The present invention pertains to the field of hematopoietic stem cells and more specifically to methods and compositions useful for expanding hematopoietic stem and/or progenitor cells.
Although umbilical cord blood (CB)-derived hematopoietic stem cells (HSCs) are essential in many life-saving regenerative therapies, their limited number in CB units has significantly restricted their clinical use and the subsequent advantages they provide during transplantation (Miller et al. 2013). Select small molecules that enhance hematopoietic stem and/or progenitor cell (HSPC) expansion in culture have been identified (Boitano et al. 2010; Fares et al., 2014) however, in many cases their mechanisms of action or the nature of the pathways they impinge on are poorly understood. A greater understanding of the molecular pathways that underpin the unique human HSC self-renewal program will facilitate the development of targeted strategies that expand these critical cell types for regenerative therapies. Whereas transcription factor networks have been shown to influence the self-renewal and lineage decisions of human HSCs (Novershtern et al., 2011; Laurenti et al., 2013), the post-transcriptional mechanisms guiding HSC fate have not been closely investigated.
In one aspect, the inventors have shown that overexpression of the RNA-binding protein (RBP) Musashi-2 (MSI2) induces multiple pro-self-renewal phenotypes. Overexpression of MSI2 resulted in a 17-fold increase in short-term repopulating cells and a net 23-fold ex vivo expansion of long-term repopulating HSCs. The inventors have also determined that MSI2 directly attenuates aryl hydrocarbon receptor (AHR) signaling through post-transcriptional downregulation of canonical AHR pathway components in cord blood (CB) HSPCs by performing a global analysis of MSI2-RNA interactions. This provides new insights into RBP-controlled RNA networks that underlie the self-renewal process. These networks may be manipulated to enhance the regenerative potential of human HSCs. Examination of MSI2 OE-induced differentially expressed genes found Cytochrome P450 1B1 Oxidase (CYP1B1), an effector of AHR signaling (Mimura et al., 2013) amongst the most repressed. As shown in the Examples, a number of inhibitors of CYP1B1, including but not limited to (E)-2,3′,4,5′-Tetramethoxystilbene (TMS), Chrysin, Narigenin and Acacetin as well as siRNA that targets CYP1B1 expression have also been demonstrated to promote the self-renewal and expansion of hematopoietic stem and progenitor cell cultures.
Accordingly, in one aspect there is provided a method of increasing the self-renewal and/or expansion of hematopoietic stem and/or progenitor cells (HSPCs) by increasing the expression of MSI2 in a population of one or more HSPCs.
In another aspect, there is provided a method of increasing the renewal and/or expansion of HSPCs by inhibiting the activity and/or expression of cytochrome P450 1B1 (CYP1B1) in a population of one or more HSPCs.
In one embodiment, the HSPCs are CD34+ cells. Optionally, the HSPCs are from cord blood, umbilical cord, mobilized peripheral blood or bone marrow. In one embodiment, the HSPCs are in vivo, ex vivo or in vitro.
In one embodiment, the methods described herein comprise contacting HSPCs with a CYP1B1 inhibitor. Examples of CYP1B1 inhibitors include, but are not limited to stilbenoids, flavonoids, coumarins or alkaloids. In one embodiment, the stilbenoid is 2,3′,4,5′-TMS. Additional examples of CYP1B1 inhibitors include antisense and/or siRNA molecules that target CYP1B1 expression, such as shRNA.
In one embodiment, CYP1B1 inhibitor is a flavonoid selected from 3,5,7-Trihydroxy-2-(4-hydroxyphenyl)-4H-chromen-4-one (Kaempferol), 5,7-Dihydroxy-2-phenyl-4H-chromen-4-one (Chrysin), 5,7-Dihydroxy-2-(4-hydroxyphenyl)chroman-4-one (Naringenin), 3,6,7-Trihydroxy-2-(4-hydroxy-3-methoxyphenyl)-4H-chromen-4-one (Isohamnetin), 3′,5-Dihydroxy-4′,6,7-trimethoxyflavone (Eupatorin), 2-(3,4-Dihydroxyphenyl)-5,7-dihydroxy-4-chromenone (Luteolin), 5,7-dihydroxy-2-(4-methoxyphenyl)-4H-1-benzopyran-4-one (Acacetin), 2-(3,4-Dimethoxyphenyl)-5,6,7,8-tetramethoxychromen-4-one (Nobiletin), 2-(3,4-dihydroxyphenyl)-3,5,7-trihydroxy-4H-chromen-4-one (Quercetin), 5,7-Dihydroxy-2-(4-hydroxyphenyl)-4H-1-benzopyran-4-one (Apigenin), 5,7-Dihydroxy-3-(4-hydroxyphenyl)chromen-4-one (Genistein), 7-Hydroxy-3-(4-hydroxyphenyl) chromen-4-one (Daidzein) and 5-hydroxy-3-(4-hydroxyphenyl)-7-methoxychromen-4-one (Prunetin).
