This invention relates generally to compositions and methods for improving the healing of tissue (e.g., wounds, liver, vessels), modifying angiogenesis (e.g., in conditions such as eye disease, cancer, ischemia), or treating stroke or thrombotic diseases (e.g., heart attacks, venous thrombosis, pulmonary embolism, shunt thrombosis). In particular, therapeutic agents are provided which increase plasmin activity by increasing the conversion of α2-antiplasmin from a plasmin inhibitor to a plasmin substrate.
Acute myocardial infarction, ischemic stroke, and peripheral arterial disease are caused by thrombotic occlusion of blood vessels by fibrin-containing thrombi. Enzymatic dissolution of these thrombi (fibrinolysis) by plasmin, a serine protease, reduces death and disability. Fibrinolysis is initiated by plasminogen activators that cleave the proenzyme plasminogen to plasmin (Collen et al., 1991, Blood 78: 3114-3124). Fibrinolysis is also under the control of regulatory molecules such as α2-antiplasmin (α2-AP), factor XIII, thrombin, plasminogen activator inhibitor-1 (PAI-1), and thrombin-activatable fibrinolysis inhibitor (Collen et al., 1991, Blood 78: 3114-3124; Tsikouris et al., 2002, J Clin Pharmacol 42:1187-1199; Lee et al., 2000, J Biol Chem 275: 37382-37389; Bajzar et al., 2000, Arterioscler Thromb Vasc Biol 20: 2511-2518). Plasmin is released as plasminogen into the circulation and is activated by tissue plasminogen activator (tPA), urokinase plasminogen activator (uPA), thrombin, fibrin, and factor XII (Hageman factor). Plasmin is inactivated by α2-antiplasmin, a serine protease inhibitor (serpin). Apart from fibrinolysis, plasmin also proteolyses proteins in various other systems, including but not limited to, fibrin, fibronectin, thrombospondin, laminin, and von Willebrand factor.
Plasmin is known to have a central role in degrading fibrin, the protein component of blood clots. More recently it has been recognized that plasmin activity is important for degrading protein matrices as well as modifying the activity of enzymes and growth factors. Plasmin affects vessel remodeling, cell migration, wound and organ healing, growth factor function, angiogenesis, tumor growth and dissemination, and infection (Li et al., 2003, Wound Repair Regen. 11(4):239-247; Castellino et al., 2005, Thromb Haemost. 93(4):647-654; Rakic et al., 2003, Cell Mol Life Sci. March 60(3):463-473; Kramer et al., 1994, Invasion Metastasis. 14(1-6):210-222).
Among the plasmin inhibitory molecules, α2-AP may be the most important fibrinolytic regulator in the formed thrombus (van Giezen et al., 1992, Blood Coagul Fibrinolysis 4:869-875; Butte et al., 1997, Circulation 95: 1886-1891; Nagai et al., 2001, Blood 97: 3086-3092). α2-AP is a single chain glycoprotein (70 kDa) that belongs to the serine protease inhibitor (serpin) family (Holmes et al., 1987, J Biol Chem 1987; 262: 1659-1664). α2-AP has an N-terminal domain which binds fibrin, a C-terminal domain which binds plasmin kringles, and a serpin domain which contains the reactive center loop (RCL) with the scissile P1-P1′ reactive bond that reacts with the active site of plasmin. It has been proposed that serpins inhibit their target proteases through a multiple step reaction that involves the formation of a serpin-protease Michaelis complex, followed by the formation of a serpin-acyl-protease intermediate which then proceeds to the inhibitory pathway (with distortion and inactivation of the protease) or to the substrate pathway (with deacylation and cleavage of the serpin by the protease) (Huntington et al., 2000, Nature 407:923-926; Wiman and Collen, 1978, Eur J Biochem 84:573-578; Schechter and Plotnick, 2004, Methods 32:159-168). α2-AP inhibits plasmin in one of the fastest protein-protein reactions described, and plasmin-α2-AP interactions appear to proceed predominantly through the inhibitory pathway (Wiman and Collen, 1978, Eur J Biochem 84:573-578). Indeed α2-AP is such a potent inhibitor that the half-life of plasmin in vivo is thought to be less than 100 msec (Edy and Collen, 1977, Biochim Biophys Acta 484:423-432). One strategy for amplifying fibrinolysis is to block the inhibitory effects of α2-AP. Inhibition of α2-AP by monoclonal antibodies (MAbs) causes “spontaneous” lysis of blood clots in the absence of exogenous plasminogen activator (Reed et al., 1988, Trans Assoc Am Physicians 101:250-256) and synergistically amplifies fibrinolysis by all plasminogen activators in vitro and in vivo (Reed, 1997, Hybridoma 16:281-286).
What is needed are additional compositions and methods for improving the healing of tissue (e.g., wounds, liver, vessels), modifying angiogenesis (e.g., in conditions such as eye disease, cancer, ischemia), or treating stroke or thrombotic diseases (e.g., heart attacks, venous thrombosis, pulmonary embolism, shunt thrombosis). In particular, it would be desirable to determine the mechanisms through which currently available inhibitors of α2-AP affect the activity of plasmin and regulate fibrinolysis. It also would be desirable to provide methods for screening for additional molecules and compounds that can increase plasmin activity in a patient in need thereof.
Methods of increasing plasmin activity in a patient in need thereof are provided, comprising administering to the patient a therapeutic amount of an agent which binds to α2-antiplasmin at a binding site to increase conversion of α2-antiplasmin from an inhibitor to a plasmin substrate, thereby increasing plasmin activity in the patient. In certain embodiments, the methods are used for improving the healing of tissue (e.g., wounds, liver, vessels), modifying angiogenesis (e.g., in conditions such as eye disease, cancer, ischemia), or treating stroke or thrombotic diseases (e.g., heart attacks, venous thrombosis, pulmonary embolism, shunt thrombosis). In one embodiment, the method increases fibrinolysis. In some embodiments, the binding agent is an antibody or antibody fragment. In some embodiments, the binding agent is specifically not an antibody or antibody fragment.
