Patent Application
20090285783
Generally, the present invention relates to a cancer therapy. More specifically, the present invention relates to an adenovirus-based cancer therapy.
Despite advances in both diagnosis and therapy, the annual number of cancer related deaths has not decreased during the past 60 years. Although conventional cancer therapies (surgery, radiotherapy, chemotherapy) produce a high rate of cure for patients with early stage disease, many cancers recur and the majority of patients with advanced cancer eventually succumb to the disease. The limitations of conventional cancer therapies do not derive from their inability to ablate tumor, but rather from limits on their ability to do so without excessively damaging the patient. It is this consideration that constrains the extent of surgical resection, the dose of radiation and volume to be irradiated, and the dose and combination of chemotherapeutic drugs. Improving the effectiveness of a treatment is of no clinical value if there is no significant increase in the differential response between tumor and normal tissue (i.e., therapeutic index).
Nonetheless, improved methods and novel agents for treating cancer have resulted in increased survival time and survival rate for patients with various types of cancer. For example, improved surgical and radiotherapeutic procedures result in more effective removal of localized tumors. Surgical methods, however, can be limited due, for example, to the location of a tumor or to dissemination of metastatic tumor cells. Radiotherapy also can be limited by other factors that limit the dose that can be administered. Tumors that are relatively radioresistant will not be cured at such a dose.
Although a single treatment modality such as radiation therapy, chemotherapy, surgery or immunotherapy can result in improvement of a patient, superior results can be achieved when such modalities are used in combination. In particular, treatment with a combination of radiotherapy, which can be directed to a localized area containing a tumor, and chemotherapy or immunotherapy, which provide a systemic mode of treatment, can be useful where dissemination of the disease has occurred or is likely to occur. Unfortunately, the therapeutic usefulness of radiation therapy can be limited where the tumor cells are relatively radioresistant, since the dose is limited by the tolerance of normal tissue in the radiation field. Thus, there exists a need to sensitize cancer tumors to the effects of radiotherapy so that it can more effectively reduce the severity of a tumor in a patient. Further, it would be useful to develop a treatment that more specifically isolates the location of the radiation, thus preventing the effects of radiation treatment on healthy cells.
In related fashion, to mitigate unwanted effects of some chemotherapies, adenovirus vectors have been used to transduce tumor cells with so-called “chemogenes” that convert a nontoxic substance, or “prodrug”, into a toxic, therapeutically effective form. Several new approaches involving gene therapy are under consideration for improving the therapeutic index of cancer therapies.
One of these approaches, so-called “suicide gene therapy,” involves the transfer and expression of non-mammalian genes encoding enzymes that convert non-toxic prodrugs into toxic anti-metabolites. Two “suicide genes” that are currently being evaluated in clinical trials are the E. coli cytosine deaminase (CD) and herpes simplex virus type-1 thymidine kinase (HSV-1 TK) genes, which confer sensitivity to 5-fluorocytosine (5-FC) and ganciclovir (GCV), respectively. Following targeted transfer of these genes to the tumor, the 5-FC and GCV prodrugs are converted locally into potent chemotherapeutic agents resulting in significant tumor cell death (see reference 1 (and the references cited therein) in the List of References Section below). Thus, the dose-limiting systemic toxicity associated with conventional chemotherapies is mitigated.
Previously, the bacterial CD and wild-type HSV-1 TK genes have been coupled to create a novel CD/HSV-1 TK fusion gene (see reference (hereinafter “ref.”) 1 in the List of References Section). The CD/HSV-1 TK fusion gene allows for combined use of CD/5-FC and HSV-1 TK/GCV suicide gene therapies. It has been previously demonstrated that CD/5-FC and HSV-1 TK/GCV suicide gene therapies render malignant cells sensitive to specific pharmacological agents and importantly, sensitize them to radiation (see refs. 1-9). Using a novel, oncolytic, replication-competent adenovirus (Ad5-CD/TKrep) containing the prototype CD/HSV-1 TK fusion gene (ref. 10), the safety and efficacy of replication-competent adenovirus-mediated double suicide gene therapy without and with radiation therapy in several preclinical cancer models (refs. 10-13) and more recently, in human prostate cancer patients (refs. 14 and 15) have been demonstrated.