In one embodiment, the CYP1B1 inhibitor is a coumarin such as is 6-,7-dihydroxycoumarin or 5-methoxypsoralen (bergapten).
In one embodiment, the CYP1B1 inhibitor is an alkaloid such as evodiamine.
In one embodiment, the CYP1B1 inhibitor is chrysin, Naringenin, Bergapten, 6-,7-dihydroxycoumarin or Quercetin.
In one embodiment, the CYP1B1 inhibitor is evodiamine, 6,7-dihydroxycoumarin, bergapten, chrysin, naringenin, isohamnetin, eupatorin, liteloin, acacetin, kaempferol, nobiletin, quercetin, apigenin, genistein, daidzein, prunetin or TMS.
In one embodiment, the CYP1B1 inhibitor has an IC50 of less than 10 μM.
In one embodiment, the CYP1B1 inhibitor increases the frequency of CD34+ cells in the population of cells relative to a control population of cells. In one embodiment, the CYP1B1 inhibitor increases the number of CD34+ cells in the population of cells relative to a control population of cells.
In another embodiment, the methods described herein comprise contacting HSPCs with a MSI2 activator.
In yet another embodiment, the methods described herein comprise contacting HSPCs with a CYP1B1 inhibitor and an agent that induces hematopoiesis, optionally SR1 or a pyrimidoindole derivative.
In another aspect, there is provided a population of HSPCs expanded using the methods described herein. In one embodiment, the expanded HSPCs are for administration or use in the treatment of a subject in need thereof. The HSPCs may be autologous HSPCs or allogenic HSPCs. In one embodiment, the subject has a hematopoietic disorder, malignancy, autoimmune disease and/or immunodeficiency. In one embodiment, the subject has a thalassemia or anemia. In one embodiment, the subject has a cancer such as blood cancer or bone marrow cancer. In one embodiment the subject has lymphoma, multiple myeloma or leukemia.
In one embodiment, there is provided a method for increasing the self-renewal and/or expansion of HSPCs in a subject in need thereof. In one embodiment, the method comprises administering to the subject a CYP1B1 inhibitor and/or an agent that increases the activity and/or expression of MSI2 as described herein. In one embodiment, the CYP1B1 inhibitor and/or agent that increases the activity and/or expression of MSI2 is administered before, concurrently or after the transplantation of autologous or allogenic HSPCs to the subject.
Also provided is a CYP1B1 inhibitor and/or an agent that increases the activity and/or expression of MSI2 as described herein for use in increasing the self-renewal and/or expansion of HSPCs in a subject in need thereof. In one embodiment, the CYP1B1 inhibitor and/or agent that increases the activity and/or expression of MSI2 is administered before, concurrently or after the transplantation of autologous or allogenic HSPCs cells to the subject.
Optionally, the methods and/or uses described include the administration or use of an agent that induces hematopoiesis such as SR1 or a pyrimidoindole derivative, concurrently or after the transplantation of autologous or allogenic HSPCs cells to the subject.
In one embodiment, there is provided a composition comprising a CYP1B1 inhibitor as described herein and an agent that induces hematopoiesis such as SR1 or a pyrimidoindole derivative. In one embodiment, there is provided a composition comprising an agent that increases the activity and/or expression of MSI2 as described herein and an agent that induces hematopoiesis such as SR1 or a pyrimidoindole derivative. In one embodiment, the composition is a growth media, such as a growth media suitable for HSPCs. In one embodiment, the composition is a pharmaceutical composition suitable for administration to a subject in need thereof.