In certain embodiments, the binding site comprises a serpin domain which is not a reactive center loop. In other embodiments, the binding site comprises a portion of the amino-terminus of α2-antiplasmin. In certain of those embodiments, the binding site has an amino acid sequence of LGNQEPGGQTALKSPPGVCS (SEQ ID NO:1). In other embodiments, the binding site is adjacent to the site at which α2-antiplasmin cross-links to fibrin. The methods of increasing plasmin activity are useful in a number of situations, for example, for increasing fibrinolysis and/or for modulating angiogenesis, vascular remodeling, and/or malignancies. The methods of increasing fibrinolysis are useful, for example, in a patient that has a disease or condition selected from the group consisting of myocardial infarction, thrombosis, ischemic stroke, and pulmonary embolism. In some embodiments, the methods further comprise administering to the patient an agent that facilitates the degradation of fibrin, that prevents fibrin formation, or that interferes with platelet formation. In certain embodiments, the agent is selected from the group consisting of plasmin, staphylokinase, streptokinase, prourokinase, urokinase, tissue-type plasminogen activator, vampire bat plasminogen activator, heparin, hirudin, activated protein C, ticlopidine, aspirin, clopidigrel, and an inhibitor of glycoprotein IIb/IIIa function.
Additional methods are provided for screening for a compound or molecule which increases plasmin activity, comprising determining whether a compound or molecule binds to a binding site on α2-antiplasmin which increases the conversion of α2-antiplasmin from a plasmin inhibitor to a plasmin substrate, thereby identifying a compound or molecule which increases plasmin activity. In certain embodiments, the binding site comprises a serpin domain which is not a reactive center loop. In some of those embodiments, the compound or molecule is an antibody or antibody fragment. In other embodiments, the binding site comprises a portion of the amino-terminus of α2-antiplasmin. In certain of those embodiments, the binding site has an amino acid sequence of LGNQEPGGQTALKSPPGVCS (SEQ ID NO:1). In other embodiments, the binding site is adjacent to the site at which α2-antiplasmin cross-links to fibrin. The binding of the compound or molecule to the binding site on α2-antiplasmin is determined, in some instances, by a standard binding assay. In one embodiment, the binding is performed by phage display technology.
Pharmaceutical compositions are provided that comprise an effective amount of a compound or molecule used in the disclosed methods for increasing plasmin activity or identified by the disclosed methods for identifying a compound or molecule that increases plasmin activity. These pharmaceutical compositions are useful, for example, for increasing fibrinolysis and/or for modulating angiogenesis, vascular remodeling, and/or malignancies. The methods of increasing fibrinolysis are useful, for example, in a patient that has a disease or condition selected from the group consisting of myocardial infarction, thrombosis, ischemic stroke, and pulmonary embolism.
The present invention may be understood more readily by reference to the following detailed description of the preferred embodiments of the invention and the Examples included herein. However, before the present compounds, compositions, and methods are disclosed and described, it is to be understood that this invention is not limited to specific nucleic acids, specific polypeptides, specific cell types, specific host cells, specific conditions, or specific methods, etc., as such may, of course, vary, and the numerous modifications and variations therein will be apparent to those skilled in the art. It is also to be understood that the terminology used herein is for the purpose of describing specific embodiments only and is not intended to be limiting.
It must be noted that as used herein and in the appended claims, the singular forms “a,” “an,” and “the,” include plural forms unless the context clearly indicates otherwise. Thus, for example, reference to “an agent” includes one or more of such different agents, and reference to “the method” includes reference to equivalent steps and methods known to those of ordinary skill in the art that could be modified or substituted for the methods described herein.
Unless otherwise defined, all technical and scientific terms used herein have the meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The practice of the present invention employs, unless otherwise indicated, conventional techniques of cell biology, molecular biology, genetics, chemistry, microbiology, recombinant DNA, and immunology. See, for example, Maniatis et al. (1982) Molecular Cloning, A Laboratory Manual, latest edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.; Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, latest edition (Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press); Ausubel et al. (1992) Current Protocols in Molecular Biology, latest edition (New York: John Wiley & Sons); Guthrie & Fink (1991) Methods Enzymol. 194:1-863; Cell Biology, A Laboratory Manual, ed. Celis, J. E., Academic Press, NY; Histochemistry, Pearse, A. G. E., Vol. 1 (1980), Vol. 2 (1985), and Vol. 3 (1990).
The present disclosure describes for the first time that certain monoclonal antibodies used to increase plasmin activity act by binding to different structural elements of α2-AP that convert α2-AP from a plasmin inhibitor to a plasmin substrate. Accordingly, methods of increasing plasmin activity in a patient in need thereof are provided, comprising administering to the patient a therapeutic amount of an agent which binds to α2-antiplasmin at a binding site to increase conversion of α2-antiplasmin from an inhibitor to a plasmin substrate, thereby increasing plasmin activity in the patient. Also provided in the present invention are α2-AP binding agents or molecules which are specifically not antibodies or fragments thereof. In certain embodiments, the binding agent or molecule is a nucleic acid, receptor decoy, ribozyme, sense polynucleotide, double stranded RNA, RNAi, aptamer, or small molecule effector.
In certain embodiments, the binding site comprises a serpin domain which is not a reactive center loop. In other embodiments, the binding site comprises a portion of the amino-terminus of α2-antiplasmin. In certain of those embodiments, the binding site has an amino acid sequence of LGNQEPGGQTALKSPPGVCS (SEQ ID NO:1). In other embodiments, the binding site is adjacent to the site at which α2-antiplasmin cross-links to fibrin. The methods of increasing fibrinolysis are useful, for example, in a patient that has a disease or condition selected from the group consisting of myocardial infarction, thrombosis, ischemic stroke, and pulmonary embolism.
