Method of increasing conversion of a fatty acid to its corresponding dicarboxylic acid

Abstract

A nucleic acid sequence including a CYP promoter operably linked to nucleic acid encoding a heterologous protein is provided to increase transcription of the nucleic acid. Expression vectors and host cells containing the nucleic acid sequence are also provided. The methods and compositions described herein are especially useful in the production of polycarboxylic acids by yeast cells.

Description

BACKGROUND OF THE INVENTION

1. Field of the Invention

This invention relates to processes and compositions for improving dicarboxylic acid production in yeast by replacing the native promoter of a target gene with a heterologous promoter from a yeast gene having a desired level of activity.

2. Description of Related Art

Aliphatic dioic acids are versatile chemical intermediates useful as raw materials for the preparation of perfumes, polymers, adhesives and macrolid antibiotics. While several chemical routes to the synthesis of long-chain α, ω-dicarboxylic acids are available, the synthesis is not easy and most methods result in mixtures containing shorter chain lengths. As a result, extensive purification steps are necessary. While it is known that long-chain dioic acids can also be produced by microbial transformation of alkanes, fatty acids or esters thereof, chemical synthesis has remained the most commercially viable route, due to limitations with the current biological approaches.

Several strains of yeast are known to excrete α, ω-dicarboxylic acids as a byproduct when cultured on alkanes or fatty acids as the carbon source. In particular, yeast belonging to the Genus Candida, such as C. albicans, C. cloacae, C. guillermondii, C. intermedia, C. lpolytica, C. maltosa, C. parapsilosis and C. zeylenoides are known to produce such dicarboxylic acids ( Agr. Biol. Chem . 35: 2033-2042 (1971)). Also, various strains of C. tropicalis are known to produce dicarboxylic acids ranging in chain lengths from C 11 through C 18 (Okino et al., B M Lawrence, B D Mookherjee and B J Willis (eds), in Flavors and Fragrances: A World Perspective . Proceedings of the 10 th International Conference of Essential Oils, Flavors and Fragrances, Elsevier Science Publishers BV Amsterdam (1988)), and are the basis of several patents as reviewed by Bühler and Schindler, in Aliphatic Hydrocarbons in Biotechnology , H. J. Rehm and G. Reed (eds), Vol. 169, Verlag Chemie, Weinheim (1984).

Studies of the biochemical processes by which yeasts metabolize alkanes and fatty acids have revealed three types of oxidation reactions: α-oxidation of alkanes to alcohols, ω-oxidation of fatty acids to α, ω-dicarboxylic acids and the degradative β-oxidation of fatty acids to CO 2 and water. The first two types of oxidations are catalyzed by microsomal enzymes while the last type takes place in the peroxisomes. In C. tropicalis , the first step in the ω-oxidation pathway is catalyzed by a membrane-bound enzyme complex (ω-hydroxylase complex) including a cytochrome P450 monooxygenase and a NADPH cytochrome reductase. This hydroxylase complex is responsible for the primary oxidation of the terminal methyl group in alkanes and fatty acids as described, e.g., in Gilewicz et al., Can. J. Microbiol . 25:201 (1979), incorporated herein by reference. The genes which encode the cytochrome P450 and NADPH reductase components of the complex have previously been identified as P450ALK and P450RED respectively, and have also been cloned and sequenced as described, e.g., in Sanglard et al., Gene 76:121-136 (1989), incorporated herein by reference. P450ALK has also been designated P450ALK1. More recently, ALK genes have been designated by the symbol CYP and RED genes have been designated by the symbol CPR. See, e.g., Nelson, Pharmacogenetics 6(1):1-42 (1996), which is incorporated herein by reference. See also Ohkuma et al., DNA and Cell Biology 14:163-173 (1995), Seghezzi et al., DNA and Cell Biology , 11:767-780 (1992) and Kargel et al., Yeast 12:333-348 (1996), each incorporated herein by reference. In addition, CPR genes are now also referred to as NCP genes. See, e.g., De Backer et al., Antimicrobial Agents and Chemotherapy , 45:1660 (2001). For example, P450ALK is also designated CYP52 according to the nomenclature of Nelson, supra. Fatty acids are ultimately formed from alkanes after two additional oxidation steps, catalyzed by alcohol oxidase as described, e.g., in Kemp et al., Appl. Microbiol. and Biotechnol . 28: 370-374 (1988), incorporated herein by reference, and aldehyde dehydrogenase. The fatty acids can be further oxidized through the same or similar pathway to the corresponding dicarboxylic acid. The ω-oxidation of fatty acids proceeds via the ω-hydroxy fatty acid and its aldehyde derivative, to the corresponding dicarboxylic acid without the requirement for CoA activation. However, both fatty acids and dicarboxylic acids can be degraded, after activation to the corresponding acyl-CoA ester through the β-oxidation pathway in the peroxisomes, leading to chain shortening. In mammalian systems, both fatty acid and dicarboxylic acid products of ω-oxidation are activated to their CoA-esters at equal rates and are substrates for both mitochondrial and peroxisomal β-oxidation ( J. Biochem ., 102:225-234 (1987)). In yeast, β-oxidation takes place solely in the peroxisomes ( Agr. Biol. Chem . 49:1821-1828 (1985)).

Cytochrome P450 monooxygenases (P450s) are terminal monooxidases of a multicomponent enzyme system including P450 and CPR (NCP). In some instances, a second electron carrier, cytochrome b5(CYTb5) and its associated reductase are involved as described below and in Morgan, et al., Drug Metab. Disp . 12:358-364 (1984). The P450s comprise a superfamily of proteins which exist widely in nature having been isolated from a variety of organisms as described e.g., in Nelson, supra. These organisms include various mammals, fish, invertebrates, plants, mollusk, crustaceans, lower eukaryotes and bacteria (Nelson, supra). First discovered in rodent liver microsomes as a carbon-monoxide binding pigment as described, e.g., in Garfinkel, Arch. Biochem. Biophys . 77:493-509 (1958), which is incorporated herein by reference, P450s were later named based on their absorption at 450 nm in a reduced-CO coupled difference spectrum as described, e.g., in Omura et al., J. Biol. Chem . 239:2370-2378 (1964), which is incorporated herein by reference.

Monooxygenation reactions catalyzed by cytochromes P450 in a eukaryotic membrane-bound system require the transfer of electrons from NADPH to P450 via NADPH-cytochrome P450 reductase (CPR) as described, e.g., in Taniguchi et al., Arch. Biochem. Biophys . 232:585 (1984), incorporated herein by reference. CPR is a flavoprotein of approximately 78,000 Da containing 1 mol of flavin adenine dinucleotide (FAD) and 1 mol of flavin mononucleotide (FMN) per mole of enzyme as described, e.g., in Potter et al., J. Biol. Chem . 258:6906 (1983), incorporated herein by reference. The FAD moiety of CPR is the site of electron entry into the enzyme, whereas FMN is the electron-donating site to P450 as described, e.g., in Vermilion et al., J. Biol. Chem . 253:8812 (1978), incorporated herein by reference. The overall reaction is as follows:

H + +RH+NADPH+O 2 →ROH+NADP + +H 2 O

Binding of a substrate to the catalytic site of P450 apparently results in a conformational change initiating electron transfer from CPR to P450. Subsequent to the transfer of the first electron, O 2 binds to the Fe 2 + -P450 substrate complex to form Fe 3 + -P450-substrate complex. This complex is then reduced by a second electron from CPR, or, in some cases, NADH via a second electron carrier, cytochrome b5 (CYTb5) and its associated NADH-cytochrome b5 reductase as described, e.g., in Guengerich et al., Arch. Biochem. Biophys . 205:365 (1980), incorporated herein by reference, and Morgan, supra. Most of the aforementioned studies implicate CYTb5 as being involved in the pathway only for the transfer of the second electron. One atom of this reactive oxygen is introduced into the substrate, while the other is reduced to water. The oxygenated substrate then dissociates, regenerating the oxidized form of the cytochrome P450 as described, e.g., in Klassen, Amdur and Doull, Casarett and Doull's Toxicology , Macmillan, N.Y. (1986), incorporated herein by reference. With respect to the CYTb5, several other models of the role of this protein in P450 expression have been proposed besides its role as an electron carrier.

While several chemical routes to the synthesis of long-chain α, ω-dicarboxylic acids as 9-octadecenedioic acid are available, such methods are complex and usually result in mixtures containing shorter chain lengths. As a result, extensive purification steps are necessary. As an alternative to chemical syntheses, long chain α,ω-dicarboxylic acids such as 9-octadecenedioic acid can be made via fermentation methods such as microbial transformation of the corresponding hydrocarbons such as alkanes or alkenes, fatty acids or esters thereof. One method for producing substantially pure α,ω-dicarboxylic acids in substantially quantitative yield is described in U.S. Pat. No. 5,254,466, the entire contents of which are incorporated herein by reference. This method comprises culturing a C. tropicalis strain wherein both copies of the chromosomal POX5 and each of the POX4A and POX4B genes are disrupted in a culture medium containing a nitrogen source, an organic substrate and a cosubstrate.

The POX4 and POX5 gene disruptions effectively block the β-oxidation pathway at its first reaction (which is catalyzed by acyl-CoA oxidase) in a C. tropicalis host strain. The POX4A and POX5 genes encode distinct subunits of long chain acyl-CoA oxidase, which are the peroxisomal polypeptides (PXPs) designated PXP-4 and PXP-5, respectively. The disruption of one or more of these genes results in a partial or complete inactivation of the β-oxidation pathway thus allowing enhanced yields of dicarboxylic acid by redirecting the substrate toward the α-oxidation pathway and also prevents reutilization of the dicarboxylic acid products through the β-oxidation pathway.

Another method for producing substantially pure α,ω-dicarboxylic acids in substantial yield is described in U.S. application Ser. No. 09/302,620, now U.S. Pat. No. 6,331,420, and international Application No.PCT/US99/20797, the entire contents of each being incorporated herein by reference. This method includes increasing the CYP and CPR (NCP) enzymes by amplification of the CYP and CPR gene copy number in C. tropicalis strain, and culturing the genetically modified strain in media containing an organic substrate.

Gene(s) involved in the bioconversion of various feed stocks, e.g., HOSFFA (high oleic sunflower oil, i.e., fatty acid mixtures containing oleic acid commercially available from Cognis Corp. as Edenor® and Emersol®), have native promoters that control their transcriptional regulation. These promoters are sometimes inadequate to achieve the level of transcription needed to make a gene(s) product, e.g., CPR or CYTb5, that is involved in a given process.

Accordingly, there exists a need for improved processes for increasing dicarboxylic acid production in yeast.

SUMMARY OF THE INVENTION

In one aspect, the present invention involves improved processes and compositions for increasing dicarboxylic acid production in a microorganism such as yeast. In one embodiment, dicarboxylic acid production is increased by isolating a weak promoter of a gene involved in dicarboxylic acid production and replacing the weak promoter with a strong promoter from a yeast gene having a high level of expression. The substitution of a strong promoter operably linked to a target gene involved in dicarboxylic acid production increases the level of transcription of that target gene.

In another aspect, a nucleic acid sequence is provided which includes a CYP52A2A gene promoter operably linked to the open reading frame of a gene encoding a heterologous protein. Such nucleic acid sequence may be utilized to transform a host cell, to obtain increased expression of a target protein.

In another aspect, expression vectors are provided which include any one of the aforementioned nucleic acid constructs. In yet another aspect, a host cell transformed with one of the aforementioned expression vectors is provided.

In another aspect, a process for transforming a host cell is provided which includes isolating a CYP52A2A promoter; isolating a target gene; operably linking CYP52A2A promoter to the open reading frame target gene to create a fusion gene; inserting the fusion gene into an expression vector; and transforming the host cell with the expression vector.

DESCRIPTION OF THE DRAWINGS

FIGS. 1A-1B depict the nucleotide sequence of the CYP52A2A gene of C. tropicalis 20336 (SEQ ID NO:1).

FIGS. 2A-2B depict the nucleotide sequence of the CPRA gene of C. tropicalis 20336 (SEQ ID NO:2).

FIGS. 3A-3B depict the nucleotide sequence of the CPRB gene of C. tropicalis 20336 (SEQ ID NO:3).

FIGS. 4A-4C depict the nucleotide sequence along with amino acid sequences corresponding to certain delineated nucleic acid sequences of the CYTb5 gene of C. tropicalis 20336 (SEQ ID NOS:4 and 5).

FIGS. 5A-5D depict the nucleotide sequence along with amino acid sequences corresponding to certain delineated nucleic acid sequences of the CYP52A2A/CPRB fusion gene (SEQ ID NO:10).

FIG. 6A is a schematic depiction of the λ ZAP Express™ vector.

FIG. 6B is a map of the pBK-CMV phagemid vector.

FIG. 7 is schematic representation plasmid pCR2.1™ available from Invitrogen. Nucleic acid sequences for selected restriction sites and other features are depicted (SEQ ID NO:33 and complementary strand SEQ ID NO:34).

FIG. 8 depicts the nucleotide sequence (SEQ ID NO:23) along with the amino acid sequences (SEQ ID NO:24) corresponding to certain delineated nucleic acid sequences of the URA3A gene.

FIG. 9 is a schematic depiction of plasmid pNEB193.

FIG. 10 is a schematic depiction of the pURAin integration vector.

FIG. 11 depicts the nucleotide sequence of the CYP52A2A gene promoter/CYP52A5A ORF fusion gene (SEQ ID NO:31).

DETAILED DESCRIPTION OF THE INVENTION

Increasing dicarboxylic acid production in yeast in accordance with the present invention is based on isolating a promoter from a yeast gene having a desired level of expression and operably linking the promoter to a target gene involved in dicarboxylic acid production. Accordingly, promoter substitution using highly inducible heterologous promoters operably linked to the open reading frame (ORF) of a target gene involved in dicarboxylic acid production in yeast increases the yield of dicarboxylic acids as a result of increased transcription. Furthermore, promoters of gene(s) that are induced at various defined times during the bioconversion in response to certain stimuli (e.g., stress, substrate, cell death) may be utilized for promoter substitution of the target gene(s) thereby leading to increased dicarboxylic acid production at defined times during the bioprocess.

The CYP52A2A gene of C. tropicalis 20336 (SEQ ID NO.1) (See FIG. 1 ), as described in aforementioned U.S. application Ser. No. 09/302,620, now U.S. Pat. No. 6,331,420, and International Application No. PCT/US99/20797 is one gene from a family of genes involved in the metabolism of oleic acid to produce oleic dicarboxylic acid. The level of transcriptional induction of this gene in an oleic acid fermentation is many fold (>25) above other members of the same gene family. CPR genes (also referred to herein as NCP genes), e.g., CPRA (SEQ ID NO.2) and CPRB (SEQ. ID. NO.3) of C. tropicalis 20336 (cytochrome P450 reductase, FIGS. 2 and 3 , respectively) are other genes involved in the process of producing dicarboxylic acid. However, the level of transcriptional induction of such CPR genes in a corresponding fermentation is only three-fold above background which defines a rate limiting factor in the production of dicarboxylic acids.

Any gene involved in fatty acid bioconversion which transcribes at a rate lower than CYP52A2A may be upregulated by the substitution of its native promoter with the CYP52A2A promoter. In a preferred embodiment, the promoter of the CPR gene is substituted with the promoter of the CYP52A2A or other CYP gene(s), thereby increasing the transcriptional induction of the CPR gene. As an example, the CYP promoter is derived from the CYP52A2A gene of C. tropicalis 20336. The complete promoter of the CYP gene or a portion thereof containing all of the essential functional sites for the promoter region is operably linked to the open reading frame of a CPR gene, such as the CPRB gene from C. tropicalis 20336. This in turn results in the increased transcription and production of the CPR protein and a corresponding increase in the conversion of a fatty acid, e.g., oleic acid, to its corresponding dicarboxylic acid. The term “operably linked” refers to the association of nucleic acid sequences so that the function of one is affected by the other. A promoter is operably linked with an open reading frame when it is capable of affecting the expression of the open reading frame (ORF) (i.e., the ORF is under the transcriptional control of the promoter). Notwithstanding the presence of other sequences between the promoter and ORF, it should be understood that a promoter may still be considered operably linked to the ORF. In another preferred embodiment the promoter of the CYTb5 gene is replaced by the promoter of the CYP52A2A or other CYP gene(s) in essentially the same manner described herein, resulting in increased production of the CYTb5 protein and an increase in the conversion of fatty acids to their corresponding dicarboxylic acids.

In one embodiment of the present invention, the desired promoter region is isolated using conventional techniques known to those skilled in the art. The CYP gene is cut at a convenient location downstream of the promoter terminus using an appropriate restriction enzyme to effect scission. The structural CYP gene region is then removed, to leave essentially a DNA sequence containing the promoter region. For the upstream cutting, a site is selected sufficiently far upstream to include in the retained portion all of the necessary functional sites for the promoter region, and then cut using an appropriate restriction enzyme. It should be understood that in all embodiments described herein the promoter may be included on a nucleic acid fragment that is larger than the actual promoter region and that the entire fragment, including additional nucleic acid sequence can be utilized for fusion to a target gene.

Next, a promoter/target gene open reading frame nucleotide fusion construct is prepared. The promoter is operably linked to a heterologous target gene, i.e., to the open reading frame of a gene other than the CYP52A2A gene to create a nucleotide fusion construct for integration into a host cell. Procedures for fusing promoters to target genes such that they are operably linked and yield the desired DNA construct are well known in the art. Restriction enzymes, ligating enzymes and polymerases are conventional tools commonly utilized by those skilled in the art to create fusion constructs. In a preferred embodiment, polymerase chain reaction (PCR) primers are constructed to amplify the promoter of the CYP52A2A gene using PCR. The correct sequence is verified by conventional techniques known to those skilled in the art. The open reading frame (ORF) and 3′ untranslated region (UTR) of the target gene, e.g., CPR or CYTb5, are also amplified by PCR and verified by sequencing. These two sequences are then fused together by PCR using the two PCR products and the original primers of the initial PCRs that are not homologous at the fusion junction. The product contains the CYP52A2A promoter, the target gene ORF and 3′ UTR and is confirmed by sequence analysis.

