Patent Application
20200237831
The instant application contains a Sequence Listing which has been filed electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Apr. 16, 2020, is named 159843-010702USCON2.txt and is 87,308 bytes in size.
This invention relates to a synthetic stool preparation and methods of use thereof for treating disorders associated with dysbiosis of the gastrointestinal tract, such as Clostridium difficile infection, including recurrent Clostridium difficile infection.
Clostridium difficile infection (CDI) is a bacterial infectious disease of the gastrointestinal tract caused by Clostridium difficile (C. difficile), a toxin-producing Gram-positive anaerobic, spore-forming bacillus. CDI accounts for 15-25% of antibiotic-associated diarrhea (Bartlett, J. G. and Gerding, D. N., Clin. Infect. Dis. 2008, 46, Suppl 1:S12-8). It occurs most commonly when patients receive antibiotics which alter or eradicate their enteric gut bacteria, allowing overgrowth of C. difficile.
Recurrent CDI is defined as complete resolution of CDI while on appropriate therapy, followed by recurrence of CDI after treatment has been stopped (Bakken, J. S., Anaerobe 2009, 15:285-9). An association exists between recurrent disease and intestinal dysbiosis, i.e., there is an inability of certain individuals to “re-establish” their normal intestinal bacteria (Chang, J. Y. et al., J. Infect. Dis. (2008), 197 (3): 435-8).
CDI is one of the primary hospital-acquired infections and is a significant infectious disease problem in the U.S., Canada and worldwide. Unfortunately, few effective treatments exist for those patients with multiple recurrences of CDI. Recommended therapy for CDI consists of either metronidazole or oral vancomycin (Cohen, S. H. et al., Infect. Control Hosp. Epidemiol. 2010, 31:431-55). However, antibiotics are not always effective, and recurrences and relapses are common after antibiotic treatment. One effective treatment is fecal bacteriotherapy, or “stool transplant” (infusing donor stool into the intestine of the recipient to re-establish normal bacterial flora or microbiota, i.e., bacterial flora or microbiota associated with a healthy state)_(Bakken, J. S., Anaerobe 2009, 15:285-9; Rohlke, F. et al., J. Clin. Gastroenterol. 2010, 44(8):567-70). However, stool transplants require costly and time-consuming screening of donors for major pathogens before therapy can proceed, are not reproducible and controllable, can contain pathogenic bacteria and viruses, and often carry a psychological and sociological stigma for the patient.
It would be desirable therefore to be provided with a method of treating CDI which is effective, controllable, reproducible, and/or lowers the rate of recurrence.
There are provided herein novel synthetic stool preparations for treating disorders of the gastrointestinal tract, e.g., disorders associated with dysbiosis. Methods of use of the synthetic stool preparations as well as methods of making the preparations are also provided herein.
According to one aspect of the invention, there is provided a novel synthetic stool preparation comprising a mixture of bacterial strains. In one aspect, the novel synthetic stool preparation of the invention includes at least one of the bacterial strains described herein, e.g., at least one of the bacterial strains listed in Table 1, 2, 2a, 7, 9, 9a, 9b, 9c, 9d, 9e, 9f, 9g, 10, 11, 12, 13, or 14 below, or at least one strain having all of the identifying characteristics of at least one strain listed in Table 1, 2, 2a, 7, 9, 9a, 9b, 9c, 9d, 9e, 9f, 9g, 10, 11, 12, 13, or 14. In another aspect, the synthetic stool preparation of the invention includes two or more, ten or more, 15 or more, 20 or more, 25 or more or 30 or more of the bacterial strains listed in Table 1, 2, 2a, 7, 9, 9a, 9b, 9c, 9d, 9e, 9f, 9g, 10, 11, 12, 13, or 14; or two or more, ten or more, 15 or more, 20 or more, 25 or more or 30 or more strains having all of the identifying characteristics of two or more, ten or more, 15 or more, 20 or more, 25 or more or 30 or more corresponding strains listed in Table 1, 2, 2a, 7, 9, 9a, 9b, 9c, 9d, 9e, 9f, 9g, 10, 11, 12, 13, or 14. In other embodiments, the synthetic stool preparation includes some or all of the bacterial strains listed in Table 1. In yet other embodiments, the synthetic stool preparation includes some or all of the bacterial strains listed in Table 2. In still other embodiments, the synthetic stool preparation includes some or all of the bacterial strains listed in Table 2a. In still other embodiments, the synthetic stool preparation includes some or all of the bacterial strains listed in Table 7. In still other embodiments, the synthetic stool preparation includes some or all of the bacterial strains listed in Table 9. In still other embodiments, the synthetic stool preparation includes some or all of the bacterial strains listed in Table 10. In still other embodiments, the synthetic stool preparation includes some or all of the bacterial strains listed in Table 11. In still other embodiments, the synthetic stool preparation includes some or all of the bacterial strains listed in Table 12. In still other embodiments, the synthetic stool preparation includes some or all of the bacterial strains listed in Table 13. In still other embodiments, the synthetic stool preparation includes some or all of the bacterial strains listed in Table 14. In still other embodiments, the synthetic stool preparation includes some or all of the bacterial strains listed in Tables 9a-9g.
Additional embodiments of synthetic stool preparations comprise bacterial strains selected from strains listed in Tables 15A/15B, 16A/16B, 17A/17B, 18, and 19A/19B, or from strains having all of the identifying characteristics of corresponding strains listed in Tables 15A/15B, 16A/16B, 17A/17B, 18, and 19A/19B. In an embodiment, synthetic stool preparations comprise bacterial strains listed in Tables 15A/15B, 16A/16B, 17A/17B, 18, and 19A/19B, or bacterial strains having the identifying characteristics of corresponding strains listed in Tables 15A/15B, 16A/16B, 17A/17B, 18, and 19A/19B.
In additional embodiments, the synthetic stool preparation comprises a mixture of bacterial strains which includes at least one strain which produces butyrate, at least one Bacteroides spp. strain, at least one Clostridium cluster XIVa group bacterial strain, at least one Bifidobacterium longum bacterial strain, at least one Lachnospiraceae bacterial strain and/or at least one bacterial strain which is antagonistic towards C. difficile (e.g., prevents or inhibits sporulation of C. difficile, neutralizes or protects against C. difficile toxin, e.g., toxin A or toxin B). In some embodiments, at least one of the bacterial strains in the mixture is not antibiotic resistant, for example not resistant to pipericillin, ceftriaxone, metronidazole, amoxicillin, clavulanic acid, imipenem, moxifloxacin, vancomycin or ceftazidime. In some embodiments, one or more of the bacterial strains in the mixture is antibiotic resistant, for example resistant to pipericillin, ceftriaxone, metronidazole, amoxicillin, clavulanic acid, imipenem, moxifloxacin, vancomycin or ceftazidime. In some embodiments, up to five, up to four, up to three, up to two, or one bacterial strain in the mixture is resistant to an antibiotic. In some embodiments, up to five, up to four, up to three, up to two, or one bacterial strain in the mixture is resistant to two or three antibiotics.
In other embodiments, the synthetic stool preparation comprises a mixture of bacterial strains which includes more than one strain of at least one single bacterial species. In an embodiment, the synthetic stool preparation comprises a mixture of bacterial strains which includes more than one strain of a single bacterial species. In another embodiment, the synthetic stool preparation comprises a mixture of bacterial strains which includes more than one strain of a first bacterial species and more than one strain of a second bacterial species; or, more than one strain of a first, a second and a third bactierial species; and so on.
In some embodiments, synthetic stool preparations comprise a mixture of bacterial strains which includes at least one strain which is antagonistic towards Clostridium difficile. In additional embodiments, the synthetic stool preparation comprises a mixture of bacterial strains which includes at least one strain which inhibits or prevents sporulation of Clostridium difficile. In an embodiment, the synthetic stool preparation comprises a mixture of bacterial strains, wherein at least one bacterial strain is Roseburia intestinalis strain 31FAA, or a strain having all of the identifying characteristics of Roseburia intestinalis strain 31FAA. In another embodiment, the synthetic stool preparation comprises a mixture of bacterial strains which includes at least one strain which neutralizes or protects against C. difficile toxin, e.g., toxin A or toxin B.
In further embodiments, the synthetic stool preparation comprises a mixture of bacterial strains, wherein the mixture comprises at least one bacterial strain selected from the group consisting of strain 13LG (Eubacterium limosum), strain 31FAA (Eubacterium limosum), F.prausnitzii, Roseburia spp., Eubacterium rectale, B.ovatus, P. distasonis, Eubacterium eligens, Eubacterium ventriosum, Roseburia spp., Blautia spp., Blautia producta, Dorea spp., R.torques, Bifidobacterium longum, Eubacterium hadrum, Anaerostipes coli, Clostridium aldenense, Clostridium hathewayi, Clostridium symbiosum, Clostridium orbiscindens, Clostridium citroniae, Clostridium thermocellum, Ruminococcus obeum, Ruminococcus productus, Ruminococcus torques, Roseburia inulinovorans, Blautia coccoides, Dorea sp., Sutterella sp., Dialister invisus, Bifidobacterium pseudocatenulatum, and strains having all of the identifying characteristics of these strains.
In other embodiments, the synthetic stool preparation further comprises a carrier. In further embodiments, the synthetic stool preparation further comprises a prebiotic, insoluble fiber, a buffer, an osmotic agent, an anti-foaming agent and/or a preservative.
The synthetic stool preparation may be made or provided in chemostat medium. In another aspect, the synthetic stool preparation is made or provided in saline, e.g., 0.9% saline. It will be understood that any carrier or solution which does not impair viability of the bacteria and is compatible with administration to a subject may be used.
In some aspects, the synthetic stool preparation is made or provided under reduced atmosphere, i.e., in the absence of oxygen. The synthetic stool preparation may be made or provided under N2, CO2, H2, or a mixture thereof, optionally with controlled levels of partial pressure of N2:CO2:H2.
The synthetic stool preparations provided herein may be used for treating or preventing a number of disorders of the gastrointestinal tract, including dysbiosis, Clostridium difficile infection, recurrent Clostridium difficile infection, prevention of recurrence of Clostridium difficile infection, treatment of Crohn's disease, ulcerative colitis, irritable bowel syndrome, inflammatory bowel disease and diverticular disease. The synthetic stool preparations may also be used for the treatment of food poisoning, such as food poisoning caused by pathogenic Escherichia coli (e.g., Escherichia coli O157, EHEC, EPEC, AIEC, EAggEC, ETEC), Salmonella, Clostridium (e.g., Clostridium perfringens, Clostridium botulinum), Listeria monocytogenes, Staphylococcus (e.g., Staph. aureus), Bacillus cereus, Campylobacter (e.g., Campylobacter jejuni, Campylobacter coli), Shigella spp., Cryptosporidium or Vibrio cholerae.
In some aspects, there is provided herein a method for treating a disorder associated with dysbiosis of the gastrointestinal tract, comprising administering the synthetic stool preparation of the invention to a subject in need thereof. In one aspect, administration is via rectal enema by the colonoscopic route. For example, a colonoscope is inserted into the cecum of the subject; optionally, a sample of fecal material is suctioned from the area; a first portion (e.g., approximately half) of the synthetic stool preparation is deposited adjacent to the cecum using a syringe attached to the colonoscope; and a second portion of the synthetic stool preparation is deposited throughout the transverse colon using the syringe as the colonoscope is withdrawn. In some cases the subject does not receive antibiotic therapy for at least 3 days before administration of the synthetic stool preparation. The subject may also be treated with a colon cleansing agent before administration of the synthetic stool preparation. In another aspect, administration is oral, e.g., freeze-dried synthetic stool preparation or synthetic stool preparation in capsule or tablet form is administered.
In other aspects, there is provided a method for treating Clostridium difficile infection comprising administering the synthetic stool preparation of the invention to a subject in need thereof. There is also provided a method for treating recurrent Clostridium difficile infection comprising administering the synthetic stool preparation of the invention to a subject in need thereof and a method for preventing recurrence of Clostridium difficile infection comprising administering the synthetic stool preparation of the invention to a subject in need thereof. Methods for treating Crohn's disease, ulcerative colitis, irritable bowel syndrome, inflammatory bowel disease and/or diverticular disease using the synthetic stool preparations of the invention are also provided.
In an embodiment, inflammation is reduced in the subject after administration of a synthetic stool preparation of the invention.
In another embodiment, sporulation of Clostridium difficile is prevented or inhibited after administration of a synthetic stool preparation of the invention. In yet another embodiment, C. difficile toxin, e.g., toxin A or toxin B, is neutralized after administration of a synthetic stool preparation of the invention, or a subject is protected against C. difficile toxin after administration of a synthetic stool preparation of the invention.
In an embodiment, there is provided a method for treating inflammation, comprising administering a synthetic stool preparation of the invention to a subject in need thereof. In an embodiment, the inflammation is associated with dysbiosis of the gastrointestinal tract. The synthetic stool preparation may be administered via rectal enema by the colonoscopic route, or orally.
In an embodiment, the synthetic stool preparation is adapted for administration via rectal enema by the colonoscopic route. In other embodiments, the synthetic stool preparation is adapted for administration orally, e.g., in capsule or tablet form. The synthetic stool preparation may be freeze-dried.
Kits for treating a disorder associated with dysbiosis of the gastrointestinal tract, treating Clostridium difficile infection, or preventing recurrence of Clostridium difficile infection, comprising the synthetic stool preparation of the invention, are also provided herein. The kits may further comprise instructions for use thereof. For example, the kit may include at least one bacterial strain selected from strains listed in Table 1, 2, 2a, 7, 9, 9a, 9b, 9c, 9d, 9e, 9f, 9g, 10, 11, 12, 13, or 14, or from strains having all of the identifying characteristics of strains listed in Table 1, 2, 2a, 7, 9, 9a, 9b, 9c, 9d, 9e, 9f, 9g, 10, 11, 12, 13, or 14. In another embodiment, the kit includes 2 or more, 10 or more, 15 or more, 20 or more, 25 or more, or 30 or more bacterial strains selected from strains listed in Table 1, 2, 2a, 7, 9, 9a, 9b, 9c, 9d, 9e, 9f, 9g, 10, 11, 12, 13, or 14, or 2 or more, 10 or more, 15 or more, 20 or more, 25 or more, or 30 or more bacterial strains having all of the identifying characteristics of 2 or more, 10 or more, 15 or more, 20 or more, 25 or more, or 30 or more corresponding strains listed in Table 1, 2, 2a, 7, 9, 9a, 9b, 9c, 9d, 9e, 9f, 9g, 10, 11, 12, 13, or 14. In other embodiments, the kit includes some or all of the bacterial strains listed in Table 1, 2, 2a, 7, 9, 9a, 9b, 9c, 9d, 9e, 9f, 9g, 10, 11, 12, 13, or 14, or some or all of a group of strains having all of the identifying characteristics of corresponding strains listed in Table 1, 2, 2a, 7, 9, 9a, 9b, 9c, 9d, 9e, 9f, 9g, 10, 11, 12, 13, or 14.
Methods of preparation and methods of use of the synthetic stool preparations are also provided. For example, there is provided a method for preparing the synthetic stool preparation of the invention, wherein the bacterial strains are grown in a chemostat containing chemostat medium, under reduced atmosphere with controlled levels of partial pressure of N2:CO2:H2, and controlled acidity (pH) to replicate human colonic gastrointestinal tract.
Bacterial strains which have not been isolated previously are also provided. For example, there are provided isolated bacterial strains which are Clostridium aldenense 1, Clostridium aldenense 2, Clostridium hathewayi 1, Clostridium hathewayi 2, Clostridium hathewayi 3, Clostridium thermocellum, Ruminococcus bromii 2, Ruminococcus torques 4, Ruminococcus torques 5, Clostridium cocleatum, Eubacterium desmolans, Eubacterium limosum, Lachnospira pectinoshiza, Ruminococcus productus, Ruminococcus obeum, Blautia producta, or strains having all of the identifying characteristics thereof. Use of the isolated bacterial strains to provide a synthetic stool preparation, and synthetic stool preparations comprising one or more novel isolated bacterial strain, are also provided.