As used herein, the term “plasmin activity” refers to the serine protease activity of plasmin (e.g., in the cleavage of fibrin, fibronectin, thrombospondin, laminin, or von Willebrand factor). As used herein, the term “fibrinolysis” is used to refer to the process wherein a fibrin clot, the product of coagulation, is broken down.
As used herein, an α2-AP binding agent or molecule can include, among other molecules, antibodies (polyclonal or monoclonal). The term “antibody” (Ab) or “monoclonal antibody” (MAb) is meant to include intact molecules as well as antibody fragments (such as, for example, Fv, Fab and F(ab′)2 fragments), single chain antigen-binding proteins, “humanized” antibodies, and chimeric antibodies which are capable of specifically binding to α2-AP. Fab and F(ab′)2 fragments lack the Fc fragment of intact antibody, clear more rapidly from the circulation, and may have less non-specific tissue binding of an intact antibody.
The phrases “selectively binds” and “specifically binds” with the polypeptide refer to a binding reaction that is determinative of the presence of the polypeptide in a heterogeneous population of polypeptides and other biologics. Thus, under designated immunoassay conditions, the specified antibodies (or other binding agent) bound to a particular polypeptide do not bind in a significant amount to other polypeptides present in the sample. Selective binding of an antibody under such conditions may require an antibody that is selected for its specificity for a particular polypeptide. A variety of immunoassay formats may be used to select antibodies that selectively bind with a particular polypeptide. For example, solid-phase ELISA immunoassays are routinely used to select antibodies selectively immunoreactive with a polypeptide. See Harlow and Lane, “Antibodies, A Laboratory Manual” Cold Spring Harbor Publications, New York, (1988), for a description of immunoassay formats and conditions that could be used to determine selective binding.
The antibodies of the present invention may be prepared by any of a variety of methods. For example, cells expressing α2-AP (or fractions, lysates, etc. thereof) can be administered to an animal in order to induce the production of sera containing polyclonal antibodies that are capable of binding α2-AP. In a preferred method, a preparation of α2-AP of the present invention is prepared and purified to render it substantially free of natural contaminants. Such a preparation is then introduced into an animal in order to produce polyclonal antisera of greater specific activity.
The antibodies of the present invention may also be prepared using phage display technology. Methods of preparing antibodies using phage display are known in the art. See, for example, U.S. Pat. No. 5,565,332; Clarkson et al., 1991, Nature 352:624-628; Huse, 1989, Science 246:1275-1281; Kang, 1993, Proc. Natl. Acad. Sci. USA 88:11120-11123; Marks, 1991, J. Mol. Biol. 222:581-597; and McCafferty et al., 1990, Nature 348:552-554.
In some instances, it is desirable to prepare monoclonal antibodies (α2-AP binding molecules) from various hosts. A description of techniques for preparing such monoclonal antibodies may be found in Stites et al., eds., “Basic and Clinical Immunology,” (Lange Medical Publications, Los Altos, Calif., Fourth Edition) and references cited therein, and in Harlow and Lane “Antibodies, A Laboratory Manual” Cold Spring Harbor Publications, New York, 1988. For example, monoclonal antibodies can be prepared using hybridoma technology. In general, such procedures involve immunizing an animal (preferably a mouse) with the antigen or with a cell which expresses the antigen. A preferred antigen is purified α2-AP or a fragment thereof. Suitable cells can be recognized by their capacity to secrete anti-α2-AP antibody. Such cells may be cultured in any suitable tissue culture medium; however, it is preferable to culture cells in Earle's modified Eagle's medium supplemented with 10% fetal bovine serum (inactivated at about 56° C.), and supplemented with about 10 ug/l of nonessential amino acids, about 1,000 U/ml of penicillin, and about 100 ug/ml of streptomycin. The splenocytes of such mice are extracted and fused with a suitable myeloma cell line. The method of somatic cell fusion is described in Galfre, G. and Milstein, C., Meth. Enzymol. 73:3-46 (1981). After fusion, the resulting hybridoma cells are selectively maintained in HAT medium, and then cloned by limiting dilution as described by Wands et al., 1981, Gastroenterology 80:225-232. The hybridoma cells obtained through such a selection are then assayed to identify clones which secrete antibodies capable of binding α2-AP.
Alternatively, additional antibodies capable of binding to the α2-AP antigen may be produced in a two-step procedure through the use of anti-idiotypic antibodies. Such a method makes use of the fact that antibodies are themselves antigens, and that, therefore, it is possible to obtain an antibody which binds to a second antibody. In accordance with this method, α2-AP-specific antibodies are used to immunize an animal, preferably a mouse. The splenocytes of such an animal are then used to produce hybridoma cells, and the hybridoma cells are screened to identify clones which produce an antibody whose ability to bind to the α2-AP-specific antibody can be blocked by the α2-AP antigen. Such antibodies comprise anti-idiotypic antibodies to the α2-AP-specific antibody and can be used to immunize an animal to induce formation of further α2-AP-specific antibodies.
It will be appreciated that Fab and F(ab′)2 and other fragments of the antibodies of the present invention may be used according to the methods disclosed herein. Such fragments are typically produced by proteolytic cleavage, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab′)2 fragments). Alternatively, α2-AP binding fragments can be produced through the application of recombinant DNA technology, through synthetic chemistry, or biotinylation.
