Morris Water Maze and Rotarod were analyzed by repeated measures analysis. All models were linear regression with a first-order autoregressive (AR) covariance structure, except for Rotarod for age 12M AD vs ADHIP, where the AR structure did not converge and the simpler compound symmetry structure was fit instead. All models included main effects for group (i.e., genotype or treatment) and trial day or age, as well as a cross-product interaction between group and day (or age) to test for differences in the slope of the group learning curves. Post-hoc tests were performed to assess group differences on each testing day. Repeated analyses were performed using SAS 9.4® PROC MIXED (SAS Institute, Inc.; Cary, N.C.; USA). Data are presented as individuals, means±SEM or means. Difference between groups was considered significant when P<0.05. All other analyses were performed using GraphPad Prism 5.0 software.
Example 1: Brain tissues from PSEN1 and APP mutation carriers were investigated for amylin deposition and interaction with AD pathology. Temporal cortex homogenates from fAD brains had higher amylin concentrations, compared to the cognitively normal (CN) group (
In neuritic plaques, immunostaining showed the presence of amylin in small proteinaceous fragments (
Analyses of the association of common and rare amylin variants with the risk of developing AD revealed no statistically significant results (Tables 2 and 3).
Mixed amylin-Aβ plaques with amylin amyloid-positive cores were identified also in brain tissues from patients with sAD (
Vascular amylin deposition appeared to coincide with cerebral amyloid angiopathy (CAA;
The results suggest that amylin secreted from the pancreas may modulate brain amyloid composition and contribute to small vessel disease in both familial and sporadic forms of AD.
Example 2: To assess the interaction between amylin dyshomeostasis and AD pathology, a combination of AD rat models, including AD rats expressing non-amyloidogenic rat amylin and AD rats expressing human amylin in the pancreatic β-cells (ADHIP rats) was used. As the negative control for amylin, AD rats with deleted amylin gene (AD-AKO rats), which were generated by crossing AD rats with amylin knockout (AKO) rats were used.
Compared to AD rats, ADHIP littermates had greater motor and cognitive deficits (
Comorbidities include sarcopenia as measured by reduction in body weights, cardiac hypertrophy as measured by heart weight-to-body weight ratio, glucose dysregulation showed as dehydration; number of animals with lethargy, cataract formation in the eyes, and abnormal gait are included. Data are means±SEM. ADHIP vs AD: P 21 0.05 *, P<0.001 ***, P<0.0001 ****; by two-tailed, unpaired Student's t test.
Altered composition of secreted amylin in ADHIP rats was reflected in the brain magnetic resonance imaging (MRI;
Patchy areas of amylin-positive neurons were found in the brains of ADHIP rats and AD rats intravenously infused with human amylin (
These results show that ADHIP rats mirror findings in fAD brains and that pancreatic overexpression of human amylin in AD rats accelerates aging and behavior deficits; genetic suppression of amylin expression is protective.
Example 3: Based on the MRI analysis and brain weights, amylin-associated pathology likely triggers hypoxic-ischemic brain injury.
In ADHIP rats, the plasma level of erythropoietin (EPO; a marker of systemic hypoxia), the brain mitochondrial DNA content and the protein levels of hypoxia inducible factors (HIFs) and vascular cell adhesion molecule 1 (VCAM-1) in brain capillary lysates are higher than in AD rats (
Thus, peripherally-mediated amylin dyshomeostasis induced hypoxic-ischemic brain injury and axonal degeneration as a result of progressive amylin deposition in small blood vessels through mechanisms that appeared to involve upregulation of vascular adhesion proteins.
Example 4: Endothelial cell (EC)-formed epoxyeicosatrienoic acids (EETs) modulate VCAM-1 expression23 and protected against cardiac amylin deposition in a rat model of amylin dyshomeostasis24. Treatment with an inhibitor of soluble epoxide hydrolase (sEH), the enzyme that degrades EETs, reduced behavior deficits in ADHIP rats based on data from 2 separate cohorts at different disease stages, i.e., the late stage of amylin dyshomeostasis (>16 months old ADHIP rats) and the early stage of amylin dyshomeostasis (ES; 12 months old ADHIP rats) (
These data indicate that pharmacological suppression of amylin secretion reduced behavior deficits in AD rats by protecting brain capillaries from accumulation of amylin and consequent hypoxic-ischemic brain injury.
