Patent Grant
7071377
The present invention relates to nucleic acid constructs containing nucleic acid molecules encoding papaya proteins or polypeptides which control papaya fruit ripening and nucleic acids encoding papaya ringspot virus coat proteins, and methods of controlling papaya fruit ripening and conferring resistance to ringspot virus coat in transgenic plants transformed with such constructs.
Papaya (Carica papaya L.) is an important fruit crop grown widely in tropical and subtropical lowland regions (Manshardt, “Papaya in Biotechnology of Perennial Fruit Crops,” ed. Hammerschlag, 21:489-511, CAB Int., Wallingford, UK (1992)). Worldwide, Brazil, India, and Mexico are the largest producers of papaya. Hawaii, the largest producer of papaya in the United States, exporting about 66% of the total fresh production, primarily to the US mainland and Japan (Martin, “Papaya Production Statistics,” Proc. Annu. Hawaii Papaya Ind. Assoc. Conf., 39th, Kihei, pp. 31-36, Sept. 23-24 (1994)). The FAO estimated that about 5.7 million metric tons of fruit were harvested in 1995, almost double the 1980 harvest (Galinsky, “World Market for Papaya,” Reg. Agribus. Proj. Mark. Inf. Bull. Feb. No. 12, 5 pp. (1996)).
Papaya ringspot virus (“PRSV”) is a member of the potyvirus group of plant viruses, which are pathogenic to several crop plants, and which exhibit cross-infectivity between members of different plant families. Generally, a potyvirus is a single-stranded (+) RNA plant virus. The viral genome is approximately 10,000 bases in length. The expression strategy of potyviruses includes translation of a complete polyprotein from the positive sense viral genomic RNA. PRSV is by far the most widespread and damaging virus that infects papaya, occurring worldwide wherever papaya is grown (Purcifull, “Papaya Ringspot Virus,” CMI/AAB Descr. Plant Viruses, No. 292 (No. 84 Revis., July 1984) 8 pp. (1984)). PRSV infections have resulted in the devastation of the papaya industry in Brazil, Taiwan, and Hawaii in recent years (Gonsalves, D., “Control of Papaya Ringspot Virus in Papaya: A Case Study,” Annu. Rev. Phytopathol. 36:415-37 (1998)). Various attempts have been made to control or prevent infection of crops by PRSV, but these have been largely unsuccessful.
The concept of parasite-derived resistance (“PDR”), conceived in the middle 1980s, offered a new approach for controlling PRSV (Sanford et al., “The Concept of Parasite-Derived Resistance—Deriving Resistance Genes from the Parasite's Own Genome,” J. Theor. Biol. 113:395-405 (1985)). Parasite-derived resistance is a phenomenon whereby transgenic plants containing genes or sequences of a parasite are protected against detrimental effects of the same or related pathogens. (Powell-Abel et al., “Delay of Disease Development in Transgenic Plants that Express the Tobacco Mosaic Virus Coat Protein Gene,” Science, 232:738-43 (1986); (Lomonossoff, G. P., “Pathogen-Derived Resistance to Plant Viruses,” Ann. Rev. Phytopathol. 33:323-43 (1995)).
The vast majority of reports regarding PDR have utilized the coat protein (“CP”) genes of the viruses that are targeted for control (Powell-Abel et al., “Delay of Disease Development in Transgenic Plants that Express the Tobacco Mosaic Virus Coat Protein Gene,” Science, 232:738-43 (1986)); however, a growing number of reports have shown that viral replicase (Golemboski et al., “Plants Transformed with a Tobacco Mosaic Virus Nonstructural Gene Sequence are Resistant to the Virus,” Proc. Natl. Acad. Sci. USA 87:6311-15 (1990)), movement protein (Beck et al., “Disruption of Virus Movement Confers Broad-Spectrum Resistance Against Systemic Infection by Plant Viruses with a Triple Gene Block,” Proc. Natl. Acad. Sci. USA 91:10310-14 (1994)), nuclear inclusion a-proteases (“NIa proteases”) of potyviruses (Maiti et al., “Plants that Express a Potyvirus Proteinase Gene are Resistant to Virus Infection,” Proc. Natl. Acad. Sci. USA 90:6110-14 (1993)), and other viral genes are also effective in conferring resistance. Furthermore, viral genes can be effective in the translatable and non-translatable sense forms, and, less frequently, antisense forms (Baulcombe, D. C., “Mechanisms of Pathogen-Derived Resistance to Viruses in Transgenic Plants,” Plant Cell 8:1833-44 (1996); Dougherty et al., “Transgenes and Gene Suppression: Telling us Something New?” Current Opinion in Cell Biology 7:399-05 (1995); Lomonossoff, G. P., “Pathogen-Derived Resistance to Plant Viruses,” Ann. Rev. Phytopathol. 33:323-43 (1995)).
Although the testing of transgenic plants have been largely confined to laboratory and greenhouse experiments, a growing number of reports showed that resistance is effective under field conditions (Grumet, R., “Development of Virus Resistant Plants via Genetic Engineering,” Plant Breeding Reviews 12:47-49 (1994)). Two virus resistant crops have been deregulated by APHIS/USDA and, thus, are approved for unrestricted release into the environment in the U.S.A. Squash that are resistant to watermelon mosaic virus 2 and zucchini yellow mosaic potyviruses have been commercialized (Fuchs et al., “Resistance of Transgenic Hybrid Squash ZW-20 Expressing the Coat Protein Genes of Zucchini Yellow Mosaic Virus and Watermelon Mosaic Virus 2 to Mixed Infections by Both Potyviruses,” Bio/Technology 13:1466-73 (1995); Tricoli, et al., “Field Evaluation of Transgenic Squash Containing Single or Multiple Virus Coat Protein Gene Constructs for Resistance to Cucumber Mosaic Virus, Watermelon Mosaic Virus 2, and Zucchini Yellow Mosaic Virus,” Bio/Technology 13:1458-65 (1995)). A transgenic Hawaiian papaya that is resistant to PRSV has also been developed (Fitch et al., “Virus Resistant Papaya Derived from Tissues Bombarded with the Coat Protein Gene of Papaya Ringspot Virus,” Bio/Technology 10:1466-72 (1992); Tennant et al., “Differential Protection Against Papaya Ringspot Virus Isolates in Coat Protein Gene Transgenic Papaya and Classically Cross-Protected Papaya,” Phytopathology 84:1359-66 (1994)). This resistant transgenic papaya was recently deregulated by the Animal and Plant Health Information Service of the United states Department of Agriculture (“USDA/APHIS”). Deregulation of the transgenic papaya is timely, because Hawaii's papaya industry is being devastated by PRSV. Remarkable progress has been made in developing virus resistant transgenic plants despite a poor understanding of the mechanisms involved in the various forms of pathogen-derived resistance (Lomonossoff, G. P., “Pathogen-Derived Resistance to Plant Viruses,” Ann. Rev. Phytopathol. 33:323-43 (1995)).
Unfortunately, the papaya grower faces a second natural challenge that threatens to limit the growth of the industry: the fragility of the papaya fruit. The characteristic fragility of ripe papaya fruit limits the large-scale exportation of mature papaya to countries in temperate regions. To minimize this problem, the current practice is to collect fruits for exportation in very precocious phases of maturation with the consequence of adulteration of the organoleptic characteristics of this fruit. This early harvest of fruit, designed to avoid damage in subsequent handling, can result in a failure to develop optimum fruit flavor and color. Another tactic is employed to slow the ripening process in-transit by shipping and storing papaya at cold temperatures. This practice ultimately results in significant fruit damage also, as papaya fruit is susceptible to chilling injury, with critical temperatures ranging between 10-15° C. In papaya, the symptoms of chilling injury are more evident upon returning the fruit to higher ripening temperatures, which results in excessive softening and the associated enhancement of pathogen susceptibility (Chan et al., “Electrolyte Leakage and Ethylene Production Induced by Chilling Injury of Papayas,” Hort. Science 20:1070-1072 (1985); Lyons et al., “Chilling Injury,” in Weichmann, ed., Postharvest Physiology of Vegetables, New York: Marcell Dekker Inc., pp. 305-326, (1987)).