Also intended within the scope of the present invention are humanized or chimeric antibodies, produced using genetic constructs derived from hybridoma cells producing the MAbs described above. Humanized antibodies are antibodies in which the framework or other regions of the murine Ab is replaced with the homologous regions of a nonmurine antibody. Chimeric antibodies are antibodies in which the murine constant region has been replaced with a non-murine constant region. Methods for production of chimeric antibodies are known in the art. See, for review: Morrison, Science, 229:1202-1207 (1985); Oi et al., BioTechniques 4:214 (1986); see also, Cabilly et al., U.S. Pat. No. 4,816,567 (Mar. 28, 1989); Taniguchi et al., EP171496 (Feb. 19, 1986); Morrison et al., EP173494 (Mar. 5, 1986); Neuberger et al., WO8601533 (Mar. 13, 1986); Robinson et al., WO 8702671 (May 7, 1987); Boulianne et al., Nature 312:643-646 (1984); and Neuberger et al., Nature 314:268-270 (1985). Methods for production of humanized antibodies are known in the art. See, for example, U.S. Pat. No. 5,585,089; Jones et al., Nature 321:522-525 (1986); and Kettleborough et al., Protein Engineering 4:773-783 (1991).
Also provided in the present invention are single-chain antibodies capable of binding to both (1) human and nonhuman circulating α2-AP and (2) human and nonhuman fibrin crosslinked α2-AP. Methods of making single chain antibodies are well known in the art. See, for example, U.S. Pat. No. 4,946,778; U.S. Pat. No. 5,260,203; U.S. Pat. No. 5,091,513; and U.S. Pat. No. 5,455,030, all of which are herein incorporated by reference. Also intended within the scope of the present invention are variants of the antibodies described above.
Also provided in the present invention are α2-AP binding agent or molecules which are specifically not antibodies or fragments thereof. Screening for such α2-AP binding agents or molecules is routine in the art given the mechanism for binding and conversion of plasmin inhibitor to plasmin substrate described herein. Particular known compounds of interest or libraries of compounds generated through combinatorial chemistry techniques, for example, can be screened for the desired binding and conversion activity. Furthermore, phage display technology can be used to identify peptides, for example, for the desired binding and conversion activity. In general, phage display describes a selection technique in which a library of variants of a peptide or protein is expressed on the outside of a phage virion, while the genetic material encoding each variant resides on the inside (Sidhu et al., 2003, Chembiochem. 4:14; Ferrer et al., 1999, J. Pept. Res.: 54, 32; BouHamdan et al., 1998, J. Biol. Chem. 273: 8009). This creates a physical linkage between each variant protein sequence and the DNA encoding it, which allows rapid partitioning based on binding affinity to a given target molecule by an in vitro selection process called panning (Whaley et al., 2000, Nature, 405, 665). In its simplest form, panning is carried out by incubating a library of phage-displayed peptides with a plate (or bead) coated with the target, washing away the unbound phage, and eluting the specifically bound phage. The eluted phage is then amplified and taken through additional binding/amplification cycles to enrich the pool in favor of binding sequences. After 3-4 rounds, individual clones are characterized by DNA sequencing and ELISA. Many variations of the phage display technology are known to those of skill in the art which can be adapted for purposes of the present invention.
In one embodiment, a phage display peptide library is used such as provided by New England Biolabs (Mass, Mass.). The pre-made random peptide libraries, Ph.D. libraries, have been used for myriad similar applications, including epitope mapping, identification of protein-protein contacts (Rozinov and Nolan, 1998, Chem. Biol. 5:713-28) and enzyme inhibitors (Rodi et al., 1999, J. Mol. Biol. 285:197-203).
As used herein, the term “patient” is intended to be human or nonhuman. Preferably, the patient is human. As used herein the term “administering” refers to various means of introducing a composition into a cell or into a patient. These means are well known in the art and may include, for example, injection; tablets, pills, capsules, or other solids for oral administration; nasal solutions or sprays; aerosols; inhalants; topical formulations; liposomal forms; and the like. As used herein, the terms “effective amount” and “therapeutic amount” refer to an amount that will result in the desired result and may readily be determined by one of ordinary skill in the art.
The compositions of the present invention (e.g., plasmin activity-promoting) may be formulated for various means of administration. As used herein, the term “route” of administration is intended to include, but is not limited to subcutaneous injection, intravenous injection, intraocular injection, intradermal injection, intramuscular injection, intraperitoneal injection, intratracheal administration, epidural administration, inhalation, intranasal administration, oral administration, sublingual administration, buccal administration, rectal administration, vaginal administration, and topical administration. The preparation of an aqueous composition that contains a peptide, antibody or antibody fragment, antisense nucleic acid, receptor decoy, ribozyme, sense polynucleotide, double stranded RNA, RNAi, aptamer, or small molecule agonist, as an active ingredient will be known to those of skill in the art in light of the present disclosure. Typically, such compositions can be prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for using to prepare solutions or suspensions upon the addition of a liquid prior to injection can also be prepared; and the preparations can also be emulsified.
The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations including sesame oil, peanut oil or aqueous propylene glycol; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form should be sterile and fluid to the extent that syringability exists. It should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms, such as bacteria and fungi.
The compositions of the present invention (e.g., plasmin activity-promoting) can be formulated into a sterile aqueous composition in a neutral or salt form. Solutions as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Pharmaceutically acceptable salts, include the acid addition salts (formed with the free amino groups of the protein), and those that are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, trifluoroacetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine, and the like.
Suitable carriers include solvents and dispersion media containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. In many cases, it will be preferable to include isotonic agents, for example, sugars, or sodium chloride. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and/or by the use of surfactants.
Under ordinary conditions of storage and use, all such preparations should contain a preservative to prevent the growth of microorganisms. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate, and gelatin.
Prior to or upon formulation, the compositions of the present invention (e.g., plasmin activity-promoting) should be extensively dialyzed to remove undesired small molecular weight molecules, and/or lyophilized for more ready formulation into a desired vehicle, where appropriate. Sterile injectable solutions are prepared by incorporating the active agents in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as desired, followed by filter sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle that contains the basic dispersion medium and the required other ingredients from those enumerated above.