In summary, amylin dyshomeostasis modulates brain amyloid composition in human AD and that pancreatic overexpression of human amylin in AD rats accelerates pathologic aging via mechanisms that involve mixed amylin-Aβ pathology and small vessel ischemic disease (SVID); genetic or pharmacologic suppression of amylin expression is protective. Given the fact that SVID is an early pathological process in both sAD25 and fAD26, the data suggest that detection of amylin dyshomeostasis and therapeutic strategies to mitigate capillary accumulation of amylin could reduce SVID and cognitive decline in humans.
In sAD, central amylin dyshomeostasis is explained by aging-related insulin resistance that triggers hyperamylinemia18. Central amylin dyshomeostasis in fAD was not anticipated, given the earlier onset of disease with reduced age-dependence of amyloid pathology. The mechanisms underlying brain amylin accumulation in fAD remain unknown. The results showed no association of common and rare amylin variants with the risk of developing AD. Given the general low allelic frequency of variants in the gene, large cohorts of well characterized cases and controls will be needed to conclusively determine the role of rare variants in this gene in AD.
Overexpression of human amylin in AD and non-AD rats15,27 leads to an increase of blood amylin levels later in life, although rats overexpress human amylin through their entire lives. Thus a steady accumulation of amylin in tissues appears to provoke an aging-induced deficiency in protein homeostasis leading to brain amylin accumulation and behavior deficits. Future studies need to test whether the interaction of amylin dyshomeostasis with AD proteins (Aβ and tau) are specifically important to induce cognitive decline in humans.
Both overexpression and deletion of the amylin gene affect physical appearance with aging in rats. Genetic suppression of pancreatic amylin in AD rats has brought to light a potential paradoxical relationship between increased body weight and brain function. These findings suggest that amylin may play a critical role in aging, energy metabolism and brain function in ways more complex than initially considered.
The protocol concerning the use of autopsy tissues from patients was approved by the University of Kentucky Institutional Review Board (IRB) and informed consent was obtained prospectively. Paraffin embedded human brain tissues (n=9) provided by the Alzheimer's Disease Center biobank at the University of Kentucky was used to explore amylin-Aβ interaction in the brain microvasculature. Formalin fixed dorsolateral frontal cortex (Brodmann area 9) tissue was used from six autopsied individuals>80 years of age at death and three age-matched cognitively unaffected (CU) individuals. The disease group included patients with AD without diabetes (n=3) and AD with diabetes (n=3). The absence/presence of diabetes was determined during life (at longitudinal clinical visits) by patient or caregiver self-report and the use of diabetic medications. Neuropathological information, neuritic amyloid plaques (Consortium to Establish a Registry for Alzheimer's Disease; CERAD), Braak NFT stage and CAA severity, along with age and sex of each individual included in the present study are summarized in Table 3.
This investigation conforms to the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85-23, revised 1996) and was approved by the Institutional Animal Care and Use Committee at the University of Kentucky.
To study the impact of systemic pancreatic amylin dyshomeostasis on the Aβ efflux from the brain, rats were used that express human amylin in pancreatic β-cells (i.e., HIP rats)36. The HIP rats (non-AD rats) develop systemic amylin dyshomeostasis by ˜10-12 months of age, which is characterized by amylin deposition in the pancreas36 and extra-pancreatic tissues 18,25-28, including the brain microvasculature18. Breeding pairs were purchased from Charles River Laboratory. Wild type (WT) littermates expressing non-amyloidogenic rat amylin served as controls.