In another aspect, there is provided a composition comprising one or more HSPCs and a CYP1B1 inhibitor. In a further aspect, there is provided a composition comprising one or more HSPCs and a MSI2 activator. In one embodiment, the composition is a cell culture. In another embodiment, the composition is a pharmaceutical composition, optionally for administration or use in the treatment of a subject in need thereof. For example, in one embodiment, the composition is for use in the treatment of a hematopoietic disorder, malignancy, autoimmune disease and/or immunodeficiency that would benefit from the transplantation of HSPCs.
In another aspect, there is provided a method of producing a culture of leukemic cells. In one embodiment, the method comprises inhibiting the activity and/or expression of cytochrome P450 1B1 (CYP1B1) in a population of one or more leukemic cells. In another embodiment, the method comprises increasing the activity and/or expression of Mushashi-2 (MSI2) in a population of one or more leukemic cells. In one embodiment, the cells are in vitro. In one embodiment, the cells are cultured in the presence of a CYP1B1 inhibitor. In one embodiment, the leukemic cells are acute myeloid leukemia (AML) cells.
In another aspect, there is provided a method for identifying agents with activity against leukemic cells that may be useful as chemotherapeutic agents. In one embodiment, the method comprises providing a culture of leukemic cells produced using the methods described herein, contacting the culture of leukemic cells with a test agent and determining whether the test agent inhibits the proliferation of leukemic cells in the cell culture relative to a control.
Other features and advantages of the present disclosure will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples while indicating embodiments of the disclosure are given by way of illustration only, since various changes and modifications within the spirit and scope of the disclosure will become apparent to those skilled in the art from this detailed description.
The disclosure will now be described in relation to the drawings in which:
The inventors have determined that overexpression of the RNA-binding protein (RBP) Musashi-2 (MSI2) induces multiple pro-self-renewal phenotypes. MSI2 has also been shown to attenuate aryl hydrocarbon receptor (AHR) signaling in HSPCs. Remarkably, the inventors have also shown that directly inhibiting CYP1B1 results in an increase in self-renewal and expansion of HSPCs. Previously, CY1B1 expression has been used as an indicator of AHR signaling activity however it was not know that inhibiting CYP1B1 activity could be used to expand HSPCs.
As used herein, “hematopoietic stem cell” refers to a cell that is capable of self-renewal and differentiating into all specialized cell types of the hematopoietic lineage.
As used herein, “hematopoietic progenitor cell” refers to a cell that is lineage restricted and capable of giving rise to either the myeloid or lymphoid lineage of cells.
As used herein “differentiation” refers to the process by which a less specialized cell such as a stem cell develops or matures to possess a more distinct form and function with a concomitant loss of potential. Cells that are less specialized can be differentiated into cells that are more specialized by culturing the cells under particular conditions or in specific media as known in the art.
As used herein “culturing” refers to maintaining cells in media with or without cell division or differentiation for any period of time.
As used herein, “hematopoietic lineage” refers to cells that give rise to cells typically found in the blood including hematopoietic stem cells, hemogenic precursors and mature cell types from the myeloid lineages (monocytes and macrophages, neutrophils, basophils, eosinophils, erythrocytes, megakaryocytes/platelets, dendritic cells), and lymphoid lineages (T-cells, B-cells, NK-cells).
The term “leukemia” as used herein refers to any disease involving the progressive proliferation of abnormal leukocytes found in hematopoietic tissues, other organs and usually in the blood in increased numbers. “Leukemic cells” refers to leukocytes characterized by an increased abnormal proliferation of such cells.
As used herein, “acute myelogenous leukemia” (“AML”) refers to a cancer of the myeloid line of blood cells, characterized by the rapid growth of abnormal white blood cells that accumulate in the bone marrow and interfere with the production of normal blood cells.
The term “subject” as used herein includes all members of the animal kingdom including mammals, and suitably refers to humans. Optionally, the term “subject” includes mammals that have been diagnosed with a hematopoietic disorder, malignancy, autoimmune disease and/or immunodeficiency. In one embodiment, the subject is a subject in need of a transplant of HSPCs. In one embodiment, the subject has received, is in the process of receiving, or will receive a transplant of HSPCs.
In one embodiment, there is provided a method of increasing the self-renewal and/or expansion of hematopoietic stem and progenitor cells (HSPCs) by inhibiting the activity and/or expression of cytochrome P450 1B1 (CYP1B1). In one embodiment, the method comprises inhibiting CYP1B1 in a population of cells comprising one or more HSPCs.