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
For a better understanding of the invention and to show more clearly how it may be carried into effect, reference will now be made by way of example to the accompanying drawings, which illustrate aspects and features according to preferred embodiments of the present invention, and in which:
According to a broad aspect of the invention there is provided herein a novel preparation (referred to as “synthetic stool”) for treatment of disorders of the gastrointestinal system, particularly disorders associated with dysbiosis. In one aspect, there is provided herein a method of treating Clostridium difficile infection (CDI), including recurrent CDI, and for prevention of recurrence of CDI. The synthetic stool preparations provided herein comprise a mixture of purified intestinal bacterial cultures, originally isolated from stool from a single donor who had not received antibiotics in the last 5 years. Also provided herein are methods of treating diseases associated with dysbiosis of the gastrointestinal tract using the synthetic stool preparations of the invention such as, for example, ulcerative colitis, irritable bowel syndrome, inflammatory bowel disease, Crohn's disease and food poisoning such as Salmonella.
We report herein a novel synthetic stool preparation composed of a number of different intestinal bacteria isolated in pure culture, from a single donor who had not received antibiotics in the last 5 years, and we show that administration of the synthetic stool preparation can provide a positive therapeutic outcome in patients with recurrent CDI unresponsive to conventional therapy. We have also isolated intestinal bacteria from other donors and report additional synthetic stool preparations composed of intestinal bacteria from other donors as well.
The human gastrointestinal tract contains vast numbers of bacteria, collectively called the intestinal microbiota. The commensal gut flora contribute to host defense by priming the dendritic cells of the immune system, producing bactericidal products that kill pathogenic bacteria, inhibiting the colonization of pathogenic bacteria and competing with pathogens for food and for binding sites along the intestinal epithelial cell surface, a phenomenon collectively known as “colonization resistance” (Stecher B. and Hardt W. D., Trends Microbiol. (2008), 16:107-14; Rolfe, R. D., Infect. Immun. (1984), 45:185-91). Recurrent CDI is thought to be largely due to the inability of the normal intestinal microflora to recover and re-establish itself, and several studies in the literature now support this concept (Chang, J. Y. et al., J. Infect. Dis. (2008), 197:435-8; Tvede, M. and Rask-Madsen, J., Lancet (1989), 1:1156-60; Khoruts, A. et al., J. Clin. Gastroenterol. (2010), 44:354-60). Therapeutic use of the synthetic stool preparations described herein is based, at least in part, on this principle of fecal flora reconstitution for CDI resolution. We show herein that synthetic stool preparations comprising purely isolated intestinal bacteria from a healthy donor are effective, and the effect is at least comparable to what would be expected for fecal bacteriotherapy.
The “synthetic stool” preparations described herein present several potential advantages over current therapies, particularly stool transplants. Synthetic stool preparations provide at least one of the following advantages: First, the exact composition of bacteria administered to a patient is known and can be controlled. Second, the composition and quantity of bacterial species can be reproduced, should further treatment be necessary. Third, the synthetic stool preparations are more stable than stool, which normally must be collected fresh and instilled into the recipient within 6 hours of collection. From a patient safety perspective, the synthetic stool preparation is expected to be superior to the use of defecated donor fecal matter or stool transplant, since absence of viruses and other pathogens in the administered preparation can be ensured. Another potential advantage is that use of the synthetic stool preparation may decrease antibiotic use, particularly oral vancomycin use, in hospitals and in the outpatient setting, thereby reducing risk of selection for drug-resistant bacterial strains. Finally, the psychological and sociological stigma of stool transplant can be eliminated by using the synthetic stool preparation rather than freshly defecated stool. In sum, synthetic stool preparations described herein can provide safe, defined, controllable, reproducible, stable, deliverable, palatable and/or available alternatives to fecal transplants.
Intestinal bacterial strains that were isolated and purified from donor stool (from a donor who had not received antibiotics in the last 5 years) are listed in Table 1. The strains were speciated using the 16S rRNA full-length sequence and the GreenGenes database (website greengenes.lbl.gov/cgi-bin/nph-blast_interface.cgi). It will be readily understood by the skilled artisan that not all strains isolated from donor stool are suitable for use in synthetic stool preparations. For example, strains known to be pathogenic, strains having an unfavorable antibiotic resistance profile (e.g., resistant to imipenem or vancomycin or both), or strains which are particularly difficult to culture or grow unreliably were not included in the synthetic stool preparations of the invention shown in Tables 2 and 2a. In an embodiment, strains known to be pathogenic, strains having an unfavorable antibiotic resistance profile (e.g., resistant to imipenem or vancomycin or both), or strains which are particularly difficult to culture or grow unreliably are not included in synthetic stool preparations of the invention.
Eubacterium rectale
Dorea longicatena
Dorea longicatena
Roseburia intestinalis
Lactobacillus casei/paracasei
Eubacterium rectale
Ruminococcus productus
Ruminococcus torques
Ruminococcus obeum
Eubacterium rectale
Bifidobacterium longum
Roseburia faecalis
Acidaminococcus intestinalis
Parabacteroides distasonis
Clostridium cocleatum
Bifidobacterium adolescentis
Eubacterium desmolans
Bacteroides ovatus
Bifidobacterium longum
Ruminococcus obeum
Eubacterium eligens
Lactobacillus casei
Eubacterium limosum
Ruminococcus torques
Eubacterium ventriosum
Collinsella aerofaciens
Bifidobacterium adolescentis
Lachnospira pectinoshiza
Faecalibacterium prausnitzii
Eubacterium rectale
Bifidobacterium pseudocatenulatum
Roseburia inulinovorans
Blautia coccoides
Lactobacillus sp.
Eubacterium sp. strain 1
Eubacterium sp. strain 2
Clostridium lactatifermentans
Clostridium citroniae
Clostridium symbiosum
Clostridium hathewayi
Clostridium orbiscindens
Eubacterium sp. or Acetobacterium
Clostridium aldenense
Dorea sp.
Dialister invisus
Sutterella sp.
Eubacterium fissicatena
Raoultella ornithinolytica
16MRS 100% ID to Lactobacillus casei and Lactobacillus paracasei
227FM 95.61% ID to Ruminococcusproductus, 94.63% ID to Clostridium coccoides, 94.68% ID to Blautia coccoides (older BLAST results named this strain Blautia sp.)
321FAA1 89.9% ID to Clostridium spiroforme (older BLAST results named this strain Coprobacillus sp.)
448FAA1 91% ID to Eubacterium desmolans (older BLAST results named this strain Butrycicoccus sp.)
513LG 99.3% ID to Eubacterium sp., 94.65% ID to Eubacterium limosum
618FAA 99.8% ID to Eubacterium rectale (older BLAST results named this strain Clostridiumclostridioforme), 6FM1 99.8% ID to Eubacterium rectale (older BLAST results named this strain Roseburia sp.)
711FM1 99.6% ID to Ruminococcus sp. (older BLAST results named this strain Blautia sp.)
Several of the bacterial strains listed in Table 1 are novel, i.e., not previously described. Thus, in an aspect of the invention there are provided herein novel bacterial strains and their use in synthetic stool preparations. In one aspect, there are provided herein the bacterial strains Ruminococcus productus 27FM, Eubacterium limosum 13LG, Ruminococcus obeum 11FM1, Clostridium cocleatum 21FAA1 and Eubacterium desmolans 48FAA1.
To prepare the synthetic stool preparations of the invention, the purified isolates were first identified by 16S rRNA sequencing and subjected to antibiotic profiling, to remove any highly resistant strains of bacteria from the mixture (see Example 1). The NIH Human Microbiome database (the MetaREP database (website jcvi.org/metarep)) was used to determine the relative proportions of bacteria needed to most closely approximate the natural composition of human stool in a healthy individual. Synthetic stool preparations were made based on available information about the natural composition of stool in healthy individuals (“normal” stool) and the gastrointestinal microbiota, to determine which strains to use and their relative proportions in the mixture, in order to most closely approximate the natural composition of normal stool.
In an embodiment, the synthetic stool preparation of the invention comprises some or all of the strains listed in Table 1, or of strains having identifying characteristics of the strains listed in Table 1. For example, the synthetic stool preparation may comprise 10 or more, 15 or more, 20 or more, 25 or more, or 30 or more of the strains listed in Table 1, or the synthetic stool preparation may comprise 10 or more, 15 or more, 20 or more, 25 or more, or 30 or more strains selected from 10 or more, 15 or more, 20 or more, 25 or more, or 30 or more corresponding strains having all of the identifying characteristics of strains listed in Table 1.
In another embodiment, the synthetic stool preparation of the invention comprises some or all of the 31 bacterial strains listed in Table 2. The closest bacterial species was determined using the 16S rRNA full-length sequences, which were identified using the GreenGenes database (website greengenes.lbl.gov/cgi-bin/nph-blast_interface.cgi; DeSantis, T. Z., et al., Appl. Environ. Microbiol. (2006), 72:5069-72). In Table 2, the third column (headed “Relative amount added to synthetic stool preparation”) describes one embodiment of the synthetic stool preparation, where all 31 strains are used, and where the relative amount of each of the 31 strains added to the preparation is shown in the column (column shows relative abundance (by biomass) in synthetic stool preparation; amounts were adjusted to give, on average, a total cell count of ˜4 to 7×109 Colony Forming Units/mL, as estimated by measurement of OD600 nm).
Acidaminococcus intestini
Bacteroides ovatus
Bifidobacterium adolescentis
Bifidobacterium longum
Clostridium cocleatum
Collinsella aerofaciens
Dorea longicatena
Enterobacteriaceae
Eubacterium desmolans
Eubacterium eligens
Eubacterium limosum
Eubacterium rectale
Eubacterium ventriosum
Faecalibacterium prausnitzii
Lachnospira pectinoshiza
Lactobacillus casei/paracasei
Lactobacillus casei
Parabacteroides distasonis
Roseburia faecalis
Roseburia intestinalis
Ruminococcus productus
Ruminococcus torques
Ruminococcus obeum
Shaded boxes indicate strains that are likely novel species (and in some cases, genera) {circumflex over ( )}, §, ‡, Δ, #, ∫, f indicate strains which are closely related or identical by 16S rRNA gene sequence alignment, but which are likely to be different strains of the same species based on differences in colony morphology, antibiotic resistance patterns and/or growth rates.
Thus, in some embodiments the synthetic stool preparation comprises any or all of the 31 bacterial strains listed in Table 2, or any or all of a group of bacterial strains having all of the identifying characteristics of corresponding strains listed in Table 2. In an embodiment, the synthetic stool preparation comprises a mixture of bacterial strains, wherein at least one strain is selected from the strains listed in Table 2. In some embodiments the synthetic stool preparation comprises any of the 31 bacterial strains listed in Table 2, in the relative proportions indicated in the table. In some embodiments the synthetic stool preparation comprises all the 31 bacterial strains listed in Table 2, in the relative proportions indicated in the table.
In another embodiment, the synthetic stool preparation of the invention comprises some or all of the 33 bacterial strains listed in Table 2a, or some or all of a group of bacterial strains having all of the identifying characteristics of corresponding strains listed in Table 2a. The closest bacterial species was determined using the 16S rRNA full-length sequences, which were aligned with the NAST server (DeSantis, T. Z. Jr. et al., Nucleic Acids Res., 34:W394-W399 (2006)) and were then classified using the GreenGenes classification server (DeSantis, T. Z. Jr. et al., Appl. Environ. Microbiol., 72:5069-5072 (2006)). The most specific name in the GreenGenes classification was used (first column) and we report the DNA maximum likelihood score for each classification (second column). The third column (headed “Relative amount added to synthetic stool preparation”) describes one embodiment of the synthetic stool preparation, where all 33 strains are used, and where the relative amount of each of the 33 strains added to the preparation is shown in the column (column shows relative abundance (by biomass) in synthetic stool preparation; amounts were adjusted to give, on average, a total cell count of ˜4 to 7×109 Colony Forming Units/mL, as estimated by measurement of OD600 nm).
Acidaminococcus intestini
Bacteroides ovatus
Bifidobacterium adolescentis
Bifidobacterium longum
Blautia producta**
Clostridium cocleatum
Collinsella aerofaciens
Dorea longicatena
Escherichia coli
Eubacterium desmolans
Eubacterium eligens
Eubacterium limosum
Eubacterium rectale
Eubacterium ventriosum
Faecalibacterium prausnitzii
Lachnospira pectinoshiza
Lactobacillus casei/paracasei
Lactobacillus casei
Parabacteroides distasonis
Raoultella sp.
Roseburia faecalis
Roseburia intestinalis
Ruminococcus torques
Ruminococcus obeum
Streptococcus mitis
Ψ
ΨIdentifies with Strep. mitis but is not α-hemolytic.
Thus, in some embodiments the synthetic stool preparation comprises any or all of the 33 bacterial strains listed in Table 2a, or any or all of a group of bacterial strains having all of the identifying characteristics of corresponding strains listed in Table 2a. In an embodiment, the synthetic stool preparation comprises a mixture of bacterial strains, wherein at least one strain is selected from the strains listed in Table 2a. In some embodiments the synthetic stool preparation comprises any of the 33 bacterial strains listed in Table 2a. In some embodiments the synthetic stool preparation comprises all the 33 bacterial strains listed in Table 2a. In some embodiments, the synthetic stool preparation comprises any or all of the 33 bacterial strains listed in Table 2a, in the relative proportions indicated in the table.
In another embodiment, the synthetic stool preparation comprises one or more than one of the bacterial strains listed in Table 1, Table 2 or Table 2a, or one or more than one bacterial strains having all of the identifying characteristics of one or more than one corresponding strains listed in Table 1, Table 2 or Table 2a. In a further embodiment, the synthetic stool preparation comprises two or more, three or more, four or more, five or more, six or more, ten or more, fifteen or more, twenty or more, twenty-five or more, or thirty or more of the bacterial strains listed in Table 1, Table 2 or Table 2a. In a particular embodiment, the synthetic stool preparation comprises ten or more of the bacterial strains listed in Table 1, Table 2 or Table 2a.
Intestinal bacterial strains that were isolated and purified from stool from a second donor (a male donor, 43 yrs old, with no history of antibiotic use in the 6 years prior to stool donation) are listed in Table 7. Strains were speciated as described above, using the 16S rRNA full-length sequence and the GreenGenes database (website greengenes.lbl.gov/cgi-bin/nph-blast_interface.cgi).
Adlercreutzia equolifaciens
Akkermansia muciniphila
Alistipes finegoldii
Alistipes putredinis
Alistipes shahii
Alistipes sp.
Bacteroides capillosus
Bacteroides cellulosilyticus
Bacteroides eggerthii
Bacteroides ovatus
Bacteroides thetaiotaomicron
Bacteroides uniformis
Bacteroides vulgatus
Bacillus circulans
Bacillus simplex
Bifidobacterium longum
Blautia hydrogenotrophica
Blautia sp.
Blautia/Clostridium coccoides
Brevibacillus parabrevis
Catabacter hongkongensis
Catabacter sp.
Catenibacterium mitsuokai
Clostridium aldenense 1
Clostridium aldenense 2
Clostridium asparagiforme
Clostridium bolteae
Clostridium celerecrescens
Clostridium hathewayi 1
Clostridium hathewayi 2
Clostridium hathewayi 3
Clostridium hathewayi 4
Clostridium hylemonae 1
Clostridium hylemonae 2
Clostridium inocuum
Clostridium lavalense
Clostridium leptum
Clostridium orbiscindens
Clostridium ramosum
Clostridium scindens
Clostridium staminisolvens
Clostridium sulfatireducens
Clostridium symbiosum
Clostridium thermocellum
Clostridium sp. 1
Clostridium sp. 2
Clostridium sp. 3
Clostridium sp. 4
Clostridium sp. 5
Clostridium sp. 6
Collinsella aerofaciens
Coprococcus catus
Coprococcus comes
Coprococcus eutactus
Dorea formicigenerans
Dorea longicatena
Escherichia coli
Eubacterium biforme
Eubacterium callanderi
Eubacterium dolichum
Eubacterium eligens
Eubacterium fissicatena
Eubacterium limosum
Eubacterium rectale
Eubacterium siraeum
Eubacterium ventriosum
Eubacterium xylanophilum 1
Eubacterium xylanophilum 2
Eubacterium sp.