In these clinical trials targeting human prostate cancer, the Ad5-CD/TKrep virus proved to be safe up to a dose of 1012 Vp when combined with up to 3 weeks of 5-FC and GCV (vGCV) prodrug therapy without (ref. 14) and with (ref. 15) conventional dose (70 Gy) three dimensional conformal radiation therapy (3DCRT). Moreover, these treatment regimens have demonstrated signs of clinical activity (refs 14 and 15).
Nonetheless, despite these advances, a significant need remains for inventions that comprise effective methods and compositions for use in cancer therapies. The present invention was developed in light of these and other drawbacks.
The present invention comprises novel, improved methods and compositions for cancer therapy which comprise a novel virus that can kill mammalian cancer cells efficiently. The virus produces a novel protein that converts non-toxic prodrugs into potent chemotherapeutic agents. These chemotherapeutic agents are produced locally and help the virus kill the cancer cells as well as sensitize them to radiation. In preclinical studies, the virus has proven effective at killing a variety of human cancer cells either alone or when combined with prodrug therapy and/or radiation therapy.
The invention comprises a novel, “second-generation” adenovirus (designated “Ad5-yCD/mutTKSR39rep-ADP”) with at least two significant improvements relative to the previously disclosed prototype Ad5-CD/TKrep virus. Ad5-yCD/mutTKSR39rep-ADP contains an improved yCD/mutTKSR39 fusion gene whose product is more efficient at converting the 5-FC and GCV prodrugs into their active chemotherapeutic agents. Moreover, Ad5-yCD/mutTKSR39rep-ADP expresses the Ad5 ADP protein, which significantly increases the oncolytic activity of replication-competent adenoviruses. Relative to the prototype Ad5-CDITKrep virus, Ad5-yCD/mutTKSR39rep-ADP has demonstrated greater viral oncolytic and chemotherapeutic activity in preclinical cancer models. The data suggest that the Ad5-yCD/mutTKSR39rep-ADP virus comprising the present invention will exhibit low toxicity and significant anti-tumor activity clinically when combined with 5-FC and GCV prodrug therapy and radiation therapy.
Other aspects of the invention will be apparent to those skilled in the art after reviewing the drawings and the detailed description below.
The present invention will now be described, by way of example, with reference to the accompanying drawings, in which:
Generally, the present invention comprises methods and compositions for the treatment for cancer. More specifically, the present invention provides a treatment that, when administered with prodrugs, can kill cancer cells and make the remaining cancer cells more sensitive to radiation.
Embodiments of the present invention include a novel virus that produces a protein that can convert non-toxic prodrugs into chemotherapeutic agents. The prodrugs can be produced locally or administered in conjunction with the treatment. Preferably, the virus is an oncolytic, replication-competent adenovirus such as, but not limited to, Ad5-yCD/mutTKSR39rep-ADP. When administered to a patient in need of such treatment, the adenovirus converts at least two prodrugs into chemotherapeutic agents. These prodrugs can include, but are not limited to, 5-fluorocytosine (5-FC) and ganciclovir (GCV and derivatives thereof).
In addition to the ability to convert the prodrugs into chemotherapeutic agents, embodiments of the present invention sensitize the cells to radiation. By sensitizing the cells, lower doses of radiation can be used without limiting the benefits of radiation. Further, the radiation therapy is more effective because the cancer cells are more sensitive to the radiation, while normal cells are not more sensitive, thus limiting the side effects of cancer treatments. The treatment of the present invention can be used in conjunction with other therapies such as surgery, chemotherapy, hormone therapy, and immunotherapy.
In preferred embodiments, the present invention comprises a novel, oncolytic, replication-competent adenovirus (Ad5-yCD/mutTKSR39rep-ADP) containing a yeast cytosine deaminase (yCD)/mutant SR39 herpes simplex virus type-1 thymidine kinase (mutTKSR39) fusion gene and the adenovirus type 5 (Ad5) adenovirus death protein (ADP) gene. Ad5-yCD/mutTKSR39rep-ADP replicates in and kills human cancer cells efficiently. Ad5-yCD/mutTKSR39rep-ADP produces a novel yCD/mutTKSR39 fusion protein that can convert two prodrugs, 5-fluorocytosine (5-FC) and ganciclovir (GCV; and GCV derivatives), into potent chemotherapeutic agents (referred to as double suicide gene therapy). Both yCD/5-FC and HSV-1 TKSR39 suicide gene therapies exhibit potent chemotherapeutic activity and sensitize tumor cells to ionizing radiation.