In another embodiment, there is provided a method of increasing the self-renewal and/or expansion of HSPCs by increasing the expression or activity of Musashi-2 (MSI2) in a population of one or more HSPCs.
In one embodiment, expanding the HSPCS increases the frequency and/or number of HSPCs in the population of cells. For example, inhibiting CYP1B1 or increasing the expression or activity of MSI2 in a population of HSPCs may increase the relative number of HSPCs relative to other cell types and/or total number of HSPCs in a population of cells. In one embodiment, inhibiting CYP1B1 increases the frequency and/or number of HSPCs in a population of cells relative to a control population wherein CYP1B1 has not been inhibited. In another embodiment, increasing the expression or activity of MSI2 increases the frequency and/or number of HSPCs in a population of cells relative to a control population wherein expression or activity of MSI2 has not been increased.
In one embodiment, expanding the HSPCS increases the frequency and/or number of HSPCs in the population of cells by at least 5%, 10%, 25%, 50%, 75%, 100%, 150% or 200% relative to the control population of cells.
The methods and compositions described herein may be used to expand an initial population of one or more HSPCs. For example, in one embodiment the initial HSPCs are from cord blood, umbilical cord, mobilized peripheral blood or bone marrow.
In one embodiment, the methods described herein comprise testing a population of cells for the expression of one or more biomarkers. In one embodiment, cells are isolated from a population of cells comprising HSPCs prior to or after expanding the HSPCs using the methods described herein. In one embodiment, one or more HSPCs that express certain biomarkers are separated from a population of cells using positive or negative selection techniques. For example, in one embodiment HSPCs are separated from a sample of cord blood prior to contacting the HSPCs with a CYP1B1 inhibitor or a MSI2 activator. In one embodiment, the cells are separated using Fluorescence Activated Cell Sorting (FACS) or other techniques for separating cells based on the expression of specific markers known in the art.
In one embodiment, hematopoietic stem cells may be separated from a population of HPSCs after expansion to produce a population of isolated hematopoietic stem cells. In another embodiment, hematopoietic progenitor cells may be separated from a population of HPSCs after expansion to produce a population of isolated hematopoietic progenitor cells, optionally common myeloid progenitors or common lymphoid progenitors.
In one embodiment, biomarkers for human hematopoietic stem cells are CD34+, CD59+, CD90/Thy1+, CD38low/−, c-Kit−/low, and/or Lin−.
In one embodiment, biomarkers for human hematopoietic progenitor cells include CD34 and Flt-3/Flk-2. Human hematopoietic progenitor cells include two types of progenitor cells with specific lineage commitments; common myeloid progenitors (CMPs) and common lymphoid progenitors (CLPs). Biomarkers for CMPs include IL-3 R alpha. Human bone marrow CLPs are CD34+CD38+Neprilysin+. Human cord blood CLPs are CD34+CD38−CD7+.
The methods and composition described herein may be used to expand a population of one or more HSPCs in in vivo, ex vivo or in vitro. In one embodiment, the cells are from a single subject. Alternatively, the cells are from two or more subjects. In some embodiments, the HSPCs expanded according to the methods describe herein are for transplantation. Optionally, the expanded HSPCs are autologous cells or allogenic cells.
Different methods may be used to inhibit the activity and/or expression of CYP1B1 in order to expand a population of HSPCs as described herein. In a preferred embodiment, the HSPCs are contacted with a CYP1B1 inhibitor. In one embodiment, the HSPCs are contacted with two or more CYP1B1 inhibitors. In one embodiment, contacting the HSPCs with a CYP1B1 inhibitor comprises culturing the cells in the presence the CYP1B1 inhibitor, such as by adding the inhibitor to a growth medium.
A “CYP1B1 inhibitor” as used herein includes any substance that is capable of inhibiting the expression or activity of CYP1B1.
A number of different CYP1B1 inhibitors known in the art may be useful for expanding HSPCs. For example, Liu et al., 2013 (incorporated by reference in its entirety) describes different classes of CYP1B1 inhibitors suitable for use in the methods described herein including stilbenoids, flavonoids, coumarins or alkaloids. Optionally, the CYP1B1 inhibitor inhibits CYP1B1 with an 1050 of less than 20 μM, less than 10 μM, less than 5 μM, less than 1 μM, less than 0.5 μM or less than 0.1 μM.
