Chloroplast transformation in green microalgae relies on the use of antibiotics as selectable marker for the isolation of transformants. For example, a streptomycin resistance cassette as a selectable marker is commonly used. However, isolation of transformants based on antibiotic resistance selectable marker is subject to various pitfalls: (i) the method is subject to isolating multiple false positives; (ii) there is a low efficiency of transformation, or co-transformation based on streptomycin and transgene transformation; (iii) there is difficulty in attaining transgenic chloroplast DNA copy segregation (homoplasmy) under antibiotic resistance pressure; and (iv) there are environmental and monetary difficulties in using the selectable marker (antibiotics) under mass culture and commercial production conditions.
All of the above pitfalls are eliminated with the “recovery of function” selectable marker of the invention. Superior transformation results (100% positive transformants) are obtained with this “recovery of function” method, than with the streptomycin-based transformation of C. reinhardtii that is currently used in the field. High yield of transgene expression is achieved with this method. Moreover, high yield of product generation was achieved under defined conditions with the “recovery of function” method, i.e. 30-100 fold better than those achieved with traditional approaches.
This invention is based, in part on the discovery that recovery of photosynthetic function can be used as a selectable marker, without antibiotic selection, in the transformation of microalgal chloroplasts. This method alleviates the need to use antibiotics for transformant strain selection, results in very low levels, e.g., (0%), false positives during screening, and further ensures a directed segregation of chloroplast DNA so as to unequivocally achieve homoplasmy in all copies of the transformant chloroplast DNA, with a concomitant elimination of wild type DNA copies. This invention also permits the generation of transgenic microalgal strains that do not contain antibiotic resistance gene(s), thus alleviating concerns of genetically engineered organisms in industrial application.
As used herein, the term “photoautotrophic growth conditions in minimal media” refers to culture conditions in which the carbon source for microalgal cell growth is provided by photosynthesis.
In the context of this invention, a “photosynthetic nucleic acid” or “photosynthetic gene” or “photosynthetic polynucleotide” refers to a gene that plays an essential role in photosynthesis such that inactivation of the gene, so that no functional protein product of the gene is generated, results in the loss of the ability to grow in the absence of media supplementation with an organic carbon source, e.g., acetate. Thus, mutation of such a photosynthetic gene is lethal in the absence of an external organic carbon source present in the growth media. In the present invention, a photosynthetic polynucleotide or a fragment thereof is introduced into a microalgal cell that has a lethal mutation in that photosynthetic gene. The gene introduced into the cell can encode the photosynthesis protein itself, e.g., it may be a cDNA sequence or chloroplast genomic DNA sequence that encodes the photosynthesis protein, or it may be a fragment of the photosynthetic gene that provides for restoration of function, e.g., through homologous recombination, once the polynucleotide is introduced into the mutant algal cells.
As used herein, microalgae refers to green microalgae and blue-green microalgae (cyanobacteria). Examples of green microalgae include Chlamydomonas reinhardtii, Scenedesmus obliquus, Chlorella vulgaris, Botryococcus braunii, Botryococcus sudeticus, Dunaliella salina, and Haematococcus pluvialis. Examples of cyanobacteria include Synechocystis sp. and Synechococcus sp.