In an effort to solve the problems associated with long-distance shipping of fruit generally, researchers have concentrated on unraveling the role of enzymes involved in the ripening process. Three enzymes that have surfaced as vital for fruit ripening are pectinmethylesterase (“PME”), β-glucuronidase (“β-Gal”), and the polygalacturonase (“PG”) family.
PME is a pectolytic enzyme which has been implicated in fruit ripening (Bacic et al., “Structure and Function of Plant Cell Walls,” in The Biochemistry of Plant: A Comprehensive Treatise, ed. J. Preiss, 14:297-371, New York: Academic (1988)). This cell wall metabolizing enzyme is responsible for the demethylation of galacturonic acid residues in high molecular weight pectin, each methyl group being converted to a proton and methanol (Hall et al., “Molecular Characterization of cDNA Clones Representing Pectin Esterase Isozymes from Tomato,” Plant Mol. Biol. 25(2):313-318 (1994)). PME activity has been reported to increase during the development of banana (Brady, “The Pectinesterase of Pulp Banana Fruit,” Aust. J. Plant Physiol. 3:163-172 (1976)), apple (Knee, “Metabolism of Polygalacturonase in Apple Fruit Cortical Tissue During Ripening,” Phytochemistry 17:1262-1264 (1979)), avocado (Awad et al., “Postharvest Variation in Cellulase, Polygalacturonase and Pectin Methylesterase in Avocado (Persea americana) Fruit in Relation to Respiration and Ethylene Production,” Plant Physiol. 64:306-308 (1979)), and papaya (Paul et al., “Postharvest Variation in Cell Wall Degrading Enzymes of Papaya (Carica papaya) During Ripening,” Plant Physiol. 72:382-385 (1983)). The exact role of PME in fruit development and ripening is yet to be determined. However, it has been hypothesized that de-esterification of pectin by PME and further depolymerization by PG are involved in fruit softening. This hypothesis is based on the observation that demethylation of pectin by PME causes a several-fold increase in cell wall solubilization by PG (Pressey et al., “Solubilization of Cell Wall by Tomato Polygalacturonase Effects of Pectinesterase,” J. Food Biochem. 6:57-74 (1982)).
A wide range of enzymes is known to catalyze aspects of pectin modification and disassembly. Among those best characterized are exo- and endo-polygalacturonases (“PGs”), which are implicated in the disassembly of pectin that accompanies many stages of plant development, in particular those requiring cell separation. Although being clear that PG participates in a wide range of developmental processes, the majority of research has been focused on its role in fruit ripening.
PG-dependent disassembly has been most extensively studied in ripening tomatoes. Following the experiences of suppression of PG gene expression in wild type tomato and on the ectopic expression of PG in the ripening impaired pleiotropic mutant ripening inhibitor (“rin”), it has been considered that PG-mediated pectin depolymerization is not necessary for normal ripening and softening (Sheehy et al., “Reduction of Polygalacturonase Activity in Tomato Fruit by Antisense RNA,” Proc. Natl. Acad. Sci. USA 85:8805-8809 (1988); Smith et al., “Antisense RNA Inhibition of Polygalacturonase Gene Expression in Transgenic Tomatoes,” Nature 334:724-726 (1988); Giovannoni et al., “Expression of a Chimeric Polygalacturonase Gene in Transgenic Rin (Ripening Inhibitor) Tomato Fruit Results in Polyuronide Degradation But Not Fruit Softening,” Plant Cell 1:53-63 (1989)). Research performed with transgenic sense and antisense tomatoes suggests that PG-mediated pectin disassembly does not contribute to early fruit ripening but contributes to tissue deterioration in the late stages of fruit ripening (Hadfield et al., “Polygalacturonase Gene Expression in Ripe Melon Fruit Supports a Role for Polygalacturonase in Ripening-Associated Pectin Disassembly,” Plant Physiol. 117: 363-373 (1998)). Analysis of cell walls from transgenic fruits with altered levels of PG activity led to the conclusion that pectin depolymerization and pectin solubilization are due to distinct enzymatic determinants (Hadfield et al., “Polygalacturonase: Many Genes in Search of a Function,” Plant Physiol. 117:337-343 (1998)). According to the same authors, pectin solubilization is primarily due to the action of PG. The fact that pectins in PG-complemented rin fruit are both solubilized and depolymerized accounts for the conclusion that PG activity is necessary and sufficient for pectin depolymerization, but it may be one of multiple, redundant pectin-solubilizing activities (Hadfield et al., “Polygalacturonase: Many Genes in Search of a Function,” Plant Physiol. 117:337-343 (1998)).
In papaya, the gradual firmness loss of fruit is associated with a discernible, although very limited, increased in PG activity (Ali et al., “The Biochemical Basis of Accelerated Softening in Papaya Following Storage at Low Temperature,” Acta Horticulture 343 (1993)). In contrast, other fruits such as strawberry (Fragaria ananassa) (Huber, “Strawberry Fruit Softening: The Potential Roles of Polyuronides and Hemicelluloses,” J. Food Sci. 49:1310-1315 (1984)), melon (Cucumis melo) (McCollum et al., “Modification of Polyuronides and Hemicelluloses During Muslanelon Fruit Softening,” Physiol. P1. 76:303-308 (1989)), and persimmon (Diospyrus kaki) (Cutillas-Iturralde et al., “Metabolism of Cell Wall Polysaccharides from Persimmon Fruit: Solubilization During Fruit Ripening Occurs in Apparent Absence of Polygalacturonase Activity,” Physiol. Plant. 89:369-375 (1993)) have been reported as lacking endo-PG activity. Recently, it was demonstrated that PG mRNA accumulation can occur at late stages of ripening at levels much lower than those observed in ripening tomato, only detectable by using very accurate methods (Wu et al., “Endopolygalacturonase in Apples (Malus domestica) and its Expression During Fruit Ripening,” Plant Physiol. 102:219-225 (1993)). It has also been reported that of three genes encoding melon PGs, one of those (MPG1) encodes an endo-PG with the potential to depolymerize melon fruit cell wall pectin (Hadfield et al., “Polygalacturonase Gene Expression in Ripe Melon Fruit Supports a Role for Polygalacturonase in Ripening-Associated Pectin Disassembly,” Plant Physiol. 117:363-373 (1998)). It is therefore possible that in some fruits the disassembly of pectins in late stages of ripening is PG dependent, even in fruits with very low levels of PG activity (Hadfield et al., “Polygalacturonase: Many Genes in Search of a Function,” Plant Physiol. 117:337-343 (1998)).