By way of example only, preclinical studies show that the Ad5-yCD/mutTKSR39rep-ADP virus is effective at killing a variety of human cancer cells when used by itself or when combined with double suicide gene therapy and/or radiation therapy. In a clinical setting, the Ad5-yCD/mutTKSR39rep-ADP virus could be used as a monotherapy for its virus-mediated oncolytic effect, it could be coupled with yCD/5-FC and HSV-1 Ad5-TKSR39/GCV suicide gene therapies for a combined viral oncolytic/chemotherapeutic effect, or it could be coupled with yCD/5-FC and HSV-1 TKSR39/GCV suicide gene therapies and radiation therapy for a combined viral oncolytic/chemotherapeutic/radiosensitization effect (referred to as trimodal therapy). Trimodal therapy could be combined with other conventional cancer treatments such as surgery, chemotherapy, hormone therapy and immunotherapy in the management of human cancer.
To develop further this gene therapy-based approach as a cancer treatment, a novel, second-generation adenovirus (Ad5-yCD/mutTKSR39rep-ADP) has been developed with two significant improvements relative to the prototype Ad5-CD/TKrep virus. Ad5-yCD/mutTKSR39rep-ADP contains an improved yCD/mutTKSR39 fusion gene whose product is more efficient at converting the 5-FC and GCV prodrugs into their active chemotherapeutic agents. Moreover, Ad5-yCD/mutTKSR39rep-ADP expresses the Ad5 ADP protein, which significantly increases the oncolytic activity of replication-competent adenoviruses. Relative to the prototype Ad5-CDITKrep virus, Ad5-yCD/mutTKSR39rep-ADP has demonstrated greater viral oncolytic and chemotherapeutic activity in preclinical cancer models.
Introduction of nucleic acid of the present invention by viral infection offers several advantages over the other listed methods. Higher efficiency can be obtained due to virus' infectious nature. Moreover, viruses are very specialized and typically infect and propagate in specific cell types. Thus, their natural specificity can be used to target the vectors to specific cell types in vivo or within a tissue or mixed culture of cells. Viral vectors can also be modified with specific receptors or ligands to alter target specificity through receptor mediated events.
Also, additional features can be added to the vector to ensure its safety and/or enhance its therapeutic efficacy. Such features include, for example, markers that can be used to negatively select against cells infected with the recombinant virus. An example of such a negative selection marker is the TK gene described above that confers sensitivity to the antibiotic gancyclovir. Negative selection is therefore a means by which infection can be controlled because it provides inducible suicide through the addition of antibiotic. Such protection ensures that if, for example, mutations arise that produce altered forms of the viral vector or recombinant sequence, cellular transformation will not occur.
Features that limit expression to particular cell types can also be included in some embodiments. Such features include, for example, promoter and regulatory elements that are specific for the desired cell type.
In addition, recombinant viral vectors are useful for in vivo expression of the nucleic acids of the present invention because they offer advantages such as lateral infection and targeting specificity. Lateral infection is inherent in the life cycle of, for example, retrovirus and is the process by which a single infected cell produces many progeny virions that bud off and infect neighboring cells. The result is that a large area becomes rapidly infected, most of which was not initially infected by the original viral particles. This is in contrast to vertical-type of infection in which the infectious agent spreads only through daughter progeny. Viral vectors can also be produced that are unable to spread laterally. This characteristic can be useful if the desired purpose is to introduce a specified gene into only a localized number of targeted cells.
As described above, viruses are very specialized infectious agents that have evolved, in many cases, to elude host defense mechanisms. Typically, viruses infect and propagate in specific cell types. The targeting specificity of viral vectors utilizes its natural specificity to specifically target predetermined cell types and thereby introduce a recombinant gene into the infected cell. The vector to be used in the methods of the invention will depend on desired cell type to be targeted and will be known to those skilled in the art. For example, if breast cancer is to be treated then a vector specific for such epithelial cells would be used. Likewise, if diseases or pathological conditions of the hematopoietic system are to be treated, then a viral vector that is specific for blood cells and their precursors, preferably for the specific type of hematopoietic cell, would be used.
The recombinant vector can be administered in several ways. For example, the procedure can take advantage of the target specificity of viral vectors and consequently do not have to be administered locally at the diseased site. However, local administration can provide a quicker and more effective treatment. Administration can also be performed by, for example, intravenous or subcutaneous injection into the subject. Following injection, the viral vectors will circulate until they recognize host cells with the appropriate target specificity for infection.