The terms “nucleic acid” and “polynucleotide” are used synonymously and refer to a single or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases read from the 5′ to the 3′ end. A nucleic acid of the present invention will generally contain phosphodiester bonds, although in some cases, nucleic acid analogs may be used that may have alternate backbones, comprising, e.g., phosphoramidate, phosphorothioate, phosphorodithioate, or O-methylphosphoroamidite linkages (see Eckstein, Oligonucleotides and Analogues: A Practical Approach, Oxford University Press); and peptide nucleic acid backbones and linkages. Other analog nucleic acids include those with positive backbones; non-ionic backbones, and non-ribose backbones. Thus, nucleic acids or polynucleotides may also include modified nucleotides, that permit correct read through by a polymerase. “Polynucleotide sequence” or “nucleic acid sequence” includes both the sense and antisense strands of a nucleic acid as either individual single strands or in a duplex. As will be appreciated by those in the art, the depiction of a single strand also defines the sequence of the complementary strand; thus the sequences described herein also provide the complement of the sequence. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses variants thereof (e.g., degenerate codon substitutions) and complementary sequences, as well as the sequence explicitly indicated. The nucleic acid may be DNA, both genomic and cDNA, RNA or a hybrid, where the nucleic acid may contain combinations of deoxyribo- and ribo-nucleotides, and combinations of bases, including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine, isoguanine, etc
The phrase “a nucleic acid sequence encoding” refers to a nucleic acid which contains sequence information for a structural RNA such as rRNA, a tRNA, or the primary amino acid sequence of a specific protein or peptide, or a binding site for a trans-acting regulatory agent. This phrase specifically encompasses degenerate codons (i.e., different codons which encode a single amino acid) of the native sequence or sequences that may be introduced to conform with codon preference in a specific host cell. In the context of this invention, the term “coding region” when used with reference to a nucleic acid reference sequence refers to the region of the nucleic acid that encodes the protein.
A polynucleotide sequence is “heterologous to” a second polynucleotide sequence if it originates from a foreign species, or, if from the same species, is modified by human action from its original form. For example, a promoter operably linked to a heterologous coding sequence refers to a coding sequence from a species different from that from which the promoter was derived, or, if from the same species, a coding sequence which is different from any naturally occurring allelic variants.
A “transgene” is a sequence encoding a protein of interest that is to be expressed in microalgal cells. A “transgene” is heterologous to the host microlagal cells
An “expression cassette” refers to a nucleic acid construct, which when introduced into a host cell, results in transcription and/or translation of a RNA or polypeptide, respectively. Often such an expression cassette comprises a transgene operatively linked to a promoter; however, in some embodiments, expression of a transgene present in the expression cassette may be driven by an endogenous promoter.
In the case where the inserted polynucleotide sequence is transcribed and translated to produce a functional polypeptide, one of skill will recognize that because of codon degeneracy a number of polynucleotide sequences will encode the same polypeptide. These variants are specifically covered by the term “transgene polynucleotide sequence” or “transgene”.
The term “isolated”, when applied to a nucleic acid or protein, denotes that the nucleic acid or protein is essentially free of other cellular components with which it is associated in the natural state. It is preferably in a homogeneous state and may be in either a dry or aqueous solution. Purity and homogeneity are typically determined using analytical chemistry techniques such as polyacrylamide gel electrophoresis or high performance liquid chromatography. A protein that is the predominant species present in a preparation is substantially purified. In particular, an isolated gene is separated from open reading frames that flank the gene and encode a protein other than the gene of interest.
Achieving homoplasmy” refers to a quantitative replacement of most, e.g., 70% or greater, or typically all, wild-type copies of the microalgal DNA in the cell with the transformant DNA copy that carries the transgene. This is normally attained over time, under the continuous selective pressure conditions applied, and entails the gradual replacement during growth of the wild-type copies of the DNA with the transgenic copies. Achieving homoplasmy is typically verified by quantitative amplification methods such as genomic-DNA PCR using primers and/or probes specific for the wild type copy of the microalgae chloroplast DNA. Transgenic DNA is typically stable under homoplasmy conditions and present in all copies of the chloroplast DNA.
The invention is based, in part, on the discovery that a selection procedure based on restoration of chloroplast function can be used to select transformed microalgal cells into which a transgene of interest has been introduced. The microalgae cells that are transformed in accordance with the methods of the invention have a defective chloroplast gene involved in photosynthesis such that the cells cannot survive in the absence of an external carbon source. Such microalgae cells are transformed with an expression cassette encoding a gene that restores photosynthetic ability. The expression cassette also encodes a transgene of interest to be expressed by the microalgae. Selection of transformants is performed in the absence of antibiotic selection.