Another enzyme that has been implicated in fruit ripening is β-Gal, an enzyme involved in cell wall softening and known to exist in three isoforms (β-Gal I, β-Gal II, and β-Gal III). In “β-Galactosidases in Ripening Tomatoes,” Plant Physiol. 71:132-135 (1983), Pressey et al., reported on the increase of activity of one of the three β-galactosidases isozymes during tomato ripening, suggesting that these isozymes may play a role on degradation of cell wall galactan, which may account for the involvement of β-Gal in fruit softening. The involvement of β-Gal in tomato fruit ripening has been confirmed (Watkins et al., “Activities of Polygalacturonase α-D Mannosidase and α-D and β-D Galactosidases in Ripening Tomato,” Hortscience 23: 192-94 (1988)). More recently, the increase of β-Gal during ripening of kiwi fruit (Wegrzyn et al., “Pectinesterase, Polygalacturonase and β-Galactosidase During Softening of Ethylene-Treated Kiwi Fruit,” HortScience 27:900-902 (1992)), mango and papaya (Lazan et al., “Cell Wall Hydrolases and Their Potential in the Manipulation of Ripening of Tropical Fruits,” Asean Food J. 8:47-53 (1993)), avocado (De Veau et al., “Degradation and Solubilization of Pectin by β-Galactosidases Purified from Avocado Mesocarp,” Physio. Plant 87:279-285 (1993)), and coffee (Golden et al., “β-Galactosidase from Coffea arabica and its Role in Fruit Ripening,” Phytochemistry 34:355-360 (1993)) have been reported. In apples, the loss of fruit firmness during ripening has been associated with increased activity of β-galactosidase and a decrease in the Gal content of the cell wall (Bartley, “β-Galactosidase Activity in Ripening Apples,” Phytochemistry 13:2107-2111 (1974); Wallner, “Apple Fruit β-Galactosidase and Softening in Storage,” J. Am. Soc. Hort. Sci. 103:364 (1978)). Furthermore, Kang et al., “N-Terminal Amino Acid Sequence of Persimmon Fruit β-galactosidase,” Plant Physiol. 105:975-979 (1994) purified two isozymes (one 34 kD and the other 44 kD) from persimmon fruit. A characteristic feature during the ripening of papaya fruit is softening. β-galactosidase might contribute significantly to pectin and hemicellulose modification and, hence, to softening of the fruit (Lazan et al., “β-galactosidase, Polygalacturonase and Pectinesterase in Differential Softening and Cell Wall Modification During Papaya Fruit Ripening,” Physiol. Plant 95:106-112 (1995)).
According to Ali et al., “The Biochemical Basis of Accelerated Softening in Papaya Following Storage at Low Temperature,” Acta Horticulture 343 (1993), PME, PG, and the β-Gal isoforms may collectively play a significant role in the development of the chilling injury symptom of increased-susceptibility-to-disease commonly observed in papaya upon returning chill-stored fruits to warmer environments. Attempts to deliver mature, full-flavored, and unadulterated papaya fruits to the consumer by long-distance transport have concentrated thus far on largely unsuccessful measures such as early harvest and low temperature storage. Given the complexity of the ripening process in papaya, it not surprising that delivering mature, full-flavored, and unadulterated papaya fruits using such measures as early harvest and low temperature storage have been largely unsuccessful.
The papaya industry is doubly vulnerable: first, to the potential for wholesale destruction from PRSV infection and, second, to unremediable damage to the fruit in long-distance transport to consumers. What is needed is a solution which utilizes and adapts the natural maturation process of the papaya such that the fruit can tolerate the stresses of long-distance exportation, carried out in combination with a method to confer PRSV resistance to papaya plants.
The present invention is directed to overcoming these and other deficiencies in the art.
The present invention relates to a DNA construct which contains a first DNA molecule encoding a protein or polypeptide which controls papaya fruit ripening and a second DNA molecule encoding a papaya ringspot virus coat protein.
The present invention also relates to methods of controlling the ripening of papaya fruit and conferring disease resistance to a plant. This involves transforming a plant cell with the DNA construct of the present invention and regenerating a plant from the transformed cell under conditions effective to control ripening and confer disease resistance.
The present invention also relates to host cells, plant cells and transgenic plants containing the nucleic acid construct of the present invention.
The present invention relates to a DNA construct which contains a first DNA molecule encoding a protein or polypeptide which controls papaya fruit ripening and a second molecule encoding a papaya ringspot virus coat protein. The “first” and “second” DNA molecules in the DNA construct of the present invention is not meant to limit the order of the DNA molecules in the construct.
As to the first DNA molecule, this protein or polypeptide is a galactosidase, a pectinmethylesterase or a polygalacturonase.
One form of the nucleic acid molecule of the present invention is β-Gal.45, which has a nucleotide sequence corresponding to SEQ ID NO: 1, as follows:
β-Gal.45, isolated from Carica papaya (“papaya”), has an open reading frame (“ORF”) of 1998 bp, extending between nucleotides 231-2228. The starting codon “ATG” is identified at 231-234 bp, with the stop codon “TAA” found between nucleotides 2225-2228.
The nucleic acid sequence corresponding to SEQ ID NO: 1 encodes an isoform of β-galactosidase isolated from Carica papaya, identified herein as β-Gal.45, which has a deduced amino acid sequence corresponding to SEQ ID NO: 2, as follows:
Another nucleic acid molecule in accordance with the present invention isolated from Carica papaya is identified herein as β-Gal.64, and has a nucleic acid sequence corresponding to SEQ ID NO: 3, as follows:
The nucleic acid sequence corresponding to SEQ ID NO: 3 encodes an isoform of β-galactosidase isolated from Carica papaya identified herein as β-Gal.64, which has a deduced amino acid sequence corresponding to SEQ ID NO: 4, as follows:
Another nucleic acid molecule in accordance with the present invention isolated from Carica papaya is identified herein as β-Gal.41, which has a nucleotide sequence corresponding to SEQ ID NO: 5, as follows:
The open reading frame (“ORF”) of Carica papaya β-Gal.41 is 2166 bp, extending between nucleotides 127-2292. The starting codon “ATG” is identified at 127-130 bp, with the stop codon “TAG” found between nucleotides 2289-2292. The nucleic acid sequence corresponding to SEQ ID NO: 5 encodes a third isoform of β-galactosidase identified herein as β-Gal.41, isolated from Carica papaya, which has an amino acid sequence corresponding to SEQ ID NO: 6, as follows:
Another suitable nucleic acid molecule in accordance with the present invention encodes for a protein or polypeptide having activity as a pectinmethylesterase (PME) isolated from Carica papaya, which has a nucleotide sequence corresponding to SEQ ID NO: 7, as follows:
The nucleic acid sequence corresponding to SEQ ID NO: 7 (PME) encodes an pectinmethylesterase isolated from Carica papaya, identified herein as PME which has a deduced amino acid sequence corresponding to SEQ ID NO: 8, as follows:
Another suitable nucleic acid molecule in accordance with the present invention encodes for a protein or polypeptide having activity as a polygalacturonase (PG), isolated from Carica papaya, which has a nucleotide sequence corresponding to SEQ ID NO: 9, as follows:
The nucleic acid sequence corresponding to SEQ ID NO: 9 encodes an polygalacturonase isolated from Carica papaya, identified herein as PG which has a deduced amino acid sequence corresponding to SEQ ID NO: 10, as follows:
The second DNA molecule in the DNA construct of the present invention encodes a papaya ringspot virus coat protein (PRSV-CP). Preferably, this PRSV-CP is derived from a gene encoding a papaya ringspot virus coat protein from the papaya ringspot virus strains Thailand (TH), Keaau (KE), Kapoho (KA), Mexico (ME), Taiwan (YK), Brazil (BR), Jamaica (JA), Oahu (OA), and Venezuela (VE).