In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze-drying techniques that yield a powder of the active ingredient, plus any additional desired ingredient from a previously sterile-filtered solution thereof.
Suitable pharmaceutical compositions in accordance with the invention will generally include an amount of the active ingredient admixed with an acceptable pharmaceutical diluent or excipient, such as a sterile aqueous solution, to give a range of final concentrations, depending on the intended use. The techniques of preparation are generally well known in the art as exemplified by Remington's Pharmaceutical Sciences, 16th Ed. Mack Publishing Company, 1980, incorporated herein by reference. It should be appreciated that for human administration, preparations should meet sterility, pyrogenicity, and general safety and purity standards as required by FDA Office of Biological Standards.
In some embodiments, the methods further comprise administering to the patient an agent that facilitates the degradation of fibrin, that prevents fibrin formation, or that interferes with platelet formation. In certain embodiments, the agent is selected from the group consisting of plasmin, staphylokinase, streptokinase, prourokinase, urokinase, tissue-type plasminogen activator, vampire bat plasminogen activator, heparin, hirudin, activated protein C, ticlopidine, aspirin, clopidigrel, and an inhibitor of glycoprotein IIb/IIIa function. Such thrombolytic agent may be administered separately or co-administered with the disclosed agent that increases plasmin activity.
Additional methods are provided for screening for a compound or molecule which increases fibrinolysis, comprising determining whether a compound or molecule binds to a binding site on α2-antiplasmin which increases the conversion of α2-antiplasmin from an inhibitor to a plasmin substrate, wherein the compound or molecule is not an antibody, thereby identifying a compound which increases fibrinolysis. In certain embodiments, the binding site comprises a serpin domain which is not a reactive center loop. In other embodiments, the binding site comprises a portion of the amino-terminus of α2-antiplasmin. In certain of those embodiments, the binding site has an amino acid sequence of LGNQEPGGQTALKSPPGVCS (SEQ ID NO:1). In other embodiments, the binding site is adjacent to the site at which α2-antiplasmin cross-links to fibrin. The binding of the compound to the binding site on α2-antiplasmin is determined, in some instances, by a standard binding assay.
Pharmaceutical compositions are provided that comprise an effective amount of a compound or molecule used in the disclosed methods for increasing fibrinolysis or identified by the disclosed methods for identifying a compound or molecule that increases fibrolysis. These pharmaceutical compositions are useful for treating a patient that has a disease or condition selected from the group consisting of myocardial infarction, thrombosis, ischemic stroke, and pulmonary embolism.
It should also be understood that the foregoing relates to preferred embodiments of the present invention and that numerous changes may be made therein without departing from the scope of the invention. The invention is further illustrated by the following examples, which are not to be construed in any way as imposing limitations upon the scope thereof. On the contrary, it is to be clearly understood that resort may be had to various other embodiments, modifications, and equivalents thereof, which, after reading the description herein, may suggest themselves to those skilled in the art without departing from the spirit of the present invention and/or the scope of the appended claims.
Materials
Proteins and reagents were obtained from the following suppliers: human Lys-plasmin, S-2251 (H-D-valyl-L-leucyl-L-lysine-p-nitroanilide dihydrochloride), S-2288 (H-D-I-isoleucine-P-proline-R-arginine-p-nitroanilide dihydrochloride), Chromogenix; native human α2-AP, Calbiochem; biotinylated peptides: α2-AP1-12, α2-AP1-32 (HPLC purified>95%), Advanced Chemtech; urokinase, American Diagnostica.; t-PA, BioResponse; bovine thrombin, pork trypsin, MUGB, 4-methylumbelliferyl p-guanidinobenzoate, Sigma; fresh-frozen human plasma pooled from random donors, Massachusetts General Hospital Blood Bank; [125I]NaI, NEN-Dupont; Fold-It Screen system, Hampton Research.
Recombinant Proteins
The α2-AP sequence was modeled on the serpin structural coordinates (Huntington et al., 2000, Nature 407:923-926) using a ClustalW program (www.ch.embnet.org). Mouse α2-AP sequence was cloned from mouse IMAGE cDNA clones (Open Biosystems) using GTCATATGGCCCAGCAGAAGCTG (SEQ ID NO:2) and CTCGAGCTGGCAGGGGAGGAC (SEQ ID NO:3) primers. Human α2-AP was chimerized with the corresponding sequences of mouse α2-AP by PCR with overlap extension. The structural domains of α2-APs are shown in
PCR products were sequenced and ligated into the pET-16b vector (kind gift of Dr. G. Matsueda, Princeton, N.J.) for bacterial expression in BL21 cells. The rα2-APs were purified as His-fusion proteins from the insoluble pellets of the bacterial lysate and refolded using Fold-It Screen system. Finally all rα2-APs were dialyzed in TBS buffer (50 mM Tris, 100 mM NaCl, pH 7.4), analyzed by SDS-PAGE. The activity of the refolded protein was determined by assays with Lys-plasmin. Recombinant micro-plasminogen was produced as described (Reed et al., 1999, Proc. Natl. Acad. Sci. (USA) 96:8879-8883), activated to micro-plasmin by catalytic amounts of urokinase coupled to protein-A sepharose, and titrated by a fluorogenic substrate as described Turner et al., 2002 J Biol Chem. 277:33068-33074.