The invention employs various routine recombinant nucleic acid techniques. Generally, the nomenclature and the laboratory procedures in recombinant DNA technology described below are those well known and commonly employed in the art. Many manuals that provide direction for performing recombinant DNA manipulations are available, e.g., Sambrook & Russell, Molecular Cloning, A Laboratory Manual (3rd Ed, 2001); and Current Protocols in Molecular Biology (Ausubel et al., eds., 1994-1999).
Examples of microalga chloroplast DNA mutants and strains that can be utilized in the context of this invention, i.e., using restoration of chloroplast photosynthetic function for selection of transformants expressing a transgene of interest and to achieve DNA copy segregation (achieving homoplasmy), are those mutants that have a defect in, e.g., a point mutation, deletion, etc in a chloroplast gene that encodes a protein that is important for photosynthesis, thereby rendering them unable to grow autotrophically. Thus these microalgal mutants are photosynthesis lethal mutants. Examples of mutants in which chloroplast genes essential for photosynthesis are missing include:
Photosynthetic genes are known in the art. A photosynthetic nucleic acid sequence for use in the invention that is introduced into the mutant algal cells (that are mutant in the photosynthetic gene) can be a partial sequence or can encode functional protein itself. For example, a partial nucleotide sequence can be employed where recombination with the endogenous gene restores the ability of the gene to produce a functional protein.
In other embodiments, the photosynthetic gene may encode the functional protein.
As appreciated by one of skill in the art, expression constructs can be designed taking into account such properties as codon usage frequencies of the organism in which the expression construct nucleic acid is to be expressed. Codon usage frequencies can be tabulated using known methods (see, e.g., Nakamura et al. Nucl. Acids Res. 28:292, 2000). Codon usage frequency tables, including those for microalgae and cyanobacteria, are also available in the art (e.g., in codon usage databases of the Department of Plant Genome Research, Kazusa DNA Research Institute at the www site kazusa.or.jp/codon.
In some embodiments, an expression vector for use in the invention comprises an RbcL cDNA, e.g., a cDNA from a green microalgae such as a Chlamydomonas that encodes a functional RbcL protein, and an expression cassette comprising an RbcL gene promoter, e.g., RbcL gene accession number J01399); the first 90 nucleotides of the RbcL coding sequence, a microalgal chloroplast codon-optimized ADH gene and an RbcL terminator. The first 90 nucleotides of the RbcL coding sequence serves as a chloroplast expression enhancement sequence. In some embodiments, the chloroplast expression enhancement sequence comprises at least 30, 60, 75, 120, 150, or 180, or more nucleotides of the RbcL coding sequence. Upon introduction, double homologous recombination restores expression of functional Rubisco such that the microalgae can perform autotrophic photosynthesis. RbcL genes are known in the art. In some embodiments, the expression vector encodes an RbcL protein having at least 95% identity, or at least 96%, at least 97%, at least 98%, or at least 99% identity to the RbcL protein sequence of accession number AAA84449.1. In typical embodiments, very low levels, (e.g., (0%, 1%, 2%, or fewer), false positives during screening.
In some embodiments, the transgene encodes a yeast enzyme, e.g., a yeast alcohol dehydrogenase. In some embodiments, the transgene is a yeast ADH1 gene, e.g., accession no. YOL086C) that has been codon optimized for expression in microalgae. In some embodiments, pyruvate decarboxylase is expressed, e.g., along with an alcohol dehydrogenase. Thus, insome embodiments, the systems of the invention is used to produce ethanol. In some embodiments, expression of a transgene, e.g., an alcohol dehydrogenase and/or pyruvate decarboxylase results is increased about 30-100-fold relative to traditional methods, e.g., employing antibiotic selection.
In some embodiments, the transgene is an isoprene synthase gene, e.g., poplar or kudzu isoprene synthase that has been codon optimized for expression in microalgae. In some embodiments, expression of isoprene synthase is increased about 30-100-fold relative to traditional methods, e.g., employing antibiotic selection.