An alternate mode of administration can be by direct inoculation locally at the site of the disease or pathological condition or by inoculation into the vascular system supplying the site with nutrients. Local administration is advantageous because there is no dilution effect and, therefore, a smaller dose is required to achieve expression in a majority of the targeted cells. Additionally, local inoculation can alleviate the targeting requirement required with other forms of administration since a vector can be used that infects all cells in the inoculated area. If expression is desired in only a specific subset of cells within the inoculated area, then promoter and regulatory elements that are specific for the desired subset can be used to accomplish this goal. Such non-targeting vectors can be, for example, viral vectors, viral genome, plasmids, phagemids and the like. Transfection vehicles such as liposomes can also be used to introduce the non-viral vectors described above into recipient cells within the inoculated area. Such transfection vehicles are known by one skilled within the art.
The compound of the present invention is administered and dosed in accordance with good medical practice, taking into account the clinical condition of the individual patient, the site and method of administration, scheduling of administration, patient age, sex, body weight and other factors known to medical practitioners. The pharmaceutically “effective amount” for purposes herein is thus determined by such considerations as are known in the art. The amount must be effective to achieve improvement including but not limited to improved survival rate or more rapid recovery, or improvement or elimination of symptoms and other indicators as are selected as appropriate measures by those skilled in the art.
In the method of the present invention, the compound of the present invention can be administered in various ways. It should be noted that it can be administered as the compound and can be administered alone or as an active ingredient in combination with pharmaceutically acceptable carriers, diluents, adjuvants and vehicles. The compounds can be administered orally, subcutaneously or parenterally including intravenous, intraarterial, intramuscular, intraperitoneally, and intranasal administration as well as intrathecal and infusion techniques. Implants of the compounds are also useful. The patient being treated is a warm-blooded animal and, in particular, mammals including humans. The pharmaceutically acceptable carriers, diluents, adjuvants and vehicles as well as implant carriers generally refer to inert, non-toxic solid or liquid fillers, diluents or encapsulating material not reacting with the active ingredients of the invention.
It is noted that humans are treated generally longer than the mice or other experimental animals exemplified herein which treatment has a length proportional to the length of the disease process and drug effectiveness. The doses may be single doses or multiple doses over a period of several days. The treatment generally has a length proportional to the length of the disease process and drug effectiveness and the patient species being treated.
When administering the compound of the present invention parenterally, it will generally be formulated in a unit dosage injectable form (solution, suspension, emulsion). The pharmaceutical formulations suitable for injection include sterile aqueous solutions or dispersions and sterile powders for reconstitution into sterile injectable solutions or dispersions. The carrier can be a solvent or dispersing medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils.
Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Nonaqueous vehicles such a cottonseed oil, sesame oil, olive oil, soybean oil, corn oil, sunflower oil, or peanut oil and esters, such as isopropyl myristate, may also be used as solvent systems for compound compositions. Additionally, various additives which enhance the stability, sterility, and isotonicity of the compositions, including antimicrobial preservatives, antioxidants, chelating agents, and buffers, can be added. Prevention of the action of microorganisms can be ensured by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, and the like. In many cases, it will be desirable to include isotonic agents, for example, sugars, sodium chloride, and the like. Prolonged absorption of the injectable pharmaceutical form can be brought about by the use of agents delaying absorption, for example, aluminum monostearate and gelatin. According to the present invention, however, any vehicle, diluent, or additive used would have to be compatible with the compounds.
Sterile injectable solutions can be prepared by incorporating the compounds utilized in practicing the present invention in the required amount of the appropriate solvent with various of the other ingredients, as desired.
A pharmacological formulation of the present invention can be administered to the patient in an injectable formulation containing any compatible carrier, such as various vehicle, adjuvants, additives, and diluents; or the compounds utilized in the present invention can be administered parenterally to the patient in the form of slow-release subcutaneous implants or targeted delivery systems such as monoclonal antibodies, vectored delivery, iontophoretic, polymer matrices, liposomes, and microspheres. Many other such implants, delivery systems, and modules are well known to those skilled in the art.
In one embodiment, the compound of the present invention can be administered initially by intravenous injection to bring blood levels to a suitable level. The patient's levels are then maintained by an oral dosage form, although other forms of administration, dependent upon the patient's condition and as indicated above, can be used. The quantity to be administered will vary for the patient being treated.