Antibodies
MAbs were generated by somatic cell fusion, selected for specific binding to α2-AP, cloned and purified as described (Reed, G. L. Functional characterization of monoclonal antibody inhibitors of alpha 2-antiplasmin that accelerate fibrinolysis in different animal plasmas. Hybridoma 1997; 16: 281-286). The serotypes of these MAbs were: 49 (Igγ2aK), 77(Igγ2aK), RWR (Igγ1aK). Polyclonal antibodies were generated against peptides that mimic the NH2-terminus (NQEQVSPLTLLKLG) (SEQ ID NO:16) and COOH-terminus (GDKLFGPDLKLVPPMEEDYPQFGSPK) (SEQ ID NO:17) as described (Reed et al. 1992, Thromb Haemost 68:315-320).
Protein Radiolabeling
Native human α2-AP was radioiodinated to a specific activity of 1.8×106 cpm/μg (Lukacova et al., 1991, Biochemistry 30:10164-10170).
Binding Assays
Binding of Native α2-AP to MAbs:
MAbs (RWR, 49, 77 and Dig-control) (3 μg/ml; 50 μl) were absorbed on microtiter plates for 1 h. Nonspecific binding was blocked. Then 125I-α2-AP (0.08-500 nM; 50 μl) was added. After 1 h. the bound 125I-α2-AP was γ-counted.
Direct Binding of MAbs to Various α2-AP Structures:
Various rα2-APs, or α2-AP peptides (α2-AP1-12 and α2-AP1-32) (5 μg/ml; 50 μl) or no protein (control) were absorbed on microtiter plates for 1 h. After blocking and washing, MAbs (RWR, 49, 77 and Dig-control) (3 μg/ml; 50 μl) were added for 1 h. After additional washing, bound MAb was detected by 125I-F(ab)′ goat anti-mouse Ig (100,000 cpm/50 μl) followed by γ-counting.
Comparative Binding of MAbs to Native and Recombinant α2-AP.
MAbs 49 or 77 (3 μg/ml; 50 ul) were absorbed on plates for 1 h. Nonspecific binding was blocked. Mixture of 125I-α2-AP (12 nM; 25 μl) with varying amounts of unlabeled native or recombinant α2-AP (0-1000 nM; 25 μl) were added to the microtiter plate for 1 h. Then plates were washed and bound 125I-α2-AP was γ-counted.
The Binding of MAbs to Native α2-AP and α2-AP-Plasmin Complex:
MAbs (RWR, 77, 49 or Dig-control) (3 μg/ml; 50 μl) were absorbed on plates for 1 h. Nonspecific binding was blocked. Human plasmin (0 and 350 nM) was pre-incubated with 125I-α2-AP (75 nM) for 30 min at 25° C. Then 50 μl of this mixture was added to the microtiter plates with coated MAbs for 1 h. After additional washing bound 125I-α2-AP was γ-counted.
Inhibition Studies
Native α2-AP (1.8 μM) was pre-incubated with or without of MAbs (49, 77, Dig-control; 1.8 μM or RWR 1.8 μM and 18 μM) for 60 min at 4° C. The fast inhibition of plasmin, micro-plasmin and trypsin was examined by a continuous method as described (Wiman, B. and Collen, D. On the kinetics of the reaction between human antiplasmin and plasmin. Eur J Biochem 1978; 84: 573-578). The serine protease (20 nM) was added to a cuvette containing S-2251 (500 μM) in 300 μl of TBS buffer, and the change in absorbance at 405 nm was recorded at 0.1-min intervals prior to and after the addition of 10 μl of α2-AP (1.8 μM) or preformed α2-AP/MAb complex. The final concentration of α2-AP in the cuvette was 60 nM. The percentage of residual protease activity was calculated from the initial value (defined as 100%). The inhibition constant (i.e., k1, the rate constant of reversible complex formation) was determined as described (Turner et al., 2002, J Biol. Chem. 277:33068-33074).
To investigate how the MAbs affected the ability of α2-AP to inhibit plasmin-catalyzed hydrolysis, plasmin (3 nM) was added to cuvettes containing S-2251 (5001.1M) with equimolar mixtures of α2-AP and MAb49 (84 nM) in TBS buffer as described (Rijken et al., 1988, Biochem J 255:609-615). The change in absorbance at 405 nm was recorded.
Measurement of Stoichiometry of Inhibition
The stoichiometry of inhibition (SI=1+ks/ki) represents the partition ratio of the serpin for the suicide inhibitory vs. the substrate pathway (Schechter and Plotnick, 2004, Methods 32:159-168). To determine the effect of MAbs on the inhibitory mechanism of α2-AP, SI values were calculated as a ratio of the number of moles of α2-AP required for inactivation of one mole of plasmin in the presence and absence of the MAbs. Equimolar complexes (0-750 nM) of native α2-AP with RWR, 49 or 77 MAbs were prepared and titrated with the same amount of plasmin (10 nM) using S-2251 substrate (500 μM). SI values were defined as the x-intercept of the graph of residual plasmin activity versus [α2-AP]/[plasmin] ratio as described (Schechter and Plotnick, 2004, Methods 32:159-168).
Western Blot Analysis of α2-AP Cleavage
Native human α2-AP (230 nM) was incubated with micro-plasmin (30 nM) in the absence of MAbs for 60 min at 25° C. In parallel studies, micro-plasmin (30 nM) was added to a premixed human α2-AP (230 nM) with corresponding amounts of MAbs (RWR, 2.5 μM; 49MAb, 500 nM; 77MAb, 500 nM or Dig-control, 2.5 μM) and incubated for 60 min at 25° C. The samples were applied on a SDS-PAGE under reducing conditions and electroblotted. The blots were blocked, treated with rabbit polyclonal antibody to the amino-terminal or to the carboxy-terminal residues of α2-AP, and examined using a phosphorimager system (Amersham, UK).