In one embodiment, the CYP1B1 inhibitor is a stilbenoid. Examples of stilbenoids useful for inhibiting CYP1B1 include, but are not limited to, 2,4,3′,5′-Tetramethoxystilbene (2,4,3′,5′-TMS), 2,4,2′,6′-Tetramethoxystilbene (2,4,2′,6′-TMS) and (E)-2,3′,4,5′-Tetramethoxystilbene (2,3′,4,5′-TMS). In one embodiment, the stilbenoid is 2,3′,4,5′-TMS.
In one embodiment, the CYP1B1 inhibitor is a flavonoid. Examples of flavonoids useful for inhibiting CYP1B1 include, but are not limited to, 3,5,7-trihydroxyflavone, 4′-methoxy-5,7-dihydroxyflavone, 3′,4′-dimethoxy-5,7-dihydroxyflavone, chrysin, naringenin, tangeretin, isohamnetin, eupatorin, diosmetin, luteolin, acacetin, myricetin, kaempferol, nobiletin, quercetin, apigenin, genistein, daidzein and prunetin. Bioflavonoids useful for inhibiting CYP1B1 are also disclosed in Doostdar et al. (2000), hereby incorporated by reference in its entirety.
In one embodiment, the CYP1B1 inhibitor is a coumarin. Examples of coumarins useful for inhibiting CYP1B1 include, but are not limited to, furocoumarins, bergamottin, coriandrin, 6,7-dihydroxycoumarin, 7,8-dihydroxycoumarin, osthole, 6-geranyl-7-hydroxycoumarin, 6,7-dihydroxybergamottin, imperatorin and bergapten.
In one embodiment, the CYP1B1 inhibitor is an alkaloid. Examples of alkaloids useful for inhibiting CYP1B1 include, but are not limited to rutaecarpines, such as 10- and 11-methoxyrutaecarpine, Berberine, palmatine, jatrorrhizine, trypanthrin and evodiamine.
In one embodiment, the CYP1B1 inhibitor has an IC50 of less than 100 μM, less than 50 μM, less than 25 μM, less than 10 μM, less than 5 less than 1 μM, less than 0.5 μM or less than 0.05 μM. In one embodiment, the CYP1B1 inhibitor has an 1050 less than 10 μM, less than 1 or less than 0.1 μM.
Other CYP1B1 inhibitors known in the art such as synthetic molecules, natural products and/or antibodies may also be used in the methods and compositions described herein. In one embodiment, the CYP1B1 inhibitor is an antisense nucleic acid molecule, siRNA, protein, antibody (or fragment thereof), aptamer, peptibody or small molecule inhibitor. In an embodiment, the inhibitor is a blocking antibody or fragment thereof against CYP1B1.
The term “antisense nucleic acid” as used herein means a nucleic acid that is produced from a sequence that is inverted relative to its normal presentation for transcription. Antisense nucleic acid molecules may be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed with mRNA or the native gene e.g. phosphorothioate derivatives and acridine substituted nucleotides. The antisense sequences may be produced biologically using an expression vector introduced into cells in the form of a recombinant plasmid, phagemid or attenuated virus in which antisense sequences are produced under the control of a high efficiency regulatory region, the activity of which may be determined by the cell type into which the vector is introduced.
The term “siRNA” refers to a short inhibitory RNA that can be used to silence gene expression of a specific gene. The siRNA can be a short RNA hairpin (e.g. shRNA) that activates a cellular degradation pathway directed at mRNAs corresponding to the siRNA. Methods of designing specific siRNA molecules and administering them are known to a person skilled in the art. It is known in the art that efficient silencing is obtained with siRNA duplex complexes paired to have a two nucleotide 3′ overhang. Adding two thymidine nucleotides is thought to add nuclease resistance. A person skilled in the art will recognize that other nucleotides can also be added. Thus, in another embodiment, the CYP1B1 inhibitor is an siRNA molecule that decreases expression of CYP1B1. In one embodiment, the siRNA is a shRNA that inhibits the expression of CYP1B1 and has sequence identity to SEQ ID NO: 23 or 24. In one embodiment, the siRNA comprises or consists of a nucleic acid sequence with at least 80%, 85%, 90%, 95% or 100% identity to SEQ ID NO: 23 or to SEQ ID NO: 24.
The term “aptamer” as used herein refers to short strands of nucleic acids that can adopt highly specific 3-dimensional conformations. Aptamers can exhibit high binding affinity and specificity to a target molecule. These properties allow such molecules to specifically inhibit the functional activity of proteins. Thus, in another embodiment, the CYP1B1 inhibitor is an aptamer that binds and inhibits CYP1B1 activity.