One suitable form of the nucleic acid of the present invention is the coat protein (CP) gene isolated from PRSV-Hawaii, strain Kapoho (“KA”), which has a nucleic acid sequence corresponding to SEQ ID NO: 11 as follows:
The present invention also relates to the PRSV-KA coat protein, encoded by the nucleotide corresponding to SEQ ID NO: 11, where the protein encoded has an amino acid sequence corresponding to SEQ ID NO: 12, as follows:
Another suitable viral CP gene of the present invention is an isolated nucleic acid molecule encoding a CP isolated from the Thailand (“TH”) strain of PRSV, which has a nucleic acid sequence corresponding to SEQ ID NO: 13 as follows:
The present invention also relates to the viral coat protein of the TH strain of PRSV, which corresponds to amino acid SEQ ID NO: 14, as follows:
Also suitable as a nucleic acid for use in the present invention is the nucleic acid which encodes a CP isolated from the Keaau (“KE”) strain of PRSV. PRSV-KE contains two “cut-sites,” i.e., two potential cleavage sites for a coat protein. The first cleavage site sequence in the KE strain of PRSV, identified herein as KE-CP1, corresponds to SEQ ID NO: 15, as follows:
A second nucleotide sequence encoding a PRSV-KE coat protein sequence, which starts from the second KE-CP cleavage site, is identified as KE-CP2 herein, and corresponds to SEQ ID. No. 16, as follows:
The nucleic acid sequence corresponding to SEQ ID NO: 15 encodes a PRSV coat protein identified herein as KE-CP1, which has an amino acid sequence corresponding to SEQ ID. No. 17, as follows:
SEQ ID NO: 16 encodes a CP of KE strain identified herein as KE-CP2, with an amino acid sequence which corresponds to SEQ ID NO: 18, as follows:
Also suitable in the present invention is the nucleic acid which encodes a CP isolated from the Taiwan (“YK”) strain of PRSV, and corresponds to SEQ ID NO: 19, as follows:
SEQ ID NO: 19 encodes the CP of the YK strain of PRSV which has an amino acid sequence corresponding to SEQ ID NO: 20, as follows:
Another nucleic acid suitable in the present invention is the nucleic acid which encodes a CP isolated from the Mexico (“ME”) strain of PRSV and corresponds to SEQ ID NO: 21, as follows:
SEQ ID NO: 21 encodes the CP of the ME strain of PRSV which has an amino acid sequence corresponding to SEQ ID NO: 22, as follows:
Another nucleic acid suitable in the present invention is the nucleic acid which encodes a CP isolated from the Brazil (“BR”) strain of PRSV and corresponds to SEQ ID NO: 23, as follows:
SEQ ID NO: 23 encodes the CP of the BR strain of PRSV which has an amino acid sequence corresponding to SEQ ID NO: 24, as follows:
Another nucleic acid suitable in the present invention is the nucleic acid which encodes a CP isolated from the Jamaica (“JA”) strain of PRSV and corresponds to SEQ ID NO: 25, as follows:
SEQ ID NO: 25 encodes the CP of the JA strain of PRSV which has an amino acid sequence corresponding to SEQ ID NO: 26, as follows:
Another nucleic acid suitable in the present invention is the nucleic acid which encodes a CP isolated from the Oahu (“OA”) strain of PRSV and corresponds to SEQ ID NO: 27, as follows:
SEQ ID NO: 27 encodes the CP of the OA strain of PRSV which has an amino acid sequence corresponding to SEQ ID NO: 28, as follows:
Another nucleic acid suitable in the present invention is the nucleic acid which encodes a CP isolated from the Venezuela (“VE”) strain of PRSV and corresponds to SEQ ID NO: 29, as follows:
SEQ ID NO: 29 encodes the CP of the VE strain of PRSV which has an amino acid sequence corresponding to SEQ ID NO: 30, as follows:
Also suitable in the present invention are other forms of the nucleic acid molecules shown above. An example of a nucleic acid suitable in the present invention is a nucleic acid molecule which has a nucleotide sequence that is at least 85% similar by basic BLAST using default parameters analysis to the nucleotide sequence of SEQ ID NOS: 1, 3, 5, 7, and 9, and which hybridizes to the nucleotide sequence of SEQ ID NOS: 1, 3, 5, 7, and 9, under stringent conditions characterized by a hybridization buffer comprising 5×SSC buffer at a temperature of about 42-56° C. A further example of nucleic acids suitable in the present invention is any nucleic acid which has a nucleotide sequence that is at least 85% similar by basic BLAST using default parameters analysis to the nucleotide sequence of SEQ ID NOS: 11, 13, 15, 16, 19, 21, 23, 25, 27, and 29 of the present invention and which hybridizes to the nucleotide sequence of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 16, 19, 21, 23, 25, 27, and 29 of the present invention under stringent conditions characterized by a hybridization buffer comprising 5×SSC buffer at a temperature of about 42-65° C., preferably 45° C.
Fragments of both PRSV-CP encoding genes and papaya ripening genes are particularly useful in the present invention. Fragments capable of use in the present invention can be produced by several means. In one method, subclones of the gene encoding the CP or papaya ripening genes of choice are produced by conventional molecular genetic manipulation by subcloning gene fragments. In another approach, based on knowledge of the primary structure of the protein, fragments of a PRSV-CP encoding gene and papaya ripening gene of choice may be synthesized by using the PCR technique together with specific sets of primers chosen to represent particular portions of the protein. These, then, would be cloned into an appropriate vector in either the sense or antisense orientation.
Another example of suitable fragments of the nucleic acids of the present invention are fragments of the genes which have been identified as conserved (“con”) regions of the CP and papaya ripening proteins, or alternatively, those portions of PRSV-CP nucleotide sequences and papaya ripening nucleotide sequences that have been identified as variable (“var”) regions. Sequences identified by standard homology analysis as either variable or conserved in PRSV-CP and papaya ripening gene nucleotide sequences can be amplified using standard PCR methods using forward and reverse primers designed to amplify the region of choice and which include a restriction enzyme sequence included to allow ligation of the PCR product into a vector of choice. Combinations of amplified conserved and variable region sequences can be ligated into a single vector to create a “cassette” which contains a plurality of DNA molecules in one vector. The use of conserved and variable regions of PRSV-CP and papaya ripening genes is further detailed below in the Examples.
The present invention also relates to a DNA construct containing nucleic acids which encode for papaya ripening proteins or polypeptides together with nucleic acids encoding one or more types of PRSV-CP. This involves incorporating the nucleic acid molecules of the present invention into host cells using conventional recombinant DNA technology. Generally, this involves inserting the nucleic acid molecule into an expression system to which the nucleic acid molecule is heterologous (i.e., not normally present). The heterologous nucleic acid molecule is inserted into the expression system which includes the necessary elements for the transcription and translation of the inserted protein coding sequences.
The nucleic acid molecules of the present invention may be inserted into any of the many available expression vectors and cell systems using reagents that are well known in the art. Suitable vectors include, but are not limited to, the following viral vectors such as lambda vector system gt11, gt WES.tB, Charon 4, and plasmid vectors such as pBR322, pBR325, pACYC177, pACYC1084, pUC8, pUC9, pUC18, pUC19, pLG339, pR290, pKC37, pKC101, SV 40, pBluescript II SK +/− or KS +/− (see “Stratagene Cloning Systems” Catalog (1993) from Stratagene, La Jolla, Calif., which is hereby incorporated by reference in its entirety), pQE, pIH821, pGEX, pET series (see F. W. Studier et. al., “Use of T7 RNA Polymerase to Direct Expression of Cloned Genes,” Gene Expression Technology vol. 185 (1990), which is hereby incorporated by reference in its entirety), and any derivatives thereof. Recombinant molecules can be introduced into cells via transformation, particularly transduction, conjugation, mobilization, or electroporation. The DNA sequences are cloned into the vector using standard cloning procedures in the art, as described by Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, NY (1989), and Ausubel, F. M. et al. (1989) Current Protocols in Molecular Biology, John Wiley & Sons, New York, N.Y., which are hereby incorporated by reference in their entirety.