Clot Lysis
Human plasma (250 μl) was pre-incubated with MAbs (0 or 80 μg) for 15 min at 37° C. Then Lys-plasmin (200 nM) or t-PA (0.1-8 nM) was added together with thrombin (2 U/ml) and CaCl2 (1 mM) to a final volume of 500 μl. The clot turbidity (A405 nm) was monitored at 37° C. The maximum and minimum absorbance values for turbidity were defined as equal to 0 and 100% clot lysis respectively.
Effect of MAbs on the Inhibition of Plasmin by α2-AP
α2-AP (60 nM) rapidly inhibited plasmin (20 nM) activity within seconds (
Effect of MAbs on the Ability of α2-AP to Inactivate Other Serine Proteases
The fast inhibition of plasmin by α2-AP involves interactions between the kringle domains of plasmin and Lys346 and Lys452 in the unique C-terminal extension of α2-AP (Wiman and Collen, 1978, Eur. J. Biochem. 84:573-578; Frank et al., 2003, Biochemistry 42:1078-1085). However, α2-AP also inhibits proteases that do not contain kringles (e.g., micro-plasmin and trypsin, an archetypal serine protease). In the absence of MAb, or in the presence of the control (Dig) MAb, α2-AP (60 nM) completely quenched the activity of all three enzymes tested (20 nM;
MAbs Accelerate Plasma Clot Lysis Induced by Plasmin and t-PA
Fibrin is the physiological substrate of plasmin, therefore inactivation of α2-AP should preserve the activity of plasmin and enhance fibrinolysis in human plasma clots. Plasmin alone, or in the presence of the control Dig-MAb, did not initiate significant clot lysis (
The Structural Requirements for the Binding of MAbs to α2-AP
To further understand the difference in the action of these MAbs we examined their binding to α2-AP. RWR, 49 and 77 bound to active 125I-α2-AP in solution in a dose-dependent manner. The apparent affinity of 49 (Kd=1.7±0.3 nM) and 77 (Kd=2.5±0.5 nM) for 125I-α2-AP was 5-8 fold higher than was the affinity of RWR (Kd=13±4 nM) (
Recombinant α2-AP chimeras were created to examine the structural elements in α2-AP recognized by these MAbs. First we established that MAbs 49 and 77 bound to native human α2-AP and to recombinant human α2-AP (hα2-AP1-452) with comparable binding avidity (
Immunoblotting experiments established that MAbs 49 and 77 bound to α2-AP structures containing the human serpin domain such as human rα2-AP1-452, rα2-APΔ405-452, or the NTm-Serh-CTm or NTm-Serh chimeras (
Influence of MAbs on the Interaction of α2-AP with Plasmin
As noted early (
To confirm these findings we examined the plasmin-α2-AP interaction by SDS-PAGE and immunoblotting. Previous studies have shown that when excess α2-AP is incubated with plasmin, there are 5 forms of α2-AP detectable: α2-AP-plasmin complex, native α2-AP, cleaved α2-AP (relative mass (Mr) of ˜55 kDa) and two smaller α2-AP fragments of Mr˜8 kDa and Mr˜6 kDa (Wiman and Collen, 1978, Eur J Biochem 84:573-578; Holmes et al., 1987, Science 238:209-211). Consistent with these data, incubation of human micro-plasmin with excess α2-AP (with or without a control MAb) lead to the formation of a stable covalent α2-AP-micro-plasmin complex (
These experiments reveal that MAbs that bind to different structural elements in the α2-AP molecule convert α2-AP from a plasmin inhibitor to a plasmin substrate. In solutions containing α2-AP, these MAbs significantly preserve the activity of plasmin. This explains the ability of these MAbs to markedly amplify fibrinolysis in plasma clots induced by plasminogen activators (Reed et al., 1990, Proc Natl Acad Sci USA 87:1114-1118).
When compared with RWR, both MAbs 49 and 77 were more potent α2-AP inhibitors and had greater effects on fibrinolysis than RWR. MAbs 49 and 77 bound preferentially, in a conformation-selective manner, to the serpin domain of α2-AP. Although MAbs 49 and 77 potently inhibited the interaction of plasmin with active α2-AP, they could bind as well to the α2-AP/plasmin covalent complex, despite the fact that covalent complex formation results in the cleavage of the RCL and would be predicted to induce a substantial loss (˜40%) in the structure of the serpin (Huntington et al., 2000, Nature 407:923-926). Thus the interaction of MAbs 49 and 77 with α2-AP did not require an intact reactive center loop, and did not affect the interaction of the plasmin active site with the Arg364-Met365 in P1-P1′.
RWR was significantly less potent (>10-fold) than 49 and 77 as an inhibitor of α2-AP and was less potent for enhancing fibrin degradation by plasmin or t-PA in human plasma clots. RWR had less apparent binding affinity for 125I-α2-AP in solution-phase assays but it bound much more avidly in solid-phase assays to immobilized α2-AP and was the only antibody that bound to fully denatured forms of α2-AP. Epitope mapping experiments showed that RWR bound to a continuous NH2-terminal sequence (13-32) near the site at which α2-AP(Gln2) is crosslinked to fibrin. This site would be predicted from other serpin structures to be at some distance from the ‘active’ site of α2-AP (Lee et al., 2000, J Biol Chem 275:37382-37389). The fact that RWR inhibited α2-AP activity indicates that contact interactions of the MAb with the NH2-terminus α2-AP, at sites distinct from the known contact sites of α2-AP with plasmin, are sufficient to block the action of this serpin. Unfortunately, because of a paucity of structural data, the spatial relationships between the NH2-terminus and the serpin domain of α2-AP are unknown. It is interesting to note that the NH2-terminus of α2-AP is a functionally distinct domain that contains the residues (Gln2 and Gln21) that activated factor XIII uses to crosslink α2-AP to fibrin (Lee et al., 2000, J Biol Chem 275:37382-37389).