The term “peptibody” as used herein refers to a recombinant protein that fuses a peptide region with the Fc region of IgG. Thus, in another embodiment, the CYP1B1 inhibitor is a CYP1B1 peptide inhibitor fused with the Fc region of IgG.
The term “antibody” as used herein is intended to include monoclonal antibodies, polyclonal antibodies, chimeric antibodies and humanized antibodies. The antibody may be from recombinant sources and/or produced in transgenic animals. The term “antibody fragment” as used herein is intended to include without limitations Fab, Fab′, F(ab′)2, scFv, dsFv, ds-scFv, dimers, minibodies, diabodies, and multimers thereof, multispecific antibody fragments and domain antibodies. Antibodies can be fragmented using conventional techniques. For example, F(ab′)2 fragments can be generated by treating the antibody with pepsin. The resulting F(ab′)2 fragment can be treated to reduce disulfide bridges to produce Fab′ fragments. Papain digestion can lead to the formation of Fab fragments. Fab, Fab′ and F(ab′)2, scFv, dsFv, ds-scFv, dimers, minibodies, diabodies, bispecific antibody fragments and other fragments can also be synthesized by recombinant techniques.
In another embodiment, there is provided a method of increasing the self-renewal and/or expansion of hematopoietic stem and progenitor cells (HSPCs) by contacting the HSPCs with a CYP1B1 inhibitor in combination with at least one additional agent. In one embodiment, the additional agent is an agent that induces hematopoiesis. In one embodiment, the agent that induces hematopoiesis is an AHR antagonist such as SR1. In another embodiment, the agent that induces hematopoiesis is a pyrimindoindole derivative. Examples of pyrimindoindole derivatives include UM171, UM125729 (UM729), UM118428 (Tranylcypromine HCl), UM121184 (2-Hydroxyxanthone), UM1211179 (Retusin 7-methyl ether), UM125454, UM121064 (3-Hydroxyflavone) and UM117304 (Pratol). Pyrimindoindole derivatives also include those described in Fares et al., 2014, which is incorporated herein by reference in its entirety.
The HSPCs may be contacted with the additional agent prior to, overlapping with, concurrently, and/or after being contacted with the CYP1B1 inhibitor. The combination of CYP1B1 inhibitor and the additional agent may act to increase the self-renewal and/or expansion of HSPCs.
Different methods may be used to increase the activity and/or expression of MSI2 in order to expand a population of HSPCs as described herein.
The term “increased expression” or “overexpression” as used herein means any form of expression of the MSI2 gene or gene product that is additional to the original wild-type MSI2 expression level.
Methods for increasing expression of genes or gene products are well known in the art and include, for example, overexpression driven by appropriate promoters, the use of transcription enhancers or translation enhancers. Isolated nucleic acids which serve as promoter or enhancer elements may be introduced in an appropriate position (typically upstream) of a non-heterologous form of a polynucleotide so as to upregulate expression of a nucleic acid encoding the polypeptide of interest. For example, endogenous promoters may be altered in vivo by mutation, deletion, and/or substitution, or isolated promoters may be introduced into a cell in the proper orientation and distance from a gene of interest so as to control the expression of the gene.
In one embodiment, the HSPCs are contacted with a MSI2 activator. In one embodiment, the HSPCs are contacted with two or more MSI2 activators. In one embodiment, contacting the HSPCs with a MSI2 activator comprises culturing the cells in the presence of a MSI2 activator, such as by adding the activator to a growth medium.
A “MSI2 activator” as used herein includes any substance that is capable of increasing the expression or activity of MSI2 and includes, without limitation, additional MSI2 nucleic acid or protein or fragments thereof, small molecule activators, antibodies (and fragments thereof), and other substances that can activate MSI2 expression or activity.