In preparing a DNA vector for expression, the various DNA sequences may normally be inserted or substituted into a bacterial plasmid. Any convenient plasmid may be employed, which will be characterized by having a bacterial replication system, a marker which allows for selection in a bacterium and generally one or more unique, conveniently located restriction sites. Numerous plasmids, referred to as transformation vectors, are available for plant transformation. The selection of a vector will depend on the preferred transformation technique and target species for transformation. A variety of vectors are available for stable transformation using Agrobacterium tumefaciens, a soilborne bacterium that causes crown gall. Crown gall are characterized by tumors or galls that develop on the lower stem and main roots of the infected plant. These tumors are due to the transfer and incorporation of part of the bacterium plasmid DNA into the plant chromosomal DNA. This transfer DNA (T-DNA) is expressed along with the normal genes of the plant cell. The plasmid DNA, pTi or Ti-DNA, for “tumor inducing plasmid,” contains the vir genes necessary for movement of the T-DNA into the plant. The T-DNA carries genes that encode proteins involved in the biosynthesis of plant regulatory factors, and bacterial nutrients (opines). The T-DNA is delimited by two 25 bp imperfect direct repeat sequences called the “border sequences.” By removing the oncogene and opine genes, and replacing them with a gene of interest, it is possible to transfer foreign DNA into the plant without the formation of tumors or the multiplication of Agrobacterium tumefaciens (Fraley, et al., “Expression of Bacterial Genes in Plant Cells,” Proc. Nat'l Acad. Sci. 80:4803-4807 (1983), which is hereby incorporated by reference in its entirety).
Further improvement of this technique led to the development of the binary vector system (Bevan, M., “Binary Agrobacterium Vectors for Plant Transformation,” Nucleic Acids Res. 12:8711-8721 (1984), which is hereby incorporated by reference in its entirety). In this system, all the T-DNA sequences (including the borders) are removed from the pTi, and a second vector containing T-DNA is introduced into Agrobacterium tumefaciens. This second vector has the advantage of being replicable in E. coli as well as A. tumefaciens, and contains a multiclonal site that facilitates the cloning of a transgene. An example of a commonly used vector is pBin19 (Frisch, et al., “Complete Sequence of the Binary Vector Bin19,” Plant Molec. Biol. 27:405-409 (1995), which is hereby incorporated by reference in its entirety). Any appropriate vectors now known or later described for genetic transformation are suitable for use with the present invention.
U.S. Pat. No. 4,237,224 issued to Cohen and Boyer, which is hereby incorporated by reference in its entirety, describes the production of expression systems in the form of recombinant plasmids using restriction enzyme cleavage and ligation with DNA ligase. These recombinant plasmids are then introduced by means of transformation and replicated in unicellular cultures including prokaryotic organisms and eukaryotic cells grown in tissue culture.
Certain “control elements” or “regulatory sequences” are also incorporated into the vector-construct. These include non-translated regions of the vector, promoters, and 5′ and 3′ untranslated regions which interact with host cellular proteins to carry out transcription and translation. Such elements may vary in their strength and specificity. Depending on the vector system and host utilized, any number of suitable transcription and translation elements, including constitutive and inducible promoters, may be used.
A constitutive promoter is a promoter that directs expression of a gene throughout the development and life of an organism. Examples of some constitutive promoters that are widely used for inducing expression of transgenes include the nopoline synthase (“NOS”) gene promoter, from Agrobacterium tumefaciens (U.S. Pat. No. 5,034,322 issued to Rogers et al., which is hereby incorporated by reference in its entirety), the cauliflower mosaic virus (“CaMV”) 35S and 19S promoters (U.S. Pat. No. 5,352,605 issued to Fraley et al., which is hereby incorporated by reference in its entirety), those derived from any of the several actin genes, which are known to be expressed in most cells types (U.S. Pat. No. 6,002,068 issued to Privalle et al., which is hereby incorporated by reference in its entirety), and the ubiquitin promoter (“ubi”), which is the promoter of a gene product known to accumulate in many cell types.
An inducible promoter is a promoter that is capable of directly or indirectly activating transcription of one or more DNA sequences or genes in response to an inducer. In the absence of an inducer, the DNA sequences or genes will not be transcribed. The inducer can be a chemical agent, such as a metabolite, growth regulator, herbicide or phenolic compound, or a physiological stress directly imposed upon the plant such as cold, heat, salt, toxins, or through the action of a pathogen or disease agent such as a virus or fungus. A plant cell containing an inducible promoter may be exposed to an inducer by externally applying the inducer to the cell or plant such as by spraying, watering, heating, or by exposure to the operative pathogen. An example of an appropriate inducible promoter for use in the present invention is a glucocorticoid-inducible promoter (Schena et al., “A Steroid-Inducible Gene Expression System for Plant Cells,” Proc. Natl. Acad. Sci. 88:10421-5 (1991), which is hereby incorporated by reference in its entirety). Expression of the transgene-encoded protein is induced in the transformed plants when the transgenic plants are brought into contact with nanomolar concentrations of a glucocorticoid, or by contact with dexamethasone, a glucocorticoid analog (Schena et al., “A Steroid-Inducible Gene Expression System for Plant Cells,” Proc. Natl. Acad. Sci. USA 88:10421-5 (1991); Aoyama et al., “A Glucocorticoid-Mediated Transcriptional Induction System in Transgenic Plants,” Plant J. 11: 605-612 (1997), and McNellis et al., “Glucocorticoid-Inducible Expression of a Bacterial Avirulence Gene in Transgenic Arabidopsis Induces Hypersensitive Cell Death, Plant J. 14(2):247-57 (1998), which are hereby incorporated by reference in their entirety). In addition, inducible promoters include promoters that function in a tissue specific manner to regulate the gene of interest within selected tissues of the plant. Examples of such tissue specific promoters include seed, flower, or root specific promoters as are well known in the field (U.S. Pat. No. 5,750,385 issued to Shewmaker et al., which is hereby incorporated by reference in its entirety). In the preferred embodiment of the present invention, a heterologous promoter is linked to the nucleic acid of the construct, where “heterologous promoter” is defined as a promoter to which the nucleic acid of the construct is not linked in nature.
The DNA construct of the present invention also includes an operable 3′ regulatory region, selected from among those which are capable of providing correct transcription termination and polyadenylation of mRNA for expression in the host cell of choice, operably linked to a DNA molecule which encodes for a protein of choice. A number of 3′ regulatory regions are known to be operable in plants. Exemplary 3′ regulatory regions include, without limitation, the nopaline synthase (“nos”) 3′ regulatory region (Fraley, et al., “Expression of Bacterial Genes in Plant Cells,” Proc. Nat'l Acad. Sci. USA 80:4803-4807 (1983), which is hereby incorporated by reference in its entirety) and the cauliflower mosaic virus (“CaMV”) 3′ regulatory region (Odell, et al., “Identification of DNA Sequences Required for Activity of the Cauliflower Mosaic Virus 35S Promoter,” Nature 313(6005):810-812 (1985), which is hereby incorporated by reference in its entirety). Virtually any 3′ regulatory region known to be operable in plants would suffice for proper expression of the coding sequence of the nucleic acid of the present invention.
The vector of choice, suitable promoter, and an appropriate 3′ regulatory region can be ligated together to produce the expression systems which contain the nucleic acids of the present invention, or suitable fragments thereof, using well known molecular cloning techniques as described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, NY (1989), and Ausubel et al. (1989) Current Protocols in Molecular Biology, John Wiley & Sons, New York, N.Y., which are hereby incorporated by reference in their entirety.