The promoter/target gene ORF fusion constructs are then utilized to create a DNA integration vector for transformation into any suitable host cells. For example, suitable yeast host cells for use in accordance with the present invention include, but are not limited to, Yarrowia, Bebaromyces, Saccharomyces, Schizosaccharomyces, and Pichia and more preferably those of the Candida genus. Preferred species of Candida are tropicalis, maltosa, apicola, paratropicalis, albicans, cloacae, guillermondii, intermedia, lipolytica, parapsilosis and zeylenoides.

Particularly preferred hosts include C. tropicalis strains that have been genetically modified so that one or more of the chromosomal POX4A, POX4B and both POX5 genes have been disrupted as described, e.g., in U.S. Pat. Nos. 5,254,466 and 5,620,878, each incorporated herein by reference. Such disruption blocks the β-oxidation pathway. Examples of β-oxidation blocked strains of C. tropicalis include H41, H41B, H51, H45, H43, H53, H534, H534B, H435 and H5343 (ATCC 20962) as described in aforementioned U.S. Pat. No. 5,254,466.

The DNA constructs described herein may be cloned and expressed in suitable expression vectors. Examples include, but are not limited to vectors such as plasmids, phagemids, phages or cosmids, yeast episomal plasmids, yeast artificial chromosomes, and yeast replicative plasmids. Host cells may also be transformed by introducing into a cell a linear DNA vector(s) containing the desired gene sequence. Such linear DNA may be advantageous when it is desirable to avoid introduction of non-native (foreign) DNA into the cell. For example, DNA consisting of a desired target gene(s) flanked by DNA sequences which are native to the cell can be introduced into the cell by methods such as, but not limited to electroporation, lithium acetate transformation, and spheroplasting. Flanking DNA sequences can include selectable markers and/or other tools for genetic engineering. Yeast cells may be transformed with any of the expression vectors described herein. The term “expression vector” is used broadly herein and is intended to encompass any medium which includes nucleic acid and which can be used to transform a target cell. Expression vector thus encompasses all the examples of vectors listed herein including, e.g., integration vectors.

In a preferred embodiment the DNA construct is used to transform a yeast cell, e.g., a Candida sp., to obtain increased expression therein of a protein, e.g., a CPR protein, the DNA construct comprising an inducible CYP promoter DNA for promoter transcription in yeast operably linked to DNA coding for the CPR protein to enable expression thereof in the yeast cell, the CYP promoter DNA being foreign or heterologous to the DNA coding for the protein. Once created, a yeast host cell containing the CYP52A2A promoter/target gene ORF chimera is generated.

In another preferred embodiment, the DNA fusion construct is used to transform a yeast cell, e.g., a Candida sp., to obtain increased expression therein of a CYTb5 protein, the DNA construct comprising an inducible CYP promoter DNA for promoter transcription in yeast operably linked to DNA coding for the CYTb5 protein to enable expression thereof in the yeast cell, the CYP promoter DNA being foreign or heterologous to the DNA coding for the CYTb5 protein. As an example, the complete CYP52A2A promoter or a portion thereof derived from the CYP52A2A gene of C. tropicalis 20336 containing all of the essential functional sites for the promoter region is fused to the open reading frame of a CYTb5 gene such as the CYTb5 gene from C. tropicalis 20336 ( FIG. 4 depicts the nucleic acid sequence (SEQ. ID. NO. 4) and amino acid sequence (SEQ. ID. NO. 5) corresponding to certain delineated nucleic acid sequences).

The strength of the promoter may be measured using techniques well known to those skilled in the art. In a preferred embodiment, promoter strength may be measured using quantitative competitive reverse transcription polymerase chain reaction (QC-RT-PCR) to measure CPR and CYTb5 gene expression in yeast e.g., Candida cells isolated from fermentors. Enzymatic assays and antibodies specific for both CPR and CYTb5 proteins may be used when appropriate to verify that increased promoter strength is reflected by increased synthesis of the corresponding protein. Diacid productivity is thus improved by selective integration, amplification, and over expression of CPR and CYTb5 genes in a yeast production host, e.g., C. tropicalis, C. maltosa , Pichia, etc.

The yeast cells transformed with one of the aforementioned vectors, may be cultured in media containing an organic substrate, to provide improved production of dicarboxylic acid(s). Culturing the yeast, i.e., fermenting the yeast, may be accomplished by procedures well known in the art as described, e.g., in aforesaid U.S. Pat. No. 5,254,466.

A suitable organic substrate herein may be any organic compound that is biooxidizable to a mono- or polycarboxylic acid. Such a compound may be any saturated or unsaturated aliphatic compound or any carboxylic or heterocyclic aromatic compound having at least one terminal methyl group, a terminal carboxyl group and/or a terminal functional group which is oxidizable to a carboxyl group by biooxidation. A terminal functional group which is a derivative of a carboxyl group may be present in the substrate molecule and may be converted to a carboxyl group by a reaction other than biooxidation. For example, if the terminal group is an ester that neither the wild-type C. tropicalis nor the genetic modifications described herein will allow hydrolysis of the ester functionality to a carboxyl group, then a lipase can be added during the fermentation step to liberate free fatty acids. Suitable organic substrates include, but are not limited to, saturated fatty acids, unsaturated fatty acids, alkanes, alkenes, alkynes and combinations thereof.

Alkanes are a type of saturated organic substrate which are particularly useful herein. The alkanes can be linear or cyclic, branched or straight chain, substituted or unsubstituted. Particularly preferred alkanes are those having from about 4 to about 25 carbon atoms, examples of which include, but are not limited to, butane, hexane, octane, nonane, dodecane, tridecane, tetradecane, hexadecane, octadecane and the like.

Examples of unsaturated organic substrates which may be used herein include, but are not limited to, internal olefins such as 2-pentene, 2-hexene, 3-hexene, 9-octadecene and the like; unsaturated carboxylic acids such as 2-hexenoic acid and esters thereof, oleic acid and esters thereof including triglyceryl esters having a relatively high oleic acid content, erucic acid and esters thereof including triglyceryl esters having a relatively high erucic acid content, ricinoleic acid and esters thereof including triglyceryl esters having a relatively high ricinoleic acid content, linoleic acid and esters thereof including triglyceryl esters having a relatively high linoleic acid content; unsaturated alcohols such as 3-hexen-1-ol, 9-octadecen-1-ol and the like; unsaturated aldehydes such as 3-hexen-1-al, 9-octadecen-1-al and the like. In addition to the above, an organic substrate which may be used herein include alicyclic compounds having at least one internal carbon-carbon double bond and at least one terminal methyl group, a terminal carboxyl group and or a terminal functional group which is oxidizable to a carboxyl group by biooxidation. Examples of such compounds include, but are not limited to, 3,6-dimethyl, 1,4-cyclohexadiene, 3-methylcyclohexene, 3-methyl-1, 4-cyclohexadiene and the like.

Examples of the aromatic compounds that may be used herein include but are not limited to, arenes such as o-, m-, p-xylene; o-, m-, p-methyl benzoic acid; dimethyl pyridine, sterols and the like. The organic substrate can also contain other functional groups that are biooxidizable to carboxyl groups such as an aldehyde or alcohol group. The organic substrate can also contain other functional groups that are not biooxidizable to carboxyl groups and do not interfere with the biooxidation such as halogens, ethers, and the like.

Examples of saturated fatty acids which may be applied to yeast cells incorporating the aforementioned fusion constructs according to the present invention include caproic, enanthic, caprylic, pelargonic, capric, undecylic, lauric, myristic, pentadecanoic, palmitic, margaric, stearic, arachidic, behenic acids and combinations thereof. Examples of unsaturated fatty acids which may be applied to genetically modified yeast cells include palmitoleic, oleic, erucic, linoleic, linolenic acids and combinations thereof. Alkanes and fractions of alkanes may be applied which include chain links from C12 to C24 in any combination. An example of a preferred fatty acid mixture is HOSFFA (high oleic sunflower oil, i.e., fatty acid mixture containing approximately 80% oleic acid commercially available from Cognis Corp. as Edenor®).

The following examples are meant to illustrate but not to limit the invention.

EXAMPLE I

Construction of CYP52A2A/CPRB Fusion Gene

PCR primers were designed to the promoter region in CYP52A2A constructs. An approximately 496 bp nucleotide segment containing the CYP52A2A promoter (−496 bp from the start codon of the CYP52A2A gene; see positions 9-504 of FIG. 5A ) was amplified using the CYP2A#1 and CYP2A fus primers set forth below. The ORF (open reading frame) of CPR B and its 3′UTR were amplified using CPR fus and CPRB#2. These two PCR products were fused together by PCR using the CYP2A#1 and CPRB#2 primers to generate a construct containing approximately 500 bp of 3′UTR. In all PCR reactions, Platinum Pfx (Stratagene, LaJolla, Calif.), was used. The nucleotide sequences of the aforementioned primers are shown in Table 1 below.

TABLE 1
CYP2A#1	3659-72M	CCTTAATTAAATGCACGAAGCGGAGATAAAAG
		(SEQ. ID. NO. 6)
CYP2A fus	106-10A	GTCTAAAGCCATGGTCGTGAT
		(SEQ. ID. NO. 7)
CPR fus	106-10B	AACATGGCTTTAGACAAGTTAG
		(SEQ. ID. NO. 8)
CPRB#2	106-87B	CCTTAATTAATGTCGTTGATAATGACGTTGCG
		(SEQ. ID. NO. 9)

The sequence of the resulting construct was verified before use (see FIG. 5 which depicts the nucleic acid sequence (SEQ. ID. NO. 10) and amino acid sequence (SEQ. ID. NO. 11) corresponding to certain delineated nucleic acid sequences). The generated fragment contained three base substitutions in the promoter and ORF regions of the respective genes which were different from the parent sequences, however there were no changes in amino acid composition. There was a “T” to “A” substitution at position 483 in the CYP52A2A promoter region, a “T” to “C” substitution at position 573 and a “C” to “T” substitution at position 2013 of the CPRB ORF. In addition, there is some evidence that, in C. tropicalis , codon CTG is not translated as leucine in accordance with the “universal genetic code”, but as serine. See, e.g., Ueda et al., Biochemie (1994) 76, 1217-1222. However, this proposition has not been conclusively proven. Accordingly, since the CTG codon at position 652-654 of FIG. 5A may be translated as either a leucine or a serine, the fiftieth amino acid shown in FIG. 5A is designated “X” where “X” may be leucine or serine. This construct was incorporated into an integration vector, pURA in RED B, as a PacI sensitive fragment to generate the new vector, pURA in CPR B/2A-NCP and then transformed into C. tropicalis.

The aforementioned procedures for cloning of the CYP52A2A and CPRB genes, preparing the integration vector, pURAin REDB, and transforming cells with the vector are described in aforementioned U.S. application Ser. No. 09/302,620 now U.S. Pat. No. 6,331,420, and International Application No. PCT/US99/20797, and are also included below.

EXAMPLE II

Quantitative Competitive Reverse Transcription Polymerase Chain Reaction (QC-RT-PCR) Protocol

QC-RT-PCR is a technique used to quantitate the amount of a specific RNA in a RNA sample. This technique employs the synthesis of a specific DNA molecule that is complementary to an RNA molecule in the original sample by reverse transcription and its subsequent amplification by polymerase chain reaction. By the addition of various amounts of a competitor RNA molecule to the sample, one can determine the concentration of the RNA molecule of interest (e.g., the mRNA transcripts of the CPR or CYTb5 gene). The levels of specific mRNA transcripts are assayed over time in response to the addition of fatty acid or alkane substrates to the growth medium of fermentation grown C. tropicalis cultures for the identification and characterization of the genes involved in the oxidation of these substrates.

A. Primer Design

The first requirement for QC-RT-PCR is the design of the primer pairs to be used in the reverse transcription and subsequent PCR reactions. These primers need to be unique and specific to the gene of interest. Primers used to measure the expression of the CYTb5 gene of C. tropicalis 20336 using the QC-RT-PCR protocol are listed in Table 2.

TABLE 2
Primers used to measure C. tropicalis CYTB5 gene expression in
the QC-RT-PCR reactions.
Primer Name	Direction	Target	Sequence
3740-179A	F	CYTb5	CACACCACCCACGACGACTTGTG	(SEQ. ID. NO. 12)
3740-179C	B	CYTb5	CTTCCGTGCTGAACGACTGCG	(SEQ. ID. NO. 13)
F = Forward
B = Backward

B. Design and Synthesis of the Competitor DNA Template

The competitor RNA is synthesized in vitro from a competitor DNA template that has the T7 polymerase promoter and preferably carries a small deletion of e.g., about 10 to 25 nucleotides relative to the native target RNA sequence. The DNA template for the in-vitro synthesis of the competitor RNA is synthesized using PCR primers that are between 42 and 46 nucleotides in length. In this example, the primer pairs for the synthesis of the CYTb5 competitor DNA are shown in Table 3.

TABLE 3
Forward and Reverse primers used to synthesize
the competitor RNA template for the QC-RT-PCR
measurement of CYTb5 gene expression.
Forward Primer	Forward Competitor	TAATACGACTCACTATAG
	primer - 3740-179B	GGAGGCACACCACCCACG
		ACGACTTGTG
		(SEQ. ID. NO. 14)
Reverse Primer	Reverse Competitor	CTTCCGTGCTGAACGACT
	primer - 3740-179D	GCGAATCTTAGCGCCCTT
		CAAGTT
		(SEQ. ID. NO. 15)

The forward primer is used with the corresponding reverse primer to synthesize the competitor DNA template. The primer pairs are combined in a standard Taq Gold polymerase PCR reaction (Perkin-Elmer/Applied Biosystems, Foster City, Calif.) according to the manufacturer's recommended instructions. The PCR reaction mix contains a final concentration of 250 nM of each primer and 10 ng of C. tropicalis chromosomal DNA for template. The reaction mixture is placed in a thermocycler for 25 to 35 cycles using the highest annealing temperature possible during the PCR reactions to assure a homogeneous PCR product (in this case 62° C.). The PCR products are either gel purified or filter purified to remove un-incorporated nucleotides and primers. The competitor template DNA is then quantified using the (A 260/280 ) method.

C. Synthesis of the Competitor RNA

Competitor template DNA is transcribed In-Vitro to make the competitor RNA using the Megascript T7 kit from Ambion Biosciences (Ambion Inc., Austin, Tex.). 250 nanograms (ng) of competitor DNA template and the in-vitro transcription reagents were mixed and the reaction mixture was incubated for 4 hrs at 37° C. The resulting RNA preparations were then checked by gel electrophoresis for the conditions giving the highest yields and quality of competitor RNA. This step may require optimization according to the manufacturer's specifications. The DNA template was then removed using the DNase I restriction endonuclease. The RNA competitor was then quantified by the (A 260/280 ) method. Serial dilutions of the RNA (1 ng/ml to 1 femtogram (fg)/ml) were made for use in the QC-RT-PCR reactions and the original stocks were stored at −70° C.

D. QC-RT-PCR Reactions

QC-RT-PCR reactions were performed using rTth Polymerase Kit (Perkin-Elmer/Applied Biosystems, Foster City, Calif.) according to the manufacturer's recommended instructions. The reverse transcription reaction was performed in a 10 μl volume with a final concentration of 200 mM for each dNTP, 1.25 units rTth polymerase, 1.0 mM MnCl 2 , 1× of the 10× buffer supplied with the enzyme from the manufacturer, 100 ng of total RNA isolated from a fermentor grown culture of C. tropicalis and 1.25 mM of the appropriate reverse primer. To quantitate CYTb5 expression in C. tropicalis an appropriate reverse primer is 3740-179C (See Table 2). Several reaction mixes were prepared for each RNA sample characterized. To quantitate CYTb5 expression a series of 8 to 12 of the previously described QC-RT-PCR reaction mixes were aliquoted to different reaction tubes. 1 ml of a serial dilution containing from 100 pg to 100 fg CYTb5 competitor RNA per ml was added to each tube to bring the final reaction mixtures up to the final volume of 10 μl. The QC-RT-PCR reaction mixtures were mixed and incubated at 70° C. for 15 min according to the manufacturer's recommended times for reverse transcription to occur. At the completion of the 15 minute incubation, the sample temperature was reduced to 4° C. to stop the reaction and 40 μl of the PCR reaction mix added to the reaction to bring the total volume up to 50 μl. The PCR reaction mix consisted of an aqueous solution containing 0.3125 mM of the forward primer 3740-179A (see Table 2), 3.125 mM MgCl 2 and 1× chelating buffer supplied with the enzyme from Perkin-Elmer. The reaction mixtures were placed in a Perkin-Elmer GeneAmp PCR System 2400 thermocycler (Perkin-Elmer/Applied Biosystems, Foster City, Calif.) and the following PCR cycle was performed: 94° C. for 1 minute followed by 94° C. for 10 seconds followed by 58° C. for 40 seconds for 17 to 22 cycles. The PCR reaction was completed with a final incubation at 58° C. for 2 minutes followed by 4° C. In some reactions where no detectable PCR products were produced the samples were returned to the thermocycler for additional cycles, and this process was repeated until enough PCR products were produced to quantify using HPLC. The number of cycles necessary to produce enough PCR product is a function of the amount of the target mRNA in the 100 ng of total cellular RNA. In cultures where the CYTb5 gene is highly expressed there is sufficient CYTb5 mRNA message present and less PCR cycles (≦17) are required to produce a quantifiable amount of PCR product. The lower the concentrations of the target mRNA present the more PCR cycles are required to produce a detectable amount of product.