In vitro BBB model of Aβ42 transcytosis with amylin-induced stress at the blood side. An in vitro BBB model described previously37 was used with modifications related to amylin deposition on the EC monolayer and consequent effects on the Aβ transport across the EC monolayer. Briefly, primary rat brain microvascular endothelial cells (Cell Applications Inc) were plated on 24-well Transwell-Clear inserts with 0.4 μm pore polycarbonate membrane (Costar, Corning, N.Y., USA) and primary rat brain astrocytes (Sigma) were cultured at the bottom wells. Barrier integrity was measured from the trans-endothelial electrical resistance (TEER) as described previously37,38 using the EVOM2 meter with STX-3 electrodes (World Precision Instruments). Maximum TEER was achieved within 8-10 days in culture. BBB permeabilities to human amylin (10 μM; Anaspec; AS-60254-1), rat amylin (10 μM; American Peptide) and DMSO (1 mM; vehicle) were assessed using FITC-Dextran 4 kDa (Fisher Scientific) diluted in Hank's Balanced Salt Solution (HBSS) buffer with 0.1% BSA (HBSS-BSA) as a paracellular diffusion marker. Permeability coefficients were calculated using the formula; P=(ΔQ/Δt)/(A*C0), (ΔQ/Δt)=rate of FITC-Dextran change; A=surface area of insert (0.33cm2); C0=Initial FITC-Dextran input.
In the Aβ42 transcytosis experiments, the EC monolayer was treated with a medium containing human amylin (10 μM) or vehicle (DMSO) for 24 hours. After washing, the luminal chamber was replaced with HBSS-BSA, and the abluminal chamber with Aβ(1-42)-FAM (5 μM; Bachem) or FITC-Dextran, respectively. Aβ(1-42) samples were collected from the luminal chamber for the measurement of the Aβ(1-42)-FAM and FITC-Dextran fluorescence intensities and Aβ(1-42) transcytosis quotient (TQ) as described previously38: TQ=(Aβ(1-42)−FAMluminal/Aβ(1-42)−FAMinput)/(FITC-Dextranluminal−FITC-DEXTRANinput).
To study the role of miRNA signaling in amylin-induced suppression of endothelial LRP1 expression, transfection of rat brain microvascular ECs was used with miR-103-3p (MCR01039)agcagcauuguacagggcuauga(SEQ ID NO: 5), miR-107-3p (MCR01045)agcuucuuuacaguguugccuugu(SEQ ID NO: 6) and control (MCH00000) (https://www.abmgood.com/mirna-mimic-negative-control-mch00000.html). Antagomir miR-103-3p (IH-320345-05-0005)(SEQ ID NO: 5), miR-107-3p (IH-320348-05-0005)(SEQ ID NO: 6) and negative control (IN-001005-01-05) (https://www.biocompare.com/22445-RNA/4995709-miRIDIAN-microRNA-Hairpin-Inhibitor-Negative-Control-1-5-nmol/#productspecs) (Dharmacon Inc.) were used in an attempt to rescue LRP1 expression. All transfections were done using RNAiMAX (Invitrogen) as per manufacturer's recommended protocol. Briefly, ECs were plated at 50% confluency in 6-well plates followed by co-transfection with either 100 nM of 103-3p and 107-3p mimics or antagomirs along with their respective negative controls. After 12-hours, antagomir-treated cell groups were further treated with 10 uM human amylin for 24-hours. After 36-hours of transfection, cells were harvested for Western blot analysis.
Total RNA was isolated using RNAqueous total RNA isolation kit according to manufacturer's protocol (Invitrogen, AM1914). cDNA synthesis and amplification were done using iTaq Universal SYBR Green One-Step Kit (Biorad; 1725151) with the following primer sequences: LRP1: forward (Fwd) 5′-TTGTGCTGAGCCAAGACATC-3′(SEQ ID NO: 7), reverse (Rev) 5′-GGCGTGGAAGACATGTAGGT-3′(SEQ ID NO: 8); and GAPDH: Fwd 5′- GCTGCGTTTTACACCCTTTC-3′(SEQ ID NO: 9), Rev 5′-GTTTGCTCCAACCAACTGC-3′(SEQ ID NO: 10) (IDT, Inc, USA). For miRNA quantification, cDNA was synthesized from total RNA using miRNA cDNA synthesis kit with poly (A) polymerase (ABMgood, G902). cDNA was amplified using SYBR Green mastermix (Biorad) along with miRNA specific primers from (rno-miR-103-3p, MPR00332; rno-miR-107-3p, MPRO0335; RNU6 house Keeping gene, MP-r99998) (ABMgood). Data were analyzed using the 2−ΔΔCt method, and experiments were normalized to GAPDH or U6 miRNA
CellTiter 96® AQueous One Solution Cell Proliferation Assay (MTS) (Promega) was used to assess cytotoxicity of aggregated amylin on the EC monolayer.