Once the DNA construct of the present invention has been prepared, it is ready to be incorporated into a host cell. Accordingly, another aspect of the present invention relates to a recombinant host cell containing one or more of the DNA constructs of the present invention containing PRSV-CP-papaya ripening genes. Basically, this method is carried out by transforming a host cell with a DNA construct of the present invention under conditions effective to yield transcription of the DNA molecule in the host cell, using standard cloning procedures known in the art, such as described by Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Springs Laboratory, Cold Springs Harbor, N.Y. (1989), which is hereby incorporated by reference in its entirety. Suitable host cells include, but are not limited to, bacteria, virus, yeast, mammalian cells, insect, plant, and the like. Preferably the host cells are either a bacterial cell or a plant cell. Methods of transformation may result in transient or stable expression of the DNA under control of the promoter. Preferably, the nucleic acid construct of the present invention is stably inserted into the genome of the recombinant plant cell as a result of the transformation, although transient expression can serve an important purpose, particularly when the plant under investigation is slow-growing. Plant tissue suitable for transformation include leaf tissue, root tissue, meristems, zygotic and somatic embryos, callus, protoplasts, tassels, pollen, embryos, anthers, and the like. The means of transformation chosen is that most suited to the tissue to be transformed.
Transient expression in plant tissue is often achieved by particle bombardment (Klein et al., “High-Velocity Microprojectiles for Delivering Nucleic Acids Into Living Cells,” Nature 327:70-73 (1987), which is hereby incorporated by reference in its entirety). In this method, tungsten or gold microparticles (1 to 2 μm in diameter) are coated with the DNA of interest and then bombarded at the tissue using high pressure gas. In this way, it is possible to deliver foreign DNA into the nucleus and obtain a temporal expression of the gene under the current conditions of the tissue. Biologically active particles (e.g., dried bacterial cells containing the vector and heterologous DNA) can also be propelled into plant cells. For papaya, particle gun bombardment has been a particularly successful method (Fitch, M. M., “Stable Transformation of Papaya Via Micro-Projectile Bombardment,” Plant Cell Rep. 9:189 (1990), and Fitch et al., “Somatic Embryogenesis and Plant Regeneration from Immature Zygotic Embryos of Papaya (Carica papaya L.),” Plant Cell Rep. 9:320 (1990), which are hereby incorporated by reference in its entirety.) Other variations of particle bombardment, now known or hereafter developed, can also be used.
An appropriate method of stably introducing the nucleic acid construct into plant cells is to infect a plant cell with Agrobacterium tumefaciens or Agrobacterium rhizogenes previously transformed with the nucleic acid construct. As described above, the Ti (or RI) plasmid of Agrobacterium enables the highly successful transfer of a foreign DNA into plant cells. Another approach to transforming plant cells with a gene which imparts resistance to pathogens is particle bombardment (also known as biolistic transformation) of the host cell, as disclosed in U.S. Pat. Nos. 4,945,050, 5,036,006, and 5,100,792, all to Sanford et al., and in Emerschad et al., “Somatic Embryogenesis and Plant Development from Immature Zygotic Embryos of Seedless Grapes (Vitis vinifera),” Plant Cell Reports 14:6-12 (1995), which are hereby incorporated by reference in their entirety. Yet another method of introduction is fusion of protoplasts with other entities, either minicells, cells, lysosomes or other fusible lipid-surfaced bodies (Fraley, et al., Proc. Natl. Acad. Sci. USA 79:1859-63 (1982), which is hereby incorporated by reference in its entirety). The DNA molecule may also be introduced into the plant cells by electroporation (Fromm et al., Proc. Natl. Acad. Sci. USA 82:5824 (1985), which is hereby incorporated by reference in its entirety). In this technique, plant protoplasts are electroporated in the presence of plasmids containing the expression cassette. Electrical impulses of high field strength reversibly permeabilize biomembranes allowing the introduction of the plasmids. Electroporated plant protoplasts reform the cell wall, divide, and regenerate. The precise method of transformation is not critical to the practice of the present invention. Any method that results in efficient transformation of the host cell of choice is appropriate for practicing the present invention. For papaya, see the procedure as described in Cai et al., “A Protocol for Efficient Transformation and Regeneration of Carica papaya L. In Vitro,” Cell Devel. Biol-Plant 35:61-69 (1999), which is hereby incorporated by reference in its entirety.
After transformation, the transformed plant cells must be regenerated. Plant regeneration from cultured protoplasts is described in Evans et al., Handbook of Plant Cell Cultures, Vol. 1: (MacMillan Publishing Co., New York, 1983); Vasil I. R. (ed.), Cell Culture and Somatic Cell Genetics of Plants, Acad. Press, Orlando, Vol. 1, 1984, and Vol. III (1986), and Fitch et al., “Somatic Embryogenesis and Plant Regeneration from Immature Zygotic Embryos of Papaya (Carica papaya L.),” Plant Cell Rep. 9:320 (1990), which are hereby incorporated by reference in its entirety.
Means for regeneration vary from species to species of plants, but generally a suspension of transformed protoplasts or a petri plate containing explants is first provided. Callus tissue is formed and shoots may be induced from callus and subsequently rooted. Alternatively, embryo formation can be induced in the callus tissue. These embryos germinate as natural embryos to form plants. The culture media will generally contain various amino acids and hormones, such as auxin and cytokinins. Efficient regeneration will depend on the medium, on the genotype, and on the history of the culture. If these three variables are controlled, then regeneration is usually reproducible and repeatable.
Preferably, transformed cells are first identified using a selection marker simultaneously introduced into the host cells along with the nucleic acid construct of the present invention. Suitable selection markers include, without limitation, markers encoding for antibiotic resistance, such as the nptII gene which confers kanamycin resistance (Fraley, et al., Proc. Natl. Acad. Sci. USA 80:4803-4807 (1983), which is hereby incorporated by reference in its entirety), and the genes which confer resistance to gentamycin, G418, hygromycin, streptomycin, spectinomycin, tetracycline, chloramphenicol, and the like. Cells or tissues are grown on a selection medium containing the appropriate antibiotic, whereby generally only those transformants expressing the antibiotic resistance marker continue to grow. Other types of markers are also suitable for inclusion in the expression cassette of the present invention. For example, a gene encoding for herbicide tolerance, such as tolerance to sulfonylurea is useful, or the dhfr gene, which confers resistance to methotrexate (Bourouis et al., EMBO J. 2:1099-1104 (1983), which is hereby incorporated by reference in its entirety). Similarly, “reporter genes,” which encode for enzymes providing for production of an identifiable compound are suitable. The most widely used reporter gene for gene fusion experiments has been uidA, a gene from Escherichia coli that encodes the β-glucuronidase protein, also known as GUS (Jefferson et al., “GUS Fusions: β Glucuronidase as a Sensitive and Versatile Gene Fusion Marker in Higher Plants,” EMBO J. 6:3901-3907 (1987), which is hereby incorporated by reference in its entirety). Similarly, enzymes providing for production of a compound identifiable by luminescence, such as luciferase, are useful. The selection marker employed will depend on the target species; for certain target species, different antibiotics, herbicide, or biosynthesis selection markers are preferred.
Plant cells and tissues selected by means of an inhibitory agent or other selection marker are then tested for the acquisition of the viral gene by Southern blot hybridization analysis, using a probe specific to the viral genes contained in the given cassette used for transformation (Sambrook et al., “Molecular Cloning: A Laboratory Manual,” Cold Spring Harbor, N.Y.: Cold Spring Harbor Press (1989), which is hereby incorporated by reference in its entirety).
The presence of a viral coat protein gene can also be detected by immunological assays, such as the double-antibody sandwich assays described by Namba et al., “Expression of the Gene Encoding the Coat Protein of Cucumber Mosaic Virus (CMV) Strain WL appears to Provide Protection to Tobacco Plants Against Infection by Several Different CMV Strains,” Gene 107:181-188 (1991) as modified by Clark et al., “Characteristics Of the Microplate Method for Enzyme-Linked Immunosorbent Assay For the Detection of plant Viruses,” J. Gen. Virol. 34, 475-83 (1977), which are hereby incorporated by reference in their entirety. Potyvirus resistance can also be assayed via infectivity studies as generally described by Namba et al., “Protection of Transgenic Plants Expressing the Coat Protein Gene of Watermelon Virus ii or Zucchini Yellow Mosaic Virus Against Potyviruses,” Phytopath. 82:940946 (1992), which is hereby incorporated by reference in its entirety, wherein plants are scored as symptomatic when any inoculated leaf shows veinclearing, mosaic, or necrotic symptoms.