Faecalibacterium prausnitzii
b
Gemmiger/Subdoligranulum
formicilis/variabile 1
Gemmiger/Subdoligranulum
formicilis/variabile 2
Holdemania filiformis
Microbacterium schleiferi
Micrococcus luteus
Odoribacter splanchnicus
Oscillibacter valericigenes
Oscillibacter sp.
Parabacteroides gordonii
Parabacteroides merdae
Parasutterella excrementihominis
Phascolarctobacterium sp.
Roseburia faecalis 1
Roseburia faecalis 2
Roseburia hominis
Roseburia intestinalis
Roseburia sp.
Ruminococcus albus
Ruminococcus bromii 1
Ruminococcus bromii 2
Ruminococcus lactaris
Ruminococcus luti
Ruminococcus obeum
Ruminococcus torques 1
Ruminococcus torques 2
Ruminococcus torques 3
Ruminococcus torques 4
Ruminococcus torques 5
Ruminococcus sp. 1
Ruminococcus sp. 2
Ruminococcus sp. 3
Staphylococcus epidermidis
Streptococcus mitis
Streptococcus thermophilus
Synergistes sp.
Turicibacter sanguinis
a % ID for each species was determined using the 16S rRNA gene database, Green Genes.
b The strain Faecalibacterium prausnitzii 5 FAA NB requires Liquid Gold for growth. A 3% final volume of Liquid Gold produced from the chemostat where the donor fecal sample was cultured was used to supplement FAA plates. Growth was observed after 48 hours.
c Multiple strains of the same species are denoted by a number following the species name.
Antibiotic resistance profiles for strains in Table 7 are provided in Table 8 below.
In some embodiments, synthetic stool preparations comprise only, or comprise predominantly (i.e., are “rich in”) bacterial strains from a certain taxonomic order or family. As used herein, synthetic stool preparations “rich in” or “comprising predominantly” certain strains are comprised of at least about 10%, at least about 20%, at least about 30%, at least about 40%, or at least about 50% of those strains. In an embodiment, a synthetic stool preparation rich in bacterial strains of a certain order, e.g., Bacteroidales, Clostridiales, etc., comprises a mixture of bacterial strains, wherein at least about 40% of the bacterial strains in the mixture are of the specified order.
In an embodiment, synthetic stool preparations comprise only, or comprise predominantly (i.e., are “rich in”) bacterial strains of the order Bacteroidales, e.g., bacterial strains of the family Bacteroidetes, e.g., strains listed in Table 14. In another embodiment, synthetic stool preparations comprise only, or comprise predominantly (i.e., are “rich in”) bacterial strains of the order Clostridiales, e.g., bacterial strains of the family Catabacteriaceae, Clostridiaceae, Erisipelotrichaceae, Eubacteriaceae, Lachnospiraceae, or Ruminococcaceae, e.g., strains listed in Table 14. In another embodiment, synthetic stool preparations comprise only, or comprise predominantly, bacterial strains of an order listed in Table 14. In another embodiment, synthetic stool preparations comprise only, or comprise predominantly, bacterial strains of an order in the human gut microbiome or in an enterotype of human gut.
In an embodiment, synthetic stool preparations comprise only, or are rich in, bacterial strains of the family Catabacteriaceae, Clostridiaceae, Erisipelotrichaceae, Eubacteriaceae, Lachnospiraceae, Ruminococcaceae, Bacteroidetes, Actinomycetales, Bacillales, Bifidobacteriales, Coriobacteriales, Lactobacillales, Proteobacteria, Selenomonadales, Synergistales, or Verucomicrobiales, e.g., strains listed in Table 14. In another embodiment, synthetic stool preparations comprise only, or comprise predominantly, bacterial strains of a family listed in Table 14. In another embodiment, synthetic stool preparations comprise only, or comprise predominantly, bacterial strains of a family in the human gut microbiome or in an enterotype of human gut.
In an embodiment, synthetic stool preparations comprise only, or are rich in, bacterial strains of the family Lachnospiraceae. Such strains are listed, for example, in Table 9a and Table 14. Lachnospiraceae family members are part of the core human microbiome and may be important in maintaining stability of the human microbiota (Sekelja, M. et al., ISME J. 5(3):519-31, 2011). Lachnospiraceae have also been implicated as part of the ‘healthy’ gut microbiota and may play a role in optimizing immune function in the gut (Reeves, A. E., et al., Infect Immun., 2012; Segata, N. et al., Genome Biol., 13(6):R42, 2012; Wang, T. et al., 6(2):320-9, 2012). In an embodiment, the synthetic stool preparation comprises the bacterial strains listed in Table 9a or Table 9b. In another embodiment, the synthetic stool preparation comprises some or all of the bacterial strains listed in Table 9a or Table 9b. In yet another embodiment, the synthetic stool preparation is rich in Lachnospiraceae (or “Lachnospiraceae-rich”), e.g., is comprised of at least about 10%, at least about 20%, at least about 30%, at least about 40%, or at least about 50% of strains in the Lachnospiraceae family, or of strains listed in Tables 9a, 9b or 14.
In an embodiment, synthetic stool preparations comprise only, or are rich in, bacterial strains of the taxonomic class Proteobacteria.
In an embodiment, the synthetic stool preparation comprises or is rich in strains associated with interconnectivity in Enterotype I of the human gut microbiome (Arumugam, M. et al., Nature, 473(7346):174-80, 2011), as shown in Table 9c. In an embodiment, the synthetic stool preparation comprises the bacterial strains listed in Table 9c. In an embodiment, the synthetic stool preparation comprises some or all of the strains listed in Table 9c.
In another embodiment, the synthetic stool preparation comprises or is rich in strains associated with interconnectivity in Enterotype II of the human gut microbiome (Arumugam, M. et al., Nature, 473(7346):174-80, 2011), as shown in Table 9d. In an embodiment, the synthetic stool preparation comprises the bacterial strains listed in Table 9d. In an embodiment, the synthetic stool preparation comprises some or all of the strains listed in Table 9d.
In another embodiment, the synthetic stool preparation comprises or is rich in strains associated with interconnectivity in Enterotype III of the human gut microbiome (Arumugam, M. et al., Nature, 473(7346):174-80, 2011), as shown in Tables 9e and 9f. In an embodiment, the synthetic stool preparation comprises the bacterial strains listed in Table 9e or 9f. In an embodiment, the synthetic stool preparation comprises some or all of the strains listed in Table 9e or 9f.
In yet another embodiment, the synthetic stool preparation comprises or is rich in known beneficial microbes, e.g., probiotic strains, as shown in Table 9g.
Catabacter hongkongensis
Catabacter sp.
Clostridium sp.
Clostridium staminisolvens
Clostridium sulfatireducens
Catenibacter mitsuokai
Clostridium innocuum
Clostridium ramosum
Eubacterium biforme
Holdemania filiformis
Eubacterium callanderi
Eubacterium fissicatena
Eubacterium eligens
Eubacterium limosum
Blautia sp.
Blautia coccoides
Blautia hydrogenotrophica
Blautia luti
Clostridium aldenense
Clostridium asparagiforme
Clostridium bolteae
Clostridium celerecrescens
Clostridium hathewayi (2
Clostridium hylemonae (2
Clostridium lavalense
Clostridium scindens
Clostridium symbiosum
Coprococcus catus
Coprococcus comes
Coprococcus eutactus
Dorea formicigenerans
Dorea longicatena
Eubacterium eligens
Eubacterium rectale
Eubacterium ventriosum
Eubacterium xylanophilum
Roseburia sp.
Roseburia faecalis (2
Roseburia hominis
Roseburia intestinalis
Ruminococcus obeum
Ruminococcus torques (5
Clostridium thermocellum
Faecalibacterium prausnitzii
Flavonifractor plautii
Oscillibacter valericigenes
Oscillibacter sp.
Ruminococcus sp. (3
Ruminococcus albus
Ruminococcus bromii (2
Alistipes finegoldii
Alistipes putredinis
Alistipes shahii
Alistipes sp.
Bacteroides capillosus
Bacteroides cellulosilyticus
Bacteroides eggerthii
Bacteroides ovatus
Bacteroides
thetaiotaomicron
Bacteroides uniformis
Bacteroides vulgatus
Odoribacter splanchnicus
Parabacteroides gordonii
Parabacteroides merdae
Microbacterium schleiferi
Micrococcus luteus
Brevibacillus parabrevis
Bacillus circulans/bataviensis
Bacillus simplex
Staphylococcus epidermidis
Turicibacter sanguinis
Bifidobacterium longum
Adlercreutzia equolifaciens
Collinsella aerofaciens
Streptococcus mitis if pen S
Streptococcus thermophilus
Escherichia coli
Gemmiger
formicilis/Subdoligranulum
variabile
Parasutterella
excrementihominis
Phascolarctobacterium sp.
Synergistes sp.
Akkermansia muciniphila
1Indicates a taxonomic class, not a family.
2“ ” indicates that the taxonomic family is not given in the table.
In an embodiment, the synthetic stool preparation of the invention comprises a mixture of bacterial strains, wherein at least one bacterial strain is of at least one of the taxonomic orders listed in Table 14. In an embodiment, the synthetic stool preparation of the invention comprises a mixture of bacterial strains, wherein at least one bacterial strain is of at least one of the taxonomic families listed in Table 11 or Table 14. In an embodiment, the synthetic stool preparation comprises a mixture of bacterial strains, wherein at least one strain is selected from the strains listed in Table 14.
In an embodiment, the synthetic stool preparation of the invention comprises a mixture of bacterial strains, wherein at least one bacterial strain from each of the taxonomic orders listed in Table 14 is included. In an embodiment, the synthetic stool preparation of the invention comprises a mixture of bacterial strains, wherein at least one bacterial strain from each of the taxonomic families listed in Table 11 or Table 14 is included.
In some embodiments the synthetic stool preparation comprises any or all of the bacterial strains listed in Table 7, Table 9, Table 9a, Table 9b, Table 9c, Table 9d, Table 9e, Table 9f, Table 9g, Table 10, Table 11, Table 12, Table 13 or Table 14, or any or all bacterial strains having all of the identifying characteristics of corresponding strains listed in Table 7, Table 9, Table 9a, Table 9b, Table 9c, Table 9d, Table 9e, Table 9f, Table 9g, Table 10, Table 11, Table 12, Table 13 or Table 14. In an embodiment, the synthetic stool preparation comprises a mixture of bacterial strains, wherein at least one strain is selected from the strains listed in Table 7, Table 9, Table 9a, Table 9b, Table 9c, Table 9d, Table 9e, Table 9f, Table 9g, Table 10, Table 11, Table 12, Table 13 or Table 14. In some embodiments the synthetic stool preparation comprises any of the bacterial strains listed in Table 7, Table 9, Table 9a, Table 9b, Table 9c, Table 9d, Table 9e, Table 9f, Table 9g, Table 10, Table 11, Table 12, Table 13 or Table 14. In an embodiment, the synthetic stool preparation comprises one or more than one of the bacterial strains listed in Table 7, Table 9, Table 9a, Table 9b, Table 9c, Table 9d, Table 9e, Table 9f, Table 9g, Table 10, Table 11, Table 12, Table 13 or Table 14. In further embodiments, the synthetic stool preparation comprises two or more, three or more, four or more, five or more, six or more, ten or more, fifteen or more, twenty or more, twenty-five or more, or thirty or more of the bacterial strains listed in Table 7, Table 9, Table 9a, Table 9b, Table 9c, Table 9d, Table 9e, Table 9f, Table 9g, Table 10, Table 11, Table 12, Table 13 or Table 14. In a particular embodiment, the synthetic stool preparation comprises ten or more of the bacterial strains listed in Table 7, Table 9, Table 9a, Table 9b, Table 9c, Table 9d, Table 9e, Table 9f, Table 9g, Table 10, Table 11, Table 12, Table 13 or Table 14.
Additional embodiments of synthetic stool preparations of the invention are shown in Tables 15A/15B, 16A/16B, 17A/17B, 18 and 19A/19B. In an embodiment, synthetic stool preparations comprise some or all of the bacteria listed in Tables 15A/15B, 16A/16B, 17A/17B, 18 and 19A/19B, or some or all of a group of bacteria having all of the identifying characteristics of corresponding bacteria listed in Tables 15A/15B, 16A/16B, 17A/17B, 18 and 19A/19B. In an embodiment, synthetic stool preparations comprise one or more than one of the bacteria listed in Tables 15A/15B, 16A/16B, 17A/17B, 18 and 19A/19B, or one or more than one bacteria having all of the identifying characteristics of corresponding bacteria listed in Tables 15A/15B, 16A/16B, 17A/17B, 18 and 19A/19B.
In some embodiments, at least one of the bacterial strains in the synthetic stool preparation is Faecalibacterium prausnitzii, or a strain having all of the identifying characteristics thereof.
In some embodiments, at least one of the bacterial strains in the synthetic stool preparation is a novel strain, i.e., a strain which was not previously identified, e.g., Clostridium aldenense 1, Clostridium aldenense 2, Clostridium hathewayi 1, Clostridium hathewayi 2, Clostridium hathewayi 3, Clostridium thermocellum, Ruminococcus bromii 2, Ruminococcus torques 4, Ruminococcus torques 5, Clostridium cocleatum, Eubacterium desmolans, Lachnospira pectinoshiza, Ruminococcus productus, Ruminococcus obeum, Blautia producta, and/or Clostridium thermocellum.
Adlercreutzia equolifaciens
Akkermansia muciniphila
Alistipes finegoldii
Alistipes putredinis
Alistipes shahii
Alistipes sp.
Bacteroides capillosus
Bacteroides cellulosilyticus
Bacteroides eggerthii
Bacteroides ovatus
Bacteroides thetaiotaomicron
Bacteroides uniformis
Bacillus circulans
Bacillus simplex
Bifidobacterium longum
Blautia hydrogenotrophica
Blautia sp.
Blautia/Clostridium coccoides
Brevibacillus parabrevis
Catabacter hongkongensis
Catabacter sp.
Catenibacterium mitsuokai
Clostridium aldenense 1
Clostridium asparagiforme
Clostridium celerecrescens
Clostridium hathewayi 1
Clostridium hathewayi 2
Clostridium hathewayi 3
Clostridium hylemonae 1
Clostridium hylemonae 2
Clostridium inocuum
Clostridium lavalense
Clostridium leptum
Clostridium sulfatireducens
Clostridium symbiosum
Clostridium thermocellum
Clostridium sp. 1
Clostridium sp. 3
Clostridium sp. 4
Clostridium sp. 5
Clostridium sp. 6
Collinsella aerofaciens
Coprococcus catus
Coprococcus comes
Coprococcus eutactus
Dorea formicigenerans
Dorea longicatena
Eubacterium biforme
Eubacterium callanderi
Eubacterium dolichum
Eubacterium eligens
Eubacterium fissicatena
Eubacterium rectale
Eubacterium siraeum
Eubacterium xylanophilum 1
Eubacterium xylanophilum 2
Eubacterium sp.
Faecalibacterium prausnitzii
b
Gemmiger/Subdoligranulum formicilis/variabile 1
Gemmiger/Subdoligranulum formicilis/variabile 2
Microbacterium schleiferi
Micrococcus luteus
Odoribacter splanchnicus
Oscillibacter valericigenes
Oscillibacter sp.
Parasutterella excrementihominis
Phascolarctobacterium sp.
Roseburia faecalis 1
Roseburia faecalis 2
Roseburia hominis
Roseburia intestinalis
Roseburia sp.
Ruminococcus albus
Ruminococcus bromii 1
Ruminococcus bromii 2
Ruminococcus lactaris
Ruminococcus luti
Ruminococcus obeum
Ruminococcus torques 1
Ruminococcus torques 2
Ruminococcus torques 3
Ruminococcus torques 4
Ruminococcus torques 5
Ruminococcus sp. 1
Ruminococcus sp. 2
Staphylococcus epidermidis
Streptococcus mitis
Streptococcus thermophilus
Synergistes sp.
Turicibacter sanguinis
Blautia hydrogenotrophica
Blautia sp.