Although there is little known about the 3-dimensional structure of α2-AP, studies of related molecules have shown that serpin structure and function is more complex and dynamic than had been appreciated. The high affinity interactions of an MAb with a serpin such as α2-AP may act to perturb serpin function through several mechanisms including 1) accelerating the conversion of the serpin from an active to latent form (Verhamme et al., 1999, J Biol Chem 274:17511-17517); 2) preventing the formation of a Michaelis inhibitory complex between the serpin and protease (Bijnens et al., 2001, J Biol Chem 276:44912-44918); 3) promoting the dissociation the intermediate acyl-protease-serpin complex leading to hydrolysis of the serpin and liberation of active protease (Komissarov et al., 2002, J Biol Chem 277:43858-43865); 4) altering the ability of the serpin to bind to other regulatory molecules (Ngo et al., 2001, J Biol Chem 276:26243-26248). Our results suggest that MAbs 49 and 77 act through the 3rd mechanism to convert α2-AP to a plasmin substrate. The interactions of α2-AP with MAbs 49 and 77 almost completely (98-99%) shift the reaction to the substrate pathway and prevent the formation of the final covalent acyl-protease-serpin complex. A similar mechanism has been described for the serpin-protease interaction between PAI-1 and t-PA where MAbs convert PAI-1 from an inhibitor into substrate (Komissarov et al., 2002, J Biol Chem 277:43858-43865). It is interesting to note that these α2-AP MAbs simulate a genetic cause of α2-AP deficiency which converts α2-AP to a plasmin substrate by a point mutation (Holmes et al., 1987, Science 238:209-211). Given that experimental α2-AP deficiency or α2-AP neutralization markedly increase the concentration of active plasmin, enhances fibrinolysis and protects against experimental ischemic stroke, this type of inhibition may have therapeutic value in cardiovascular diseases (Butte et al., 1997, Circulation 95:1886-1891; Reed et al., 1988, Trans Assoc Am Physicians 101:250-256; Reed et al., 1990, Circulation 82:164-168).
In addition, in mice, α2AP-deficiency also has the desirable property of accelerating wound healing, perhaps through an increase in the release of vascular endothelial growth factor. Inhibitors of mouse α2AP accelerated the rate of liver healing after injury when compared to controls. Deficiency of α2AP also decreased arteriosclerosis (neointimal proliferation) after vascular injury.
For the purposes of this application, one of the most profound and intriguing results of α2AP deficiency or depletion is that it markedly reduced ischemic stroke size, even if there is no reperfusion. In contrast, TPA increased stroke size—which may be attributable to TPA's neurotoxic effects.
When many new therapies are developed, there is no indication of how they might work in humans prior to clinical trials. However, the data on humans with α2AP deficiency provides a compelling argument that transient α2AP deficiency would be safe and effective for dissolving clots. There is additional data in mice that complete α2AP deficiency is safe and, that α2AP-deficient mice can be safely treated with TPA without increasing bleeding risk. Moreover, α2AP deficiency reduces ischemic stroke size, reduces mortality from experimental pulmonary embolism, protects against arteriosclerosis, and accelerates wound healing.
This application is a continuation of U.S. application Ser. No. 12/597,311 filed Oct. 23, 2009, allowed, which is claims priority to PCT Application No. PCT/US2008/061662 filed Apr. 25, 2008, which claims priority to U.S. Provisional Application No. 60/913,913 filed Apr. 25, 2007, the entire contents of which are hereby incorporated by reference in their entirety.
This invention was made, in part, with Government support under National Institutes of Health Grant HL-058496 to G.L.R. Accordingly, the United States Government has certain rights in this invention.
Number | Name | Date | Kind |
---|---|---|---|
6114506 | Reed et al. | Sep 2000 | A |
7309774 | McKee et al. | Dec 2007 | B2 |
9150903 | Reed | Oct 2015 | B2 |
20020086025 | Reed | Jul 2002 | A1 |
20030017147 | Reed | Jan 2003 | A1 |
20030031664 | Reed | Feb 2003 | A1 |
Number | Date | Country |
---|---|---|
0272609 | Jun 1988 | EP |
9961072 | Dec 1999 | WO |
2004042000 | May 2004 | WO |
2006005583 | Jan 2006 | WO |
Entry |
---|
Reed et al., 1990, Inhibition of Clot-Bound —2-Antiplasmin Enhances In Vivo Thrombolysis, Circulation, 82: 1: 164-168. |
Mimuro et al., 1987, Monoclonal Antibodies to Discrete Regions in —2-Plasmin Inhibitor, Blood, 2: 446-453. |
Anonick et al., 1991, “Soluble Fibrin Preparations Inhibit the Reaction of Plasmin with Alpha-2-Macroglobulin: Comparison with Alpha-2-Antiplasmin and Leupeptin,” Biochem. J., vol. 275, pp. 53-59. |
Holmes et al., 1987, “Characterization of Recombinant Human cu2-Antiplasmin and of Mutants Obtained by Site-Directed Mutagenesis of the Reactive Site,” Biochemistry, vol. 26, p. 5133. |
Potempa et al., 1988, “Alpha-2-Antiplasmin: A Serpin with Two Separate but Overlapping Reactive Sites,” Science, vol. 241, No. 4866, pp. 699-700 (abstract only). |
International Search Report for PCT/US08/061662 dated Aug. 18, 2008 (1 page). |
Sazonova et al., 2007, “Fibrinolysis is Amplified by Converting alpha 2-Antiplasmin from a Plasmin Inhibitor to a Substrate,” Journal of Thrombosis and Haemostasis, 5:2087-2904. |
Number | Date | Country | |
---|---|---|---|
20160039943 A1 | Feb 2016 | US |
Number | Date | Country | |
---|---|---|---|
60913913 | Apr 2007 | US |
Number | Date | Country | |
---|---|---|---|
Parent | 12597311 | US | |
Child | 14872776 | US |