After the expression cassette is stably incorporated in transgenic plants, it can be transferred to other plants by sexual crossing. Any of a number of standard breeding techniques can be used, depending upon the species to be crossed. Once transgenic plants of this type are produced, the plants themselves can be cultivated in accordance with conventional procedure so that the nucleic acid construct is present in the resulting plants. Alternatively, transgenic seeds or propagules (e.g., cuttings) are recovered from the transgenic plants. These seeds can then be planted in the soil and cultivated using conventional procedures to produce transgenic plants.
In one aspect of the present invention, one or more of the nucleic acids of the present invention are inserted into a vector in the sense direction (5′→3′), such that the open reading frame is properly oriented for the expression of the encoded protein under the control of a promoter of choice. Single or multiple nucleic acids of the present invention may be ligated into an appropriate vector in this way under the control of the appropriate heterologous promoter and 3′ regulatory region.
In another aspect of the present invention, individual or multiple nucleic acid molecules of the present invention are incorporated into an appropriate vector in either the sense (5′→3′) or the antisense orientation (3′→5′), or any combination of the two. This involves inserting one or more of the nucleic acid sequences of the present invention into the restriction sites of a single vector, as described above, under the control of a single promoter with the DNA molecules operably linked 3′ to the promoter. The use of antisense RNA to down-regulate the expression of specific plant genes is well known (van der Krol et al., Nature, 333:866-869 (1988) and Smith et al., Nature, 334:724-726 (1988), which are hereby incorporated by reference in their entirety). Antisense RNA technology involves the production of an RNA molecule that is complementary to the messenger RNA of a target gene; the antisense RNA can potentially block all expression of the targeted gene. Accordingly, both antisense and sense forms of the nucleic acids of the present invention are suitable for use in the DNA constructs of the invention. A single construct may contain both sense and antisense forms of one or more papaya ripening genes. Likewise, both sense and antisense variations of the nucleic acids encoding PRSV-CP and papaya ripening proteins are suitable in the construct of the present invention, as are combinations of one or more papaya ripening genes linked to one or more PRSV-CP genes in any orientation. These constructs generally contain a nucleotide that is translatable into either a sense or antisense mRNA molecule.
Alternatively, the DNA construct of the present invention may be configured so that the DNA molecule encodes a mRNA which is not translatable, i.e., does not result in the production of a protein or polypeptide. This is achieved, for example, by introducing into the desired nucleic acid sequence of the present invention one or more premature stop codons, adding one or more bases (except multiples of 3 bases) to displace the reading frame, and removing the translation initiation codon (U.S. Pat. No. 5,583,021 to Dougherty et al., which is hereby incorporated by reference in its entirety). This can involve the use of a primer to which a stop codon, such as TAATGA, is inserted into the sense (or “forward”) PCR-primer for amplification of the full nucleic acid, between the 5′ end of that primer, which corresponds to the appropriate restriction enzyme site of the vector into which the nucleic acid is to be inserted, and the 3′ end of the primer, which corresponds to the 5′ sequence of the enzyme-encoding nucleic acid. Combinations of sense, antisense, translatable and non-translatable variations of the nucleic acids encoding ripening genes and PRSV-CP are suitable for the present invention. Constructs containing nontranslatable versions of the nucleic acids of the present invention may be particularly useful for results which employ PDR as a mechanism to achieve viral resistance in plants transformed with the DNA constructs of the present invention.
Another aspect of the present invention relates to a method of controlling the ripening of fruit and conferring viral resistance to plants. This involves transforming a plant with a single DNA construct of the present invention which contains nucleotide sequences for proteins or polypeptides which controls papaya ripening, as well as nucleotide sequences from the coat protein of PRSV, and regenerating the transformed plant cell under conditions appropriate to control ripening and impart viral resistance. Preparation of the DNA construct can be carried out as described above. Depending on whether enhanced/early ripening, or delayed ripening is desired, different configurations of the nucleic acids of the present invention are suitable in the construct. For example, choices as to sense or antisense orientation, translatable and non-translatable nucleotides, as well as promoters, will vary depending on the effect on the transformed plant that is desired. While both the ripening-related nucleotides and the viral coat protein nucleotides can be placed under the control of a single promoter, different promoters may also be used 5′ to each gene cassette if it is desirable to effect viral resistance and control of ripening at different times, in different tissues in the plant, and/or in differing intensities of expression.
Three cDNA clones for three isoforms of the papaya cell-wall softening enzyme β-galactosidase (β-Gal.41, β-Gal.45, and β-Gal.64) were isolated by RT-PCR. Degenerate oligonucleotides were designed based on alignment of regions of high homology of amino acid sequences between known β-galactosidase from other plants, and were used to amplify partial-length cDNA from reverse-transcribed total RNA of mature ripe (>70% yellow) papaya fruit mesocarp. The amplified fragments were then used as specific sequences for the RACE 5′/3′ technique to obtain full-length cDNAs. Amplification of the 5′ and 3′ ends was done using a RACE 5′/3′ kit (Boehringer, Roche Molecular Biochemicals, Germany) following the manufacturer's protocol. The degenerate oligonucleotides used for initial amplification were as follows:
Specific primers used to obtain full-length cDNA by RACE 5′/3′ were as follows:
After cloning, the full-length β-Gal.41 (SEQ ID NO: 5) and β-Gal.45 (SEQ ID NO: 1) were used to construct the multiple fruit ripening gene cassettes. The pEPJ vector, shown in
Construct 1 (“C1”): pTi-TL-Bgal41: Amplification of TL-Bgal41 (2.166 kb):
GGGCCCTCATGTTGAAGACAAACCTGGTCTTGTTC
GGATCCCCCGGGATTAGGGTTAAACTATAAACCTTTACC
Construct 2 (“C2”): pTi-TL-Bgal45: Amplification of TL-Bgal45 (1.998 kb)
GGGGGCCCAAGGACCTTTCAAG GCATACATGCAAAGA
CGGGATCCCCCGGGCACTGGGGCAGGGATCTCCAC
Construct 3 (“C3”): pTi-NTL-Bgal41: Amplification ofNTL-Bgal41 (2.166 kb)
GGGCCCTCATGTTGTAGACAAACCTGGTCTTGTTC
GGATCCCCCGGGATTAGGGTTAAACTATAAACCTTTACC
Construct 4 (“C4”): pTi-NTL-Bgal45: Amplification of NTL-Bgal45 (1.998 kb)
CGGGATCCCCCGGGCACTGGGGCAGGGATCTCCAC
GGGGGCCCAAGGACCTTTC AAGGCATACATGCAATAGA
Construct 5 (“C5”): pTi-ATL-Bgal41: Amplification of ATL-Bgal41 (2.166 kb)
GGGCCCTCATGTTGAAGACAAACCTGGTCTTGTTC
GGATCCCCCGGGATTAGGGTTAAACTATAAACCTTTACC
Construct 6 (“C6”): pTi-ATL-Bgal45: Amplification of ATL-Bgal45 (1.998 kb)
GGGGGCCCAAGGACCTTTCAAG GCATACATGCAAAGA
CGGGATCCCCCGGGCACTGGGGCAGGGATCTCCAC
Total RNA was extracted from papaya infected with the KE strain of PRSV. Reverse transcription and standard PCR were used to amply the coat protein region of KE using the following two primers, for 5′ and 3′ amplification, respectively. Italics indicate restriction site sequence added in the amplification step for cloning purposes.