Blautia/Clostridium coccoides
Clostridium aldenense 1
Clostridium aldenense 2
Clostridium asparagiforme
Clostridium bolteae
Clostridium hathewayi 1
Clostridium hathewayi 2
Clostridium hathewayi 3
Clostridium hathewayi 4
Clostridium celerecrescens
Clostridium scindens
Clostridium symbiosum
Coprococcus catus
Coprococcus comes
Coprococcus eutactus
Dorea formicigenerans
Dorea longicatena
Eubacterium xylanophilum 1
Eubacterium xylanophilum 2
Eubacterium eligens
Eubacterium rectale
Eubacterium ventriosum
Roseburia faecalis 1
Roseburia faecalis 2
Roseburia hominis
Roseburia intestinalis
Roseburia sp.
Ruminococcus lactaris
Ruminococcus torques 1
Ruminococcus torques 2
Ruminococcus torques 3
Ruminococcus torques 4
Ruminococcus torques 5
Blautia hydrogenotrophica
Blautia sp.
Blautia/Clostridium coccoides
Clostridium celerecrescens
Clostridium scindens
Clostridium symbiosum
Coprococcus catus
Coprococcus comes
Coprococcus eutactus
Dorea formicigenerans
Dorea longicatena
Eubacterium xylanophilum 1
Eubacterium xylanophilum 2
Eubacterium eligens
Eubacterium rectale
Eubacterium ventriosum
Roseburia faecalis 1
Roseburia faecalis 2
Roseburia hominis
Roseburia intestinalis
Roseburia sp.
Ruminococcus lactaris
Ruminococcus obeum
Ruminococcus torques 1
Ruminococcus torques 2
Ruminococcus torques 3
Ruminococcus torques 4
Ruminococcus torques 5
Bacteroides capillosus
Bacteroides cellulosilyticus
Bacteroides eggerthii
Bacteroides ovatus
Bacteroides thetaiotaomicron
Bacteroides uniformis
Bacteroides vulgatus
Roseburia faecalis 1
Roseburia faecalis 2
Roseburia hominis
Roseburia intestinalis
Roseburia sp.
Parabacteroides gordonii
Parabacteroides merdae
Akkermansia muciniphila
Escherichia coli
Holdemania filiformis
Clostridium leptum
Ruminococcus bromii 1
Ruminococcus bromii 2
Ruminococcus albus
Gemmiger/Subdoligranulum formicilis/variabile 1
Gemmiger/Subdoligranulum formicilis/variabile 2
Faecalibacterium prausnitzii
Clostridium orbiscindens/Flavonifractor plautii
Eubacterium siraeum
Oscillibacter valericigenes
Oscillibacter sp.
Clostridium thermocellum
Clostridium staminisolvens
Akkermansia muciniphila
Alistipes finegoldii
Alistipes putredinis
Alistipes shahfi
Alistipes sp.
Clostridium leptum
Ruminococcus bromii 1
Ruminococcus bromii 2
Ruminococcus albus
Gemmiger/Subdoligranulum formicilis/variabile 1
Gemmiger/Subdoligranulum formicilis/variabile 2
Faecalibacterium prausnitzii
Clostridium orbiscindens/Flavonifractor plautii
Eubacterium siraeum
Oscillibacter valericigenes
Oscillibacter sp.
Clostridium thermocellum
Clostridium staminisolvens
Staphylococcus epidermidis
Akkermansia muciniphila
Alistipes finegoldii
Alistipes putredinis
Alistipes shahii
Alistipes sp.
Clostridium leptum
Ruminococcus bromii 1
Ruminococcus bromii 2
Ruminococcus albus
Gemmiger/Subdoligranulum formicilis/variabile 1
Gemmiger/Subdoligranulumformicilis/variabile 2
Clostridium orbiscindens/Flavonifractor plautii
Eubacterium siraeum
Oscillibacter valericigenes
Oscillibacter sp.
Clostridium thermocellum
Clostridium staminisolvens
Adlercreutzia equolifaciens
Akkermansia muciniphila
Bifidobacterium longum
Roseburia faecalis 1
Roseburia faecalis 2
Roseburia hominis
Roseburia intestinalis
Roseburia sp.
Faecalibacterium prausnitzii
Bacteroides
Parabacteroides
Roseburia sp
Erysipelotrichaceae
Enterobacteriaceae
Acidaminococcus
Faecalibacterium
Lachnospiracea
Enterobacteriaceae
Roseburia
Coffinsella
Eubacterium
Lachnospiraceae
Gammaproteobacteria
Dorea
Sporanaerobacter
1indicates taxonomic order, not family.
Adlercreutzia
equolifaciens
Akkermansia
muciniphila
Alistipes
shahii
Bacteroides
ovatus
Bacteroides
cellulosilyticus
Bacillus
circulans
Bifidobacterium
longum
Blautia/Clostridium
coccoides
Catenibacterium
mitsuokai
Clostridium
hylemonae 1
Clostridium
symbiosum
Eubacterium
limosum
Eubacterium
rectale
Coffinsella
aerofaciens
Coprococcus
comes
Dorea
longicatena
Escherichia
coli
Eubacterium
eligens
Faecalibacterium
prausnitzii
Microbacterium
schleiferi
Osciffibacter
valericigenes
Parabacteroides
merdae
Parasutterella
excrementihominis
Phascolarctobacterium sp.
Roseburia
faecalis 1
Ruminococcus
torques 1
Synergistes sp.
In an embodiment, the synthetic stool preparation further comprises one or more other bacterial strains which are known in the art to occupy the intestine in healthy individuals or to be found in stool from healthy individuals. In an embodiment, the synthetic stool preparation comprises one or more bacterial strains found in an enterotype of human gut, e.g., the Bacteroides, the Prevotella or the Ruminococcus enterotype. In another embodiment, the synthetic stool preparation comprises one or more bacterial strains found in the human gut microbiome.
In an embodiment, the bacterial strains in the synthetic stool preparation are not antibiotic-resistant. In a particular embodiment, the bacterial strains in the synthetic stool preparation are not resistant to pipericillin, ceftriaxone, metronidazole, amoxicillin/clavulanic acid, imipenem, moxifloxacin, vancomycin and/or ceftazidime.
In yet another embodiment, at least one of the bacterial strains in the synthetic stool preparation is a butyrate-producing strain (See, e.g., Louis, P. and Flint, H. J., FEMS Microbiol. Lett. (2009), 294(1):1-8 for a discussion of butyrate-producing bacteria in the human large intestine; see also Wong, J. M. et al., J. Clin. Gastroenterol. (2006), 40(3):235-43 for a review of the importance of butyrate). In one embodiment, the synthetic stool preparation comprises F.prausnitzii, Roseburia spp. and/or Eubacterium rectale.
In a further embodiment, at least one of the bacterial strains in the synthetic stool preparation is a Bacteroides spp. strain. In one embodiment, the synthetic stool preparation comprises B.ovatus and/or P. distasonis.
In yet another embodiment, at least one of the bacterial strains in the synthetic stool preparation is a bacterial species in the Clostridium cluster XIVa group, also known as the Lachnospiraceae. These strains are among the most abundant bacteria in the human gut in healthy individuals. Thus in one embodiment, the synthetic stool preparation comprises organisms that identify with Eubacterium eligens, Eubacterium ventriosum, Roseburia spp., Dorea spp., Ruminococcus obeum, Blautia producta, and/or Ruminococcus torques.
In an embodiment, the synthetic stool preparation comprises Bifidobacterium longum. Some B.longum strains are known to have clinically proven probiotic effects.
It will be understood by the skilled artisan that many other embodiments are possible. For example, in an embodiment, the synthetic stool preparation comprises at least one Lachnospiraceae strain. In another embodiment, the synthetic stool preparation comprises one or more strains that identify with the following species: Eubacterium hadrum; Anaerostipes coli; Clostridium spp. (aldenense, hathewayi, symbiosum, orbiscindens and citroniae); Roseburia inulinovorans; Blautia coccoides; Dorea spp.; Sutterella spp.; Dialister invisus; and Bifidobacterium pseudocatenulatum.
It will be appreciated that in some embodiments, it will be desirable to include at least one bacterial strain in the synthetic stool preparation which is antagonistic towards C. difficile, e.g., antagonistic to the growth or survival of C.difficile. In an embodiment, at least one of the bacterial strains in the synthetic stool preparation has an activity of preventing or inhibiting sporulation of C. difficile. For example, at least one of the bacterial strains in the synthetic stool preparation is Roseburia intestinalis strain 31FAA. In another embodiment, at least one of the bacterial strains in the synthetic stool preparation has an activity of neutralizing or protecting against C. difficile toxin, e.g., toxin A or toxin B.
In one embodiment, the synthetic stool preparation comprises more than one strain of a single species. Without wishing to be bound by theory, it is believed that in some cases two strains of the same species isolated from the same host can work together synergistically; indeed, the strains may have adapted to do so.
In an embodiment, the synthetic stool preparation further comprises a prebiotic. Without wishing to be bound by theory, a prebiotic may provide a bolus of nutrients for the strains in the synthetic stool preparation to assist their early growth after administration to the patient. Any prebiotic known in the art may be used. Non-limiting examples of prebiotics include oligosaccharides, e.g., fructooligosaccharides such as oligofructose and inulin, mannan oligosaccharides and galactooligosaccharides, soluble, oligofructose-enriched inulin and soluble fiber.
It is known in the art that identification of a bacterial species is based on many factors, including cell and colony morphology, chemical composition of cell walls (e.g., Gram-negative vs. Gram-positive, cell wall fatty acid make-up), biochemical activities, nutritional requirements, motility, presence or absence of structures external to the cell wall (e.g., flagella, pili), endospore formation, genomic sequence (including 16S rRNA gene sequence), etc. It should be understood therefore that many different factors may be used to identify a bacterial species and that an exact identification is not always feasible. Accordingly, as used herein, reference to a certain bacterial strain includes a strain having all of the identifying characteristics of the bacterial strain. Identifying characteristics used to identify bacterial species or strains may include factors listed above, such as cell morphology, colony morphology, Gram staining reaction, biochemical activities (e.g., aerobic or anaerobic), nutritional requirements, 16S rRNA sequence, or a subset or combination thereof. The particular identifying characteristics used will depend on the type of bacteria and are determined by the skilled artisan.
In one embodiment, bacterial species or strains are identified by 16S rRNA sequence, e.g., sequence of V6 region of 16S rRNA. In an embodiment, two bacterial species or strains are considered to be the same, or to share identifying characteristics, if they share at least 20%, at least 50%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% sequence identity in their 16S rRNA sequences or in the V6 region of their 16S rRNA sequences.
The preparations and methods of the invention may be used to treat disorders associated with dysbiosis (microbial imbalance) of the gastrointestinal tract. Dysbiosis is an imbalance of intestinal bacteria that leads to changes in the activities of the gastrointestinal tract. Non-limiting examples of such conditions which may be treated by the synthetic stool preparations of the invention include C.difficile colitis, Ulcerative colitis, Microscopic colitis, Pouchitis, Acute Postradiotherapy Diarrhea, Post-infectious colitis, Irritable Bowel Syndrome (IBS), Inflammatory Bowel Disease, Crohn's disease, obesity, regressive autism with gut involvement, PANDAS, Neonatal necrotizing colitis, enteritis caused by various pathogens including Salmonella spp., Campylobacter spp., Shigella spp., pathogenic Escherichia coli strains, and Cryptosporidium parvum, HIV enteropathy, Anorexia nervosa/Bulimia nervosa (due to the emerging link between gut microbiota and brain/behaviour), Clinical depression, toxic or aseptic shock, Toxic megacolon, Traveler's diarrhea, Hepatitis B Virus-Induced Chronic Liver Disease, systemic sclerosis, antibiotic-associated diarrhea, and diverticular disease. Intestinal dysbiosis is also linked to a number of other disorders or health conditions including metabolic disease, cardiovascular disease, colon cancer, breast cancer, autism, attention deficit disorder, autoimmune disorders, asthma, and allergies.
In one embodiment, the preparations and methods of the invention are used to treat Clostridium difficile infection (CDI), including recurrent CDI. The preparations and methods of the invention may also be used to prevent recurrence of CDI in a subject previously afflicted with CDI. In another embodiment, the preparations and methods of the invention are used to treat a disorder associated with dysbiosis of the gastrointestinal tract. In yet another embodiment, the preparations and methods of the invention are used to treat ulcerative colitis, Irritable Bowel Syndrome (IBS), Inflammatory Bowel Disease, Crohn's disease and/or diverticular disease.
In another embodiment, the synthetic stool preparations of the invention are used to treat bacterial pathogens such as those causing food poisoning. For example, the synthetic stool preparations may be used to treat Escherichia coli (e.g., E. coli enteritis, E. coli 0157), Salmonella spp., Clostridium perfringens, Listeria monocytogenes, Staphylococcus (e.g., Staph. aureus, Botulism (Clostridium botulinum), Campylobacter spp., Shigella spp., Bacillus cereus, Cryptosporidium, cholera (Vibrio cholerae) and other known bacterial pathogens which cause food poisoning.
In a further embodiment, the synthetic stool preparations of the invention are used prophylactically in persons at risk of developing CDI, for example persons receiving antibiotic therapy, persons having a prolonged hospital stay, or persons lacking a threshold level of bacterial diversity. The level of bacterial diversity of a subject could be determined, for example, using 16S rRNA gene sequence profiling of bacteria from a fecal sample.
In an embodiment, synthetic stool preparations of the invention are used to reduce inflammation, e.g., inflammation of the colon, in a subject,
In another aspect, there are provided herein kits for treating the described disorders comprising the synthetic stool preparations or the bacterial strains described herein. In some embodiments the kits may also include instruction materials. Instructions may be printed on paper or other substrates, and/or may be supplied as an electronic-readable medium, such as a floppy disc, CD-ROM, DVD-ROM, Zip disc, videotape, audio tape, etc. Detailed instructions may not be physically associated with the kit; instead, a user may be directed to an internet web site specified by the manufacturer or distributor of the kit, or supplied as electronic mail.
In an embodiment, the synthetic stool preparation is adapted for administration via rectal enema using a colonoscope. For example, in one embodiment the colonoscope is inserted into the cecum of the subject; a sample of fecal material is suctioned from the area; a syringe containing the synthetic stool preparation is attached to the colonoscope; a first portion of the synthetic stool preparation is deposited adjacent to the cecum; and a second portion of the synthetic stool preparation is deposited throughout the transverse colon as the colonoscope is withdrawn. In an embodiment, the subject does not receive antibiotic therapy for at least 3 days before administration of the synthetic stool preparation. In another embodiment, the subject is treated with colon cleansing agents before administration of the synthetic stool preparation. In yet another embodiment, the first and second portions each comprise approximately half of the synthetic stool preparation.
In another embodiment, the synthetic stool preparation is adapted for administration orally. For example, the bacteria are freeze-dried and encapsulated (e.g., in a capsule or pressed into a tablet) for oral administration. In some embodiments it may be desirable to add agents, such as buffering agents, to promote viability of the bacterial strains. It will be appreciated that the capsule or tablet may need a coating to protect against stomach acid. Such capsules and tablets may be formulated using methods known in the art.
It will be appreciated that the optimal synthetic stool preparation may vary depending on the subject, the disease or condition being treated, and so on. For example, it has been reported that the human gut microbiome, that is, the community of organisms that live symbiotically within humans, may occur in certain set varieties or “enterotypes” (Arumugan, M. et al., Nature (2011), 473: 174). Three human enterotypes which vary in species and functional composition have been reported, namely Bacteroides, Prevotella and Ruminococcus. Thus, it will be appreciated that the optimal synthetic stool preparation may depend on the enterotype of the subject, which may in turn depend upon patient lifestyle, e.g., their diet. In one aspect, there is provided herein a synthetic stool preparation having a mixture of bacteria consistent with the Bacteroides enterotype. In another aspect, there is provided herein a synthetic stool preparation having a mixture of bacteria consistent with the Prevotella enterotype. In yet another aspect, there is provided herein a synthetic stool preparation having a mixture of bacteria consistent with the Ruminococcus enterotype.
In some embodiments, the synthetic stool preparation comprises a carrier.
It will also be appreciated that it may be desirable to supplement the bacterial mixture in the synthetic stool preparation with additional buffers, nutrients, or other agents, for example to enhance the viability of the bacterial strains during transit or storage. In some embodiments, insoluble fiber is added to the synthetic stool preparation as a carrier, e.g., to provide protection during transit or storage. In yet other embodiments, the synthetic stool preparation comprises insoluble fiber, a buffer, an osmotic agent, an anti-foaming agent and/or a preservative, such as an anti-fungal agent. Glycerol or DMSO may be added to the bacterial strains for cryoprotection when the strains are frozen for storage.