E. HPLC Quantification

Upon completion of the QC-RT-PCR reactions the samples were analyzed and quantitated by HPLC and by agarose gel electrophoresis. Five to fifteen microliters of the QC-RT-PCR reaction mix was injected into a Waters Bio-Compatible 625 HPLC equipped with a Waters 484 tunable detector (Waters Corp., Milford, Mass.). The detector was set to measure a wave length of 254 nm. The HPLC contained a Sarasep brand DNASep™ column (Sarasep, Inc., San Jose, Calif.) which is placed within the oven and the temperature set for 52° C. The column was installed according to the manufacturer's recommendation of having 30 cm. of heated PEEK tubing installed between the injector and the column. The system was configured with a Sarasep brand Guard column positioned before the injector. In addition, there was a 0.22 mm filter disk just before the column, within the oven. Two buffers were used to create an elution gradient to resolve and quantitate the PCR products from the QC-RT-PCR reactions. Buffer-A consists of 0.1 M tri-ethyl ammonium acetate (TEAA) and 5% acetonitrile (volume to volume). Buffer-B consists of 0.1 M TEAA and 25% acetonitrile (volume to volume). The QC-RT-PCR samples were injected into the HPLC and the linear gradient of 75% buffer-A/25% buffer-B to 45% buffer-A/55% B is run over 6 min at a flow rate of 0.85 ml per minute. The QC-RT-PCR product of the competitor RNA being smaller was eluted from the HPLC column before the larger QC-RT-PCR product from the CYTb5 mRNA(U). The amount of the QC-RT-PCR products was plotted and quantitated with an attached Waters Corporation 745 data module. The log ratios of the amount of CYTb5 mRNA QC-RT-PCR product (U) to competitor QC-RT-PCR product (C), as measured by peak areas, was plotted and the amount of competitor RNA required to equal the amount of CYTb5 mRNA product determined.

EXAMPLE III

Purification of Genomic DNA from Candida tropicalis ATCC 20336

A. Construction of Genomic Library

50 ml of YEPD broth (see Appendix) was inoculated with a single colony of C. tropicalis 20336 from YEPD agar plate and grown overnight at 30° C. 5 ml of the overnight culture was inoculated into 100 ml of fresh YEPD broth and incubated at 30° C. for 4 to 5 hrs. with shaking. Cells were harvested by centrifugation, washed twice with sterile distilled water and resuspended in 4 ml of spheroplasting buffer (1 M Sorbitol, 50 mM EDTA, 14 mM mercaptoethanol) and incubated for 30 minutes at 37° C. with gentle shaking. 0.5 ml of 2 mg/ml zymolyase (ICN Pharmaceuticals, Inc., Irvine, Calif.) was added and incubated at 37° C. with gentle shaking for 30 to 60 minutes. Spheroplast formation was monitored by SDS lysis. Spheroplasts were harvested by brief centriguation (4,000 rpm, 3 min) and washed once with the spheroplast buffer without mercaptoethanol. Harvested spheroplasts were then suspended in 4 ml of lysis buffer (0.2 M Tris/pH 8.0, 50 mM EDTA, 1% SDS) containing 100 mg/ml Rnase (Qiagen Inc., Chatsworth, Calif.) and incubated at 37° C. for 30 to 60 min.

Proteins were denatured and extracted twice with an equal volume of chloroform/isoamyl alcohol (24:1) by gently mixing the two phases by hand inversions. The two phases were separated by centrifugation at 10,000 rpm for 10 minutes and the aqueous phase containing the high-molecular weight DNA was recovered. NaCl was added to the aqueous layer to a final concentration of 0.2 M and the DNA was precipitated by adding 2 vol of ethanol. Precipitated DNA was spooled with a clean glass rod and resuspended in TE buffer (10 mM Tris/pH 8.0, 1 mM EDTA) and allowed to dissolve overnight at 4° C. To the dissolved DNA, RNase free of any DNase activity (Qiagen Inc., Chatsworth, Calif.) was added to a final concentration of 50 mg/ml and incubated at 37° C. for 30 minutes. Then protease (Qiagen Inc., Chatsworth, Calif.) was added to a final concentration of 100 mg/ml and incubated at 55 to 60° C. for 30 minutes. The solution was extracted once with an equal volume of phenol/chloroform/isoamyl alcohol (25:24:1) and once with equal volume of chloroform/isoamyl alcohol (24:1). 0.1 vol of 3 M sodium acetate and 2 volumes of ice cold ethanol (200 proof) was added to the aqueous phase, and the high molecular weight DNA was spooled with a glass rod and dissolved in 1 to 2 ml of TE buffer.

B. Genomic DNA Preparation for PCR Amplification of CYTb5 Gene

Five 5 ml of YEPD medium was inoculated with a single colony and grown at 30° C. overnight. The culture was centrifuged for 5 min at 1200×g. The supernatant was removed by aspiration and 0.5 ml of a sorbitol solution (0.9 M sorbitol, 0.1 M Tris-Cl/pH 8.0, 0.1 M EDTA) was added to the pellet. The pellet was resuspended by vortexing and 1 ml of 2-mercaptoethanol and 50 ml of a 10 mg/ml zymolyase solution were added to the mixture. The tube was incubated at 37° C. for 1 hr on a rotary shaker (200 rpm). The tube was then centrifuged for 5 min at 1200×g and the supernatant was removed by aspiration. The protoplast pellet was resuspended in 0.5 ml 1×TE (10 mM Tris-Cl/pH 8.0, 1 mM EDTA) and transferred to a 1.5 ml microcentrifuge tube. The protoplasts were lysed by the addition of 50 ml 10% SDS followed by incubation at 65° C. for 20 minutes. Next, 200 ml of 5M potassium acetate was added and after mixing, the tube was incubated on ice for at least 30 minutes. Cellular debris was removed by centrifugation at 13,000×g for 5 minutes. The supernatant was carefully removed and transferred to a new microfuge tube. The DNA was precipitated by the addition of 1 ml 100% (200 proof) ethanol followed by centrifugation for 5 min at 13,000×g. The DNA pellet was washed with 1 ml 70% ethanol followed by centrifugation for 5 min at 13,000×g. After partially drying the DNA under a vacuum, it was resuspended in 200 ml of 1×TE. The DNA concentration was determined by ratio of the absorbance at 260 nm/280 nm (A 260/280 ).

EXAMPLE IV

Construction of Candida tropicalis 20336 Genomic Library

A genomic library was constructed using λ ZAP Express™ vector (Stratagene, La Jolla, Calif.) (FIG. 6 A). Genomic DNA was partially digested with Sau3A1 and fragments in the range of 6 to 12 kb were purified from an agarose gel after electrophoresis of the digested DNA. These DNA fragments were then ligated to BamHI digested λ ZAP Express™ vector arms according to the manufacturer's protocol. Three ligations were set up to obtain approximately 9.8×10 5 independent clones. The library was pooled and amplified according to manufacturer instructions to obtain high-titre (>10 plaque forming units/ml) stock for long-term storage. The titre of packaged phage library was ascertained after infection of E. coli XL1Blue-MRF′ cells. E. coli XL1Blue-MRF′ cells were grown overnight either in LB medium or NZCYM (See Appendix) containing 10 mM MgSO 4 and 0.2% maltose at 37° C. of 30° C., respectively with shaking. Cells were then centrifuged and resuspended in 0.5 to 1 volume of 10 mM MgSO 4 . 200 ml of this E. coli culture was mixed with several dilutions of packaged phage library and incubated at 37° C. for 15 min. To this mixture 2.5 ml of LB top agarose or NZCYM top agarose (maintained at 60° C.) (see Appendix) was added and placed on LB agar or NCZYM agar (see Appendix) present in 82 mm petri dishes. Phage were allowed to propagate overnight at 37° C. to obtain discrete plaques and the phage titre was determined.

EXAMPLE V

Screening of Genomic Library

The λ ZAP Express™ vector is a phagemid vector that can be propagated either as phage or plasmid DNA (after conversion of phage to plasmid). Therefore, the genomic library constructed in this vector can be screened either by plaque hybridization (screening of lambda form of library) or by colony hybridization (screening plasmid form of library after phage to plasmid conversion). The mechanism of excision of plasmid pBK-CMV ( FIG. 6B ) from phage λ ZAP Express™ (Stratagene, LaJolla, Calif.) requires the assistance of a helper phage such as ExAssist™ (Stratagene) and an E. coli strain such as XLOR (Stratagene). The plasmid pBK-CMV can replicate autonomously in E. coli.

A. Screening Genomic Libraries (Plaque Form)

1) λ Library Plating

E. coli XL1Blue-MRF′ cells were grown overnight in LB medium (25 ml) containing 10 mM MgSO 4 and 0.2% maltose at 37° C., 250 rpm. Cells were then centrifuged (2,200×g for 10 min) and resuspended in 0.5 volumes of 10 mM MgSO 4 . 500 ml of this E. coli culture was mixed with a phage suspension containing 25,000 amplified lambda phage particles and incubated at 37° C. for 15 min. To this mixture 6.5 ml of NZCYM top agarose (maintained at 60° C.) (see Appendix) was added and plated on 80-100 ml NCZYM agar (see Appendix) present in a 150 mm petridish. Phage were allowed to propagate overnight at 37° C. to obtain discrete plaques. After overnight growth plates were stored in a refrigerator for 1-2 hrs before plaque lifts were performed.

2) Plaque Lift and DNA Hybridizations

Magna Lift™ nylon membranes (Micron Separations, Inc., Westborough, Mass.) were placed on the agar surface in complete contact with plaques, and transfer of plaques to nylon membranes was allowed to proceed for 5 min at RT. After plaque transfer the membrane was placed on 2 sheets of Whatman 3M™ (Whatman, Hillsboro, Oreg.) filter paper saturated with a 0.5 N NaOH, 1.0 M NaCl solution and left for 10 min at RT to denature DNA. Excess denaturing solution was removed by blotting briefly on dry Whatman 3M paper™. Membranes were then transferred to 2 sheets of Whatman 3M™ paper saturated with 0.5 M Tris-HCl (pH 8.0), 1.5 M NaCl and left for 5 min to neutralize. Membranes were then briefly washed in 200-500 ml of 2×SSC, dried by air and baked for 30-40 min at 80° C. The membranes were then probed with labeled DNA.

Membranes were prewashed with a 200-500 ml solution of 5×SSC, 0.5% SDS, 1 mM EDTA (pH 8.0) for 1-2 hr at 42° C. with shaking (60 rpm) to get rid of bacterial debris from the membranes. The membranes were prehybridized for 1-2 hrs at 42° C. with (in a volume equivalent to 0.125-0.25 ml/cm 2 of membrane) ECL Gold™ buffer (Amersham) containing 0.5 M NaCl and 5% blocking reagent. DNA fragments used as probes were purified from agarose gel using a QIAEXII™ gel extraction kit (Qiagen Inc., Chatsworth, Calif.) according to manufacturer's protocol and labeled using an Amersham ECL™ direct nucleic acid labeling kit (Amersham). Labeled DNA (5-10 ng/ml hybridization solution) was added to the prehybridized membranes and the hybridization was allowed to proceed overnight. The following day, membranes were washed with shaking (60 rpm) twice at 42° C. for 20 min each time in (in a volume equivalent to 2 ml/cm 2 of membrane) a buffer containing either 0.1 (high stringency) or 0.5 (low stringency)×SSC, 0.4% SDS and 360 g/l urea. This was followed by two 5 min washes at room temperature in (in a volume equivalent to 2 ml/cm 2 of membrane) 2×SSC. Hybridization signals were generated using the ECL™ nucleic acid detection reagent and detected using Hyperfilm ECL™ (Amersham).

Agar plugs which contained plaques corresponding to positive signals on the X-ray film were taken from the master plates using the broad-end of Pasteur pipet. Plaques were selected by aligning the plates with the x-ray film. At this stage, multiple plaques were generally taken. Phage particles were eluted from the agar plugs by soaking in 1 ml SM buffer (Sambrook et al., supra) overnight. The phage eluate was then diluted and plated with freshly grown E. coli XL1Blue-MRF′ cells to obtain 100-500 plaques per 85 mm NCZYM agar plate. Plaques were transferred to Magna Lift nylon membranes as before and probed again using the same probe. Single well-isolated plaques corresponding to signals on X-ray film were picked by removing agar plugs and eluting the phage by soaking overnight in 0.5 ml SM buffer.

B. Conversion of λ Clones to Plasmid Form

The lambda clones isolated were converted to plasmid form for further analysis. Conversion from the plaque to the plasmid form was accomplished by infecting the plaques into E. coli strain BM25.8. The E. coli strain was grown overnight at 31° C., 250 rpm in LB broth containing 10 mM MgSO 4 and 0.2% maltose until the OD 600 reached 1.1-1.4. Ten milliliters of the overnight culture was removed and mixed with 100 ml of 1 M MgCl 2 . A 200 ml volume of cells was removed, mixed with 150 ml of eluted phage suspension and incubated at 31° C. for 30 min. LB broth (400 ml) was added to the tube and incubation was continued at 31° C. for 1 hr with shaking, 250 rpm. 1-10 ml of the infected cell suspension was plated on LB agar containing 100 mg/ml ampicillin (Sigma Chemical Company, St. Louis, Mo.). Well-isolated colonies were picked and grown overnight in 5 ml LB broth containing 100 mg/ml ampicillin at 37° C., 250 rpm. Plasmid DNA was isolated from these cultures and analyzed. To convert the λ ZAP Express™ vector to plasmid form E. coli strains XL1Blue-MRF′ and XLOR were used. The conversion was performed according to the manufacturer's (Stratagene) protocols for single-plaque excision.

EXAMPLE VI

Cloning and Characterization of C. tropicalis 20336 Cytochrome b5 (CYTb5) Gene

The CYTb5 gene was isolated from a Candida tropicalis ATCC 20336 genomic library constructed as described in Example IV using a PCR fragment as a probe. The PCR fragment probe for CYTb5 was generated after PCR amplification of Saccharomyces cerevisiae genomic DNA with oligonucleotide primers that were designed to amplify a region using the available CYTb5 gene of S. cerevisiae from the National Center for Biotechnology Information. A forward primer 3698-66A, 5′ ATAAGAATGCGGCCGCTGAACGAGAACCACATCCAGGAG 3′ (SEQ. ID. NO. 16) and a reverse primer 3698-66B 5′ CCTTAATTAAGGATAACCACATCCATACGTCGC 3′ (SEQ. ID. NO. 17) were made based on the S. cerevisiae CYTb5 sequence. These primers were used in pairwise combinations in a PCR reaction with Taq DNA polymerase (Perkin-Elmer Cetus, Foster City, Calif.) according to the manufacturer's recommended instructions. A PCR product of approximately 1036 bp was obtained. This product was purified from agarose gel using Qiaquick (Qiagene, Chatsworth, Calif.) and ligated to the pCR2.1™ vector ( FIG. 7 , Invitrogen, LaJolla, Calif.) according to the recommendations of the manufacturer. This PCR fragment was used as a probe in isolating the C. tropicalis 20336 Cytb5 homolog. The genomic library (see Examples IV & V)was screened using this CYTb5 probe and a clone that contained a full length CYTb5 gene was obtained. The clone contained a gene having regulatory and protein coding regions (FIG. 4 ). An open reading frame of 387 nucleotides encodes a CYTb5 protein of 129 amino acids (FIG. 4 ).

EXAMPLE VII

Construction of CYP52A2A/CYTb5 Fusion Gene

In a manner similar to Example I above, the 496bp nucleotide segment containing the CYP52A2A promoter is fused to the open reading frame of CYTb5 to create a CYP52A2A promoter/CYTb5 ORF fusion product. The CYP52A2A promoter region is amplified using the CYP2A#1 and CYP2A/b5 fus (TGTGTCGGTCATGGTCGTGATGTG SEQ. ID. NO. 18) primers. The ORF of CYTb5 and its 3′UTR are amplified using b5/2A fus (CACATCACGACCATGACCGACACA SEQ. ID. NO. 19) and b5#2 (CCCTTAATTAAGGGGGGATGGAAGTGGCCG SEQ. ID NO. 20) primers. These two PCR products are fused together by PCR using the CYP52A#1 and b5#2 primers. The resulting construct is verified before use and then incorporated into an integration vector, pURA in RED B, as a PacI sensitive fragment to generate a new vector and then transformed into C. tropicalis.

EXAMPLE VIII

Integration of CYP52A2A/CYTb5 and CYP52A2A/CPRB Fusion Genes into the Genome of Candida tropicalis

In order to integrate selected genes into the chromosome of C. tropicalis there has to be a target DNA sequence, which may or may not be an intact gene, into which the genes can be inserted. There must also be a method to select for the integration event. In some cases the target DNA sequence and the selectable marker are the same and, if so, then there must also be a method to regain use of the target gene as a selectable marker following the integration event. In C. tropicalis and its descendants, one gene which fits these criteria is URA3A, encoding orotidine-5′-phosphate decarboxylase. Using it as a target for integration, ura − variants of C. tropicalis can be transformed in such a way as to regenerate a URA + genotype via homologous recombination. Depending upon the design of the integration vector, one or more genes can be integrated into the genome at the same time. Using a split URA3A gene, homologous integration would yield at least one copy of the gene(s) of interest which are inserted between the split portions of the URA3A gene. Moreover, because of the high sequence similarity between URA3A and URA3B genes, integration of the construct can occur at both the URA3A and URA3B loci. Subsequently, an oligonucleotide designed with a deletion in a portion of the URA gene based on the identical sequence across both the URA3A and URA3B genes, can be utilized to yield C. tropicalis transformants which are once again ura − but which still carry one or more newly integrated genes of choice. Ura − variants of C. tropicalis can also be isolated via other methods such as classical mutagenesis or by spontaneous mutation. Using well established protocols, selection of ura − strains can be facilitated by the use of 5-fluoroorotic acid (5-FOA) as described, e.g., in Boeke et al., Mol. Gen. Genet . 197:345-346 (1984), incorporated herein by reference. The utility of this approach for the manipulation of C. tropicalis has been well documented as described, e.g., in Picataggio et al., Mol. and Cell. Biol . 11:4333-4339 (1991); Rohrer et al., Appl. Microbiol. Biotechnol . 36:650-654 (1992); Picataggio et al., Bio/Technology 10:894-898 (1992); U.S. Pat. No. 5,648,247; U.S. Pat. No. 5,620,878; U.S. Pat. No. 5,204,252; U.S. Pat. No. 5,254,466, all of which are incorporated herein by reference.