Cell transformation methods for cyanobacteria are well known in the art (Wirth, Mol Gen Genet. 1989 March; 216(1):175-7; Koksharova, Appl Microbiol Biotechnol 2002 February; 58(2): 123-37; Thelwell). Transformation methods and selectable markers for use in bacteria are well known (see, e.g., Sambrook et al., supra).
In microalgae, e.g., green microalgae, the nuclear, mitochondrial, and chloroplast genomes are transformed through a variety of known methods, including by microparticle bombardment, or using a glass bead method (see, e.g., Kindle, J Cell Biol 109:2589-601, 1989; Kindle, Proc Natl Acad Sci USA 87:1228-32, 1990; Kindle, Proc Natl Acad Sci USA 88:1721-5, 1991; Shimogawara, Genetics 148:1821-8, 1998; Boynton, Science 240:1534-8, 1988; Boynton, Methods Enzymol 264:279-96, 1996; Randolph-Anderson, Mol Gen Genet 236:235-44, 1993).
Chlamydomonas reinhardtii strain CC2653 (Spreitzer et al., 1985), obtained from the Chlamydomonas Center (<http://www.chlamy.org>), was employed as the recipient strain for chloroplast transformation purposes. Strain CC2653 is a chloroplast mutant that contains a point mutation in the 5′ end of the RbcL gene coding region, causing an early termination of the RbcL protein synthesis (Spreitzer et al., 1985). In consequence, lack of the RbcL large subunit of the enzyme ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco, EC4.1.1.39) led to the absence of both the chloroplast-encoded RbcL large subunit, and the nuclear-encoded RbcS small subunit of the Rubisco. Therefore, strain CC2653 is deficient in Rubisco and unable to grow photo-autotrophically. It requires acetate for growth, and is light sensitive. This strain was cultivated in a TRIS-Acetate-Phosphate (TAP) medium, pH 7.0 (Gorman and Levine, 1965), under dim light or in the dark. For other Chlamydomonas strains, cells were grown either photo-mixotrophically in TAP medium, or photo-autotrophically in HS minimal medium (Sueoka, 1960). Cells in liquid culture were grown in Erlenmeyer flasks at 24° C. with shaking under continuous illumination at approximately 50 μmol photons m−2 s−1. Culture density was measured by cell counting using a Neubauer ultraplane hemacytometer and a BH-2 light microscope (Olympus, Tokyo).
Plasmid P-67 containing the C. reinhardtii chloroplast DNA EcoRI 14 fragment (5.8 kb) was acquired from the Chlamydomonas Center, and used as the starting material for the construction of the expression vector. This EcoRI 5.8 kb DNA contains the PsaB, tRNAG, and RbcL genes, as well as the 5′ end of the atpA gene (
The ADH gene sequence for the transformation of the Chlamydomonas chloroplast was designed on the basis of the ADH1 gene of Saccharomyces cerevisiae (accession no. YOL086C). The sequence of the ADH1 gene was “codon-optimized” to match the Chlamydomonas chloroplast codon usage, so as to maximize the expression of the yeast ADH protein in the Chlamydomonas chloroplast.