For immunohistochemistry, formalin-fixed, paraffin-embedded brain tissues from humans and rats were processed as described before16,18,28,39. Antibodies against amylin (1:200; clone E5; SC-377530; Santa Cruz) and Aβ (1:300; CST2454; Cell Signaling Technology) were the primary antibodies. Biotinylated IMPRESS horse anti-rabbit-AP conjugated (2 drops/slide; MP-5401; Vector), biotinylated horse-anti mouse (1:300, BA-2000, Vector) were secondary antibodies. The specificity of the amylin antibody in both human and rat brain tissues was established in previous studies16,18,28,39. Pancreatic tissue from rats with deleted amylin gene (AKO rats) was the negative control for amylin. The generation of AKO rat model was described previously18.
In immunofluorescence experiments, formalin-fixed, paraffin-embedded human brain tissue was used and processed as previously described16,18,39, brain capillaries from HIP and WT rats isolated as previously described18. and cultured ECs. Anti-amylin (1:200; clone E5; SC-377530; Santa Cruz), anti-collagen IV (1:500; ab6586; abcam), anti-alpha smooth muscle actin-Alexa Fluor 405 (1:200; ab210128, abcam), anti-caveolin-1 (1:100; sc-894; Santa Cruz, Tex.), anti-LRP1 (1:500; sc-57351; Santa Cruz), anti-4HNE (1:200; ab46545; abcam) were the primary antibodies. Secondary antibodies were: Alexa Fluor 488 conjugated anti-mouse IgG (1:300; A11029; Invitrogen), Alexa Fluor 568 conjugated anti-rabbit IgG (1:200; A11036; Invitrogen), Alexa Fluor 568 conjugated anti-mouse IgG (1:300; A11004; Invitrogen). Nuclei were counterstained with DAPI mounting media. For triple staining of human brain tissues, smooth muscle actin-Alexa Fluor 405 antibody was added after staining with human amylin and collagen IV; DAPI free mounting media was used. For Thioflavin S staining, after secondary antibody incubation, brain slides were incubated in 0.5% Thioflavin S for 30 minutes at room temperature. Slides were then incubated for 3 minutes in 70% ethanol, 5 minutes in 0.2% Sudan black before washing and mounting. Immunocytochemistry was performed as described previously (39, 40).
To immunoprecipitate rat Aβ from brain homogenates and plasma, a previously published protocol (16) was used. Briefly, 1000 μg of protein was incubated with anti-rat and human Aβ (2 μg; CST2454; Cell Signaling Technology) overnight with end-over-end rotation, at 4° C. All of the elution was used for Western blot analysis.