A. Construction of a URA Integration Vector, pURAin

Primers were designed and synthesized based on the 1712 bp sequence of the URA3A gene of C. tropicalis 20336. URA3A Primer Set #1a, AGGCGCGCCGGAGTCCAAAAAGACCAACCTCTG, and (SEQ. ID. NO. 21) #1b, CCTTAATTAATACGTGGATACCTTCAAGCAAGTG, (SEQ. ID. NO. 22) was used in PCR with C. tropicalis 20336 genomic DNA to amplify URA3A sequences between nucleotide 733 and 1688 as shown in FIG. 8 which depicts the nucleic acid sequence (SEQ. ID. NO. 23) and amino acid sequence (SEQ. ID. NO. 24) corresponding to certain delineated nucleic acid sequences. The primers were designed to introduce unique 5′ AscI and 3′ PacI restriction sites into the resulting amplified URA3A fragment. AscI and PacI sites were chosen because these sites are not present within CYTb5 or CPRB gene. URA3A Primer Set #2 was used in PCR with C. tropicalis 20336 genomic DNA as a template, to amplify URA3A sequences between nucleotide 9 and 758 as shown in FIG. 8 . URA3A Primer set #2a, CCTTAATTAAGC TCACGAGTTTTGGGATTTTCGAG (SEQ. ID. NO. 25) and #2b GGGTTTAAACCGCAGAGGTTGGTCTTTTTGGACTC (SEQ. ID. NO. 26) were designed to introduce unique 5′ PacI and 3′ PmeI restriction sites into the resulting amplified URA3A fragment. The PmeI site is also not present within CYTb5 and CPRB genes. PCR fragments of the URA3A gene were purified, restricted with AscI, PacI and PmeI restriction enzymes and ligated to a gel purified, QiaexII cleaned AscI-PmeI digest of plasmid pNEB193 ( FIG. 9 ) purchased from New England Biolabs (Beverly, Mass.). The ligation was performed with an equimolar number of DNA termini at 16° C. for 16 hr using T4 DNA ligase (New England Biolabs). Ligations were transformed into E. coli XL1-Blue cells (Stratagene, LaJolla, Calif.) according to manufacturer's recommendations. White colonies were isolated, grown, plasmid DNA isolated and digested with AscI-PmeI to confirm insertion of the modified URA3A into pNEB 193. The resulting base integration vector was designated pURAin ( FIG. 10 SEQ. ID. NO. 27).

B. Construction of pURAin RED B

The next step was to clone the CPRB fusion gene into the pURAin integration vector. In a preferred aspect of the present invention, no foreign DNA other than that specifically provided by synthetic restriction site sequences was incorporated into the DNA which was cloned into the genome of C. tropicalis , i.e., with the exception of restriction site DNA only native C. tropicalis DNA sequences are incorporated into the genome. pURAin is digested with PacI, QiaexII cleaned, and dephosphorylated with Shrimp Alkaline Phosphatase (SAP) (United States Biochemical, Cleveland, Ohio) according to the manufacturer's recommendations. Approximately 500 ng of PacI linearized pURAin was dephosphorylated for 1 hr at 37° C. using SAP at a concentration of 0.2 Units of enzyme per 1 pmol of DNA termini. The reaction was stopped by heat inactivation at 65° C. for 20 min.

Prior to its use, the CPRB PacI fragment derived using the primers described above was sequenced and compared to CPRB to confirm that PCR did not introduce DNA base pair changes that would result in an amino acid change. Following confirmation, CPRB was ligated to plasmid pURAin which has also been digested with PacI. PacI digested pURAin was dephosphorylated, and ligated to the CPR Expand Hi-Fi PCR product as described previously. The ligation mixture was transformed into E. coli XL1 Blue MRF′ (Stratagene) and several resistant colonies were selected and screened for correct constructs which contain vector sequence, the inverted URA3A gene, and the amplified CPRB gene ( FIG. 3 ) of 20336. AscI-PmeI digestion confirmed a successful construct. This vector was called pURAin RED B.

C. Construction of Vectors Containing the CYP52A2A/CPRB and CYP52A2A/CYTb5 Fusion Genes

The previously constructed integration vector pURA in RED B was chosen as the starting vector. This vector was partially digested with PacI and the linearized fragment was gel-isolated. The active PacI was destroyed by treatment with T4 DNA polymerase and the vector was re-ligated. Subsequent isolation and complete digestion of this new plasmid yielded a vector containing only one active PacI site. This fragment was gel-isolated, dephosphorylated and ligated to the CYP52A2A/CPRB PacI fragment. Alternatively, this fragment is gel-isolated, dephosphorylated and ligated to the CYP52A2A/CYTb5 PacI fragment.

D. Confirmation of Integration of the CYP52A2A/CPRB Fusion Gene.

Based on the vector construct containing the CYP52A2A/CPRB fusion gene used to transform Candida tropicalis , a scheme to detect integration was devised. Genomic DNA from transformants was digested with PacI which is an enzyme that cuts and liberates the fusion gene but does not cut within the CYP52A2A and CPRB genes. Digestion of genomic DNA where an integration has occurred at the URA3A or URA3B loci is expected to result in a 3.04 Kb fragment. Southern hybridizations of these digests with fragments of the CPRB gene was used to screen for these integration events. Intensity of the band signal from the Southern using PacI digestion is used as a measure of the number of integration events, (i.e., the more copies of the CYP52A2A/CPRB fusion gene which are present, the stronger the hybridization signal).

C. tropicalis URA prototrophs were grown at 30° C., 170 rpm, in 10 ml SC-uracil media for preparation of genomic DNA. Genomic DNA was isolated by the method described previously. Genomic DNA was digested with PacI. A 0.95% agarose gel was used to prepare a Southern hybridization blot. The DNA from the gel was transferred to a MagnaCharge nylon filter membrane (MSI Technologies, Westboro, Mass.) according to the alkaline transfer method of Sambrook et al., supra. For the Southern hybridization, a 3.3 Kb CPRB DNA fragment was used as a hybridization probe. 300 ng of CPRB DNA was labeled using an ECL Direct labeling and detection system (Amersham) and the Southern was processed according to the ECL kit specifications. The blot was processed in a volume of 30 ml of hybridization fluid corresponding to 0.125 ml/cm 2 . Following a prehybridization at 42° C. for 1 hr, 300 ng of CPRB probe was added and the hybridization continued for 16 hr at 42° C. Following hybridization, the blots are washed two times for 20 min each at 42° C. in primary wash containing urea. Two 5 min secondary washes at RT was conducted, followed by detection according to directions. The blots were exposed for 16 hr as recommended.

Integration was confirmed by the detection of a PacI 3.04 Kb fragment from the genomic DNA of the transformants but not with the C. tropicalis 20336 control. This strain was designated HDC25.

EXAMPLE IX

Fusion of the CYP52 Promoters to the ORFs of CPR and CYP52

Based on QC-RT-PCR analysis, it was determined that the CYP52A2A promoter is the strongest induced promoter of the CYP52 family in ATCC 20336. The following promoter/ORF combinations were produced: CYP52A2A promoter/CPR ORF (HDC25) and the CYP52A2A promoter/CYP52A5A ORF (HDC28).

A. Construction of CYP52A2A/CYP52A5A Fusion Gene

PCR primers were designed such that the same promoter region used in previous CYP52A2A constructs described herein was conserved. 496 bp of the CYP52A2A promoter was amplified using the CYP2A#1 (SEQ. ID. NO.: 6) and CYP2A/5A RC fus (SEQ. ID. NO. 28) primers. The ORF of CYP52A5A and its 3′UTR was amplified using CYP2A/5A fus (SEQ. ID. NO.: 29) and CYP5A#2 (SEQ. ID. NO.: 30) primers. These two PCR products were fused together by PCR using CYP2A#1 and CYP5A#2 to generate a construct containing approximately 687 bp of 3′UTR. In all PCR reactions, Platinum Pfx (Stratagene, LaJolla, Calif.), was used. The nucleotide sequences of the aforementioned primers are shown in Table 1 and Table 4.

In order to minimize sequencing, a 1632 bp AatII/MluI fragment from the genomic library plasmid, pPa13 (CYP52A5A), was isolated and used to replace the corresponding fragment of the CYP52A2A promoter/CYP52A5A ORF PCR product. The sequence (SEQ. ID. NO. 31) of the resulting construct was verified before use. (See FIG. 11 ). This construct was incorporated into an integration vector, pURA in, as a PacI sensitive fragment to generate the new vector, pURAin 2A-5A and then transformed into C. tropicalis . This construct was successfully used to generate strains HDC 28-1, -2, -3 and -4. The amino acid sequence of the CYP52A5A protein is set forth in SEQ. ID. NO. 32.

TABLE 4
CYP2A/5A RC fus	218-200B	GGAGTTGTTCAATCATGGTCGTGA
		TGTGTGTA
		(SEQ. ID. NO. 28)
CYP2A/5A fus		TACACACATCACGACCATGATTGA
		ACAACTCC
		(SEQ. ID. NO. 29)
CYP5A#2	3659-72L	CCTTAATTAAGGCAGACAACAACT
		TGGCAAAGTC
		(SEQ. ID. NO. 30)

B. Transformat Analysis

Following the isolation of genomic DNA from the transformants, the DNA was digested with PacI. The PacI digests were processed according to the standard Southern method and probed with a 3.3 Kb CYP52A5A fragment. Only those strains receiving the integration construct yielded the anticipated 2.7 Kb band upon Southern hybridization.

C. Strain Comparisons

When comparing strain HDC28-1 to strain H5343 (base strain), it was demonstrated that HDC28-1 has the ability to produce more oleic dicarboxylic acid from HOSFFA than the compared strain. The table lists the increase in oleic dicarboxylic acid production over time as compared to H5343.

	Conversion	Total product
	Time	(g/Kg)	% improvement
	(hr)	H5343	HDC28-1	over H5343
	16	8.8	16.9	92
	25	15.4	29.2	89.6
	41	25.9	42.8	65.2
	48	24.9	49.2	97.6
	64	24.9	63.7	155.8
	73	38.7	67.5	74.4

When comparing strain HDC25 to the strain H5343 (base strain), it was demonstrated that HDC25 has an ability to produce more oleic dicarboxylic acid from HOSFFA than the compared strain. The table lists the increase in oleic dicarboxylic acid production over time as compared to H5343.

	Conversion	Total product
	Time	(g/Kg)	% improvement
	(hr)	H5343	HDC25	over H5343
	17	11.4	12.8	12.3
	27	20.9	22.5	7.7
	41	31.3	33.9	8.3
	68	38	51.8	36.3

It will be understood that various modifications may be made to the embodiments and examples described herein. Therefore, the above description should not be construed as limiting, but merely as exemplifications of preferred embodiments. For example, transformation of host cells can be accomplished using biolistic gene transfer techniques. Although reference has been made herein to production of dicarboxylic acids, it is intended that the present disclosure is applicable to polycarboxylic acids as well. Those with skill in the art will envision other modifications of the various embodiments and examples which are still considered to be within the scope of the claims appended hereto.

APPENDIX
Media Composition
	LB Broth
	Bacto Tryptone	10	g
	Bacto Yeast Extract	5	g
	Sodium Chloride	10	g
	Distilled Water	1,000	ml
	LB Agar
	Bacto Tryptone	10	g
	Bacto Yeast Extract	5	g
	Sodium Chloride	10	g
	Agar	15	g
	Distiled Water	1,000	ml
	LB Top Agarose
	Bacto Tryptone	10	g
	Bacto Yeast Extract	5	g
	Sodium Chloride	10	g
	Agarose	7	g
	Distiled Water	1,000	ml
	NZCYM Broth
	Bacto Casein Digest	10	g
	Bacto Casamino Acids	1	g
	Bacto Yeast Extract	5	g
	Sodium Chloride	5	g
	Magnesium Sulfate	0.98	g
	(anhydrous)
	Distilled Water	1,000	ml
	NZCYM Agar
	Bacto Casein Digest	10	g
	Bacto Casamino Acids	1	g
	Bacto Yeast Extract	5	g
	Sodium Chloride	5	g
	Magnesium Sulfate	0.98	g
	(anhydrous)
	Distilled Water	1,000	ml
	NZCYM Top Agarose
	Bacto Casein Digest	10	g
	Bacto Casamino Acids	1	g
	Bacto Yeast Extract	5	g
	Sodium Chloride	5	g
	Magnesium Sulfate	0.98	g
	(anhydrous)
	Distilled Water	1,000	ml
	YEPD Broth
	Bacto Yeast Extract	10	g
	Bacto Peptone	20	g
	Glucose	20	g
	Distilled Water	1,000	ml
	YEPD Agar*
	Bacto Yeast Extract	10	g
	Bacto Peptone	20	g
	Glucose	20	g
	Distilled Water	1,000	ml
	YNB
	Yeast extract	3	g/L
	Maltose	3	g/L
	Peptone	5	g/L
	Dextrose	10	g/L
	DCA2 medium	5 g/l
	Peptone	3.0
	Yeast Extract	6.0
	Sodium Acetate	3.0
	Yeast Nitrogen Base (Difco)	6.7
	Glucose (anhydrous)	50.0
	Potassium Phosphate (dibasic, trihydrate)	7.2
	Potassium Phosphate (monobasic, anhydrous)	9.3
	DCA3 medium	g/l
	0.3 M Phosphate buffer, containing, pH	7.5
	Glycerol	50
	Yeast Nitrogen base (Difco)	6.7
	SC - uracil*
	Bacto-yeast nitrogen base without amino acids	6.7	g
	Glucose	20	g
	Bacto-agar	20	g
	Drop-out mix	2	g
	Distilled water	1,000	ml
	Drop-out mix
	Adenine	0.5	g
	Alanine	2	g
	Ariginine	2	g
	Asparagine	2	g
	Aspartic acid	2	g
	Cysteine	2	g
	Glutamine	2	g
	Glutamic acid	2	g
	Glycine	2	g
	Histidine	2	g
	Inositol	2
	Isoleucine	2	g
	Leucine	10	g
	Lysine	2	g
	Methionine	2	g
	para-Aminobenzoic acid	0.2	g
	Phenylalanine	2	g
	Proline	2	g
	Serine	2	g
	Threonine	2	g
	Tryptophan	2	g
	Tyrosine	2	g
	Valine	2	g
	*See Kaiser et al., Methods in Yeast Genetics, Cold Spring Harbor Laboratory Press, U.S.A. (1994), incorporated herein by reference.