Unless stated otherwise or suggested by context, the following terms and phrases have the meaning provided below.
The term “gene therapy” as used herein refers to the transfer of genetic material (e.g. DNA or RNA) of interest into a host to treat or prevent a genetic or acquired disease or condition phenotype. The genetic material of interest encodes a product (e.g. a protein, polypeptide, peptide, functional RNA, antisense) whose production in vivo is desired. For example, the genetic material of interest can encode a hormone, receptor, enzyme, polypeptide or peptide of therapeutic value. The genetic material of interest can also encode a suicide gene. For a review see, in general, the text “Gene Therapy” (Advances in Pharmacology 40, Academic Press, 1997).
The phrase “in vivo gene therapy” refers to when the genetic material to be transferred is introduced into the target cells of the recipient organism in situ, which is within the recipient. After therapy, the genetically altered target cells express the transfected genetic material in situ. Such therapy also includes repairing the gene in situ, if the host gene is defective.
The phrase “gene expression vehicle” refers to any vehicle capable of delivery/transfer of heterologous nucleic acid into a host cell. The expression vehicle may include elements to control targeting, expression and transcription of the nucleic acid in a cell selective manner as is known in the art. It should be noted that often the 5′UTR and/or 3′UTR of the gene may be replaced by the 5′UTR and/or 3′UTR of the expression vehicle. Therefore, as used herein the expression vehicle may, as needed, not include the 5′UTR and/or 3′UTR of the actual gene to be transferred and only include the specific amino acid coding region. The expression vehicle can include a promoter for controlling transcription of the heterologous material and can be either a constitutive or inducible promoter to allow selective transcription. Enhancers that may be required to obtain necessary transcription levels can optionally be included. Enhancers are generally any non-translated DNA sequence which works contiguously with the coding sequence (in cis) to change the basal transcription level dictated by the promoter. The expression vehicle can also include a selection gene.
1. Description of the Ad5-yCD/mutTKSR39rep-ADP Adenovirus
The complete and partial DNA and translated protein sequences of the Ad5-yCD/mutTKSR39rep-ADP adenovirus, yCD/mutTKSR39 fusion gene and ADP gene (SEQ ID NOs. 1-5) are disclosed following the List of References Section. The following examples are presented in view of such sequences.
The Ad5-yCD/mutTKSR39rep-ADP virus (SEQ ID NO. 1) of the examples is a replication-competent, type 5 adenovirus (the sequence of which is readily known and obtainable to one skilled in the art) that contains an improved yCD/mutTKSR39 fusion gene in the E1 region and the Ad5 ADP gene in the E3 region. A schematic representation of Ad5-yCD/mutTKSR39rep-ADP is provide in
Ad5-yCD/mutTKSR39rep-ADP contains a 1,255 base pair (bp) deletion (bases 2,271 to 3,524) in the 55 kDa E1B gene (see SEQ ID NO. 2). Using methods known to those of ordinary skill in the art, two premature translation stop codons were engineered into the 55 kDa E1B gene resulting in the production of a truncated, non-functional, 78 amino acid E1B protein. Ad5-yCD/mutTKSR39rep-ADP expresses the wild-type Ad5 E1A and 19 kDa E1B proteins. The yCD/mutTKSR39 fusion gene (SEQ ID NO. 4) was inserted in place of the deleted 55 kDa E1B gene. Expression of the yCD/mutTKSR39 fusion gene is driven by the human cytomegalovirus (CMV) promoter and utilizes simian virus 40 (SV40) polyadenylation elements. The yCD/mutTKSR39 fusion gene codes for a 59 kDa yCD/mutTKSR39 fusion protein, which is capable of enzymatically converting 5-flurocytosine (5-FC) into fluorouracil (5-FU) and ganciclovir (GCV) and its derivatives into their corresponding monophosphates (e.g. GCV-MP). The downstream metabolic products of 5-FU and GCV-MP are potent inhibitors of DNA replication and result in the death of dividing cells. These downstream metabolic products are also potent radiosensitizers and can markedly increase the therapeutic effect of radiation therapy (see refs. 1-14). Cells that express the yCD/mutTKSR39 fusion protein, as well as neighboring cells via the bystander effect, are killed by yCD/5-FC and HSV-1 TKSR39/GCV suicide gene therapies and are sensitized to the killing effects of ionizing radiation.