Western blot analysis was performed on isolated brain capillaries, brain tissue homogenate and plasma from rats. Tissues were processed as described previously16,18,28,39. RIPA buffer with 2% SDS was used to retrieve Aβ monomers from frozen brain samples41. The lysate was centrifuged at 17,000×G for 30-minnutes. The supernatant was separated from pellet after centrifugation and was then used for Western blotting. Total protein levels were estimated using a BCA kit (23225, ThermoFisher). Anti-LRP1 antibody recognizing the β-subunit of LRP1 (1:1,000; clone 5A6; sc-57351; Santa Cruz), rabbit anti-amylin polyclonal (1:2,000; T-4157, Bachem-Peninsula Laboratories, CA), anti-rat and human Aβ (1:1,000; 2454; Cell Signaling Technology), mouse anti-β actin (1:10,000; clone BA3R; MA5-15739; ThermoFisher), mouse monoclonal anti-GAPDH (1:10,000; clone 6C5; ab8245; Abcam), anti-rabbit IgG HRP conjugated (1:30,000; NA934VS; GE Healthcare) and anti-mouse IgG HRP conjugated (1:20,000; NXA931; GE Healthcare) were primary antibodies. Immunoprecipitated rat Aβ from brain homogenates and matched plasma (50 μg of protein from tissue homogenate or immunoprecipitated rat Aβ elution) were loaded on 8% SDS-PAGE gel. Aggregated Aβ from brain homogenates were resolved in native-PAGE (non-reducing; non-denatured). Monomeric Aβ peptides were resolved in acidic Bis-Tris gel with 8M urea35. To enhance signal for monomeric Aβ, membranes were boiled for 3 minutes in PBS before the blocking step. LRP1 in cell and brain capillary lysates was resolved using 4-12% Bis-Tris gel under non-reducing condition. HRP-conjugated anti-rabbit or anti-mouse were secondary antibodies. Equal loading in Western blot experiments was verified by re-probing with a monoclonal anti-β actin antibody (raised in mouse, clone BA3R, Thermo Scientific; 1:2000). Protein levels were compared by densitometric analysis using ImageJ software.
Levels of amylin in the rat plasma and red blood cells were measured using amylin ELISA kits (EZHA-52K, Millipore), according to the manufacturer's protocol.
Lipid peroxidation and ROS were measured in cultured rat brain microvascular ECs using previously published protocols26,39.
Parametric comparison of two groups was done using two-tailed unpaired t-test. Welch's correction was used with t-test to account for unequal variance from unequal sample sizes, if necessary. Parametric comparisons between three groups or more were performed using one-way or two-way ANOVA with Dunnett's post hoc or Tukey's post hoc tests. Data are presented as mean±S.E.M. Difference between groups was considered significant when P<0.05. All analyses were performed using GraphPad Prism 8.1 software.
1. Aβ deposition in perivascular spaces co-occurs with amylin accumulation in vessel wall.
Co-staining of human brain sections with anti-amylin and anti-Aβ antibodies identified amylin immunoreactivity (brown) on the luminal side of small arterioles that co-occurred frequently with patchy areas of Aβ immunoreactivity (green) within Virchow-Robin spaces, in AD but not CU individuals (
The results of the instant exploratory study in human brains reveal histological evidence of interaction between amylin secreted from the pancreas and Aβ at the blood-brain interface, in AD. Tangled amylin-Aβ deposits across cerebral blood vessel walls were identified in AD brains from individuals with AD independent of comorbid type-2 diabetes, consistent with previous studies16. The presence of amylin deposition at the luminal side of small blood vessels and Aβ in perivascular spaces suggest that systemic amylin dyshomeostasis may contribute to impaired Aβ efflux from the brain into the bloodstream in individuals with AD.
2. Tangled amylin-Aβ across the BBB impairs the Aβ efflux from the brain, in rats.
To study in vivo how systemic pancreatic amylin dyshomeostasis impairs Aβ transcytosis across the BBB, HIP rats that express amyloid-forming human amylin in pancreatic β-cells36 and accumulate amylin in brain capillaries18 were used. The average circulating level of amylin in 16-month old HIP rats was ˜2-fold higher compared to that in wild type (WT) littermates (
Co-staining of brain slices from HIP and WT rat brains with anti-Aβ (green) and anti-amylin (brown) antibodies showed vascular amylin-Aβ interaction in HIP, but not WT rats (
Western blot analysis of HIP rat brain homogenates shows accumulation of Aβ in the brain (
AD model rats are genetically determined to develop brain Aβ pathology, whereas rats expressing human amylin in the pancreatic islets may accumulate Aβ in the brain due to changes associated with chronically elevated blood levels of human amylin. To test whether the Aβ efflux from the brain to bloodstream is altered in HIP vs. WT rats, immunoprecipitation was used to enrich Aβ in plasma samples and brain homogenates from age-matched rats in the two groups followed by Western blot analysis of Aβ (
Taken together, the results show that increased pancreatic secretion of amyloid-forming amylin is associated with: 1, amylin accumulation in brain capillaries (
3. High blood human amylin suppresses the Aβ efflux transporter expression.
Amylin deposition in the brain microvasculature may induce stress in ECs and decline of the Aβ efflux transporter LRP1 expression. To test this hypothesis, LRP1 protein expression was analyzed in brain capillary lysates from aged HIP rats vs. WT littermates and EC lysates from EC monolayers that were subjected to amylin-induced stress.