#             SEQUENCE LISTING
<160> NUMBER OF SEQ ID NOS: 34
<210> SEQ ID NO 1
<211> LENGTH: 3948
<212> TYPE: DNA
<213> ORGANISM: Candida tropicalis
<400> SEQUENCE: 1
gacctgtgac gcttccggtg tcttgccacc agtctccaag ttgaccgacg cc
#caagtcat     60
gtaccacttt atttccggtt acacttccaa gatggctggt actgaagaag gt
#gtcacgga    120
accacaagct actttctccg cttgtttcgg tcaaccattc ttggtgttgc ac
#ccaatgaa    180
gtacgctcaa caattgtctg acaagatctc gcaacacaag gctaacgcct gg
#ttgttgaa    240
caccggttgg gttggttctt ctgctgctag aggtggtaag agatgctcat tg
#aagtacac    300
cagagccatt ttggacgcta tccactctgg tgaattgtcc aaggttgaat ac
#gaaacttt    360
cccagtcttc aacttgaatg tcccaacctc ctgtccaggt gtcccaagtg aa
#atcttgaa    420
cccaaccaag gcctggaccg gaaggtgttg actccttcaa caaggaaatc aa
#gtctttgg    480
ctggtaagtt tgctgaaaac ttcaagacct atgctgacca agctaccgct ga
#agtgagag    540
ctgcaggtcc agaagcttaa agatatttat tcattattta gtttgcctat tt
#atttctca    600
ttacccatca tcattcaaca ctatatataa agttacttcg gatatcattg ta
#atcgtgcg    660
tgtcgcaatt ggatgatttg gaactgcgct tgaaacggat tcatgcacga ag
#cggagata    720
aaagattacg taatttatct cctgagacaa ttttagccgt gttcacacgc cc
#ttctttgt    780
tctgagcgaa ggataaataa ttagacttcc acagctcatt ctaatttccg tc
#acgcgaat    840
attgaagggg ggtacatgtg gccgctgaat gtgggggcag taaacgcagt ct
#ctcctctc    900
ccaggaatag tgcaacggag gaaggataac ggatagaaag cggaatgcga gg
#aaaatttt    960
gaacgcgcaa gaaaagcaat atccgggcta ccaggttttg agccagggaa ca
#cactccta   1020
tttctgctca atgactgaac atagaaaaaa caccaagacg caatgaaacg ca
#catggaca   1080
tttagacctc cccacatgtg atagtttgtc ttaacagaaa agtataataa ga
#acccatgc   1140
cgtccctttt ctttcgccgc ttcaactttt ttttttttat cttacacaca tc
#acgaccat   1200
gactgtacac gatattatcg ccacatactt caccaaatgg tacgtgatag ta
#ccactcgc   1260
tttgattgct tatagagtcc tcgactactt ctatggcaga tacttgatgt ac
#aagcttgg   1320
tgctaaacca tttttccaga aacagacaga cggctgtttc ggattcaaag ct
#ccgcttga   1380
attgttgaag aagaagagcg acggtaccct catagacttc acactccagc gt
#atccacga   1440
tctcgatcgt cccgatatcc caactttcac attcccggtc ttttccatca ac
#cttgtcaa   1500
tacccttgag ccggagaaca tcaaggccat cttggccact cagttcaacg at
#ttctcctt   1560
gggtaccaga cactcgcact ttgctccttt gttgggtgat ggtatcttta cg
#ttggatgg   1620
cgccggctgg aagcacagca gatctatgtt gagaccacag tttgccagag aa
#cagatttc   1680
ccacgtcaag ttgttggagc cacacgttca ggtgttcttc aaacacgtca ga
#aaggcaca   1740
gggcaagact tttgacatcc aggaattgtt tttcagattg accgtcgact cc
#gccaccga   1800
gtttttgttt ggtgaatccg ttgagtcctt gagagatgaa tctatcggca tg
#tccatcaa   1860
tgcgcttgac tttgacggca aggctggctt tgctgatgct tttaactatt cg
#cagaatta   1920
tttggcttcg agagcggtta tgcaacaatt gtactgggtg ttgaacggga aa
#aagtttaa   1980
ggagtgcaac gctaaagtgc acaagtttgc tgactactac gtcaacaagg ct
#ttggactt   2040
gacgcctgaa caattggaaa agcaggatgg ttatgtgttt ttgtacgaat tg
#gtcaagca   2100
aaccagagac aagcaagtgt tgagagacca attgttgaac atcatggttg ct
#ggtagaga   2160
caccaccgcc ggtttgttgt cgtttgtttt ctttgaattg gccagaaacc ca
#gaagttac   2220
caacaagttg agagaagaaa ttgaggacaa gtttggactc ggtgagaatg ct
#agtgttga   2280
agacatttcc tttgagtcgt tgaagtcctg tgaatacttg aaggctgttc tc
#aacgaaac   2340
cttgagattg tacccatccg tgccacagaa tttcagagtt gccaccaaga ac
#actaccct   2400
cccaagaggt ggtggtaagg acgggttgtc tcctgttttg gtgagaaagg gt
#cagaccgt   2460
tatttacggt gtctacgcag cccacagaaa cccagctgtt tacggtaagg ac
#gctcttga   2520
gtttagacca gagagatggt ttgagccaga gacaaagaag cttggctggg cc
#ttcctccc   2580
attcaacggt ggtccaagaa tctgtttggg acagcagttt gccttgacag aa
#gcttcgta   2640
tgtcactgtc aggttgctcc aggagtttgc acacttgtct atggacccag ac
#accgaata   2700
tccacctaag aaaatgtcgc atttgaccat gtcgcttttc gacggtgcca at
#attgagat   2760
gtattagagg gtcatgtgtt attttgattg tttagtttgt aattactgat ta
#ggttaatt   2820
catggattgt tatttattga taggggtttg cgcgtgttgc attcacttgg ga
#tcgttcca   2880
ggttgatgtt tccttccatc ctgtcgagtc aaaaggagtt ttgttttgta ac
#tccggacg   2940
atgttttaaa tagaaggtcg atctccatgt gattgttttg actgttactg tg
#attatgta   3000
atctgcggac gttatacaag catgtgattg tggttttgca gccttttgca cg
#acaaatga   3060
tcgtcagacg attacgtaat ctttgttaga ggggtaaaaa aaaacaaaat gg
#cagccaga   3120
atttcaaaca ttctgcaaac aatgcaaaaa atgggaaact ccaacagaca aa
#aaaaaaaa   3180
ctccgcagca ctccgaaccc acagaacaat ggggcgccag aattattgac ta
#ttgtgact   3240
tttttacgct aacgctcatt gcagtgtagt gcgtcttaca cggggtattg ct
#ttctacaa   3300
tgcaagggca cagttgaagg tttgcaccta acgttgcccc gtgtcaactc aa
#tttgacga   3360
gtaacttcct aagctcgaat tatgcagctc gtgcgtcaac ctatgtgcag ga
#aagaaaaa   3420
atccaaaaaa atcgaaaatg cgactttcga ttttgaataa accaaaaaga aa
#aatgtcgc   3480
acttttttct cgctctcgct ctctcgaccc aaatcacaac aaatcctcgc gc
#gcagtatt   3540
tcgacgaaac cacaacaaat aaaaaaaaca aattctacac cacttctttt tc
#ttcaccag   3600
tcaacaaaaa acaacaaatt atacaccatt tcaacgattt ttgctcttat aa
#atgctata   3660
taatggttta attcaactca ggtatgttta ttttactgtt ttcagctcaa gt
#atgttcaa   3720
atactaacta cttttgatgt ttgtcgcttt tctagaatca aaacaacgcc ca
#caacacgc   3780
cgagcttgtc gaatagacgg tttgtttact cattagatgg tcccagatta ct
#tttcaagc   3840
caaagtctct cgagttttgt ttgctgtttc cccaattcct aactatgaag gg
#tttttata   3900
aggtccaaag accccaaggc atagtttttt tggttccttc ttgtcgtg
#              3948
<210> SEQ ID NO 2
<211> LENGTH: 4206
<212> TYPE: DNA
<213> ORGANISM: Candida tropicalis
<400> SEQUENCE: 2
catcaagatc atctatgggg ataattacga cagcaacatt gcagaaagag cg
#ttggtcac     60
aatcgaaaga gcctatggcg ttgccgtcgt tgaggcaaat gacagcacca ac
#aataacga    120
tggtcccagt gaagagcctt cagaacagtc cattgttgac gcttaaggca cg
#gataatta    180
cgtggggcaa aggaacgcgg aattagttat ggggggatca aaagcggaag at
#ttgtgttg    240
cttgtgggtt ttttccttta tttttcatat gatttctttg cgcaagtaac at
#gtgccaat    300
ttagtttgtg attagcgtgc cccacaattg gcatcgtgga cgggcgtgtt tt
#gtcatacc    360
ccaagtctta actagctcca cagtctcgac ggtgtctcga cgatgtcttc tt
#ccacccct    420
cccatgaatc attcaaagtt gttgggggat ctccaccaag ggcaccggag tt
#aatgctta    480
tgtttctccc actttggttg tgattggggt agtctagtga gttggagatt tt
#cttttttt    540
cgcaggtgtc tccgatatcg aaatttgatg aatatagaga gaagccagat ca
#gcacagta    600
gattgccttt gtagttagag atgttgaaca gcaactagtt gaattacacg cc
#accacttg    660
acagcaagtg cagtgagctg taaacgatgc agccagagtg tcaccaccaa ct
#gacgttgg    720
gtggagttgt tgttgttgtt gttggcaggg ccatattgct aaacgaagac aa
#gtagcaca    780
aaacccaagc ttaagaacaa aaataaaaaa aattcatacg acaattccaa ag
#ccattgat    840
ttacataatc aacagtaaga cagaaaaaac tttcaacatt tcaaagttcc ct
#ttttccta    900
ttacttcttt tttttcttct ttccttcttt ccttctgttt ttcttacttt at
#cagtcttt    960
tacttgtttt tgcaattcct catcctcctc ctactcctcc tcaccatggc tt
#tagacaag   1020
ttagatttgt atgtcatcat aacattggtg gtcgctgtag ccgcctattt tg
#ctaagaac   1080
cagttccttg atcagcccca ggacaccggg ttcctcaaca cggacagcgg aa
#gcaactcc   1140
agagacgtct tgctgacatt gaagaagaat aataaaaaca cgttgttgtt gt
#ttgggtcc   1200
cagacgggta cggcagaaga ttacgccaac aaattgtcca gagaattgca ct
#ccagattt   1260
ggcttgaaaa cgatggttgc agatttcgct gattacgatt gggataactt cg
#gagatatc   1320
accgaagaca tcttggtgtt tttcattgtt gccacctatg gtgagggtga ac
#ctaccgat   1380
aatgccgacg agttccacac ctggttgact gaagaagctg acactttgag ta
#ccttgaaa   1440
tacaccgtgt tcgggttggg taactccacg tacgagttct tcaatgccat tg
#gtagaaag   1500
tttgacagat tgttgagcga gaaaggtggt gacaggtttg ctgaatacgc tg
#aaggtgat   1560
gacggtactg gcaccttgga cgaagatttc atggcctgga aggacaatgt ct
#ttgacgcc   1620
ttgaagaatg atttgaactt tgaagaaaag gaattgaagt acgaaccaaa cg
#tgaaattg   1680
actgagagag acgacttgtc tgctgctgac tcccaagttt ccttgggtga gc
#caaacaag   1740
aagtacatca actccgaggg catcgacttg accaagggtc cattcgacca ca
#cccaccca   1800
tacttggcca gaatcaccga gacgagagag ttgttcagct ccaaggacag ac
#actgtatc   1860
cacgttgaat ttgacatttc tgaatcgaac ttgaaataca ccaccggtga cc
#atctagct   1920
atctggccat ccaactccga cgaaaacatt aagcaatttg ccaagtgttt cg
#gattggaa   1980
gataaactcg acactgttat tgaattgaag gcgttggact ccacttacac ca
#tcccattc   2040
ccaaccccaa ttacctacgg tgctgtcatt agacaccatt tagaaatctc cg
#gtccagtc   2100
tcgagacaat tctttttgtc aattgctggg tttgctcctg atgaagaaac aa
#agaaggct   2160
tttaccagac ttggtggtga caagcaagaa ttcgccgcca aggtcacccg ca
#gaaagttc   2220
aacattgccg atgccttgtt atattcctcc aacaacgctc catggtccga tg
#ttcctttt   2280
gaattcctta ttgaaaacgt tccacacttg actccacgtt actactccat tt
#cgtcttcg   2340
tcattgagtg aaaagcaact catcaacgtt actgcagttg ttgaagccga ag
#aagaagct   2400
gatggcagac cagtcactgg tgttgtcacc aacttgttga agaacgttga aa
#ttgtgcaa   2460
aacaagactg gcgaaaagcc acttgtccac tacgatttga gcggcccaag ag
#gcaagttc   2520
aacaagttca agttgccagt gcatgtgaga agatccaact ttaagttgcc aa
#agaactcc   2580
accaccccag ttatcttgat tggtccaggt actggtgttg ccccattgag ag
#gttttgtc   2640
agagaaagag ttcaacaagt caagaatggt gtcaatgttg gcaagacttt gt
#tgttttat   2700
ggttgcagaa actccaacga ggactttttg tacaagcaag aatgggccga gt
#acgcttct   2760
gttttgggtg aaaactttga gatgttcaat gccttctcca gacaagaccc at
#ccaagaag   2820
gtttacgtcc aggataagat tttagaaaac agccaacttg tgcacgagtt gt
#tgactgaa   2880
ggtgccatta tctacgtctg tggtgatgcc agtagaatgg ctagagacgt gc
#agaccaca   2940
atttccaaga ttgttgctaa aagcagagaa attagtgaag acaaggctgc tg
#aattggtc   3000
aagtcctgga aggtccaaaa tagataccaa gaagatgttt ggtagactca aa
#cgaatctc   3060
tctttctccc aacgcattta tgaatcttta ttctcattga agctttacat at
#gttctaca   3120
ctttattttt tttttttttt ttattattat attacgaaac ataggtcaac ta
#tatatact   3180
tgattaaatg ttatagaaac aataactatt atctactcgt ctacttcttt gg
#cattgaca   3240
tcaacattac cgttcccatt accgttgccg ttggcaatgc cgggatattt ag
#tacagtat   3300
ctccaatccg gatttgagct attgtagatc agctgcaagt cattctccac ct
#tcaaccag   3360
tacttatact tcatctttga cttcaagtcc aagtcataaa tattacaagt ta
#gcaagaac   3420
ttctggccat ccacgatata gacgttattc acgttattat gcgacgtatg ga
#tgtggtta   3480
tccttattga acttctcaaa cttcaaaaac aaccccacgt cccgcaacgt ca
#ttatcaac   3540
gacaagttct ggctcacgtc gtcggagctc gtcaagttct caattagatc gt
#tcttgtta   3600
ttgatcttct ggtactttct caattgctgg aacacattgt cctcgttgtt ca
#aatagatc   3660
ttgaacaact ttttcaacgg gatcaacttc tcaatctggg ccaagatctc cg
#ccgggatc   3720
ttcagaaaca agtcctgcaa cccctggtcg atggtctccg ggtacaacaa gt
#ccaagggg   3780
cagaagtgtc taggcacgtg tttcaactgg ttcaacgaac atgttcgaca gt
#agttcgag   3840
ttatagttat cgtacaacca ttttggtttg atttcgaaaa tgacggagct ga
#tgccatca   3900
ttctcctggt tcctctcata gtacaactgg cacttcttcg agaggctcaa tt
#cctcgtag   3960
ttcccgtcca agatattcgg caacaagagc ccgtaccgct cacggagcat ca
#agtcgtgg   4020
ccctggttgt tcaacttgtt gatgaagtcc gaggtcaaga caatcaactg ga
#tgtcgatg   4080
atctggtgcg ggaacaagtt cttgcatttt agctcgatga agtcgtacaa ct
#cacacgtc   4140
gagatatact cctgttcctc cttcaagagc cggatccgca agagcttgtg ct
#tcaagtag   4200
tcgttg
#
#
#         4206
<210> SEQ ID NO 3
<211> LENGTH: 4145
<212> TYPE: DNA
<213> ORGANISM: Candida tropicalis
<400> SEQUENCE: 3
tatatgatat atgatatatc ttcctgtgta attattattc gtattcgtta at
#acttacta     60
catttttttt tctttattta tgaagaaaag gagagttcgt aagttgagtt ga
#gtagaata    120
ggctgttgtg catacgggga gcagaggaga gtatccgacg aggaggaact gg
#gtgaaatt    180
tcatctatgc tgttgcgtcc tgtactgtac tgtaaatctt agatttccta ga
#ggttgttc    240
tagcaaataa agtgtttcaa gatacaattt tacaggcaag ggtaaaggat ca
#actgatta    300
gcggaagatt ggtgttgcct gtggggttct tttatttttc atatgatttc tt
#tgcgcgag    360
taacatgtgc caatctagtt tatgattagc gtacctccac aattggcatc tt
#ggacgggc    420
gtgttttgtc ttaccccaag ccttatttag ttccacagtc tcgacggtgt ct
#cgccgatg    480
tcttctccca cccctcgcag gaatcattcg aagttgttgg gggatctcct cc
#gcagttta    540
tgttcatgtc tttcccactt tggttgtgat tggggtagcg tagtgagttg gt
#gattttct    600
tttttcgcag gtgtctccga tatcgaagtt tgatgaatat aggagccaga tc
#agcatggt    660
atattgcctt tgtagataga gatgttgaac aacaactagc tgaattacac ac
#caccgcta    720
aacgatgcgc acagggtgtc accgccaact gacgttgggt ggagttgttg tt
#ggcagggc    780
catattgcta aacgaagaga agtagcacaa aacccaaggt taagaacaat ta
#aaaaaatt    840
catacgacaa ttccacagcc atttacataa tcaacagcga caaatgagac ag
#aaaaaact    900
ttcaacattt caaagttccc tttttcctat tacttctttt tttctttcct tc
#ctttcatt    960
tcctttcctt ctgcttttat tactttacca gtcttttgct tgtttttgca at
#tcctcatc   1020
ctcctcctca ccatggcttt agacaagtta gatttgtatg tcatcataac at
#tggtggtc   1080
gctgtggccg cctattttgc taagaaccag ttccttgatc agccccagga ca
#ccgggttc   1140
ctcaacacgg acagcggaag caactccaga gacgtcttgc tgacattgaa ga
#agaataat   1200
aaaaacacgt tgttgttgtt tgggtcccag accggtacgg cagaagatta cg
#ccaacaaa   1260
ttgtcaagag aattgcactc cagatttggc ttgaaaacca tggttgcaga tt
#tcgctgat   1320
tacgattggg ataacttcgg agatatcacc gaagatatct tggtgttttt ca
#tcgttgcc   1380
acctacggtg agggtgaacc taccgacaat gccgacgagt tccacacctg gt
#tgactgaa   1440
gaagctgaca ctttgagtac tttgagatat accgtgttcg ggttgggtaa ct
#ccacctac   1500
gagttcttca atgctattgg tagaaagttt gacagattgt tgagtgagaa ag
#gtggtgac   1560
agatttgctg aatatgctga aggtgacgac ggcactggca ccttggacga ag
#atttcatg   1620
gcctggaagg ataatgtctt tgacgccttg aagaatgact tgaactttga ag
#aaaaggaa   1680
ttgaagtacg aaccaaacgt gaaattgact gagagagatg acttgtctgc tg
#ccgactcc   1740
caagtttcct tgggtgagcc aaacaagaag tacatcaact ccgagggcat cg
#acttgacc   1800
aagggtccat tcgaccacac ccacccatac ttggccagga tcaccgagac ca
#gagagttg   1860
ttcagctcca aggaaagaca ctgtattcac gttgaatttg acatttctga at
#cgaacttg   1920
aaatacacca ccggtgacca tctagccatc tggccatcca actccgacga aa
#acatcaag   1980
caatttgcca agtgtttcgg attggaagat aaactcgaca ctgttattga at
#tgaaggca   2040
ttggactcca cttacaccat tccattccca actccaatta cttacggtgc tg
#tcattaga   2100
caccatttag aaatctccgg tccagtctcg agacaattct ttttgtcgat tg
#ctgggttt   2160
gctcctgatg aagaaacaaa gaagactttc accagacttg gtggtgacaa ac
#aagaattc   2220
gccaccaagg ttacccgcag aaagttcaac attgccgatg ccttgttata tt
#cctccaac   2280
aacactccat ggtccgatgt tccttttgag ttccttattg aaaacatcca ac
#acttgact   2340
ccacgttact actccatttc ttcttcgtcg ttgagtgaaa aacaactcat ca
#atgttact   2400
gcagtcgttg aggccgaaga agaagccgat ggcagaccag tcactggtgt tg
#ttaccaac   2460
ttgttgaaga acattgaaat tgcgcaaaac aagactggcg aaaagccact tg
#ttcactac   2520
gatttgagcg gcccaagagg caagttcaac aagttcaagt tgccagtgca cg
#tgagaaga   2580
tccaacttta agttgccaaa gaactccacc accccagtta tcttgattgg tc
#caggtact   2640
ggtgttgccc cattgagagg tttcgttaga gaaagagttc aacaagtcaa ga
#atggtgtc   2700
aatgttggca agactttgtt gttttatggt tgcagaaact ccaacgagga ct
#ttttgtac   2760
aagcaagaat gggccgagta cgcttctgtt ttgggtgaaa actttgagat gt
#tcaatgcc   2820
ttctctagac aagacccatc caagaaggtt tacgtccagg ataagatttt ag
#aaaacagc   2880
caacttgtgc acgaattgtt gaccgaaggt gccattatct acgtctgtgg tg
#acgccagt   2940
agaatggcca gagacgtcca gaccacgatc tccaagattg ttgccaaaag ca
#gagaaatc   3000
agtgaagaca aggccgctga attggtcaag tcctggaaag tccaaaatag at
#accaagaa   3060
gatgtttggt agactcaaac gaatctctct ttctcccaac gcatttatga at
#attctcat   3120
tgaagtttta catatgttct atatttcatt ttttttttat tatattacga aa
#cataggtc   3180
aactatatat acttgattaa atgttataga aacaataatt attatctact cg
#tctacttc   3240
tttggcattg gcattggcat tggcattggc attgccgttg ccgttggtaa tg
#ccgggata   3300
tttagtacag tatctccaat ccggatttga gctattgtaa atcagctgca ag
#tcattctc   3360
caccttcaac cagtacttat acttcatctt tgacttcaag tccaagtcat aa
#atattaca   3420
agttagcaag aacttctggc catccacaat atagacgtta ttcacgttat ta
#tgcgacgt   3480
atggatatgg ttatccttat tgaacttctc aaacttcaaa aacaacccca cg
#tcccgcaa   3540
cgtcattatc aacgacaagt tctgactcac gtcgtcggag ctcgtcaagt tc
#tcaattag   3600
atcgttcttg ttattgatct tctggtactt tctcaactgc tggaacacat tg
#tcctcgtt   3660
gttcaaatag atcttgaaca acttcttcaa gggaatcaac ttttcgatct gg
#gccaagat   3720
ttccgccggg atcttcagaa acaagtcctg caacccctgg tcgatggtct cg
#gggtacaa   3780
caagtctaag gggcagaagt gtctaggcac gtgtttcaac tggttcaagg aa
#catgttcg   3840
acagtagttc gagttatagt tatcgtacaa ccactttggc ttgatttcga aa
#atgacgga   3900
gctgatccca tcattctcct ggttcctttc atagtacaac tggcatttct tc
#gagagact   3960
caactcctcg tagttcccgt ccaagatatt cggcaacaag agcccgtagc gc
#tcacggag   4020
catcaagtcg tggccctggt tgttcaactt gttgatgaag tccgatgtca ag
#acaatcaa   4080
ctggatgtcg atgatctggt gcggaaacaa gttcttgcac tttagctcga tg
#aagtcgta   4140
caact
#
#
#          4145
<210> SEQ ID NO 4
<211> LENGTH: 2710
<212> TYPE: DNA
<213> ORGANISM: Candida tropicalis
<400> SEQUENCE: 4
acatacttca agcagtttgg cgacatagtg aacctcaagt tatcacggaa ca
#agacgacg     60
ggcaagagca agcactacgg gtttatagag ttcacgtcgc ctgaagttgc cc
#agatcgcg    120
gcggagacga tgaacaacta cttgttgttt ggacacttga tcaaatgtga gg
#ttgtcagc    180
gagccgttca aggacttgtt caaggactcg aagaggaagt tcaaggtgat tc
#cctggaag    240
aagatcgcga aggataagca cgataagcca aagtccgcga aggagtgggc ga
#agttggtg    300
gagaagttcg aagagtccaa gaagaagaag caggaggagt tgaagagtaa ag
#gtattgat    360