Ad5-yCD/mutTKSR39rep-ADP also contains a 2.68 kb deletion in the E3 region (bases 28,133 to 30,181), which affects genes that suppress the host immune response but are unnecessary for virus replication (see SEQ ID NO. 3). Ad5-yCD/mutTKSR39rep-ADP contains an Ad5 ADP expression cassette in place of the natural Ad5 E3 genes. Expression of the ADP gene (SEQ ID NO. 5) is driven by the human cytomegalovirus (CMV) promoter and utilizes simian virus 40 (SV40) polyadenylation elements. The authentic 111.6 kDa Ad5 ADP protein is produced, which significantly increases the oncolytic activity of replication-competent adenoviruses. Ad5-yCD/mutTKSR39rep-ADP lacks all other known Ad5 E3 genes (gp19, 10.4 kDa, 14.5 kDa and 14.7 kDa genes).
2. Construction of the Ad5-yCD/mutTKSR39rep-ADP Adenovirus
Plasmids containing adenoviral sequences used in the construction of Ad5-yCD/mutTKSR39rep-ADP were obtained from Microbix (Toronto, Canada). To generate the pCMV-yCD/mutTKSR39 expression plasmid (left-end vector), the mutant SR39 HSV-1 TK gene (ref. 16) was generated by the polymerase chain reaction (PCR) using linearized pET23d:HSVTKSR39 as template. The following primer pair was used to generate the mutTKSR39 PCR product:
The resulting 1,128 bp fragment was digested with BamHI (GGATCC)+EcoRI (GAATTC) and cloned between the BamHI+EcoRI sites of pCA14-CDglyTK-E1aE1b (ref. 10) after removal of the prototype CD/HSV-1 TK fusion gene generating pCA14-CMV-mutTKsR39-E1aE1b. The yCD gene (ref. 17) was generated by PCR using linearized pBAD-ByCD as template. The following primer pair was used to generate the yCD PCR product:
The resulting 526 bp fragment was digested with XhoI (CTCGAG)+NheI (GCTAGC) and cloned between the XhoI+NheI sites of pCA14-CMV-mutTKSR39-E1aE1b generating pCA14-CMV-yCD/mutTKSR39−E1aE1b.
To generate pBHG10-PacImod-CMV-ADP (right-end vector), the ADP gene was generated by PCR and cloned between the PacI and SwaI sites of pBHG10-PacImod. pBHG10-PacImod is a derivative of pBHG10 (Microbix; Toronto, Canada) and contains PacI and SwaI sites in the E3 region to facilitate directional cloning.
pBHG10 is a plasmid that contains the entire adenovirus type 5 genome minus bases 188 to 1,339 in the E1 region and bases 28,133 to 30,818 in the E3 region. Using wild-type Ad5 DNA as template, a 333 bp PCR product containing the ADP gene was generated. The following primer pair was used to generate the ADP PCR product:
The resulting 333 bp PCR product was digested with BamHI (GGATCC)+HindIII (AAGCTT) and cloned into BamHI-HindIII digested pCA14 (Microbix; Toronto, Canada) generating pCA14-ADP. The entire CMV-ADP-SV40 polyA expression cassette was generated by PCR using the following primer pair:
A SwaI restriction site (ATTTAAAT) was introduced upstream of the CMV promoter in the 5′ primer and a PacI restriction site (TTAATTAA) was introduced downstream of the SV40 poly A region with the 3′primer. The PCR product was digested with SwaI and PacI and cloned into SwaI-PacI digested pBGH10-PacImod generating pBGH10-PacImod-CMV-ADP.
To generate Ad5-yCD/mutTKSR39rep-ADP virus, pCA14-CMV-yCD/mutTKSR39-E1aE1b (10 μg) was linearized by PvuI digestion and co-transfected with ClaI-linearized pBHG10-PacImod-CMV-ADP (30 μg) into HEK 293 cells (Microbix) using the CaPO4-DNA precipitation method. Isolated plaques were harvested 7-14 days later and plaque-purified a second time on HEK 293 cells. Virus form twice purified plaques was used to infect HEK 293 cells to generate crude viral supernatants and CsCl gradient-purified adenovirus.