Vascular amylin-induced LRP1 downregulation in the brain endothelium. Brain capillaries were isolated from HIP and WT rats and tested for the presence of amylin deposition and LRP1 protein expression by immunofluorescence and Western blot. Confocal microscopy analysis of isolated brain capillaries (
Amylin-induced LRP1 downregulation in endothelial cells, in vitro. To further evaluate the relationship between vascular amylin deposition and LRP1 protein expression, rat brain microvascular ECs was incubated with various concentrations of human amylin for 24 hours followed by analysis of LRP1 protein expression by Western blot (
Impaired endothelial Aβ transcytosis by amylin in a 3-dimensional BBB model. To determine whether the amylin stress-induced LRP1 downregulation affects Aβ transcytosis, a well-established model of BBB37 was employed in which the EC monolayer was exposed to human amylin on the luminal side (as shown in
First, the effect of human amylin was tested on EC monolayer structural integrity. Aβ transcytosis was measured across the BBB using FAM tagged Aβ42 (Aβ42-FAM) and FITC-dextran as a paracellular diffusion marker. TEER, cell morphology within the EC monolayer and permeability to FITC-dextran (4 kDa) were measured following the incubation of the ECs for 24-hours with 10 μM human amylin or similar concentrations of rat amylin or vehicle (
From these results (
4. Aβ efflux transporter expression is suppressed by amylin-induced endothelial cell stress.
Paralog miRNAs miR-103 and miR-107 are upregulated by oxidative stress42 and repress LRP1 translation in several cell lines32. Thus, to determine if these miRNAs are involved in amylin-induced LRP1 downregulation in the BBB.
Amylin accumulation in brain capillaries induced oxidative stress in ECs by forming deposits with biochemical properties of amyloid (
Next, ECs were pre-treated with poloxamer 188, a surfactant that decreases lipid peroxidation in cellular membranes26,39. Surfactant molecules blocked lipid peroxidation and consequent ROS production (
The results support the hypothesis that miRNA is upregulatied by amylin-mediated endothelial stress and suggest that additional pathways may compromise the capability of ECs to express LRP1, which were not linked to peroxidative membrane injury.
5. Antisense microRNAs rescue amylin-induced suppression of Aβ efflux transporter.
TargetScan predicts that miR-103 and miR-107 bind directly to LRP1, with the biding site located at the 3′UTR region of rat LRP1 (
Antisense microRNAs are used to target aberrant miRNA43. Antagomir (amiR) 103 and amiR-107 was used to test the hypothesis that silencing amylin-induced upregulation of miR-103 and miR-107 rescues LRP1 expression. The instant results show that amiR-103/107 rescued LRP1 expression in ECs following amylin-induced cell stress (
These results indicate that: 1, endothelial LRP1 downregulation associated with amylin stress is a miRNA-based translational repression mechanism; and 2, LRP1 downregulation by amylin-induced stress on ECs can be reversed by modulating miR-103 and miR-107.
It will be understood that various details of the presently disclosed subject matter can be changed without departing from the scope of the subject matter disclosed herein. Furthermore, the foregoing description is for the purpose of illustration only, and not for the purpose of limitation.
All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference, including the references set forth in the following list:
This application claims priority from U.S. Provisional Patent Application No. 62/908,937 filed on Oct. 1, 2019 the entire disclosure of which is incorporated herein by this reference.
This invention was made with government support under grant number AG053999, awarded by the National Institutes of Health. The government has certain rights in the invention.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US20/53787 | 10/1/2020 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 62908937 | Oct 2019 | US |