tttgatttgg ctgctatata aaggagataa gagaggagga tgacaagcgc aa
#acgagcat    420
tctgttgatg tgtaaagcag gtatagataa tagcggataa cgtaaaataa ga
#gatctcca    480
acttccaact tccaacttcc gaccctcatc ttttggggga gagggattgg ta
#tgtagtgg    540
tgagggagag gaggatattt tgttttgcct aattgggata aattatccca gt
#cagttgaa    600
agagcgaggc gtaagccatt tctttttcta actgcaaata gcatacagat gc
#gatagtta    660
acgaagagag aaatcaagag caggtgacta catacataga tagtgacatt at
#aataacat    720
ggcgcatcat tggttctatg tagctggcag ggttattatc aagcttgaat ag
#tttaataa    780
aaatcgtacc atgaatgtat gcatagaagc aataaggaag cctgtgcctg tg
#agtagtag    840
cagtagcggg gggagacgct agtttagggg taaaatgtca gcacatgaac ag
#cagttgaa    900
gtgggtgcca atcaagtaag aacatcttgt gaaaaatcaa aagcaatggt at
#atgtgttc    960
ctgcatacag tgctggagtc aacgagccaa aaaaaaaaaa gaaagaaaga ga
#gaaaaact   1020
tatcgtataa aaaccacaca aaaatttccc aatcccaatt ccttcattct tc
#ttctttta   1080
ctgatttaac ccacagatac atacaattat gaccgacaca gacaccacga cc
#accatcta   1140
cacccacgaa gaggttgccc agcacaccac ccacgacgac ttgtgggtta tt
#ctcaatgg   1200
taaggtctac aacatctcca actatataga cgagcaccca ggtggtgaag aa
#gtcattct   1260
tgattgcgcc ggcacagacg ccactgaagc ctttgacgac attggccact cc
#gacgaggc   1320
ccacgagatc ttggaaaagt tgtacattgg taacttgaag ggcgctaaga tt
#gttgaggc   1380
caagcacgcg cagtcgttca gcacggaaga agactcgggt atcaacttcc ca
#ttgattgc   1440
tgttggtgtg tttttggctg ctttcggtgt ctactactac aagaccaact tt
#gcctaagc   1500
ataacaagca gtacagttga aggacagggt agaggagatg agaaaaaacg gg
#aacccaac   1560
aaagattatt ttcacacatc acatggaggg gctgatccca ctttttgacg tc
#aatatcca   1620
cagcacgaag aaagaaagaa agaaagaaag tctatggaag aggaaatgga tc
#acattaga   1680
gcttttcttt atgtaacata tatatatata taaactaata cagatttaca ga
#tacaccac   1740
atcaccgcag ggcttatcat ctgatggtgc ccaaaaaaaa aaatccactg tg
#gatgagcc   1800
tagttaggag atatcggagt agctcattct tttgatatct aggtcttcct ct
#cttggatt   1860
ctacgttggt acttggtgct acacgatgag atcaccaggt gtcattctgg ag
#tttggtgg   1920
aaagtgtgtt gattttttta gtaagcaaga atttgttgag ttctattgga tg
#ttctggtg   1980
cggccacttc catcccccca ccccttgtct tgtcttgtct tgtcttattt tt
#ttgggtcg   2040
gttggcggaa gtaagacgca cgcacaggag gagcacgacg gataaatatc ca
#cttttttc   2100
acacgcgtcg attgacggct tgtgtgaatt gtggggaata cggataaggg gg
#tataccac   2160
acacacacat atctaacata tcagaccact ttctataaca gatctcatga tc
#cccttgag   2220
agttgatgca agtctatgct cctgtgatat tgcccccccc cccccaagga ag
#ggcggggc   2280
atgttatcag ggacctggat gaacccttga tggcggtgtg agtagatgca ag
#agaggttg   2340
tgctttggaa gtagctgaag gtgtagggac atccggtact atagttctct tg
#aaggatca   2400
tgccagctcc ctttctgtgg ctctctggaa gctctgcatc ttctcttcgt tg
#aaacagcg   2460
tggagttacg aaaggtaccc tgtggtgagt tcaaacaaga catggctcta ca
#agctgtcg   2520
aggataaaag taattaaaca acatgtatat atattaataa acggatccgt gg
#tgctagat   2580
tgtggtagat gtttagtatc gtttatcacc tctagtgaaa actagcattt ga
#ttccatta   2640
gtcatcagta cttgatgtta cattcaacca aatgaaggtc ggtccaagat cc
#aaagaatt   2700
caaaaagctt
#
#
#      2710
<210> SEQ ID NO 5
<211> LENGTH: 129
<212> TYPE: PRT
<213> ORGANISM: Candida tropicalis
<400> SEQUENCE: 5
Met Thr Asp Thr Asp Thr Thr Thr Thr Ile Ty
#r Thr His Glu Glu Val
1               5
#                10
#                15
Ala Gln His Thr Thr His Asp Asp Leu Trp Va
#l Ile Leu Asn Gly Lys
20
#            25
#            30
Val Tyr Asn Ile Ser Asn Tyr Ile Asp Glu Hi
#s Pro Gly Gly Glu Glu
35
#        40
#        45
Val Ile Leu Asp Cys Ala Gly Thr Asp Ala Th
#r Glu Ala Phe Asp Asp
50
#    55
#    60
Ile Gly His Ser Asp Glu Ala His Glu Ile Le
#u Glu Lys Leu Tyr Ile
65
#70
#75
#80
Gly Asn Leu Lys Gly Ala Lys Ile Val Glu Al
#a Lys His Ala Gln Ser
85
#                90
#                95
Phe Ser Thr Glu Glu Asp Ser Gly Ile Asn Ph
#e Pro Leu Ile Ala Val
100
#           105
#           110
Gly Val Phe Leu Ala Ala Phe Gly Val Tyr Ty
#r Tyr Lys Thr Asn Phe
115
#       120
#       125
Ala
<210> SEQ ID NO 6
<211> LENGTH: 32
<212> TYPE: DNA
<213> ORGANISM: Primer
<400> SEQUENCE: 6
ccttaattaa atgcacgaag cggagataaa ag
#
#          32
<210> SEQ ID NO 7
<211> LENGTH: 21
<212> TYPE: DNA
<213> ORGANISM: Primer
<400> SEQUENCE: 7
gtctaaagcc atggtcgtga t
#
#
#21
<210> SEQ ID NO 8
<211> LENGTH: 22
<212> TYPE: DNA
<213> ORGANISM: Primer
<400> SEQUENCE: 8
aacatggctt tagacaagtt ag
#
#                 22
<210> SEQ ID NO 9
<211> LENGTH: 32
<212> TYPE: DNA
<213> ORGANISM: Primer
<400> SEQUENCE: 9
ccttaattaa tgtcgttgat aatgacgttg cg
#
#          32
<210> SEQ ID NO 10
<211> LENGTH: 3037
<212> TYPE: DNA
<213> ORGANISM: Candida tropicalis
<400> SEQUENCE: 10
ttaattaaat gcacgaagcg gagataaaag attacgtaat ttatctcctg ag
#acaatttt     60
agccgtgttc acacgccctt ctttgttctg agcgaaggat aaataattag ac
#ttccacag    120
ctcattctaa tttccgtcac gcgaatattg aaggggggta catgtggccg ct
#gaatgtgg    180
gggcagtaaa cgcagtctct cctctcccag gaatagtgca acggaggaag ga
#taacggat    240
agaaagcgga atgcgaggaa aattttgaac gcgcaagaaa agcaatatcc gg
#gctaccag    300
gttttgagcc agggaacaca ctcctatttc tgctcaatga ctgaacatag aa
#aaaacacc    360
aagacgcaat gaaacgcaca tggacattta gacctcccca catgtgatag tt
#tgtcttaa    420
cagaaaagta taataagaac ccatgccgtc ccttttcttt cgccgcttca ac
#tttttttt    480
ttatatctta cacacatcac gaccatggct ttagacaagt tagatttgta tg
#tcatcata    540
acattggtgg tcgctgtggc cgcctatttt gccaagaacc agttccttga tc
#agccccag    600
gacaccgggt tcctcaacac ggacagcgga agcaactcca gagacgtctt gc
#tgacattg    660
aagaagaata ataaaaacac gttgttgttg tttgggtccc agaccggtac gg
#cagaagat    720
tacgccaaca aattgtcaag agaattgcac tccagatttg gcttgaaaac ca
#tggttgca    780
gatttcgctg attacgattg ggataacttc ggagatatca ccgaagatat ct
#tggtgttt    840
ttcatcgttg ccacctacgg tgagggtgaa cctaccgaca atgccgacga gt
#tccacacc    900
tggttgactg aagaagctga cactttgagt actttgagat ataccgtgtt cg
#ggttgggt    960
aactccacct acgagttctt caatgctatt ggtagaaagt ttgacagatt gt
#tgagtgag   1020
aaaggtggtg acagatttgc tgaatatgct gaaggtgacg acggcactgg ca
#ccttggac   1080
gaagatttca tggcctggaa ggataatgtc tttgacgcct tgaagaatga ct
#tgaacttt   1140
gaagaaaagg aattgaagta cgaaccaaac gtgaaattga ctgagagaga tg
#acttgtct   1200
gctgccgact cccaagtttc cttgggtgag ccaaacaaga agtacatcaa ct
#ccgagggc   1260
atcgacttga ccaagggtcc attcgaccac acccacccat acttggccag ga
#tcaccgag   1320
accagagagt tgttcagctc caaggaaaga cactgtattc acgttgaatt tg
#acatttct   1380
gaatcgaact tgaaatacac caccggtgac catctagcca tctggccatc ca
#actccgac   1440
gaaaacatca agcaatttgc caagtgtttc ggattggaag ataaactcga ca
#ctgttatt   1500
gaattgaagg cattggactc cacttacacc attccattcc caactccaat ta
#cttacggt   1560
gctgtcatta gacaccattt agaaatctcc ggtccagtct cgagacaatt ct
#ttttgtcg   1620
attgctgggt ttgctcctga tgaagaaaca aagaagactt tcaccagact tg
#gtggtgac   1680
aaacaagaat tcgccaccaa ggttacccgc agaaagttca acattgccga tg
#ccttgtta   1740
tattcctcca acaacactcc atggtccgat gttccttttg agttccttat tg
#aaaacatc   1800
caacacttga ctccacgtta ctactccatt tcttcttcgt cgttgagtga aa
#aacaactc   1860
atcaatgtta ctgcagtcgt tgaggccgaa gaagaagccg atggcagacc ag
#tcactggt   1920
gttgttacca acttgttgaa gaacattgaa attgcgcaaa acaagactgg cg
#aaaagcca   1980
cttgttcact acgatttgag cggcccaaga ggtaagttca acaagttcaa gt
#tgccagtg   2040
cacgtgagaa gatccaactt taagttgcca aagaactcca ccaccccagt ta
#tcttgatt   2100
ggtccaggta ctggtgttgc cccattgaga ggtttcgtta gagaaagagt tc
#aacaagtc   2160
aagaatggtg tcaatgttgg caagactttg ttgttttatg gttgcagaaa ct
#ccaacgag   2220
gactttttgt acaagcaaga atgggccgag tacgcttctg ttttgggtga aa
#actttgag   2280
atgttcaatg ccttctctag acaagaccca tccaagaagg tttacgtcca gg
#ataagatt   2340
ttagaaaaca gccaacttgt gcacgaattg ttgaccgaag gtgccattat ct
#acgtctgt   2400
ggtgacgcca gtagaatggc cagagacgtc cagaccacga tctccaagat tg
#ttgccaaa   2460
agcagagaaa tcagtgaaga caaggccgct gaattggtca agtcctggaa ag
#tccaaaat   2520
agataccaag aagatgtttg gtagactcaa acgaatctct ctttctccca ac
#gcatttat   2580
gaatattctc attgaagttt tacatatgtt ctatatttca tttttttttt at
#tatattac   2640
gaaacatagg tcaactatat atacttgatt aaatgttata gaaacaataa tt
#attatcta   2700
ctcgtctact tctttggcat tggcattggc attggcattg gcattgccgt tg
#ccgttggt   2760
aatgccggga tatttagtac agtatctcca atccggattt gagctattgt aa
#atcagctg   2820
caagtcattc tccaccttca accagtactt atacttcatc tttgacttca ag
#tccaagtc   2880
ataaatatta caagttagca agaacttctg gccatccaca atatagacgt ta
#ttcacgtt   2940
attatgcgac gtatggatat ggttatcctt attgaacttc tcaaacttca aa
#aacaaccc   3000
cacgtcccgc aacgtcatta tcaacgacat taattaa
#
#    3037
<210> SEQ ID NO 11
<211> LENGTH: 679
<212> TYPE: PRT
<213> ORGANISM: Candida tropicalis
<220> FEATURE:
<221> NAME/KEY: MISC_FEATURE
<222> LOCATION: (50)..(50)
<223> OTHER INFORMATION: Xaa=leucine or serine
<400> SEQUENCE: 11
Met Ala Leu Asp Lys Leu Asp Leu Tyr Val Il
#e Ile Thr Leu Val Val
1               5
#                10
#                15
Ala Val Ala Ala Tyr Phe Ala Lys Asn Gln Ph
#e Leu Asp Gln Pro Gln
20
#            25
#            30
Asp Thr Gly Phe Leu Asn Thr Asp Ser Gly Se
#r Asn Ser Arg Asp Val
35
#        40
#        45
Leu Xaa Thr Leu Lys Lys Asn Asn Lys Asn Th
#r Leu Leu Leu Phe Gly
50
#    55
#    60
Ser Gln Thr Gly Thr Ala Glu Asp Tyr Ala As
#n Lys Leu Ser Arg Glu
65
#70
#75
#80
Leu His Ser Arg Phe Gly Leu Lys Thr Met Va
#l Ala Asp Phe Ala Asp
85
#                90
#                95
Tyr Asp Trp Asp Asn Phe Gly Asp Ile Thr Gl
#u Asp Ile Leu Val Phe
100
#           105
#           110
Phe Ile Val Ala Thr Tyr Gly Glu Gly Glu Pr
#o Thr Asp Asn Ala Asp
115
#       120
#       125
Glu Phe His Thr Trp Leu Thr Glu Glu Ala As
#p Thr Leu Ser Thr Leu
130
#   135
#   140
Arg Tyr Thr Val Phe Gly Leu Gly Asn Ser Th
#r Tyr Glu Phe Phe Asn
145                 1
#50                 1
#55                 1
#60
Ala Ile Gly Arg Lys Phe Asp Arg Leu Leu Se
#r Glu Lys Gly Gly Asp
165
#               170
#               175
Arg Phe Ala Glu Tyr Ala Glu Gly Asp Asp Gl
#y Thr Gly Thr Leu Asp
180
#           185
#           190
Glu Asp Phe Met Ala Trp Lys Asp Asn Val Ph
#e Asp Ala Leu Lys Asn
195
#       200
#       205
Asp Leu Asn Phe Glu Glu Lys Glu Leu Lys Ty
#r Glu Pro Asn Val Lys
210
#   215
#   220
Leu Thr Glu Arg Asp Asp Leu Ser Ala Ala As
#p Ser Gln Val Ser Leu
225                 2
#30                 2
#35                 2
#40
Gly Glu Pro Asn Lys Lys Tyr Ile Asn Ser Gl
#u Gly Ile Asp Leu Thr
245
#               250
#               255
Lys Gly Pro Phe Asp His Thr His Pro Tyr Le
#u Ala Arg Ile Thr Glu
260
#           265
#           270
Thr Arg Glu Leu Phe Ser Ser Lys Glu Arg Hi
#s Cys Ile His Val Glu
275
#       280
#       285
Phe Asp Ile Ser Glu Ser Asn Leu Lys Tyr Th
#r Thr Gly Asp His Leu
290
#   295
#   300
Ala Ile Trp Pro Ser Asn Ser Asp Glu Asn Il
#e Lys Gln Phe Ala Lys
305                 3
#10                 3
#15                 3
#20
Cys Phe Gly Leu Glu Asp Lys Leu Asp Thr Va
#l Ile Glu Leu Lys Ala
325
#               330
#               335
Leu Asp Ser Thr Tyr Thr Ile Pro Phe Pro Th
#r Pro Ile Thr Tyr Gly
340
#           345
#           350
Ala Val Ile Arg His His Leu Glu Ile Ser Gl
#y Pro Val Ser Arg Gln
355
#       360
#       365
Phe Phe Leu Ser Ile Ala Gly Phe Ala Pro As
#p Glu Glu Thr Lys Lys
370
#   375
#   380
Thr Phe Thr Arg Leu Gly Gly Asp Lys Gln Gl
#u Phe Ala Thr Lys Val
385                 3
#90                 3
#95                 4
#00
Thr Arg Arg Lys Phe Asn Ile Ala Asp Ala Le
#u Leu Tyr Ser Ser Asn
405
#               410
#               415
Asn Thr Pro Trp Ser Asp Val Pro Phe Glu Ph
#e Leu Ile Glu Asn Ile
420
#           425
#           430
Gln His Leu Thr Pro Arg Tyr Tyr Ser Ile Se
#r Ser Ser Ser Leu Ser
435
#       440
#       445
Glu Lys Gln Leu Ile Asn Val Thr Ala Val Va
#l Glu Ala Glu Glu Glu
450
#   455
#   460
Ala Asp Gly Arg Pro Val Thr Gly Val Val Th
#r Asn Leu Leu Lys Asn
465                 4
#70                 4
#75                 4
#80
Ile Glu Ile Ala Gln Asn Lys Thr Gly Glu Ly
#s Pro Leu Val His Tyr
485
#               490
#               495
Asp Leu Ser Gly Pro Arg Gly Lys Phe Asn Ly
#s Phe Lys Leu Pro Val
500
#           505
#           510
His Val Arg Arg Ser Asn Phe Lys Leu Pro Ly
#s Asn Ser Thr Thr Pro
515
#       520
#       525
Val Ile Leu Ile Gly Pro Gly Thr Gly Val Al
#a Pro Leu Arg Gly Phe
530
#   535
#   540
Val Arg Glu Arg Val Gln Gln Val Lys Asn Gl
#y Val Asn Val Gly Lys
545                 5
#50                 5
#55                 5
#60
Thr Leu Leu Phe Tyr Gly Cys Arg Asn Ser As
#n Glu Asp Phe Leu Tyr
565
#               570
#               575
Lys Gln Glu Trp Ala Glu Tyr Ala Ser Val Le
#u Gly Glu Asn Phe Glu
580
#           585
#           590
Met Phe Asn Ala Phe Ser Arg Gln Asp Pro Se
#r Lys Lys Val Tyr Val
595
#       600
#       605
Gln Asp Lys Ile Leu Glu Asn Ser Gln Leu Va
#l His Glu Leu Leu Thr
610
#   615
#   620
Glu Gly Ala Ile Ile Tyr Val Cys Gly Asp Al
#a Ser Arg Met Ala Arg
625                 6
#30                 6
#35                 6
#40
Asp Val Gln Thr Thr Ile Ser Lys Ile Val Al
#a Lys Ser Arg Glu Ile
645
#               650
#               655
Ser Glu Asp Lys Ala Ala Glu Leu Val Lys Se
#r Trp Lys Val Gln Asn
660
#           665
#           670
Arg Tyr Gln Glu Asp Val Trp
675
<210> SEQ ID NO 12
<211> LENGTH: 23
<212> TYPE: DNA
<213> ORGANISM: Primer
<400> SEQUENCE: 12
cacaccaccc acgacgactt gtg
#
#                23
<210> SEQ ID NO 13
<211> LENGTH: 21
<212> TYPE: DNA
<213> ORGANISM: Primer
<400> SEQUENCE: 13
cttccgtgct gaacgactgc g
#
#
#21
<210> SEQ ID NO 14
<211> LENGTH: 46
<212> TYPE: DNA
<213> ORGANISM: Primer
<400> SEQUENCE: 14
taatacgact cactataggg aggcacacca cccacgacga cttgtg
#                 46
<210> SEQ ID NO 15
<211> LENGTH: 42
<212> TYPE: DNA
<213> ORGANISM: Primer
<400> SEQUENCE: 15
cttccgtgct gaacgactgc gaatcttagc gcccttcaag tt
#
#  42
<210> SEQ ID NO 16
<211> LENGTH: 39
<212> TYPE: DNA
<213> ORGANISM: Primer
<400> SEQUENCE: 16
ataagaatgc ggccgctgaa cgagaaccac atccaggag
#
#    39
<210> SEQ ID NO 17
<211> LENGTH: 33
<212> TYPE: DNA
<213> ORGANISM: Primer
<400> SEQUENCE: 17
ccttaattaa ggataaccac atccatacgt cgc
#
#         33
<210> SEQ ID NO 18
<211> LENGTH: 24
<212> TYPE: DNA
<213> ORGANISM: Primer
<400> SEQUENCE: 18
tgtgtcggtc atggtcgtga tgtg
#
#                24
<210> SEQ ID NO 19
<211> LENGTH: 24
<212> TYPE: DNA
<213> ORGANISM: Primer
<400> SEQUENCE: 19
cacatcacga ccatgaccga caca
#
#                24
<210> SEQ ID NO 20
<211> LENGTH: 30
<212> TYPE: DNA
<213> ORGANISM: Primer
<400> SEQUENCE: 20
cccttaatta aggggggatg gaagtggccg
#
#           30
<210> SEQ ID NO 21
<211> LENGTH: 33
<212> TYPE: DNA
<213> ORGANISM: Primer
<400> SEQUENCE: 21
aggcgcgccg gagtccaaaa agaccaacct ctg
#
#         33
<210> SEQ ID NO 22
<211> LENGTH: 34
<212> TYPE: DNA
<213> ORGANISM: Primer
<400> SEQUENCE: 22
ccttaattaa tacgtggata ccttcaagca agtg
#
#        34
<210> SEQ ID NO 23
<211> LENGTH: 1712
<212> TYPE: DNA
<213> ORGANISM: Candida tropicalis
<400> SEQUENCE: 23
ggtaccgagc tcacgagttt tgggattttc gagtttggat tgtttccttt gt
#tgattgaa     60
ttgacgaaac cagaggtttt caagacagat aagattgggt ttatcaaaac gc
#agtttgaa    120
atattccagt tggtttccaa gatatcttga agaagattga cgatttgaaa tt
#tgaagaag    180
tggagaagat ctggtttgga ttgttggaga atttcaagaa tctcaagatt ta
#ctctaacg    240
acgggtacaa cgagaattgt attgaattga tcaagaacat gatcttggtg tt
#acagaaca    300
tcaagttctt ggaccagact gagaatgcca cagatataca aggcgtcatg tg
#ataaaatg    360
gatgagattt atcccacaat tgaagaaaga gtttatggaa agtggtcaac ca
#gaagctaa    420
acaggaagaa gcaaacgaag aggtgaaaca agaagaagaa ggtaaataag ta
#ttttgtat    480
tatataacaa acaaagtaag gaatacagat ttatacaata aattgccata ct
#agtcacgt    540
gagatatctc atccattccc caactcccaa gaaaaaaaaa aagtgaaaaa aa
#aaatcaaa    600
cccaaagatc aacctcccca tcatcatcgt catcaaaccc ccagctcaat tc
#gcaatggt    660
tagcacaaaa acatacacag aaagggcatc agcacacccc tccaaggttg cc
#caacgttt    720
attccgctta atggagtcca aaaagaccaa cctctgcgcc tcgatcgacg tg
#accacaac    780
cgccgagttc ctttcgctca tcgacaagct cggtccccac atctgtctcg tg
#aagacgca    840
catcgatatc atctcagact tcagctacga gggcacgatt gagccgttgc tt
#gtgcttgc    900
agagcgccac gggttcttga tattcgagga caggaagttt gctgatatcg ga
#aacaccgt    960
gatgttgcag tacacctcgg gggtataccg gatcgcggcg tggagtgaca tc
#acgaacgc   1020
gcacggagtg actgggaagg gcgtcgttga agggttgaaa cgcggtgcgg ag
#ggggtaga   1080
aaaggaaagg ggcgtgttga tgttggcgga gttgtcgagt aaaggctcgt tg
#gcgcatgg   1140
tgaatatacc cgtgagacga tcgagattgc gaagagtgat cgggagttcg tg
#attgggtt   1200
catcgcgcag cgggacatgg ggggtagaga agaagggttt gattggatca tc
#atgacgcc   1260
tggtgtgggg ttggatgata aaggcgatgc gttgggccag cagtatagga ct
#gttgatga   1320
ggtggttctg actggtaccg atgtgattat tgtcgggaga gggttgtttg ga