3. Advantage of the ADP Gene Contained in Ad5-yCD/mutTKSR39rep-ADP in vitro
Human DU145 prostate adenocarcinoma cells were plated in a 24-well plate at a concentration of 5×104 cells/well and were infected with graded amounts of thee Ad5-CD/TKrep (lane 1) and Ad5-yCD/mutTKSR39rep-ADP viruses (lane 2). Five days later, cells were fixed and stained with crystal violet. The results (as shown in
4. Advantage of the yCD/mutTKSR39 Gene Contained in Ad5-yCD/mutTKSR39rep-ADP in vitro
LNCaP C4-2 cells were mock-infected (lanes 1 & 5), or infected with Ad5-CD/TKrep (lanes 2 & 6), Ad5-yCD/mutTKSR39rep-ADP (lanes 3 & 7), Ad5-yCD/mutTKSR39 rep-hNIS (lanes 4 & 8) at a MOI of 10. Seventy two hours later, cells were examined for CD activity using [14C]-cytosine (lanes 1-4) and [3H]-5-FC (lanes 4-8) as substrates. The results are shown in
Cells (106 cells, 60 mm dish) were mock-infected or infected with Ad5-CD/TKrep or Ad5-yCD/mutTKSR39rep-ADP at an MOI of 3. The next day, cells were replated (24 well plate) in medium containing varying concentrations of 5-FC (wells 3-7 and 15-19, going left to right, top to bottom) or GCV (wells 8-12 and 20-24, going left to right, top to bottom) in μg/ml. Cells were stained with crystal violet 9 days later. The results (as shown in
The results of this example also demonstrate that yCD/5-FC and HSV-1 TKSR39/GCV suicide gene therapies can be used to increase the therapeutic effect of the Ad5-yCD/mutTKSR39rep-ADP virus itself. Ad5-yCD/mutTKSR39rep-ADP contains a novel yCD/mutTKSR39 fusion gene whose product has improved catalytic activity relative to the CD/HSV-1 TK fusion protein produced by the prototype Ad5-CD/TKrep virus. Recombinant adenoviruses that express the improved yCD/mutTKSR39 fusion protein demonstrate significantly greater conversion of 5-FC into 5-FU, and possibly GCV into GCV-MP, than viruses that express the prototype CD/HSV-1-TK fusion protein. Thus, yCD/5-FC and HSV-1 TKSR39/GCV suicide gene therapies can be used independently and together to augment the tumor destructive effects of the Ad5-yCD/mutTKSR39rep-ADP virus.
5. Advantage of the ADP Gene Contained in Ad5-yCD/mutTKSR39rep-ADP in vivo
Intramuscular (leg) C33A tumors (150-200 mm3) were injected with 1010 vp of Ad5-CD/TKrep or Ad5-CD/TKrep-ADP on Days 0, 2 and 4 (arrowheads in
aMedian survival is in days.
bAd5-CD/TKrep-ADP vs. Ad5-CD/TKrep
cAd5-CD/TKrep-ADP + 5-FC + GCV vs. Ad5-CD/TKrep + 5-FC + GCV
6. Effectiveness of Ad5-yCD/mutTKSR39rep-ADP in vivo in Mouse Model
Male SCID mice bearing intraprostatic LNCaP C4-2 tumors (˜25-50 mm3 in size) were injected with about 109 vp of Ad5-yCD/mutTKSR39rep-ADP on Day 0 (arrowhead in
aAd5-yCD/mutTKSR39rep-ADP vs. PBS;
bAd5-yCD/mutTKSR39rep-ADP + 5-FC + GCV vs. PBS.
7. Radiosensitized Human Cancer Cells Using yCD/5-FC and HSV-1 TKSR39/GCV
As shown in previous experiments by the inventors (see refs. 1-14), yCD/5-FC and HSV-1 TKSR39/GCV suicide gene therapies can also be used to radiosensitize human cancer cells. Ad5-yCD/mutTKSR39rep-ADP contains a novel yCD/mutTKSR39 fusion gene whose product has improved catalytic activity relative to the CD/HSV-1 TK fusion protein produced by the prototype Ad5-CD/TKrep virus. The previous studies demonstrated that CD/5-FC and HSV-1 TK/GCV suicide gene therapies can sensitize human tumor cells to ionizing radiation. Thus, since Ad5-yCD/mutTKSR39 rep-ADP expresses an improved yCD/mutTKSR39 fusion protein, it may result in greater tumor cell radiosensitization in vivo.