In some embodiments, the synthetic stool preparation is made or stored in chemostat medium, e.g., the medium in which a steady-state culture is actively growing. In one embodiment, this medium is supplemented with additional insoluble fiber. In other embodiments, the synthetic stool preparations are provided at physiological salt concentrations. For example, the synthetic stool preparations may be made or stored in saline, e.g., 0.9% saline.
In some embodiments, the synthetic stool preparations are made and/or stored under reduced atmosphere, i.e., in the absence of oxygen. For example, the synthetic stool preparations may be made and/or stored under N2, CO2, H2, or under a mixture of these, such as N2:CO2:H2, 80:10:10. It will be appreciated that when the bacterial strains are not metabolically active, an inert gas like N2 can be used, although some of the bacterial strains in the synthetic stool preparations may need CO2 and/or H2 when growing actively. The pressure is the same or substantially the same as the pressure of the outside air.
The present invention will be more readily understood by referring to the following examples, which are provided to illustrate the invention and are not to be construed as limiting the scope thereof in any manner.
Unless defined otherwise or the context clearly dictates otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. It should be understood that any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the invention.
A healthy donor was identified and screened for suitability as a fecal transplant donor using a standard panel of microbiology tests. The most important criterion for donor selection was the donors prior exposure to antibiotic therapy. Our donor had only one reported antibiotic exposure, 5 years prior to donation, and cannot recall having had any during her childhood, which is believed to be the critical time during which the gut microbiota develop.
All the bacterial strains used in the synthetic stool preparations of the invention were isolated from a single donor. Without wishing to be bound by theory, it is believed that strains that have evolved together in one host may work synergistically together and that it may therefore be preferable to use strains isolated from a single donor.
The donor was asked to void feces in a private bathroom near the lab, into a provided sterile pot. The pot was immediately transported to the lab and placed into an anaerobic container within 5 minutes of voiding. It is noted that some of the isolates, in particular Roseburia spp., are extremely sensitive to oxygen, and thus it is critical that the voided sample is protected from exposure to oxygen even for the short-term (5 mins).
Once in the anaerobic chamber, a 10 g sample of feces was weighed into 50 mL sterile, pre-reduced saline and placed into a sterile stomacher bag. This was placed into the stomacher instrument and pummelled for 2 minutes to homogenize the sample. The homogenate was then placed into a sterile centrifuge tube and spun at low speed to sediment large particles.
Two rounds of microbial isolation were then performed. At the outset, a dilution series of the homogenate supernatant was made in sterile, pre-reduced saline. 100 uL of each dilution was separately plated onto quadruplicates of prepared agar media as below:
FASTIDIOUS ANAEROBE AGAR™ (Lab 90) supplemented with 5% defibrinated sheep blood;
FASTIDIOUS ANAEROBE AGAR™ without blood supplementation;
FASTIDIOUS ANAEROBE AGAR™+5% defibrinated sheep blood+3% ‘liquid gold’ (described below);
FASTIDIOUS ANAEROBE AGAR™+3% liquid gold;
deMan-Rogosa-Sharpe (MRS) media (purchased from Oxoid Limited, Hampshire, United Kingdom), enriches for Lactobacillus and Bifidobacterium spp.);
Mucin agar formulated in-house (minimal media with mucin as the only carbon source; this is used since some bacterial species of the human gut microflora are known to utilize mucin as a carbon source); and
LS agar, which is agar supplemented with 3% v/v spent cell culture supernatant taken from a confluent culture of LS174T cells (a human colonic cell line which secretes mucin; see website ATCCAdvancedCatalogSearch/ProductDetails/tabid/452/Default.aspx?ATCCNum=CL-188&Template=cellBiology).
Cell culture media was prepared from: 1 package of minimum essential medium (Gibco #41500-034); 2.2g sodium bicarbonate (Sigma); 4.766g HEPES buffer (Sigma); 10 mL 100 mM sodium pyruvate solution; 10% (v/v) heat-inactivated fetal bovine serum (Gibco) (30 min. at 56° C.), brought up to 1 litre in double-distilled water and filter-sterilized through a 0.22 μm pore-sized filter (Millipore). Spent cell culture medium was medium taken from the supernatant of LS174T cells cultured at 37° C. in 5% CO2 for 5 days, and filtered through a 0.22 μm pore-sized filter to remove host cells. This medium was used as some bacterial isolates may require human cell signals for proliferation and growth in vitro.
Plates were incubated for 2 weeks in a humidified anaerobe chamber (Bug Box from Ruskinn, Bridegend, United Kingdom), and inspected for growth every few days. Isolated colonies were picked to new plates and allowed to grow for the same length of time, to ensure that pure cultures were obtained; any second or third colony type which grew was removed. All cultures were carefully cryopreserved in freezing media (a milk-glycerol-dimethyl sulfoxide mix designed for preservation of anaerobes, containing 60g Carnation skim milk powder (Zehr's), 5 mL DMSO (Sigma) and 5 mL glycerol (Sigma) and double distilled H2O to bring total volume to 500 mL).
Once strains were isolated, optimal growth conditions were determined empirically by culturing each isolate on each different medium type as above, and determining which media gave the best growth. It is important to note that the strains were kept in an anaerobic environment at all times. They were never worked with outside of an anaerobic environment, e.g., we never worked with the live bacteria on an open bench, and the microbes were kept as healthy as possible at all times.
For the second round of characterization, a chemostat was used to first stabilize the microbial community as a whole, in vitro. Steady state (equilibrium) was reached after about 1 month, following which we used the dilution and plating methods as above to try to isolate further micro-organisms. The chemostat was used to allow us to effectively sample and culture the community and also to enrich for some gut microbes that may have been present in only small numbers in the original fecal sample. These organisms may be, for example, microbes that are intimately associated with the mucosa and are ‘sloughed off’ along with dead cells in the colon. The chemostat environment allows some of these bugs to survive and proliferate effectively, enriching their numbers so that they can be plate-cultured as above.
The terms “cultured” and “grown” are sometimes used interchangeably herein.
For growth in the chemostat, we developed a single-stage chemostat vessel by modifying a Multifors fermentation system (Infors, Switzerland; shown in
Throughout the duration of the experiment, the vessels were kept anaerobic by bubbling filtered nitrogen gas (Praxair) through the culture. Temperature (37° C.) and pH (set to 7.0; usually fluctuated around 6.9 to 7 in the culture) were automatically controlled and maintained by the computer-operated system. The system maintained the culture pH using 5% (v/v) HCl (Sigma) and 5% (w/v) NaOH (Sigma). The growth medium was continuously fed into the vessel at a rate of 400 mL/day (16.7 mL/hour) to give a retention time of 24 hours, a value set to mimic the retention time of the distal gut (Cummings, J. H. et al., Gut (1976), 17:210-18).
Since the growth medium contained components which cannot survive sterilization by autoclaving (see below), the vessels were autoclaved with 400 mL of ddH2O. During autoclaving, the waste pipes were adjusted so the metal tube reached the bottom of the vessel. Once the vessel cooled it was fitted to the rest of the computer operated unit, filtered nitrogen gas was bubbled through the water to pressurize and drain the vessel. The waste pipe was then raised to the working volume (400 mL) and 300 mL of sterile media was pumped into the vessel. The vessel was then left stirring, heating, and degassing overnight. To check for contamination within the vessel, each vessel was aseptically sampled and plated out (both aerobically and anaerobically) on FASTIDIOUS ANAEROBE AGAR™ (FAA™) supplemented with 5% defibrinated sheep blood. This procedure was repeated one day before inoculation and immediately prior to inoculation to ensure contamination was avoided.
The fecal sample was collected as described above; the freshly voided stool sample was collected and immediately placed in an anaerobic chamber (in an atmosphere of 90% N2, 5% CO2 and 5% H2)(Praxair). A 10% (w/v) fecal slurry was immediately prepared by macerating 5g of fresh feces in 50 mL of anaerobic phosphate buffered saline (PBS) for 1 minute using a stomacher (Tekmar Stomacher Lab Blender, made by Seward). The resulting fecal slurry was centrifuged for 10 minutes at 1500 rpm to remove large food residues. The resulting 10% original w/v fecal slurry supernatant (“10% inocula”) was used as the inoculum for this study.
To give a final working volume of 400 mL, 100 mL of 10% inocula was added to the 300 mL of sterile medium in each vessel. Since the thickness of the fecal inoculum made it difficult to seed the vessel through the septum using a needle, the inoculum was added to the vessel through the waste pipe using a syringe. Immediately following inoculation the pH controls were turned on so the vessel pH was adjusted to and maintained at a pH of about 6.9 to 7.0. During the first 24 hours post-inoculation the communities were grown in batch culture to allow the community to adjust from in vivo to in vitro conditions and avoid culture washout. During this period the vessels were heated, degassed and stirred with continuous pH adjustment. After this 24 hour period the feed pumps were turned on and the vessels were run as chemostats. Fresh culture medium was added continuously and waste was continuously removed. In the chemostat, culture conditions and media supply were maintained constant. The chemostat system was set with a retention time of 24 hours to mimic distal gut transit time.
A chemostat growth medium was developed. Due to the large amount of medium used by each vessel, medium was prepared in 2 L volumes. The chemostat medium was prepared in the following steps (for 2 L):
Mixture 1: The following reagents were dissolved in 1800 mL of distilled water: peptone water, 4 g (Oxoid Limited); yeast extract, 4g (Oxoid Limited); NaHCO3, 4g (Sigma); CaCl2), 0.02g (Sigma); pectin (from citrus), 4g (Sigma); xylan (from beechwood), 4g (Sigma); arabinogalactan, 4g (Sigma); starch (from wheat, unmodified), 10g (Sigma); casein, 6g (Sigma); inulin (from Dahlia tubers), 2g (Sigma); NaCl, 0.2g (Sigma). This mixture was sterilized by autoclaving at 121° C. for 60 min.
Mixture 2: The following reagents (all purchased from Sigma) were dissolved in 100 mL of distilled water (Mixture 2A): K2HPO4, 0.08g; KH2PO4, 0.08g; MgSO4, 0.02g; hemin, 0.01g; menadione, 0.002g. Bile salts (1g) was dissolved in 50 mL of distilled water (Mixture 2B). L-cysteine HCl (1g) was also dissolved in 50 mL of distilled water (Mixture 2C). After Mixtures 2B and 2C dissolved they were added to Mixture 2A resulting in the formation of a fine white precipitate. This precipitate was then dissolved by the drop-wise addition of 6M KOH until a clear, brown solution was formed (Mixture 2). This mixture (200 mL total volume) was sterilized by filtering through a 0.22 μm filter.
Chemostat media: Mixture 2 (0.2 L) was aseptically added to mixture 1 (1.8 L), in order to reach the final volume of 2 L. To prevent future foaming, 5 mL of antifoam B silicone emulsion (J.T. Baker) was aseptically added to each 2L bottle of media. The media was stored at 4° C. until use for a maximum of two weeks.
The media was pumped into each vessel using a peristaltic pump whose speed is controlled by the computer-operated system. To pump media from the bottles into the vessel, standard GL-45 glass bottle lids (VWR) had holes drilled into them to fit two stainless steel metal tubes. When Mixture 1 was prepared, the media bottle had all the required silicone tubing and 0.22 μm filters attached (see
Each vessel was fed from one media bottle with a 2L volume of media. Since the tubing which supplied the media to the vessel was also changed as each media bottle was changed, this helped to prevent back-growth of bacteria from the vessel into the sterile media reservoir. Each media bottle was plated out on supplemented FAA and grown both aerobically and anaerobically before each bottle was added to the chemostat and after each bottle was removed from the chemostat.
During weekdays, 10 drops of antifoam B silicone emulsion was added through the septum by a syringe and needle at 9 am and 5 μm (20 drops per day total). On weekends, 20 drops of antifoam was added to each vessel around 12 μm. This amount of antifoam added to each vessel daily (in conjunction with the amount of antifoam present in the media) was sufficient to prevent foaming in our system using a 24 hour retention time.
The term “liquid gold” refers to the effluent from the chemostat, i.e., the effluent forced out of the chemostat through pressure differentials; it drips into sterile bottles, housed behind the chemostat, via tubing. When the bottle is full, it is sealed and stored at +4° C. until needed. This is essentially a soup of microbes (dead and alive) as well as a plethora of signaling molecules, growth factors and so on. The liquid gold is passed through a 0.22 um filter to remove bacterial cells to produce cell-free liquid gold, which is used to supplement the growth media (usually added to 3% v/v).
To characterize the isolates, about 1 uL of an isolated colony from an actively growing culture was resuspended in 500 ul Tris-EDTA solution (TE) (Sigma). This was boiled for 5 minutes at 100° C. to lyse the cells. The crude lysate was then used as a template in a Polymerase Chain Reaction (PCR) using universal primers to amplify the full-length 16S rRNA gene. One each of these universal primers had additional sequences for universal sequencing primers, and thus the PCR product could be isolated and sequenced. Sequencing was performed by the MWG Operon sequencing service (website eurofinsdna.com/products-services/custom-dna-sequencing) using the ‘single sequencing in tubes’ service.
To start, a single read, ˜500 bp of sequence, was used to conduct a BLAST search against several databases to infer the identity of each isolate (RDP: website rdp.cme.msu.edu; GreenGenes: website greengenes.lbl.gov/cgi-bin/nph-index.cgi; NCBI: website blast.ncbi.nlm.nih.gov/Blast). The BLAST search was done using blast 2.2.10 and the command line “blastall-p blastn../../torrent/EnE/reads/RP_otu6.fna-e 1e-35-m>8-d 16s_named_full_seq.faa”; the parameters were as follows: mismatch penalties for nucleotide blast was-3; match penalties were 1; word size was 11; dropoff value for gapped alignment (in bits) was 30; threshold for extending hits was 11; dropoff value for final gapped alignment in bits was 50; and the E value cutoff was set such that only near perfect matches were recovered.
Once the genus (and possibly the species) was inferred from this short read, we made alignments to consolidate clonal (duplicate) strains. Full-length 16S rRNA gene reads were then obtained to identify the genus and species for each strain. Full-length 16S rRNA sequences are shown in
For antibiotic resistance profiling, the standard Bauer-Kirby method of antibiotic disc diffusion was used. Each isolate was separately cultured according to optimal conditions (see Table 3), and then a suspension was made to McFarland standard of 0.5 in sterile, pre-reduced saline. 100 uL of this was spread onto agar
plates containing agar formulations optimal for the tested strain (as shown in Table 3). To the surface of the inoculated plates, an antibiotic disc was applied (antibiotic discs were purchased from Sigma). Plates were inoculated for 1-4 days, depending on the isolate, until good growth was seen. The zone of clearance (area with no bacterial growth) around each disc for each strain was then measured in mm using a ruler. The larger the zone of clearance, the more sensitive the tested isolate to the tested antibiotic. Zones of clearance are given as measurements of the diameter of the zone of clearance (including the 7 mm discs). Where no zone of clearance is seen, the value stated is 0, i.e., in this case the size of the disc is not reported. The interpretation of the resistance profiles was descriptive.
The antibiotics tested and results of the antibiotic resistance profiling are shown in Table 4, where: numbers indicate diameters of the zones of clearance, in centimeters; PIP stands for pipericillin; CRO stands for ceftriaxone; MZ stands for metronidazole; AMC stands for amoxicillin/clavulanic acid; IPM stands for imipenem; MXF stands for moxifloxacin; VA stands for vancomycin; and CAZ stands for ceftazidime.
It should be noted that some bacterial species have intrinsic resistance to certain antibiotics. For example, vancomycin will have no effect on Bacteroides spp. since these are Gram negative organisms and vancomycin is effective only against Gram positive organisms. Intrinsic resistance is very different from acquired resistance.