#aaaggaag   1380
agaccctgag gtggagggaa agagatacag ggatgctgga tggaaggcat ac
#ttgaagag   1440
aactggtcag ttagaataaa tattgtaata aataggtcta tatacataca ct
#aagcttct   1500
aggacgtcat tgtagtcttc gaagttgtct gctagtttag ttctcatgat tt
#cgaaaacc   1560
aataacgcaa tggatgtagc agggatggtg gttagtgcgt tcctgacaaa cc
#cagagtac   1620
gccgcctcaa accacgtcac attcgccctt tgcttcatcc gcatcacttg ct
#tgaaggta   1680
tccacgtacg agttgtaata caccttgaag aa
#
#        1712
<210> SEQ ID NO 24
<211> LENGTH: 267
<212> TYPE: PRT
<213> ORGANISM: Candida tropicalis
<400> SEQUENCE: 24
Met Val Ser Thr Lys Thr Tyr Thr Glu Arg Al
#a Ser Ala His Pro Ser
1               5
#                10
#                15
Lys Val Ala Gln Arg Leu Phe Arg Leu Met Gl
#u Ser Lys Lys Thr Asn
20
#            25
#            30
Leu Cys Ala Ser Ile Asp Val Thr Thr Thr Al
#a Glu Phe Leu Ser Leu
35
#        40
#        45
Ile Asp Lys Leu Gly Pro His Ile Cys Leu Va
#l Lys Thr His Ile Asp
50
#    55
#    60
Ile Ile Ser Asp Phe Ser Tyr Glu Gly Thr Il
#e Glu Pro Leu Leu Val
65
#70
#75
#80
Leu Ala Glu Arg His Gly Phe Leu Ile Phe Gl
#u Asp Arg Lys Phe Ala
85
#                90
#                95
Asp Ile Gly Asn Thr Val Met Leu Gln Tyr Th
#r Ser Gly Val Tyr Arg
100
#           105
#           110
Ile Ala Ala Trp Ser Asp Ile Thr Asn Ala Hi
#s Gly Val Thr Gly Lys
115
#       120
#       125
Gly Val Val Glu Gly Leu Lys Arg Gly Ala Gl
#u Gly Val Glu Lys Glu
130
#   135
#   140
Arg Gly Val Leu Met Leu Ala Glu Leu Ser Se
#r Lys Gly Ser Leu Ala
145                 1
#50                 1
#55                 1
#60
His Gly Glu Tyr Thr Arg Glu Thr Ile Glu Il
#e Ala Lys Ser Asp Arg
165
#               170
#               175
Glu Phe Val Ile Gly Phe Ile Ala Gln Arg As
#p Met Gly Gly Arg Glu
180
#           185
#           190
Glu Gly Phe Asp Trp Ile Ile Met Thr Pro Gl
#y Val Gly Leu Asp Asp
195
#       200
#       205
Lys Gly Asp Ala Leu Gly Gln Gln Tyr Arg Th
#r Val Asp Glu Val Val
210
#   215
#   220
Leu Thr Gly Thr Asp Val Ile Ile Val Gly Ar
#g Gly Leu Phe Gly Lys
225                 2
#30                 2
#35                 2
#40
Gly Arg Asp Pro Glu Val Glu Gly Lys Arg Ty
#r Arg Asp Ala Gly Trp
245
#               250
#               255
Lys Ala Tyr Leu Lys Arg Thr Gly Gln Leu Gl
#u
260
#           265
<210> SEQ ID NO 25
<211> LENGTH: 35
<212> TYPE: DNA
<213> ORGANISM: Primer
<400> SEQUENCE: 25
ccttaattaa gctcacgagt tttgggattt tcgag
#
#       35
<210> SEQ ID NO 26
<211> LENGTH: 35
<212> TYPE: DNA
<213> ORGANISM: Primer
<400> SEQUENCE: 26
gggtttaaac cgcagaggtt ggtctttttg gactc
#
#       35
<210> SEQ ID NO 27
<211> LENGTH: 4399
<212> TYPE: DNA
<213> ORGANISM: vector
<400> SEQUENCE: 27
tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg ga
#gacggtca     60
cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tc
#agcgggtg    120
ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ct
#gagagtgc    180
accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc at
#caggcgcc    240
attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tc
#ttcgctat    300
tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta ac
#gccagggt    360
tttcccagtc acgacgttgt aaaacgacgg ccagtgaatt cgagctcggt ac
#ccgggggc    420
gcgccggagt ccaaaaagac caacctctgc gcctcgatcg acgtgaccac aa
#ccgccgag    480
ttcctttcgc tcatcgacaa gctcggtccc cacatctgtc tcgtgaagac gc
#acatcgat    540
atcatctcag acttcagcta cgagggcacg attgagccgt tgcttgtgct tg
#cagagcgc    600
cacgggttct tgatattcga ggacaggaag tttgctgata tcggaaacac cg
#tgatgttg    660
cagtacacct cgggggtata ccggatcgcg gcgtggagtg acatcacgaa cg
#cgcacgga    720
gtgactggga agggcgtcgt tgaagggttg aaacgcggtg cggagggggt ag
#aaaaggaa    780
aggggcgtgt tgatgttggc ggagttgtcg agtaaaggct cgttggcgca tg
#gtgaatat    840
acccgtgaga cgatcgagat tgcgaagagt gatcgggagt tcgtgattgg gt
#tcatcgcg    900
cagcgggaca tggggggtag agaagaaggg tttgattgga tcatcatgac gc
#ctggtgtg    960
gggttggatg ataaaggcga tgcgttgggc cagcagtata ggactgttga tg
#aggtggtt   1020
ctgactggta ccgatgtgat tattgtcggg agagggttgt ttggaaaagg aa
#gagaccct   1080
gaggtggagg gaaagagata cagggatgct ggatggaagg catacttgaa ga
#gaactggt   1140
cagttagaat aaatattgta ataaataggt ctatatacat acactaagct tc
#taggacgt   1200
cattgtagtc ttcgaagttg tctgctagtt tagttctcat gatttcgaaa ac
#caataacg   1260
caatggatgt agcagggatg gtggttagtg cgttcctgac aaacccagag ta
#cgccgcct   1320
caaaccacgt cacattcgcc ctttgcttca tccgcatcac ttgcttgaag gt
#atccacgt   1380
attaattaag ctcacgagtt ttgggatttt cgagtttgga ttgtttcctt tg
#ttgattga   1440
attgacgaaa ccagaggttt tcaagacaga taagattggg tttatcaaaa cg
#cagtttga   1500
aatattccag ttggtttcca agatatcttg aagaagattg acgatttgaa at
#ttgaagaa   1560
gtggagaaga tctggtttgg attgttggag aatttcaaga atctcaagat tt
#actctaac   1620
gacgggtaca acgagaattg tattgaattg atcaagaaca tgatcttggt gt
#tacagaac   1680
atcaagttct tggaccagac tgagaatgcc acagatatac aaggcgtcat gt
#gataaaat   1740
ggatgagatt tatcccacaa ttgaagaaag agtttatgga aagtggtcaa cc
#agaagcta   1800
aacaggaaga agcaaacgaa gaggtgaaac aagaagaaga aggtaaataa gt
#attttgta   1860
ttatataaca aacaaagtaa ggaatacaga tttatacaat aaattgccat ac
#tagtcacg   1920
tgagatatct catccattcc ccaactccca agaaaaaaaa aaagtgaaaa aa
#aaaatcaa   1980
acccaaagat caacctcccc atcatcatcg tcatcaaacc cccagctcaa tt
#cgcaatgg   2040
ttagcacaaa aacatacaca gaaagggcat cagcacaccc ctccaaggtt gc
#ccaacgtt   2100
tattccgctt aatggagtcc aaaaagacca acctctgcgg tttaaacctg ca
#ggcatgca   2160
agcttggcgt aatcatggtc atagctgttt cctgtgtgaa attgttatcc gc
#tcacaatt   2220
ccacacaaca tacgagccgg aagcataaag tgtaaagcct ggggtgccta at
#gagtgagc   2280
taactcacat taattgcgtt gcgctcactg cccgctttcc agtcgggaaa cc
#tgtcgtgc   2340
cagctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat tg
#ggcgctct   2400
tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg ag
#cggtatca   2460
gctcactcaa aggcggtaat acggttatcc acagaatcag gggataacgc ag
#gaaagaac   2520
atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt gc
#tggcgttt   2580
ttccataggc tccgcccccc tgacgagcat cacaaaaatc gacgctcaag tc
#agaggtgg   2640
cgaaacccga caggactata aagataccag gcgtttcccc ctggaagctc cc
#tcgtgcgc   2700
tctcctgttc cgaccctgcc gcttaccgga tacctgtccg cctttctccc tt
#cgggaagc   2760
gtggcgcttt ctcatagctc acgctgtagg tatctcagtt cggtgtaggt cg
#ttcgctcc   2820
aagctgggct gtgtgcacga accccccgtt cagcccgacc gctgcgcctt at
#ccggtaac   2880
tatcgtcttg agtccaaccc ggtaagacac gacttatcgc cactggcagc ag
#ccactggt   2940
aacaggatta gcagagcgag gtatgtaggc ggtgctacag agttcttgaa gt
#ggtggcct   3000
aactacggct acactagaag gacagtattt ggtatctgcg ctctgctgaa gc
#cagttacc   3060
ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg ta
#gcggtggt   3120
ttttttgttt gcaagcagca gattacgcgc agaaaaaaag gatctcaaga ag
#atcctttg   3180
atcttttcta cggggtctga cgctcagtgg aacgaaaact cacgttaagg ga
#ttttggtc   3240
atgagattat caaaaaggat cttcacctag atccttttaa attaaaaatg aa
#gttttaaa   3300
tcaatctaaa gtatatatga gtaaacttgg tctgacagtt accaatgctt aa
#tcagtgag   3360
gcacctatct cagcgatctg tctatttcgt tcatccatag ttgcctgact cc
#ccgtcgtg   3420
tagataacta cgatacggga gggcttacca tctggcccca gtgctgcaat ga
#taccgcga   3480
gacccacgct caccggctcc agatttatca gcaataaacc agccagccgg aa
#gggccgag   3540
cgcagaagtg gtcctgcaac tttatccgcc tccatccagt ctattaattg tt
#gccgggaa   3600
gctagagtaa gtagttcgcc agttaatagt ttgcgcaacg ttgttgccat tg
#ctacaggc   3660
atcgtggtgt cacgctcgtc gtttggtatg gcttcattca gctccggttc cc
#aacgatca   3720
aggcgagtta catgatcccc catgttgtgc aaaaaagcgg ttagctcctt cg
#gtcctccg   3780
atcgttgtca gaagtaagtt ggccgcagtg ttatcactca tggttatggc ag
#cactgcat   3840
aattctctta ctgtcatgcc atccgtaaga tgcttttctg tgactggtga gt
#actcaacc   3900
aagtcattct gagaatagtg tatgcggcga ccgagttgct cttgcccggc gt
#caatacgg   3960
gataataccg cgccacatag cagaacttta aaagtgctca tcattggaaa ac
#gttcttcg   4020
gggcgaaaac tctcaaggat cttaccgctg ttgagatcca gttcgatgta ac
#ccactcgt   4080
gcacccaact gatcttcagc atcttttact ttcaccagcg tttctgggtg ag
#caaaaaca   4140
ggaaggcaaa atgccgcaaa aaagggaata agggcgacac ggaaatgttg aa
#tactcata   4200
ctcttccttt ttcaatatta ttgaagcatt tatcagggtt attgtctcat ga
#gcggatac   4260
atatttgaat gtatttagaa aaataaacaa ataggggttc cgcgcacatt tc
#cccgaaaa   4320
gtgccacctg acgtctaaga aaccattatt atcatgacat taacctataa aa
#ataggcgt   4380
atcacgaggc cctttcgtc
#
#                 439
#9
<210> SEQ ID NO 28
<211> LENGTH: 32
<212> TYPE: DNA
<213> ORGANISM: Primer
<400> SEQUENCE: 28
ggagttgttc aatcatggtc gtgatgtgtg ta
#
#          32
<210> SEQ ID NO 29
<211> LENGTH: 32
<212> TYPE: DNA
<213> ORGANISM: Primer
<400> SEQUENCE: 29
tacacacatc acgaccatga ttgaacaact cc
#
#          32
<210> SEQ ID NO 30
<211> LENGTH: 34
<212> TYPE: DNA
<213> ORGANISM: Primer
<400> SEQUENCE: 30
ccttaattaa ggcagacaac aacttggcaa agtc
#
#        34
<210> SEQ ID NO 31
<211> LENGTH: 2724
<212> TYPE: DNA
<213> ORGANISM: Candida tropicalis
<400> SEQUENCE: 31
atgcacgaag cggagataaa agattacgta atttatctcc tgagacaatt tt
#agccgtgt     60
tcacacgccc ttctttgttc tgagcgaagg ataaataatt agacttccac ag
#ctcattct    120
aatttccgtc acgcgaatat tgaagggggg tacatgtggc cgctgaatgt gg
#gggcagta    180
aacgcagtct ctcctctccc aggaatagtg caacggagga aggataacgg at
#agaaagcg    240
gaatgcgagg aaaattttga acgcgcaaga aaagcaatat ccgggctacc ag
#gttttgag    300
ccagggaaca cactcctatt tctgctcaat gactgaacat agaaaaaaca cc
#aagacgca    360
atgaaacgca catggacatt tagacctccc cacatgtgat agtttgtctt aa
#cagaaaag    420
tataataaga acccatgccg tcccttttct ttcgccgctt caactttttt tt
#ttttatct    480
tacacacatc acgaccatga ttgaacaact cctagaatat tggtatgtcg tt
#gtgccagt    540
gttgtacatc atcaaacaac tccttgcata cacaaagact cgcgtcttga tg
#aaaaagtt    600
gggtgctgct ccagtcacaa acaagttgta cgacaacgct ttcggtatcg tc
#aatggatg    660
gaaggctctc cagttcaaga aagagggcag ggctcaagag tacaacgatt ac
#aagtttga    720
ccactccaag aacccaagcg tgggcaccta cgtcagtatt cttttcggca cc
#aggatcgt    780
cgtgaccaaa gatccagaga atatcaaagc tattttggca acccagtttg gt
#gatttttc    840
tttgggcaag aggcacactc tttttaagcc tttgttaggt gatgggatct tc
#acattgga    900
cggcgaaggc tggaagcaca gcagagccat gttgagacca cagtttgcca ga
#gaacaagt    960
tgctcatgtg acgtcgttgg aaccacactt ccagttgttg aagaagcata tt
#cttaagca   1020
caagggtgaa tactttgata tccaggaatt gttctttaga tttaccgttg at
#tcggccac   1080
ggagttctta tttggtgagt ccgtgcactc cttaaaggac gaatctattg gt
#atcaacca   1140
agacgatata gattttgctg gtagaaagga ctttgctgag tcgttcaaca aa
#gcccagga   1200
atacttggct attagaacct tggtgcagac gttctactgg ttggtcaaca ac
#aaggagtt   1260
tagagactgt accaagctgg tgcacaagtt caccaactac tatgttcaga aa
#gctttgga   1320
tgctagccca gaagagcttg aaaagcaaag tgggtatgtg ttcttgtacg ag
#cttgtcaa   1380
gcagacaaga gaccccaatg tgttgcgtga ccagtctttg aacatcttgt tg
#gccggaag   1440
agacaccact gctgggttgt tgtcgtttgc tgtctttgag ttggccagac ac
#ccagagat   1500
ctgggccaag ttgagagagg aaattgaaca acagtttggt cttggagaag ac
#tctcgtgt   1560
tgaagagatt acctttgaga gcttgaagag atgtgagtac ttgaaagcgt tc
#cttaatga   1620
aaccttgcgt atttacccaa gtgtcccaag aaacttcaga atcgccacca ag
#aacacgac   1680
attgccaagg ggcggtggtt cagacggtac ctcgccaatc ttgatccaaa ag
#ggagaagc   1740
tgtgtcgtat ggtatcaact ctactcattt ggaccctgtc tattacggcc ct
#gatgctgc   1800
tgagttcaga ccagagagat ggtttgagcc atcaaccaaa aagctcggct gg
#gcttactt   1860
gccattcaac ggtggtccaa gaatctgttt gggtcagcag tttgccttga cg
#gaagctgg   1920
ctatgtgttg gttagattgg tgcaagagtt ctcccacgtt aggctggacc ca
#gacgaggt   1980
gtacccgcca aagaggttga ccaacttgac catgtgtttg caggatggtg ct
#attgtcaa   2040
gtttgactag cggcgtggtg aatgcgtttg attttgtagt ttctgtttgc ag
#taatgaga   2100
taactattca gataaggcga gtggatgtac gttttgtaag agtttcctta ca
#accttggt   2160
ggggtgtgtg aggttgaggt tgcatcttgg ggagattaca ccttttgcag ct
#ctccgtat   2220
acacttgtac tctttgtaac ctctatcaat catgtggggg ggggggttca tt
#gtttggcc   2280
atggtggtgc atgttaaatc cgccaactac ccaatctcac atgaaactca ag
#cacactaa   2340
aaaaaaaaaa gatgttgggg gaaaactttg gtttcccttc ttagtaatta aa
#cactctca   2400
ctctcactct cactctctcc actcagacaa accaaccacc tgggctgcag ac
#aaccagaa   2460
aaaaaaagaa caaaatccag atagaaaaac aaagggctgg acaaccataa at
#aaacaatc   2520
tagggtctac tccatcttcc actgtttctt cttcttcaga cttagctaac aa
#acaactca   2580
cttcaccatg gattacgcag gcatcacgcg tggctccatc agaggcgagg cc
#ttgaagaa   2640
actcgcagaa ttgaccatcc agaaccagcc atccagcttg aaagaaatca ac
#accggcat   2700
ccagaaggac gactttgcca agtt
#
#              2724
<210> SEQ ID NO 32
<211> LENGTH: 517
<212> TYPE: PRT
<213> ORGANISM: Candida tropicalis
<400> SEQUENCE: 32
Met Ile Glu Gln Leu Leu Glu Tyr Trp Tyr Va
#l Val Val Pro Val Leu
1               5
#                10
#                15
Tyr Ile Ile Lys Gln Leu Leu Ala Tyr Thr Ly
#s Thr Arg Val Leu Met
20
#            25
#            30
Lys Lys Leu Gly Ala Ala Pro Val Thr Asn Ly
#s Leu Tyr Asp Asn Ala
35
#        40
#        45
Phe Gly Ile Val Asn Gly Trp Lys Ala Leu Gl
#n Phe Lys Lys Glu Gly
50
#    55
#    60
Arg Ala Gln Glu Tyr Asn Asp Tyr Lys Phe As
#p His Ser Lys Asn Pro
65
#70
#75
#80
Ser Val Gly Thr Tyr Val Ser Ile Leu Phe Gl
#y Thr Arg Ile Val Val
85
#                90
#                95
Thr Lys Asp Pro Glu Asn Ile Lys Ala Ile Le
#u Ala Thr Gln Phe Gly
100
#           105
#           110
Asp Phe Ser Leu Gly Lys Arg His Thr Leu Ph
#e Lys Pro Leu Leu Gly
115
#       120
#       125
Asp Gly Ile Phe Thr Leu Asp Gly Glu Gly Tr
#p Lys His Ser Arg Ala
130
#   135
#   140
Met Leu Arg Pro Gln Phe Ala Arg Glu Gln Va
#l Ala His Val Thr Ser
145                 1
#50                 1
#55                 1
#60
Leu Glu Pro His Phe Gln Leu Leu Lys Lys Hi
#s Ile Leu Lys His Lys
165
#               170
#               175
Gly Glu Tyr Phe Asp Ile Gln Glu Leu Phe Ph
#e Arg Phe Thr Val Asp
180
#           185
#           190
Ser Ala Thr Glu Phe Leu Phe Gly Glu Ser Va
#l His Ser Leu Lys Asp
195
#       200
#       205
Glu Ser Ile Gly Ile Asn Gln Asp Asp Ile As
#p Phe Ala Gly Arg Lys
210
#   215
#   220
Asp Phe Ala Glu Ser Phe Asn Lys Ala Gln Gl
#u Tyr Leu Ala Ile Arg
225                 2
#30                 2
#35                 2
#40
Thr Leu Val Gln Thr Phe Tyr Trp Leu Val As
#n Asn Lys Glu Phe Arg
245
#               250
#               255
Asp Cys Thr Lys Leu Val His Lys Phe Thr As
#n Tyr Tyr Val Gln Lys
260
#           265
#           270
Ala Leu Asp Ala Ser Pro Glu Glu Leu Glu Ly
#s Gln Ser Gly Tyr Val
275
#       280
#       285
Phe Leu Tyr Glu Leu Val Lys Gln Thr Arg As
#p Pro Asn Val Leu Arg
290
#   295
#   300
Asp Gln Ser Leu Asn Ile Leu Leu Ala Gly Ar
#g Asp Thr Thr Ala Gly
305                 3
#10                 3
#15                 3
#20
Leu Leu Ser Phe Ala Val Phe Glu Leu Ala Ar
#g His Pro Glu Ile Trp
325
#               330
#               335
Ala Lys Leu Arg Glu Glu Ile Glu Gln Gln Ph
#e Gly Leu Gly Glu Asp
340
#           345
#           350
Ser Arg Val Glu Glu Ile Thr Phe Glu Ser Le
#u Lys Arg Cys Glu Tyr
355
#       360
#       365
Leu Lys Ala Phe Leu Asn Glu Thr Leu Arg Il
#e Tyr Pro Ser Val Pro
370
#   375
#   380
Arg Asn Phe Arg Ile Ala Thr Lys Asn Thr Th
#r Leu Pro Arg Gly Gly
385                 3
#90                 3
#95                 4
#00
Gly Ser Asp Gly Thr Ser Pro Ile Leu Ile Gl
#n Lys Gly Glu Ala Val
405
#               410
#               415
Ser Tyr Gly Ile Asn Ser Thr His Leu Asp Pr
#o Val Tyr Tyr Gly Pro
420
#           425
#           430
Asp Ala Ala Glu Phe Arg Pro Glu Arg Trp Ph
#e Glu Pro Ser Thr Lys
435
#       440
#       445
Lys Leu Gly Trp Ala Tyr Leu Pro Phe Asn Gl
#y Gly Pro Arg Ile Cys
450
#   455
#   460
Leu Gly Gln Gln Phe Ala Leu Thr Glu Ala Gl
#y Tyr Val Leu Val Arg
465                 4
#70                 4
#75                 4
#80
Leu Val Gln Glu Phe Ser His Val Arg Leu As
#p Pro Asp Glu Val Tyr
485
#               490
#               495
Pro Pro Lys Arg Leu Thr Asn Leu Thr Met Cy
#s Leu Gln Asp Gly Ala
500
#           505
#           510
Ile Val Lys Phe Asp
515
<210> SEQ ID NO 33
<211> LENGTH: 222
<212> TYPE: DNA
<213> ORGANISM: vector
<400> SEQUENCE: 33
caggaaacag ctatgaccat gattacgcca agcttggtac cgagctcgga tc
#cactagta     60
acggccgcca gtgtgctgga attcgccctt aagggcgaat tctgcagata tc
#catcacac    120
tggcggccgc tcgagcatgc atctagaggg cccaattcgc cctatagtga gt
#cgtattac    180
aattcactgg ccgtcgtttt acaacgtcgt gactgggaaa ac
#
# 222
<210> SEQ ID NO 34
<211> LENGTH: 222
<212> TYPE: DNA
<213> ORGANISM: vector
<400> SEQUENCE: 34
gtcctttgtc gatactggta ctaatgcggt tcgaaccatg gctcgagcct ag
#gtgatcat     60
tgccggcggt cacacgacct taagccggaa ttcccgctta agacgtctat ag
#gtagtgtg    120
accgccggcg agctcgtacg tagatctccc gggttaagcg ggatatcact ca
#gcataatg    180
ttaagtgacc ggcagcaaaa tgttgcagca ctgacccttt tg
#
# 222