In a similar approach, the nucleotide sequence of the pyruvate decarboxylase PDC gene was codon-optimized to match the Chlamydomonas chloroplast codon usage, so as to maximize the expression of the pyruvate decarboxylase protein in the Chlamydomonas chloroplast (
In yet another similar approach, the nucleotide sequence of the isoprene synthase IspS gene was codon-optimized to match the Chlamydomonas chloroplast codon usage, so as to maximize the expression of the isoprene synthase protein in the Chlamydomonas chloroplast (
Chlamydomonas reinhardtii strain CC2653 was plated on 1.5% agar as a thin liquid layer of cells at a density of approximately 1−2×107 cells per Petri dish (85 mm diameter) containing HS minimal medium. Gold particles (1 μm diameter) coated with pHCCrCpADH plasmid DNA were delivered into cells upon bombardment with a Biolistic PDS-1000/He Particle Delivery System (BioRad) operated at 1100 psi. Approximately 5 μg of plasmid DNA, linearized with SacI restriction enzyme (
Following the biolistic treatment, plates were incubated at 24° C. under continuous illumination at about 50 μmol photons m−2 s−1. After two weeks incubation, transformant colonies became visible to the eye, indicating ability of autotrophic growth by the cells. Such individual colonies were transferred onto fresh HS minimal medium agar plates. Once such autotrophic strains established themselves (about two weeks following transfer of the transformants), cells from individual colonies were cultured in liquid HS minimal media for 2 days and re-plated onto HS agar plates to obtain individual single-cell lines. The resulting lines were then tested for the presence of the ADH gene and for homoplasmy of the chloroplast DNA by PCR analysis.
Presence of the transgenes in the transformants was tested upon PCR analysis by using the following set of ADH-specific primers: CrCpADHF2 5′CTGTTCAAGCTGCTCATATT3′, and CrCpADHR2 5′TACAGATGGTGGTGCACA3′, anticipating a fragment size of 324 bp (
Total RNA was extracted with Trizol (Invitrogen) following the manufacturer's instructions. Amplification of ADH transcripts was performed as follows: 0.1 μg of total RNA was used for the reverse transcription with an ADH gene specific primer located at the 3′ end of the gene, termed CrCpADHR1: 5′CATAACGACCTACAATTTGACC3′, using Superscript III from Invitrogen and by following the manufacturer's instructions. The reaction mix was then diluted 3× and 1 μl aliquot was employed for the subsequent PCR reaction using the primers: CrCpADHF1 5′ATGTCAATTCCTGAAACTC3′ and CrCpADHR2 5′TGTGCACCACCATCTGTAGC3′ (
Cells were harvested by centrifugation at 3000 g for 5 min at 4° C., and cell pellets were resuspended in ice-cold sonication buffer containing 50 mM Tricine (pH 7.8), 10 mM NaCl, 5 mM MgCl2, 0.2% polyvinylpyrrolidone-40, 0.2% sodium ascorbate, 1 mM aminocaproic acid, 1 mM aminobenzamidine and 100 μM phenylmethylsulfonylfluoride (PMSF). Cells were broken by sonication in a Branson 250 Cell Disruptor operated at 4° C. for 30 s (pulse mode, 50% duty cycle, output power 5). For total protein extraction, an equal volume of 2× protein solubilization buffer containing 0.5 M Tris-HCl (pH 6.8), 7% SDS, 20% glycerol, 2 M urea, and 10% β-mercaptoethanol was added.
Soluble and membrane protein fractions were separated as follows: the sonicated suspension was centrifuged at 10,000 g for 5 min at 4° C. to pellet the membrane fraction. The supernatant containing mostly soluble proteins was concentrated by Amicon centrifugal filter devices 10K (Millipore) and resuspended in solubilization buffer at a concentration of 1 μg protein per μl. Membrane fractions were resuspended in solubilization buffer on the basis of equal chlorophyll concentration. The latter was determined from the absorbance of a pigment extract in 80% acetone spectrophotometrically (Amon 1949). Solubilized protein extracts were resolved by SDS-PAGE using the discontinuous buffer system of Laemmli (1970). After completion of the electrophoresis, proteins on polyacrylamide gels were either stained with Coomassie Brilliant Blue or electro-transferred onto PVDF membrane Immunoblot analysis was carried out with specific polyclonal or monoclonal antibodies, followed by chemiluminescence detection of the cross reactions using the SuperSignal West Pico Chemiluminesencet substrate (Pierce-Thermo Scientific).