Eubacterium
rectale
Dorea
longicatena
Dorea
longicatena
Roseburia
intestinalis
Lactobacillus
casei/paracasei
Eubacterium
rectale
Ruminococcus
productus
Ruminococcus
torques
Ruminococcus
obeum
Eubacterium
rectale
Bifidobacterium
longum
Roseburia
faecalis
Acidaminococcus
intestinalis
Parabacteroides
distasonis
Clostridium
cocleatum
Bifidobacterium
adolescentis
Eubacterium
desmolans
Bacteroides
ovatus
Bifidobacterium
longum
Ruminococcus
obeum
Eubacterium
eligens
Lactobacillus
casei
Eubacterium
limosum
Ruminococcus
torques
Eubacterium
ventriosum
Coffinsella
aerofaciens
Bifidobacterium
adolescentis
Lachnospira
pectinoshiza
Faecalibacterium
prausnitzii
Eubacterium
rectale
1FAA ™: FASTIDIOUS ANAEROBE AGAR ™, commercially available as Lab90;
2Relative growth rate; on average plates were incubated for 3 days at 37° C. under anaerobic conditions.
Eubacterium
rectale
6
Dorea
longicatena
Dorea
longicatena
Roseburia
intestinalis
Lactobacillus
casei/paracasei
1
Eubacterium
rectale
Ruminococcus
productus
2
Ruminococcus
torques
Ruminococcus
obeum
Eubacterium
rectale
6
Bifidobacterium
longum
Roseburia
faecalis
Acidaminococcus
intestinalis
Parabacteroides
distasonis
Clostridium
cocleatum
3
Bifidobacterium
adolescentis
Eubacterium
desmolans
4
Bacteroides
ovatus
Bifidobacterium
longum
Ruminococcus
obeum
7
Eubacterium
eligens
Lactobacillus
casei
Eubacterium
limosum
5
Ruminococcus
torques
Eubacterium
ventriosum
Collinsella
aerofaciens
Bifidobacterium
adolescentis
Lachnospira
pectinoshiza
Faecalibacterium
prausnitzii
Eubacterium
rectale
Antibiotic resistance profiles for strains listed in Table 7 are shown in Table 8. For data in Table 8, antibiotic resistance was described using methods described herein. In brief, a standard Kirby-Bauer disk diffusion susceptibility test was used. Bacterial strains were grown on FASTIDIOUS ANAEROBE AGAR™ (FAA™) in a completely anaerobic environment from frozen stock. Each strain was streaked heavily onto two FAA plates. Four antibiotic disks were placed onto each plate. Plates were incubated for at least one day, or longer if required. Plates were then removed from the anaerobe chamber and the susceptibility zone was measured. Measurements were conducted with a ruler. The susceptibility zone (measured in cm) was the diameter of the zone with no visible growth including the antibiotic disk diameter of 0.7 cm. Adjustments were made as required, for example strains with high susceptibility were restreaked with only two antibiotic disks per plate. Values in the table are given in cm; “R” indicates that the strain was resistant to the antibiotic tested; “nd” indicates not determined. The following antibiotics were tested: Moxifloxacin (MXF 5; tested at 5 μg/disk; Oxoid Antimicrobial Susceptibility Test Discs); Vancomycin (VA 30; tested at 30 μg/disk; BD BBL Sensi-Disc); Piperacillin (PIP 100; tested at 100 μg/disk; BD BBL Sensi-Disc); Ceftriaxone (CRO 30; tested at 30 μg/disk; BD BBL Sensi-Disc); Metronidazole (MZ 5; tested at 5 μg/disk; Oxoid Antimicrobial Susceptibility Test Discs); Ceftazidime (CAZ 30; tested at 30 μg/disk; BD BBL Sensi-Disc); Amoxicillin/Clavulanic acid (AMC 30; tested at 30 μg/disk; BD BBL Sensi-Disc); and Imipenem (IPM 10; tested at 10 μg/disk; BD BBL Sensi-Disc).
Here we describe the use of a synthetic stool preparation to treat recurrent CDI which failed repeated standard antibiotic treatments. We report the successful outcome of 2 patients with recurrent CDI unresponsive to conventional therapy who received a “synthetic” stool preparation of 33 different intestinal bacteria isolated in pure culture, from a single healthy donor. Patients reported complete cure of recurrent CDI after receiving the synthetic stool preparation, and remained symptom free after 6 months of follow-up. Bioinformatic analysis demonstrated that microbial profile reverts to features of the synthetic stool in each case.
Embodiments of the synthetic stool preparation shown in Tables 2 and 2a were used in these studies. The terms “RePOOPulate” (also abbreviated “RP” for “RePOOPulate Preparation”) and “MET” are used interchangeably herein to refer to embodiments of the synthetic stool preparation shown in Table 2a and used in these studies.
The study protocol was approved by the Human Research Ethics Boards at Queen's University, Kingston, Ontario, Canada, and the University of Guelph, Guelph, Ontario, Canada, in accordance with current regulations and the provisions of the Helsinki Declaration of the World Medical Association. Inclusion criteria for the study included a history of previous CDI, confirmed by C.difficile fecal toxin immunoassay; new onset of symptoms after completing a full course of medication for CDI; positive C.difficile toxin assay confirming recurrent CDI; and age 18 years or older. All patients were assessed by specialists in infectious disease and gastroenterology, and other possible causes of diarrhea were ruled out. Two patients who fulfilled the inclusion criteria were enrolled in the study and written informed consent was obtained. The trial was conducted in compliance with the Good Clinical Practice guidelines (see website clinicaltrials.gov for details).
A human probiotic or “synthetic stool” preparation comprising 33 different strains of bacteria, was developed by culturing the microbial diversity from the stool of a healthy 41-yr old female donor as described above. In brief, sixty-two different bacterial isolates were recovered on various media types (including Brain Heart Infusion agar, Wilkins-Chalgren agar, Reinforced Clostridial Agar, and deMan, Rogosa & Sharpe agar) using strict anaerobic conditions (to recover both strict and facultative anaerobes). Purified isolates were identified by 16S rRNA gene sequencing and subjected to antibiotic susceptibility profiling. Susceptibility to antimicrobials was determined either by directly measuring susceptibility or through inference based on other cultivated representatives. For instance, in cases where minimum inhibitory concentration (MIC) breakpoints are not documented, susceptibility was determined using Kirby-Bauer discs for select antibiotics known to have anaerobic activity, and if the bacterial lawn grew up to the edge of the disc then it was considered resistant and that isolate was not used. For isolates where there was a zone of inhibition of questionable significance, an acceptable level of inhibition was inferred based on other cultivated representatives. If there was any doubt, and the organism was at all suspected to be resistant, then it was not used in the mixture.
Thirty-three isolates, representing commensal species with no known pathogenic tendencies that were generally sensitive to a range of antibiotics and relatively straightforward to culture, were selected for the final synthetic stool preparation (see Tables 2 and 2a, which list cultured isolates from the healthy donor, with favorable antibiotic resistance profiles (defined as vancomycin and/or imipenem sensitive, with further sensitivity to at least 3 of pipericillin, amoxicillin/clavulanic acid, ceftazidime, ceftriaxone, moxifloxacin and metronidazole) that were included in the stool substitute preparation).
The METARep database (Goll, J. et al., Bioinformatics (2010), 26(20):2631-2) was utilized to inform of the potential relative abundance of each isolate in a healthy ecosystem. The MetaREP metagenomic database includes a collection of stool sample datasets from healthy donors (Goll, J. et al., Bioinformatics, 26(20): 2631-2, 2010). Using the taxonomy browser, the dataset that most closely matched our profile of cultured isolates (SRS058723) was selected and used as a guide for inference of relative abundance of each species—with the exception that Bifidobacterium spp. were added to higher abundances, reflecting the widely observed underestimated abundances of Actinobacteria, and specifically this genus, in metagenomic analyses of human stool [9,10]. An approximate ratio based on culture cell biomass, measured using standard 10 μL microbiological loops, was generated (see Tables 2 and 2a). Each of the thirty-three isolates was individually cultured on FASTIDIOUS ANAEROBE AGAR™ (FAA™) (Lab M Ltd. Heywood, Lancashire, UK) under anaerobic conditions, and then cultures were approximately formulated into the predetermined ratio, as described above, in 100 mL pre-reduced sterile 0.9% normal saline to an estimated concentration of 3.5×109 colony-forming units (CFU)/mL. The bacterial suspension was placed in a reduced atmosphere in a double-sealed container at 4° C., and used within 24 hours of preparation.
An aliquot of the same bacterial mixture was simultaneously inoculated into a continuous culture vessel and the community was allowed to equilibrate for 12 days. This microbial community was compared to the human week 2 samples in order to allow us to compare the therapeutic ecosystem development in vitro and in vivo.
To determine which strains to use in the synthetic stool preparation, several factors were considered, including the antibiotic resistance profile of a strain; reports in the literature suggesting that a strain may be pathogenic in any way; reports in the literature suggesting a strain may have probiotic effects; and the desired overall antimicrobial profile. Safety was a primary concern in the selection of bacterial strains. The NIH Human Microbiome database was utilized to determine the relative proportions of bacteria needed to most closely approximate the natural composition of stool from healthy individuals.
After obtaining written patient consent, antibiotic therapy was withheld for 2 or 3 days and the patients underwent standard colon cleansing with 4 L of oral polyethylene glycol solution the evening prior to the procedure. The “synthetic stool” preparation was administered to each patient the next morning via rectal enema by the colonoscopic route. The scope was first inserted to the cecum, a sample of fecal material was suctioned from the area, and then the syringe containing the synthetic stool was attached to the scope pump and half (about 50-60 mL) deposited in the region of the cecum/proximal ascending colon. The remaining approx. 50-60 mL was drizzled throughout the transverse colon as the colonoscope was withdrawn. Both patients were noted to have significant diverticular disease. Following scope withdrawal, patients were maintained in the Trendelenburg position with feet slightly elevated for 60 minutes and then discharged home. No complications from the procedure occurred in any of the patients. Patients were instructed to eat a fiber-rich diet and not to consume any products containing probiotics. Patients were followed up by a study nurse, e.g., at days 3 and 10 post treatment, to obtain stool samples and closely monitor their clinical response.
Patient 1 was a 74-year-old Caucasian woman who presented with a history of six episodes of recurrent CD (confirmed by C.difficile toxin assay) over an 18-month period, all of which required hospitalization. She developed her first C.difficile infection after being admitted to hospital for elective orthopedic surgery (knee arthroplasty or replacement), during which time she received pre-operative cefazolin (see
After treatment with the synthetic stool preparation, patient 1 became constipated within 72 hours and then her bowel movements became normal, both in terms of frequency and consistency. The patient reverted to her normal bowel pattern of a formed stool every 1 or 2 days. No C.difficile was detectable by C.difficile toxin assay at 10 days post-procedure. Her diarrhea did not recur and she remained symptom-free at 22 weeks. Patient 1 did receive several courses of antibiotics for recurrent urinary tract infections in the subsequent weeks following her stool substitute treatment, but her diarrhea did not recur. She remained symptom-free at the last evaluation, 24 weeks after treatment.
The pre-procedure sample of stool was used to collect C.difficile spores, and her strain of C.difficile was cultivated and identified. In brief, for isolation and ribotyping of C. difficile from patient stool samples, C. difficile was isolated from stool samples according to methods described previously (Medina-Torres, C. E. et al., Vet. Microbiol. 152:212-215, 2011) using selective media of moxalactam norfloxacin broth (CDMN; Oxoid, Nepean, Ontario, Canada) enriched with 0.1% sodium taurocholate. Isolates were typed using the PCR ribotyping method described by Bidet and colleagues (Bidet, P. et al., FEMS Microbiol. Lett., 175:261-266, 1999). For patient 1, two different strains of C. difficile were isolated from the pre-treatment sample. One strain was identified as ribotype 078; the other was a less common toxinotype 0 ribotype.
Patient 2 was a 70-year-old Caucasian woman with a history of peripheral neuropathy, which predisposed her to recurrent skin and soft tissue infections. She developed her initial C.difficile infection after receiving cefazolin for cellulitis and presented to the clinic with a history of three episodes of recurrent CDI, the last of which had failed standard medical therapy (
After receiving the study treatment, patient 2 reported normal, formed bowel movements within 72 hours. She remained symptom-free for 3 weeks, at which point she again developed recurrent cellulitis and was placed on i.v. ceftriaxone for 10 days by her family physician. She was monitored closely while on i.v. ceftriaxone but did not develop loose stool or diarrhea. After completion of her antibiotic course for cellulitis, she was tested for C.difficile by toxin assay and was still found to be negative. She suffered from several skin and soft tissue infections in the subsequent weeks and received several additional courses of broad-spectrum antibiotics for these infections. Nevertheless, she remained symptom-free with no diarrhea at 14 weeks post-procedure, and at last evaluation, which was 26 weeks post procedure. Similar to patient 1, a pre-procedure sample of stool was used to culture her strain of C.difficile and this was identified as ribotype 078.
A timeline of events for Patients #1 and #2 are shown in
A bioinformatics analysis of the study described in Example 3 was performed by analyzing the V6 region of the bacterial 16S rRNA genes via Ion Torrent.
gDNA Extraction from Stool Samples
gDNA was extracted using a protocol involving a combination of bead beating, the E.Z.N.A.® Stool DNA Kit (Omega Bio-Tek, Norcross, Ga., USA) and the Maxwell® 16 DNA Purification Kit (Promega, Madison, Wis., USA). Briefly, 200 μL of stool sample, 300 μL of E.Z.N.A. kit SLX buffer, 10 μL of 20 mg/mL proteinase K (in 0.1 mM CaCl2) and 200 mg glass beads were added to a screw-capped Eppendorf tube and disrupted in a bead beater for 3 minutes. Following subsequent incubation at 70° C. for 10 minutes and 95° C. for 2 minutes, 100 μL E.Z.N.A. Kit Buffer P2 was added to each sample and incubated on ice for 5 minutes. Samples were then centrifuged at 14000×g for 5 minutes, and the supernatant transferred into new tubes, each containing 200 μL E.Z.N.A. Kit HTR reagent. Following thorough mixing, samples were incubated at room temperature for 2 minutes, centrifuged at 14000×g, and the supernatant was transferred into Maxwell® 16 DNA Purification Kit cartridges. The remainder of the DNA extraction protocol was carried out in the Maxwell® 16 Instrument according to manufacturer's instructions (Promega).
V6 rRNA Amplification
PCR amplification of the bacterial V6 rRNA region was carried out with the left-side primer CWACGCGARGAACCTTACC (SEQ ID NO: 133) and the right-side primer ACRACACGAGCTGACGAC (SEQ ID NO: 134). These primer sequences were chosen because they are exact matches to greater than 95% of the rRNA sequences from organisms identified in the human microbiome project. In addition the left-side primers contained the standard Ion Torrent (Ion Torrent Systems Inc., Guilford, Conn., USA) adapter and key sequence at their 5′ end (CCATCTCATCCCTGCGTGTCTCCGACTCAG) (SEQ ID NO: 135). One of the following 5-mer barcodes was located between the 3′ end of the key sequence and the 5′ end of the primer: TATCG, TAGAC, TGCAT, ATGAG, ACAGT, AGATG, CTCAC, CTGTA, CGTGA, CGACT, AACTC, CCTAT. Duplicate samples did not use the same barcodes. The right-side primer had the other standard Ion Torrent adapter sequence (CCTCTCTATGGGCAGTCGGTGAT) (SEQ ID NO: 136) attached to its 5′ end. Amplification was performed for 25 cycles in 40 μL using the colorless GO-Taq hot start master mix (Promega) according to the manufacturers instructions with the following three-step temperature profile: 95° C., 55° C., and 72° C. for 1 minute each step. Then 5 μL of the resulting amplification were quantified using the QuBit broad-range double-stranded DNA fluorometric quantitiation reagent (InVitroGen, Life Technologies, Inc., Burlington, Ontario, Canada). Samples were pooled at approximately equal concentrations and purified using a Wizard PCR Clean-Up Kit (Promega).
The V6 region of the bacterial 16S rRNA genes was first amplified using the following primers for PCR:
For the left-side primers, the first part of the primer (shown in upper case) is the Ion Torrent adapter sequence, and is identical across all left primers. The second part of the primer (shown in lower case) is the sequence tag that is used to identify each individual amplified product. This allows a mixture of PCR products to be identified by their unique sequence tag. The third part of the primer (shown in upper case, 3′ to the second part) is the sequence complementary to the constant region on the left side of the V6 region. Standard nucleotide base nomenclature is followed.