Claims

1. A method of converting a fatty acid to its corresponding dicarboxylic acid which comprises isolating a yeast CYP52A2A gene promoter, wherein the yeast CYP52A2A gene promoter consists of about 495 contiguous nucleotides located upstream from nucleotide 1199 of SEQ ID NO:1, or about 495 contiguous nucleotides located upstream from nucleotide 505 of SEQ ID NO:10;isolating a target gene involved in dicarboxylic acid production; operably linking the yeast CYP52A2A gene promoter to the open reading frame (ORF) of the target gene involved in dicarboxylic acid production to create a fusion gene; inserting the fusion gene into an expression vector; transforming a yeast host cell with the expression vector; and culturing the transformed yeast host cell in a media containing an organic substrate that is biooxidizable to a mono- or polycarboxylic acid.

2. A method of increasing conversion of a fatty acid to its corresponding dicarboxylic acid which comprises isolating a yeast CYP52A2A gene promoter, wherein the yeast CYP52A2A gene promoter consists of about 495 contiguous nucleotides located upstream from nucleotide 1199 of SEQ ID NO:1, or about 495 contiguous nucleotides located upstream from nucleotide 505 of SEQ ID NO:10;isolating at least one of a CPR gene, a CYTb5 gene, or a CYP52A2A gene; operably linking the CYP52A2A gene promoter to the open reading frame (ORF) of at least one of a CPR gene, a CYTb5 gene or a CYP52A5A gene to create a fusion gene; inserting the fusion gene into an expression vector; transforming a yeast host cell with the expression vector; and culturing the transformed host cell in a media containing an organic substrate that is biooxidizable to a mono- or polycarboxylic acid.

3. The method of claim 1 or 2 wherein the organic substrate is a saturated fatty acid, an unsaturated fatty acid, an alkane, an alkene, an alkyne, or a combination thereof.

4. The method of claim 1 or 2 wherein the yeast host cell is from at least one of Candida, Yarrowia, Bebaromyces, Saccharomyces, Schizosaccharomyces, or Pichia.

5. The method of claim 4 wherein the yeast host cell is from at least one of Candida tropicalis, C. maltosa, C. apicola, C. paratropicalis, C. albicans, C. cloacae, C. guillermondii, C. intermedia, C. lipolytica, C. parapsilosis, or C. zeylenoides.

6. The method of claim 5 wherein the yeast host cell is from C. tropicalis.

7. The method of claim 6 wherein the yeast host cell is from a β-oxidation blocked strain of C. tropicalis.