In one embodiment, the MSI2 activator is a MSI2 mRNA or DNA molecule or fragment thereof. In another embodiment, the MSI2 activator is a MSI protein or functional fragment thereof. In another embodiment, the MSI protein or functional fragment thereof is conjugated, directly or indirectly, to a protein transfection reagent that facilitates transfection of the protein into a HSPC. Protein transfection reagents normally form non-covalent complexes with the protein to be delivered and carry it through the plasma membrane. Examples of protein transfection reagents include, but are not limited to, cell penetrating peptides or protein transduction domains, lipids and complexes thereof. For example, Gundry et al., (2016) reports refined electroporation conditions for introducing recombinant protein into primitive human blood cells. A protein of interest may also be coupled to a transduction domain like TAT as described in Krosl et al., (2003) or to a cell penetrating peptide as described in Bolhassani et al., (2017)
In one embodiment, HSPCs may be contacted with an additional agent that induces hematopoiesis as described herein prior to, overlapping with, concurrently, and/or after being contacted with the MSI2 activator.
In one embodiment, the methods described herein also include the use of a combination of a CYP1B1 inhibitor and a MSI2 activator for increasing the self-renewal and/or expansion of HSPCs. In one embodiment, the CYP1B1 inhibitor and the MSI2 activator are for use or administration concurrently, overlapping or separately. In one embodiment, the methods described herein include contacting HSPCs with the combination of a CYP1B1 inhibitor and a MSI2 activator either at the same time or at different times. In one embodiment, the methods and/or uses described herein include contacting HSPCs with a composition comprising a CYP1B1 inhibitor and a MSI2 activator.
In one embodiment, HSPCs expanded according to the methods described herein may be useful for transplantation or use in a subject in need thereof. Optionally, the expanded HSPCs are autologous HSPCs taken from the subject and expanded ex vivo or allogenic HSPCs taken from one or more donor subjects.
In one embodiment, a CYP1B1 inhibitor and/or MSI2 activator as described herein may be used and/or administered to a subject in order to increase the self-renewal and/or expansion of HSPCs in vivo, optionally before, during or after a transplant of HSPCs.
In one embodiment, the subject has a disease or disorder that can be treated by the use or administration of HSPCs, including but not limited to a hematopoietic disorder, malignancy, autoimmune disease and/or immunodeficiency. In one embodiment, the hematopoietic disorder is thalassemia, sickle cell anemia, aplastic anemia or fanconi anemia. In one embodiment, the malignancy is a cancer of the blood or bone marrow. In one embodiment, the cancer is non-Hodgkin's lymphoma, Hodgkin's lymphoma, multiple myeloma or leukemia. In some embodiments, the subject has received chemotherapy and/or radiation. In one embodiment, the chemotherapy and/or radiation has resulted in a hematopoietic disorder in the subject.
In one embodiment, the methods and compositions described herein provide for the treatment of a subject in need thereof who would benefit from transplantation of HSPCs. The term “treating” or “treatment” as used herein and as is well understood in the art, means an approach for obtaining beneficial or desired results, including clinical results. Beneficial or desired clinical results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, diminishment of extent of disease, stabilized (i.e. not worsening) state of disease (e.g. maintaining a patient in remission), preventing disease or preventing spread of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, diminishment of the reoccurrence of disease, and remission (whether partial or total), whether detectable or undetectable. “Treating” and “Treatment” can also mean prolonging survival as compared to expected survival if not receiving treatment. “Treating” and “treatment” as used herein also include prophylactic treatment. In one embodiment, treatment methods comprise administering to a subject a therapeutically effective amount of expanded HSPCs as described herein and optionally consists of a single administration, or alternatively comprises a series of administrations.
In one embodiment, the methods and uses described herein involve the administration or use of an effective amount of HSPCs. As used herein, the phrase “effective amount” or “therapeutically effective amount” means an amount effective, at dosages and for periods of time necessary to achieve the desired result. For example in the context of treating a hematopoietic disorder such as anemia, an effective amount is an amount that for example induces an increase in the amount of red blood cells in the blood compared to the response obtained without administration of the HSPCs. Effective amounts may vary according to factors such as the disease state, age, sex and weight of the animal. The amount of a given compound that will correspond to such an amount will vary depending upon various factors, such as the given drug or compound, the pharmaceutical formulation, the route of administration, the type of disease or disorder, the identity of the subject or host being treated, and the like, but can nevertheless be routinely determined by one skilled in the art.
In one embodiment, there is provided a composition comprising one or more HSPCs and a cytochrome P450 1B1 (CYP1B1) inhibitor. Also provided is a composition comprising one or more HSPCs, a cytochrome P450 1B1 (CYP1B1) inhibitor and an agent that induces hematopoiesis, optionally SR1 or a pyrimidoindole derivative.