For the right-side primer, the first 41 nucleotides are the Ion Torrent right adapter sequence, and the last 18 nucleotides are complementary to the right side of the V6 rRNA region. No sequence tags are attached.
As described above, the standard PCR protocol for amplification was as follows: The PCR machine block was heated to 90° C. A mixture composed of 20 uL of the appropriate left and right-side primers (0.8 pmol/uL for each primer) and 1.5 uL of DNA sample was placed under 50 uL of light mineral oil in the block to pre-heat. 20 uL of colourless GO-Taq™ Master mix was added under the oil and expelled strongly to mix the cocktail. After waiting 2 minutes for the temperature to equilibrate, 25 repeats of the following PCR cycle were run: 95 degrees, 55 degrees, 72 degrees at 1 minute each. At the end of the run, the mixture was cooled to room temperature and placed at 4 degrees.
Samples were then quantitated and purified as follows: 5 μL of each sample was taken out and mixed with 195 μL of QuBit broad-range fluorometric compound. After 2-10 minutes of incubation, the samples were read in a QuBit fluorometer and compared to the broad-range standard. The fluorometric reading was taken to indicate the amount of double-stranded DNA in the sample, and was used to make an approximately equal concentration mixture of the amplified PCR products, where the largest volume available was approximately 10 μL, and more concentrated samples were added in proportionally lower amounts. The amplified sequences were purified away from contaminating primer sequences using the Promega Wizard™ PCR purification kit. Samples and their QuBit quantitation are shown in
Amplified sequences were then further purified using agarose gel electrophoresis. The approximately 200 bp band was extracted from the gel with a Pip-n-Prep™ machine using the widest possible gate. The exact center of the gate was the center of mass of the band. This corresponded to removing a set of bands between 175 and 225 bp inclusive.
Sequencing was done at the Robarts Research Institute (London, Ontario, Canada) following standard protocols for the Ion Torrent machine exactly starting with the emulsion PCR step. Sequences were provided in the fastq file format. No library was used for the Ion Torrent runs, so quality scores associated with the reads were not used for downstream analysis. For sequence extraction, the steps were automated in a workflow using standard methods.
Four sequencing reactions were carried out, three on the Ion Torrent “314” chip and one on the Ion Torrent “316” chip platform. The chips differed only in the density of the spots, and hence in the amount of sequence that could be obtained. The 316 chip is about 5-6 times as dense as the 314 chip. One internal standard, the C12 sample, was run on both chips, and we found that the chips gave equivalent results.
Up to 12 samples were multiplexed on each chip through use of individual sequence tags. Data from all runs were pooled when samples were run on more than one chip.
Five sequencing reactions were carried out on the Ion Torrent platform: three reactions on a 314 chip and two reactions on the 316 chip. The chips differ only in the density of the spots, and hence in the amount of sequence that can be obtained (the 316 chip is about five to six times as dense as the 314 chip). The sequence was provided in fastq format. All sequences were then filtered according to the following criteria: exact matches to the barcodes used, exact match to the left-side primer including redundant positions in the primer, an exact match to the first six nucleotides of the right-side primer, and a length between the left-side and right-side primer of between 71 and 83 nucleotides. This length was chosen because it encompasses the predicted amplicon product size from all human-associated bacterial organisms that have been cultured and sequenced as part of the human microbiome project.
Approximately 40 to 50% of the reads passed these filters in the most recent Ion Torrent runs; reads not passing the filters were not examined further. Reads were processed as described by Gloor and colleagues [13] except that clustering with USEARCH was performed at 97% identity. Chimera detection was performed with UCHIME (version v5.2.32) using the de novo method [14]. Only four chimeric sequences were observed out of 30,419 unique sequences in the merged dataset, and all were rare. This frequency is similar to that reported previously for amplification and sequencing of the V6 rRNA region using the Illumina platform [13]. Chimeric sequences were not considered an issue in this dataset.
A table of counts for sequences grouped at the 97% operational taxonomic unit (OTU) and 100% identical sequence unit identity level were generated for each sample as before [13], keeping all identical sequence unit or OTU sequences that were represented in any sample at a frequency>0.5%. Reads that were never abundant in any sample (<0.5%) were grouped into the remainder and discarded. Between 12.6 and 51.9% (median 31%) of the identical sequence unit reads and between 1.4 and 17.2% (median 5.8%) of the OTU reads were in the remainder group. These values are approximately five times greater than those observed for identical sequence units sequenced on the Illumina platform but are about equivalent to the Illumina platform observations when reads were clustered. The fastq files were named: 2PG-23, 1PG-15, 2PG-25, 1PG-18 with a “trivial number.fastq.txt” appended. In all cases the left sequence tag and primer are the first nucleotides read. For convenience, the fastq files were converted to a non-standard format whereby all the information for an individual read is contained on one line using a custom Perl program which uses the following logic: the unique machine code attached to each read (assigned by the Ion-Torrent machine) is identified; the position of the left-side primer is identified; the first 5 nucleotides prior to the left-side primer are identified; the position of the 6 residues in the right-side primer closest to the read is identified; the sequence between the left and right side primer sequences is identified; the machine code, sequence tag, left-side primer, sequence, right-side primer, and sequence tag (for convenience only) are written out, all separated by tabs if the sequence is >71 and <83 nucleotides long, and if the sequence tag is represented over 1000 times in the dataset. This logic ensures that only those reads that fulfill the criteria of being from a bona-fide V6 region (length criterion) and with a real sequence tag are written out. The sequence tags in these files were then changed to the actual sample name using custom AWK scripts, e.g.:
awk ‘$2==“TATCG”’ 2PG23_tabbed_reads.txt|awk ‘BEGIN {OFS=″\t″}$2=“1_PT”’|awk ‘BEGIN {OFS=″\t″}$6=“1_PT’”>data/dataset_tabbed.txt
The V6 sequences were then grouped by identity and ordered by abundance from most to least in a fasta formatted file. Attached to each sequence is its identical sequence unit (ISU name). The sequences were clustered by 95% percent identity using uclust, a program standard in the field. The most abundant sequence in the cluster is the seed, or representative sequence. Each sequence cluster is called an operational taxonomic unit or OTU. The counts of reads in each OTU per sample were written to a file, and the representative sequence of each OTU (SEQ ID Nos: 44-132) was written to a fasta file (text is shown in
Statistical analyses were automated. Analyses and plotting were carried out using the R statistical programming language. Only OTUs that were present at an abundance of greater than or equal to 0.5% in any sample were included in the analysis. All other reads were grouped into the remainder bin. The read counts for each OTU in each sample were converted to proportions. The vector of these proportions was used for unsupervised heirarchical clustering by the neighbour-joining method using a euclidian distance matrix.
Classification of the sequences by either the GreenGenes or RDP classifiers proved to be unreliable because of the short length of the V6 region. Classification of the sequences present in the count table was therefore performed using the RDP closest match option on the full-length, high-quality, isolated subset. The maximum number of best hits was identified, and the taxonomic classification of the best match and ties was collected. The classification of those hits was adopted for all levels where the classification was identical across all best matches, otherwise the classification was marked as undefined. The V6 region is not able to resolve the genus or species level of a number of clades, so all analyses were carried out at the family level. This strategy worked for all abundant families—with the exception of the Bifidobacterium, which were annotated as such from BLAST searches of the NCBI microbial 16 S rRNA database. The taxonomic classification was added to the sequence count table and the data were presented in formats that could be accepted by QIIME 1.5.0 [15] as follows. Sequence alignments were built using Muscle [16] and a neighbor-joining tree was generated by ClustalW2 [17]. Beta-diversity was calculated by the UniFrac algorithm [18]. Tables were imported into MacQIIME, which is an OS X bundled version of QIIME 1.5.0, and were analyzed using the default parameters.
The Ion Torrent instrument has not previously been used for community microbial composition analysis with amplified rRNA variable regions. We therefore first examined the reproducibility of the reads obtained on the instrument by performing three separate PCR amplifications of the V6 rRNA region and sequencing these amplifications on four separate Ion Torrent runs, as described above. The PCR reactions were amplified by two separate individuals on separate days. A separate library was prepared from each amplification. Each library was run on either a 314 or a 316 Ion Torrent chip, with one library run on two separate chips. In this way the technical replication both of the amplification and of the sequencing reaction could be assessed.
The number of reads obtained for these sequencing reactions was often small—especially for the initial run on the 314 chip, which has limited capacity—and is summarized in Table 5. Reads were processed by the standard pipeline, as outlined above, and an unweighted pair group method with arithmetic mean distance tree was generated from the beta-diversity output by QIIME. The result (shown in
In total, there were between 3,758 and 76,752 V6 rRNA reads per sample for Patient 1 and between 19,751 and 64,200 reads per sample for Patient 2 using the Ion Torrent instrument as outlined above. These reads were processed by a combination of custom scripts and the QIIME pipeline as described above. Reads were clustered at 97% sequence identity for the analysis that follows, unless stated otherwise. Read counts were normalized using rarefaction to the minimum number of reads per sample in each patient, and Shannon's diversity index was plotted for each intermediate rarefaction level and for the nonrarefied data. Shannon's diversity index provides a measure of community diversity including richness (number of species present) and evenness (relative abundance of species). We observed that the mean Shannon's diversity index of 10 rarefaction samples approximated the diversity index of the total dataset when the number of rarefied samples exceeded 1,000 (data not shown). This observation indicates that we obtained sufficient reads in all samples to accurately estimate the diversity. Shannon's diversity on the total dataset for all samples is given in Table 6, from which we see that the two patients had dramatically different Shannon's diversity scores before and after treatment. Patient 1 had a highly diverse microbiota that became less diverse after treatment, and over time tended to become more diverse. At 6 months post treatment, this patient had a diversity score that was almost the same as that at pre-treatment. Patient 2 initially had a low diversity microbiota, which became more diverse following treatment and stabilized over the long term at a level that was more diverse than that at pre-treatment.
Taxonomic assignments of the seed sequences for each OTU were derived from best-hit analysis of the sequences in the RDP database as explained above. Briefly, the full taxonomic lineage of the 20 best hits and ties was captured using a custom Perl script and added to the QIIME input tables. Any lineage where the best hits and ties were not in full agreement was annotated as undefined. Taxonomic assignment was carried out to the family level since the rRNA V6 region has poor resolution below this taxonomic level for several groups found in our dataset, such as the Gammaproteobacteria and Lachnospiraceae families. Beta-diversity taxonomic bi-plots at the family level were generated using the QIIME package with default values for the read counts of the samples derived from each individual patient including the initial RePOOPulate sample (
The taxonomic distribution of reads in the two patients was noticeably different, however, as shown in the barplots of
The data shown in
A table of counts for sequences grouped at the 97% operational taxonomic unit (OTU) and 100% identical sequence unit identity level were generated for each sample as described (Gloor, G. et al., PLoS ONE, vol 5:e15406), keeping all identical sequences that were represented in any sample at a frequency>=0.5%. Reads that were never abundant in any sample (<0.5%) were discarded. Between 12.6 and 51.9% (median 31%) of the identical sequence unit reads and between 1.4 and 17.2% (median 5.8%) of the OTU reads were in the remainder group {AU Query: Confirm sentence is OKOKgg}. These values are approximately five times greater than those observed for identical sequence units sequenced on the Illumina platform but are about equivalent to the Illumina platform observations when reads were clustered.
Classification of the sequences by either the GreenGenes or RDP classifiers proved to be unreliable because of the short length of the V6 region. Classification of the sequences present in the count table was therefore performed using the RDP closest match option on the full-length, high-quality, isolated subset. The maximum number of best hits was identified, and the taxonomic classification of the best match and ties was collected. The classification of those hits was adopted for all levels where the classification was identical across all best matches, otherwise the classification was marked as unclassified. The V6 region is generally not able to resolve the species level, so all analyses were carried out to the genus level. This strategy worked for all abundant families—with the exception of the Bifidobacterium, which were annotated as such from BLAST searches of the NCBI microbial 16S rRNA database. The taxonomic classification was added to the sequence count table and the data were presented in formats that could be accepted by QIIME 1.5.0 (Caporaso et al., Nature Methods, vol 7: pg 335-336, 2012) as follows. Sequence alignments were built using Muscle and a neighbor-joining tree was generated by ClustalW2. Beta-diversity was calculated by the UniFrac algorithm in QIIME 1.5.0. Tables were imported into MacQIIME, which is an OS X bundled version of QIIME 1.5.0, and were analyzed using the default parameters.
These methods were also used to generate the data in the tables corresponding to
The data in Tables 15A/15B and 16A/B show, for each column of the barplot in
We were interested to determine the ability of the organisms composing the RePOOPulate formulation to stably colonize the distal colon of the patients. We noted that the weighted UniFrac distances between the samples at pre-treatment and 6 months post treatment in Patient 1 were less than those between either sample and any other. In contrast, the earliest time point for Patient 2 was most similar to the pre-treatment sample. These relationships can be seen in
See also
In sum, full-length 16S rRNA sequence was obtained and the V6 rRNA region of each sample was amplified and subsequently sequenced on the Ion Torrent platform and the 314 and 316 chips. Individual sequence tags were used to allow multiplexing of up to 12 samples on each Ion Torrent sequencing chip. Four Ion Torrent runs in total were conducted with excellent technical replication. Data from all runs were pooled when samples were run on more than one Ion Torrent chip. The samples were de-multiplexed based on their unique sequence tags and the sample identifier was attached to each read. Reads were analyzed by adapting the pipeline used in Gloor et al., PLoS One (2010), 26; 5(10):e15406 and were grouped first by identity, then by 95% identity into operational taxonomic units (OTUs) using UCLUST (Edgar, R. C., Bioinformatics (2010), 26(19): 2460) with the most abundant identity groups serving as seed sequences. The count of OTUs that were more abundant than 0.5% in any sample were tabulated and used for analysis. Statistical analysis was carried out with the R statistical programming language (R Development Core Team (2011); see R: A language and environment for statistical computing, R Foundation for Statistical Computing, Vienna, Austria. ISBN 3-900051-07-0, website R-project.org/). 16S rRNA sequences were aligned with the NAST server (DeSantis, T. Z. et al., Nucleic Acids Res. (2006), 34:W394-9), then classified using the Greengenes classification server (DeSantis, T. Z., et al., Appl. Environ. Microbiol. (2006), 72:5069-72). The most specific name in the Greengenes classification was used and we report the DNA maximum likelihood score for each classification.
For all patients stool samples were collected prior to administration of the “synthetic stool” preparation (PT), 72 hours after procedure (D2), 2 weeks after procedure (W2) and 4 weeks after procedure (W4). The composition of the synthetic stool preparation is also shown, as administered (RP) and then 12 days after incubation of the bacterial community in a chemostat (CS). Results are shown in
A column was selected as abundant in the RP sample if it contained 0.5% or more of the total RP reads. This ensured that OTUs derived from sequence or PCR-based errors were not included in the counts. In each sample the total reads per OTU and the OTUs that overlapped the RP OTUs (at greater than or equal to 0.5% abundance) were calculated. The CS sample seemingly contained a larger fraction of RP reads than did RP itself. This is an artefact caused by the relatively low diversity of this sample.
The results of this analysis (
It is noted that collecting stool samples prospectively and collecting multiple stool samples from the same patient helped to minimize inter-individual variability, as each patient also served as his/her own background control.
The results of the bioinformatics analysis also show that, interestingly, the microbiota of both patients adapted characteristics of the synthetic stool mixture yet still retained some of the patient's original microbiota. The bacteria in the synthetic stool preparation were rare in the pre-treatment samples for both patients, but constituted between 40 and 75% of the organisms after synthetic stool treatment was given. This result indicates that the administered bacteria stably colonized the colon.
Overall, these studies show that a synthetic stool (stool substitute) may be an effective and feasible alternative to the use of defecated donor fecal matter (stool transplant) in the treatment of recurrent CDI. The clinical cure achieved at 6 months of follow-up demonstrates feasibility of this approach as an alternative to conventional stool transplant. The stool substitute preparation used here was effective at eradicating disease that had failed all other treatment regimens. This benefit correlated with major changes in stool microbial profile and these changes reflect isolated from the synthetic stool preparation.