Throughout this application, various references are noted by reference numbers. A numbered list of these references with their full citations is provided below. The disclosures of these references in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which this invention pertains.
While the present invention has been particularly shown and described with reference to the foregoing preferred and alternative embodiments, and examples, it should be understood by those skilled in the art that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention without departing from the spirit and scope of the invention as defined in the following claims. It is intended that the following claims define the scope of the invention and that the method and composition within the scope of these claims and their equivalents be covered thereby. This description of the invention should be understood to include all novel and non-obvious combinations of elements described herein, and claims may be presented in this or a later application to any novel and non-obvious combination of these elements. The foregoing embodiments are illustrative, and no single feature or element is essential to all possible combinations that may be claimed in this or a later application. Where the claims recite “a” or “a first” element of the equivalent thereof, such claims should be understood to include incorporation of one or more such elements, neither requiring nor excluding two or more such elements.
TCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTGGGGATCTTCGAGTCGAGGGATCCCTC
GAGC
TCCT
ATTGGCGGATGTCTTATCAATAACAAAGACGGAAGTGTTCTCGGTCGTGGTCACAACATGAGATTTCAAAAGGGATCCGCCACACTACATGGTGAG
ATCT
CCACTTTGGAAAACTGTGGGAGATTAGAGGGCAAAGTGTACAAAGATACCACTTTGTATACGACGCTGTCTCCATGCGACATGTGTACAGGTGCCA
TCAT
CATGTATGGTATTCCACGCTGTGTTGTCGGTGAGAACGTTAATTTCAAAAGTAAGGGCGAGAAATATTTACAAACTAGAGGTCACGAGGTTGTTGT
TGTT
GACGATGAGAGGTGTAAAAAGATCATGAAACAATTTATCGATGAAAGACCTCAGGATTGGTTTGAAGATATTGGTGAG
GGTGGAGGGGGAGGCGGT
GGGG
GAGGT
GCTAGC
ATGGCTTCGTACCCCTGCCATCAACACGCGTCTGCGTTCGACCAGGCTGCGCGTTCTCGCGGCCATAGCAACCGACGTACGGCGT
ATTTAAATAATTCCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATG
TTTA
CCCCAAGTTCATGCCTTTGTCAATGACTGGGCGAGCTTGGACATGTGGTGGTTTTCCATAGCGCTTATGTTTGTTTGCCTTATTATTATGTGGCTT
ATTT
GTTGCCTAAAGCGCAGACGCGCCAGACCCCCCATCTATAGGCCTATCATTGTGCTCAACCCACACAATGAAAAAATTCATAGATTGGACGGTCTGA
AACC
ATGTTCTCTTCTTTTACAGTATGATTAAATGAGACATGATTCCAAGCTTGTCGACTTCGAGCAACTTGTTTATTGCAGCTTATAATGGTTACAAAT
AAAG
ATGGGGACAGGGGGAATGGCAAGCAAGTGGGATCAGAAGGGTATGGACATTGCCTATGAGGAGGCGGCCTTAGGTTACAAAGAGGGTGGT
GTTCCTATTGGCGGATGTCTTATCAATAACAAAGACGGAAGTGTTCTCGGTCGTGGTCACAACATGAGATTTCAAAAGGGATCCGCCACA
CTACATGGTGAGATCTCCACTTTGGAAAACTGTGGGAGATTAGAGGGCAAAGTGTACAAAGATACCACTTTGTATACGACGCTGTCTCCA
TGCGACATGTGTACAGGTGCCATCATCATGTATGGTATTCCACGCTGTGTTGTCGGTGAGAACGTTAATTTCAAAAGTAAGGGCGAGAAA
TATTTACAAACTAGAGGTCACGAGGTTGTTGTTGTTGACGATGAGAGGTGTAAAAAGATCATGAAACAATTTATCGATGAAAGACCTCAG
GATTGGTTTGAAGATATTGGTGAG
GGTGGAGGGGGAGGCGGTGGGGGAGGTGCTAGC
ATGGCTTCGTACCCCTGCCATCAACACGCGTCT
| Number | Date | Country | Kind |
|---|---|---|---|
| PCT/US04/22320 | Jul 2004 | US | national |
This application claims priority based on U.S. Provisional Patent Application No. 60/486,219, filed Jul. 9, 2003, which is hereby incorporated by reference in full.
| Number | Date | Country | |
|---|---|---|---|
| 60486219 | Jul 2003 | US |