Cells were grown to the mid exponential growth phase (OD730=0.2-0.3, i.e., about 2−3×106 cells/ml), in Erlenmeyer flasks at 24° C. upon orbital shaking under continuous illumination of about 50 μmol photons m−2 s−1. The culture was then centrifuged and cell pellet was resuspended in fresh TAP medium at a concentration of OD730=0.9. The concentrated culture was then sealed and incubated at 24° C. under either light-dark cycles (LD=12 h light, 12 h dark) or in total darkness (D) for 48 h. The ethanol content of the liquid medium in the culture was quantified using a dichromate-based method (Ethanol Assay kit from the BioChain Institute, Inc., Hayward, Calif., USA). To prepare the liquid samples for this assay, cells were first pelleted from the growth medium, and the supernatant was filtered through a nylon syringe filter of 0.45 μm pore size (National Scientific) to remove insoluble particles prior to measuring the ethanol content of the liquid phase.
Volatile isoprene hydrocarbons accumulation was measured from the gaseous composition of the culture headspace. Gas from the headspace of sealed cultures was sampled and analyzed by gas chromatography using a Shimadzu 8A GC (Shimadzu, Columbia, Md., USA) equipped with a flame ionization detector (FID) and a column selected to detect short-chain hydrocarbons. Amounts of isoprene produced were estimated by comparison with a pure isoprene standard (Acros Organics, Fair Lawn, N.J., USA).
The complete nucleotide sequence of the CrCpADH expression cassette is shown in
The expression vector pHCCrCpADH having the CrCpADH cassette inserted in the intergenic region of PsaB-tRNAG (
The “recovery of function” selection criterion employed in this invention is superior to that of an antibiotic resistance based selection, because (i) it substantially minimizes the recovery of false positives, (ii) accelerates the process of achieving chloroplast DNA homoplasmy without the otherwise required persistent use of antibiotics, and (iii) alleviates concerns of undesirable secondary mutagenesis effects, which are common side effects many antibiotics have on microorganisms (Harris, 1989). For example, in our “recovery of function” based selection, more than 50 putative transformants were isolated from each transformation plate, based on the photoautotrophic growth criterion. All of these isolated putative transformant strains were true positive, i.e., they were shown to contain the CrCpADH transgene (see below).
Eight independent and randomly selected CrCpADH transformant lines that grew under selective photoautotrophic conditions (function of the RbcL gene) were isolated for further testing. These putative transformants were first tested for the presence of the ADH gene via genomic PCR analysis. Probing with ADH gene specific primers (see Materials and methods) resulted in positive amplification of the anticipated 324 bp product size of ADH gene sequence in all randomly selected transformants (
Chloroplast DNA homoplasmy in the CrCpADH transformants was also assessed by chloroplast DNA PCR. The issue here is to assess whether the transgenic DNA copy that carries the CrCpADH transgene has quantitatively replaced all (about 100) wild type copies of the chloroplast DNA in the isolated transformant cell lines. Achieving homoplasmy on the basis of an antibiotic selectable marker is often difficult, as antibiotics are not essential for cell growth and chloroplast DNA multiplication, whereas “recovery of function” would be key to the basic cell and chloroplast functions. Accordingly, “recovery of function” may be a more powerful condition favoring transgene chloroplast DNA segregation. The position of primers used to test homoplasmy of the chloroplast DNA in the CrCpADH transformants is shown in
Based on the above homoplasmy testing, a rigorous screening of numerous CrCpADH transformant strains was undertaken. As a result, we selected eight independent homoplasmic lines of chloroplast transformants for further gene expression analysis.
Analysis of ADH Gene Expression in Chlamydomonas reinhardtii Chloroplast
The steady state levels of ADH transcripts were examined by RT-PCR in eight isolated and verified homoplasmic lines of chloroplast transformants (lines CpT-0 through CpT-7). Using CrCpADH gene specific primers, strong expression of the ADH gene was evidenced by the presence of a 720 bp product in all but the CpT-3 line (
Presence of the ADH protein was also tested by Western blot analysis.