As discussed above, a synthetic stool substitute approach has multiple potential advantages: the exact composition of bacteria administered is known and can be controlled; the bacterial species composition can be reproduced, should a future treatment be necessary; preparations of pure culture are more stable than stool, which some groups recommend should be collected fresh and instilled into the recipient within 6 hours of collection (Bakken, J. S. et al., Clin. Gastroenterol. Hepatol., 9:1044-1049 (2011)); an absence of viruses and other pathogens in the administered mixture can be ensured, thereby improving patient safety; and/or the administered organisms can be selected based on their sensitivity to antimicrobials, allowing an enhanced safety profile.
Recurrent CDI is thought to be largely due to the inability of the intestinal microflora to recover and re-establish itself (Chang, J. Y. et al., J. Infect. Dis., 197:435-438 (2008); Khoruts, A. et al., J. Clin. Gastroenterol., 44:354-360 (2010); Tvede, M. and Rask-Madsen, J., Lancet, 1:1156-1160 (1989)). We used the Ion Torrent platform to analyze the 16 S rRNA gene profiles of stool samples collected from each patient during the study, and carried out exhaustive quality control of our data. We concluded that this sequencing platform, together with the PCR amplification protocol and bioinformatic analysis pipeline, was adequate to reproducibly separate both technical replicate samples (
Our results also suggest that a defined microbial community, isolated from a single healthy donor, is robust enough to withstand further perturbations by antibiotics as illustrated by the patients in our study. In the case of Patient 1, who suffered from occasional urinary tract infections, the antibiotics used post procedure (ciprofloxacin, nitrofurantoin and amoxicillin) were for short courses only, up to a maximum of 7 days. For Patient 2, her recurrent skin and soft tissue infections occasionally necessitated a broad-spectrum antibiotic combination (for example, cephalexin and metronidazole) of much longer duration (4 weeks in one case). Despite post-procedure administration of these incidental antibiotics for infections unrelated to C. difficile colitis, neither patient developed further recurrent CDI. However, at this time it remains unclear whether antibiotic administration affected the long-term colonization by the microbial community used as treatment, or to what extent the differences in microbial profile in the 6-month samples between patients is driven by the different antibiotics administered.
Salmonella typhimurium-Xen26 was derived from the parental strain S. typhimurium SL1344, a clinical isolate. S. typhimurium Xen26 possesses a stable copy of the Photorhabdus luminescens lux operon on the bacterial chromosome. S. typhimurium Xen26 grows well in Luria Bertani (LB) medium at 37° C. under ambient aeration. It may also be grown selectively on LB agar containing 30 μg/mL kanamycin. On LB plates, S. typhimurium Xen26 appears as medium (3 mm), cream, circular colonies after 24 hours incubation at 37° C.
For these studies, seven to eight week old female C57BL/6 mice were purchased from Charles River (St Constant, Quebec, Canada) and were kept under specific pathogen-free conditions. Animal experiments were carried out in accordance with the guidelines of the Canadian council of animal use. For inducing colitis in mice (Barthel, M. et al., Infect. Immun. (2003), 71(5):2839-58; Ye, Z. et al., Am. J. Pathol (2007), 174(5):1981-2), food was withheld for 4 hours prior to oral gavage with 20 mg of streptomycin (SteriMax, Mississauga, Ontario, Canada); animals had ad libitum access to food and water afterwards. Twenty hours after treatment with streptomycin, mice were orally gavaged with either the synthetic stool preparation or saline vehicle control. Four hours later, the mice were orally gavaged with 108 CFU of S.typhimurium-Xen 26. Forty-eight hours post-infection with S. typhimurium-Xen 26, the mice were sacrificed and the intestinal tract removed for analysis in an IVIS Xenogen animal imager (Caliper Lifesciences). The imager records the intensity of the luminescence emitted by Salmonella bacteria in the intestinal tracts of the mice (measured as photons per second).
Results are shown in
We have also shown that pretreatment with a synthetic stool preparation decreased Salmonella infection in a Salmonella animal model of colitis. The synthetic stool preparation used in the above examples and the Salmonella strain Salmonella typhimurium-Xen26 were used for these studies. Results are given in
Assays in Examples 5 and 6 were performed using methods as published (Wu, S. et al., Am. J. Physiol. Gastrointest. Liver Physiol., 298(5):G784-94, 2010; Liao, A. P. et al., PLoS One, 3(6):e2369, 2008; Petrof, E. O. et al., 294(3):G808-18, 2008), and as described below:
Purification of Toxin a and Toxin B of Clostridium difficile
Purification of toxin A and B was carried out according to N.M. Sullivan et al. (Sullivan, N. M. et al., Infect. Immun., 35: 1032-1040, 1982) and J. Meador et al. (Meador III, J. and Tweten, R. K., Infect. Immun., 56: 1708-1714, 1988). In brief, 50 mL of brain heart infusion broth was inoculated with C. difficile 078 and grown for 24 hours at 35° C. This culture was transferred to 100 mL of PBS in a dialysis bag (12-14 kDa exclusion limit; Fisher Scientific), which was suspended in 800 mL of brain heart infusion broth and grown anaerobically for 72 hours at 35° C. After centrifugation at 8,000 g for 10 minutes, the supernatant was filtered through a 0.45 um membrane filter, and concentrated to 5 mL by centrifugation at 4° C. with Centricon Plus-70 filter device (exclusion limit 30,000 kDa; Millipore). The concentrated 5 mL supernatant was loaded onto a DEAE-Sepharose CL-6B column (Sigma Aldrich), which was equilibrated with 50 mM Tris-HCl (pH 7.5), followed by a wash with 200 mL of 50 mM Tris-HCl containing 50 mM NaCl. A 300 mL linear gradient of NaCl (50 mM to 250 mM) in 50 mM Tris-HCl buffer (pH7.5) was first applied to the column to elute toxin A. Then the column was washed with 50 mM Tris-HCl containing 300 mM NaCl. A second linear gradient of NaCl (300 mM to 600 mM) in the same Tris buffer was applied to the column to elute toxin B. Fractions from both gradients were collected and protein concentration was monitored by absorbance at 280 nm.
The cytotoxicity assay was carried out in 12-well plates. NIH 3T3 cells were cultured to confluency in DMEM medium containing 10% fetal bovine serum (Invitrogen). Peak fractions determined by UV spectrometry were put on the cells (100 ul from each fraction in each well). The toxicity of toxins was determined by causing 100% of the cells in the wells to become round within 24 hours. The fractions with the highest cytotoxicity were pooled, concentrated to around 500 μl, and protein concentration was determined by A280 using extinction coefficient 0.1% (1 g/L) 1.292 for toxin A and 0.1% (1 g/L) 1.067 for toxin B by using ExPASy.
C57131/6 female mice 7 weeks old were fasted for 4 hours prior to gavage with 20 mg streptomycin. The mice were left overnight with free access to food and water. Eighteen hours after streptomycin administration the mice were gavaged with 100 μl of the“RePOOPulate” synthetic stool preparation (OD600 at 1/10 dilution was 0.340, corresponding to 3.4×109 cells/mL) or vehicle control (Saline). After 4 hours, the mice were gavaged with 108 colony forming units of Salmonella enterica serovar Typhimurium. At 2 days post-infection, mice from each treatment group were euthanized with isoflurane followed by cervical dislocation.
During the entire experimental model mice were weighed daily, to monitor body weight.
Spleens and colons were harvested 2 days post-infection with S. Typhimurium and weighed. Each sample was put into 1 ml of sterile phosphate-buffered saline (PBS) and homogenized. Serial dilutions were plated on MacConkey agar plates containing 100 μg/ml streptomycin. Plates were incubated at 37° C. for 24 hours.
Blood was collected from the mice through cardiac puncture. Blood was spun at 5000 rpm for 7 minutes and serum was removed and stored at −80° C. until assay. Serum levels of MCP-1 were detected using ELISA according to manufacturer's instructions.
The ceca of the mice were fixed in 10% formalin for 18-24 hours followed by 18-14 hours in 70% ethanol. The ceca were then embedded in paraffin, sectioned and stained with hematoxylin and eosin.
Each independent mouse experiment consisted of 17 female, 6-8 week old C57BL/6 mice. Mice were obtained from Charles River and were allowed to acclimatize for 7 days. Following the week of acclimatization, half the mice were gavaged with 150 μL of synthetic stool preparation (“RePoopulate”), and half were gavaged with 150 μL of saline as a vehicle control. The following day the mice were again gavaged identically to the day prior, ending the 2 days of pre-treatment. The following morning mice in the DSS+Saline, and DSS+RePoop treatment groups were administered 3% DSS (w/v) dissolved in their water. Mice in non-DSS groups remained on normal water. DSS mouse groups were administered DSS in the water for 5 full days, and on the sixth morning they were returned to normal water for 2 full days. On the third morning following the end of DSS mice were sacrificed and tissues collected for analysis.
Following sacrifice of mice, 200-300 μL of blood was obtained by cardiac puncture and transferred to blood collection tubes. Tubes were centrifuged for 10 minutes at 4000 rpm, and 100-200 μL of serum was removed and stored in Eppendorf tubes at −80° C. until needed for MCP-1 ELISA. Instructions provided in the Quantikine JE/MCP-1 Immunoassay Kit were used to carry out the ELISA.
Toxin B was isolated from C.difficile cultures, and then used to treat NIH 3T3 fibroblasts for 2 or 4 hours with 1 ug of purified toxin B. Cells pretreated with the synthetic stool preparation were protected from dying in both cases (
Mice were fed (gavaged) daily for 2 days with either “RePOOPulate” synthetic stool preparation or saline. Their colons were then removed and sutured to make intestinal loops which were then injected with C.difficile toxin A purified from C.difficile cultures (see
In order to test anti-sporulation of bacterial strains, CD13, a non-toxigenic C. difficile strain, was spread on FASTIDIOUS ANAEROBE AGAR™ supplemented with 5% sheep's blood (FAA™), and incubated at 37° C. in an anaerobic chamber for 24 hours. 1 medium-sized colony was selected and subsequently inoculated into 2 mL brain-heart infusion broth (BHI). To ensure no spores were present at the onset of the experiment, C. difficile strains were incubated anaerobically in BHI until an OD of 0.2-0.5 was reached and 1% of this inoculum was inoculated into 2 mL BHI supplemented with 0.1% L-cysteine and 5 mg/mL yeast extract (BHIS), an efficient medium for C. difficile sporulation (Burns, D. A. and Minton, N. P., J. Microbiol. Methods, 87(2):133-8, 2011).
Strain 31FAA was grown anaerobically on FAA™ for 24 hours at 37° C. 1 medium-sized colony was inoculated into 8 mL of tryptic soy broth supplemented with 200 μL of hemin and 200 μL menadione (suppl. TSB) in a borosilicate glass tube and incubated for 48 hours. 1 mL of resuspended CD13 in fresh BHIS and 2 mL of 31FAA in suppl. TSB were combined into culture in a fresh borosilicate glass tube. The mixed culture was incubated anaerobically at 37° C. for 24 hours. 50 μL of sample was taken from the mixed culture and thoroughly vortexed for 10 seconds, fixed with 100% methanol and mounted on a microscope slide. The Schaeffer-Fulton endosporestain (Schaeffer, A. B. and Fulton, M., Sci. New Series 1933, 77:194, 1990) was employed, and specimens were viewed with bright-field microscopy using 1000× magnification and an oil immersion lens. 9 different fields of view were captured and spores were enumerated in the 9 fields of view per microscope slide. Results are shown in
Results shown in
“RePOOPulate” synthetic stool preparation (RP) was used to inoculate a batch culture and a continuous culture, and the cultures were run in parallel. Samples from the starting inoculum, the continuous culture, and the batch culture after 1, 2 or 3 days, were compared. The results show that the samples are nearly identical (
Data in
Erysipelotrich
Escherichia/Shi
Erysipelotrich
Escherichia/Shi
For the analysis in this example, PCR amplification of the bacterial V6 rRNA region was carried out with the left-side primer CWACGCGARGAACCTTACC (SEQ ID NO: 133) and the right-side primer ACRACACGAGCTGACGAC (SEQ ID NO: 134). These primer sequences were chosen because they are exact matches to >95% of the rRNA sequences from organisms identified in the human microbiome project. In addition the left-side primers contained the standard Ion Torrent adapter and key sequence at their 5′ end (CCATCTCATCCCTGCGTGTCTCCGACTCAG) (SEQ ID NO: 135). One of the following 5-mer barcodes was located between the 3′ end of the key sequence and the 5′ end of the primer: GTATC, GCGAT, GCATG, GTAGA, GTCGT. The right-side primer had the other standard Ion Torrent adapter sequence (CCTCTCTATGGGCAGTCGGTGAT) (SEQ ID NO: 136) attached to its 5′ end. Amplification was performed for 25 cycles in 40 μl using the colorless GO-Taq hot start master mix (Promega) according to the manufacturer's instructions with the following three-step temperature profile: 95° C., 55° C. and 72° C. for 1 minute each step. Then 5 μl of the resulting amplification were quantified using the QuBit broad-range double-stranded DNA fluorometric quantitation reagent. Samples were pooled at approximately equal concentrations and purified using a Wizard PCR Clean-Up Kit.
Sequence reactions were carried out on the Ion Torrent 316 chip platform. The sequence was provided in sff format and was converted to fastq by the sff2fastq program (0.8.0) with no trimming enabled. The Ion Torrent key sequence was trimmed using a custom perl script. All sequences were then filtered according to the following criteria: exact match to the left-side primer including redundant positions in the primer, exact matches to the barcodes used, an exact match to the first nine nucleotides of the right-side primer, and a length between the left-side and right-side primer of between 70 and 90 nucleotides. This length was chosen because it encompasses the predicted amplicon product size from all human-associated bacterial organisms that have been cultured and sequenced as part of the human microbiome project.
A table of counts for sequences grouped at the 97% operational taxonomic unit (OTU) and 100% identical sequence unit identity level were generated for each sample, keeping all identical sequence unit or OTU sequences that were represented in any sample at a frequency>0.5%. Reads that were never abundant in any sample (<0.5%) were grouped into the remainder and discarded.
Classification of the sequences by either the GreenGenes or RDP classifiers proved to be unreliable because of the short length of the V6 region. Classification of the sequences present in the count table was therefore performed using the RDP closest match option on the full-length, high-quality, isolated subset. The maximum number of best hits was identified, and the taxonomic classification of the best match and ties was collected down to the genus level. The classification of those hits was adopted for all levels where the classification was identical across all best matches, otherwise the classification was marked as undefined. Classifications were verified by Mega-BLAST (NCBI) to the 16S rRNA dataset. When BLAST classification provided more information, it was used instead and the percent coverage of the sequence and the percent identity are reported in the taxonomy file provided as the underscore-separated numbers. The sequence files for each OTU are attached.
Sequences were aligned by muscle (v3.6) using the default parameters, and a neighbour joining tree was generated in clustalw (v 2.0.10). The OTU table and the tree were used as inputs for qiime (v 1.5.0) analysis using the macqiime installation. Beta diversity and the weighted unifrac distances were calculated using default parameters. The unifrac distance matrix is included Barplots ordered by the weighted unifrac distances were drawn with a custom R script.
Although this invention is described in detail with reference to preferred embodiments thereof, these embodiments are offered to illustrate but not to limit the invention. It is possible to make other embodiments that employ the principles of the invention and that fall within its spirit and scope as defined by the claims appended hereto.
The contents of all documents and references cited herein are hereby incorporated by reference in their entirety.
This application is a continuation of U.S. application Ser. No. 15/492,770, filed Apr. 20, 2017, which is a continuation of U.S. application Ser. No. 14/344,981, filed Aug. 20, 2014, which is a National Phase 371 application of International Application No. PCT/CA2012/050642, filed Sep. 14, 2012, which claims priority to U.S. provisional application No. 61/534,456, filed on Sep. 14, 2011, the entire contents of which are hereby incorporated by reference.
| Number | Date | Country | |
|---|---|---|---|
| 61534456 | Sep 2011 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 15492770 | Apr 2017 | US |
| Child | 16710187 | US | |
| Parent | 14344981 | Aug 2014 | US |
| Child | 15492770 | US |