The PCR fragment digested with NcoI/XbaI was ligated into pEPJ and/or pGA482G with the same restriction enzyme sites, or digested with ApaI/BamHI and ligated into the pEPJ vector.
The pEPJ86 cassette digested with HindIII-KpnI was ligated into transformation vector pGA482G. ApaI-BamHI digested fragments of non-translatable (NTL) were ligated into pEPJ-Kenco/xba vector and XhoI-KpnI (KpnI partial) digested fragments from the expression vector were then ligated into transformation vector pGA482G-KEnco/xba. XhoI-SmaI digested fragments of non-translatable (NTL) were ligated into pEPJ-KEapa/bam and XhoI-KpnI (KpnI partial) digested fragments from the expression vector were then ligated into transformation vector pGA482G, resulting in Constructs 7-10, as shown in
Construct 7 (“C7”): pTi-KE-NTL-Bgal41: Amplification of NTL-Bgal41 (2.216
GGGCCCTCATGTTGTAGACAAACCTGGTCTTGTTC
GGATCCCCCGGGATTAGGGTTAAACTATAAACCTTTACC
Construct 8 (“C8”): pTi-KE-NTL-Bgal45: Amplification of NTL-Bgal45 (2.120
CGGGATCCCCCGGGCACTGGGGCAGGGATCTCCAC
GGGGGCCCAAGGACCTTTC AAGGCATACATGCAATAGA
Construct 9 (“C9”): pTi-NTL-Bgal41-KE: Amplification of NTL-Bgal41 (2.216
GGGCCCTCATGTTGTAGACAAACCTGGTCTTGTTC
GGATCCCCCGGGATTAGGGTTAAACTATAAACCTTTACC
Construct 10 (“C10”): pTi-NTL-Bgal45-KE
CGGGATCCCCCGGGCACTGGGGCAGGGATCTCCAC
GGGGGCCCAAGGACCTTTCAAGGCATACATGCAATAGA
The pEPJ86 cassette digested with HindIII-KpnI was ligated into transformation vector pGA482G. ApaI-BamHI digested fragments of each conserved region of β-galactosidase isoenzymes β-Gal.41, β-Gal.45 and β-Gal.64 were ligated individually into pEPJ-KEnco/xba vector. XhoI-KpnI digested fragments from the expression vector were then ligated into transformation vector pGA482G-KEnco/xba, resulting in Constructs 11-13, as shown in
Construct 11 (“C11”): pTi-KE-CON-Bgal41
GGGGGCCCAGACGTACGTGTTTTGGAATGGGCAT
CGGGATCCCCGAAATTGGTGCCGCCGTG
Construct 12 (“C12”): pTi-KE-CON-Bgal45
GGGGGCCCAGACGTACGTGTTTTGGAATGGGCAT
CGGGATCCCCGAAATTGGTGCCGCCATG
Construct 13 (“C13”): pTi-KE-CON-βgal64
GGGGGCCCGAATGGAATTATGGGGGGGTTCC
CGGGATCCCCAAAGTTGGTGCCGCCATG
The pEPJ86 cassette digested with HindIII-KpnI was ligated into transformation vector pGA482G. XhoI-SmaI, SmaI-ApaI and ApaI-BamHI digested fragments of each conserved region of β-Gal.41, β-Gal.45, and β-Gal.64 were ligated together downstream of KE-CP into pEPJ-Kenco/xba vector. XhoI-KpnI digested fragments from the expression vector were then ligated into transformation vector pGA482G-KEnco/xba, resulting in Constructs 14-16, containing KE-CP and all conserved DNA sequences from all three β-Gal genes, as shown in
Construct 14 (“C14”): pTi-KE-CON-Bgal41-45-64
CCGCTCGAGAGACGTATGTGTTTTGGAATGGACAT
TCCCCCGGGCCAAAATTGGTGCCGCCGTG
TCCCCCGGGAGACGTACGTGTTTTGGAATGGGCAT
GGGGGCCCCCGAAATTGGTGCCGCCATG
GGGGGCCCGAATGGAATTATGGGGGGGTTCC
Construct 15 (“C15”): pTi-KE-CON-Bgal45-64-41
CCGCTCGAGAGACGTATGTGTTTTGGAATGGACAT
TCCCCCGGGCCGAAATTGGTGCCGCCATG
TCCCCCGGGGAATGGAATTATGGGGGGGTTCC
GGGGGCCCCCAAAGTTGGTGCCGCCATG
GGGGGCCCAGACGTACGTGTTTTGGAATGGGCAT
CGGGATCCCCGAAATTGGTGCCGCCATG
Construct 16 (“C16”): pTi-KE-CON-Bgal64-41-45
CCGCTCGAGGAATGGAATTATGGGGGGTTCCG
TCCCCCGGGCCAAAGTTGGTGCCGCCATG
Constructs were prepared which contained a KE-CP nucleotide and varying lengths of the open reading frame (ORF) of the β-Gal.41 gene. The pEPJ86 cassette digested with HindIII-KpnI was ligated into transformation vector pGA482G. ApaI-BamHI digested fragments amplified from the ORF of β-Gal.41 were ligated into pEPJ-KEnco/xba vector. XhoI-KpnI digested fragments from the expression vector were then ligated into transformation vector pGA482G-KEnco/xba resulting in Constructs 17-20, as shown in
Construct 17 (“C17”): pTi-KE-14TL-Bgal41
GGGGGCCCATGTTGAAGACAAACCTGGTCTTGTTC
CGGGATCCCATTTGTGCCTTGAAAGGTCCATT
Construct 18 (“C18”): pTi-KE-24TL-Bgal41
GGGGGCCCTGAACCTCAAGGGGGTCCAAT
CGGGATCCTGCCCCCATTTTGGCTCC
Construct 19 (“C19”): pTi-KIE-34TL-Bgal41
GGGGGCCCTTGAGGGATTTGCATAAAACCATCA
CGGGATCCCTGATAGTTGACCATTCACAAAAACATG
Construct 20 (“C20”): pTi-KE-44TL-Bgal41
GGGGGCCCCTGTATATGGACAATTGGAAAATCCCA
CGGGATCCTACCATCTCTGAGAAGCCTTTCCAC
Although the invention has been described in detail for the purpose of illustration, it is understood that such detail is solely for that purpose, and variations can be made therein by those skilled in the art without departing from the spirit and scope of the invention which is defined by the following claims.
This application claims the benefit of U.S. Provisional Patent Application Ser. No. 60/283,022, filed Apr. 11, 2001.
| Number | Name | Date | Kind |
|---|---|---|---|
| 5583021 | Dougherty et al. | Dec 1996 | A |
| 5767376 | Stiles et al. | Jun 1998 | A |
| 5998699 | Slightom et al. | Dec 1999 | A |
| 6002072 | McMaster et al. | Dec 1999 | A |
| 6046384 | McMaster et al. | Apr 2000 | A |
| 6069000 | Andersen et al. | May 2000 | A |
| 6124525 | Botella | Sep 2000 | A |
| 6750382 | Pang et al. | Jun 2005 | B1 |
| 6903248 | Pang et al. | Jun 2005 | B1 |
| 20030115633 | Pais et al. | Jun 2003 | A1 |
| 20030172397 | Gonsalves et al. | Sep 2003 | A1 |
| Number | Date | Country |
|---|---|---|
| WO 9621019 | Jul 1996 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 20030204869 A1 | Oct 2003 | US |
| Number | Date | Country | |
|---|---|---|---|
| 60283022 | Apr 2001 | US |