Presence of the ADH protein in the transformants was also tested by Western blot analysis, using specific monoclonal antibodies against the 6×His-tag (Invitrogen, USA). Evidence was obtained to show a specific cross-reaction between the 6×His monoclonal antibodies with a protein of approximately 43 kD (
Ethanol concentration calibration curves were obtained with the dichromate-based method (Ethanol Assay kit from BioChain, see Materials and methods) by following the manufacturer's specifications. A representative ethanol calibration standard curve (
For ethanol production measurements, C. reinhardtii CrCpADH transformant and wild type strains were grown to a similar cell density (OD730=0.2-0.3) and subsequently concentrated to a higher cell density (OD730=0.9) before being subjected to various treatments and incubations for ethanol production. At the end of the respective incubation, cells were pelleted from their suspension and supernatants were filtered through a 0.45 μm syringe filter prior to assaying the ethanol content of the liquid phase. his centrifugation and filtering pretreatment was necessary in order to eliminate scattering effects by insoluble matter in the samples, as scattering interfered with the spectrophotometric quantitation measurements. Even with these precautions, some variations in ethanol productivity among different samples in separate experiments were noted, as shown in
In all CrCpIspS transformants (
Earlier studies from different laboratories showed that Chlamydomonas reinhardtii does not produce ethanol in the light (Gfeller and Gibbs, 1984). However, ethanol production was detected under certain experimental conditions, including sulfur deprivation and hydrogen production (Winkler et al. 2002) and obligate anaerobiosis (Mus et al. 2007). Results in this disclosure are consistent with these earlier studies showing that the ethanol level produced under LD conditions was about half or less than that produced in the dark by the wild type control strains (
Similarly, Chlamydomonas reinhardtii and other microalgae are not endowed with gene that confer upon them volatile isoprene hydrocarbons production. However, substantial isoprene production was detected upon transformation of this green microalga with the CrCpIspS construct (
Two approaches could be applied when aiming at transgene expression in the chloroplasts of Chlamydomonas. One is through the nuclear transformation process to integrate into the nuclear genome of Chlamydomonas a transgene that contains a chloroplast transit peptide. The transgenic protein synthesized in the cytosol could then be targeted into chloroplast through the function of the transit peptide. The other approach is the chloroplast transformation method that we employed in the illustrative examples here, which allows the direct integration of the transgene into the chloroplast genome, allowing direct synthesis of the transgenic protein in the chloroplast without going through the protein import process. The second method has advantages over the first one in many aspects:
(1) The mode of integration of a transgene into Chlamydomonas nuclear genome is at random, which usually leads to significant variations in the levels of transgene expression. Epigenetic gene silencing phenomena often render this insertional transformation ineffective, if not useless. In consequence, a screening process of a large population of transformants is necessary in order to obtain a transgenic line that shows optimal expression level.
(2) In contrast, integration of transgenes into the chloroplast DNA is mediated through homologous recombination. Therefore, one can target the insertion sites in the area of the genome that contain highly expressed genes or “hot spots”, to assure the expression of the transgenes.
(3) Direct chloroplast transformation ensures the final localization of the protein by the direct protein synthesis in designated organelle.
(4) Chlamydomonas chloroplast contains over one hundred copies of chloroplast genome. Direct chloroplast transformation allows the initially inserted single copy transgene to multiply to the same copy numbers of the chloroplast genome after the transformation through the establishment of homoplasmy process. The high copy number of the transgene in the chloroplast thus ensures higher levels of expression.
This application claims benefit of priority to U.S. provisional application No. 61/411,387 filed Nov. 8, 2010, which application is herein incorporated by reference for all purposes.
Filing Document | Filing Date | Country | Kind | 371c Date |
---|---|---|---|---|
PCT/US11/59636 | 11/7/2011 | WO | 00 | 7/23/2013 |
Number | Date | Country | |
---|---|---|---|
61411387 | Nov 2010 | US |