In another embodiment, there is provided a composition comprising one or more HSPCs and a Musashi-2 (MSI2) activator.
In one embodiment, the composition is a cell culture. Optionally, the cell culture comprises a CYP1B1 inhibitor and further comprises one or more factors that encourage the growth or expansion of HSPCs. In one embodiment, the cell culture further comprises an agent that induces hematopoiesis.
In another embodiment, the cell culture comprises a MSI2 activator and further comprises one or more factors that encourage the growth or expansion of HSPCs.
In one embodiment, the composition is a pharmaceutical composition. In one embodiment, the pharmaceutical composition comprises one or more HSPCs, a CYP1B1 inhibitor and a pharmaceutically acceptable carrier. Optionally, the pharmaceutical composition further comprises an agent that induces hematopoiesis.
In another embodiment, the pharmaceutical composition comprises one or more HSPCs, a MSI2 activator and a pharmaceutically acceptable carrier.
In one embodiment, the HSPCs may be formulated for use or prepared for administration to a subject using pharmaceutically acceptable formulations known in the art. Conventional procedures and ingredients for the selection and preparation of suitable formulations are described, for example, in Remington's Pharmaceutical Sciences (2003-20th edition) and in The United States Pharmacopeia: The National Formulary (USP 24 NF19) published in 1999. The term “pharmaceutically acceptable” means compatible with the treatment of animals, in particular, humans. Optionally, the pharmaceutical composition is formulated for intravenous administration.
In one embodiment, the pharmaceutical compositions are useful for the treatment of a hematopoietic disorder, malignancy, autoimmune disease and/or immunodeficiency in a subject in need thereof.
Leukemic cells and in particular AML cells can be difficult to culture and expand in vitro. Compositions and methods described herein for expanding populations of HSPCs are also expected to be useful for expanding populations of leukemic cells.
Accordingly, in one embodiment there is provided a method of producing a culture of leukemic cells, the method comprising inhibiting the activity and/or expression of cytochrome P450 1B1 (CYP1B1) in a population of one or more leukemic cells. In one embodiment, the method comprises culturing the cells in the presence of a CYP1B1 inhibitor. Optionally, the leukemic cells are acute myelogenous leukemia (AML) cells.
In a further embodiment there is provided a method of producing a culture of leukemic cells, the method comprising increasing the activity and/or expression of Musashi-2 (MSI2) in a population of one or more leukemic cells. In one embodiment, the method comprises culturing the cells in the presence of a MSI2 activator. Optionally, the leukemic cells are acute myelogenous leukemia (AML) cells.
In one embodiment, the culture of leukemic cells may be used in a screening assay for identifying agents that inhibit the proliferation of leukemic cells that may be useful as chemotherapeutic agents. In one embodiment, the method comprises contacting the culture of leukemic cells with a test agent and determining whether the test agent reduces the growth or proliferation of leukemic cells in the cell culture relative to a control.
As used herein, “reducing the growth or proliferation of leukemic cells” refers to a reduction in the number of cells that arise from a leukemic cell as a result of cell growth or cell division and includes cell death. The term “cell death” as used herein includes all forms of killing a cell including necrosis and apoptosis.
The above disclosure generally describes the present application. A more complete understanding can be obtained by reference to the following specific examples. These examples are described solely for the purpose of illustration and are not intended to limit the scope of the disclosure. Changes in form and substitution of equivalents are contemplated as circumstances might suggest or render expedient. Although specific terms have been employed herein, such terms are intended in a descriptive sense and not for purposes of limitation.
NOD-scid-IL2Rγc−/− (Jackson Laboratory) mice were bred and maintained in the Stem Cell Unit animal barrier facility at McMaster University. All procedures received the approval of the Animal Research Ethics Board at McMaster University.
All patient samples were obtained with informed consent and with the approval of local human subject research ethics boards at McMaster University. Human umbilical cord blood mononuclear cells were collected by centrifugation with Ficoll-Paque Plus (GE), followed red blood cell lysis with ammonium chloride (Stemcell Technologies). Cells were then incubated with a cocktail of lineage specific antibodies (CD2, CD3, CD11 b, CD11c, CD14, CD16, CD19, CD24, CD56, CD61, CD66b, and GlyA, Stemcell Technologies) for negative selection of Lin− cells using an EasySep immunomagnetic column (Stemcell Technologies). Live cells were discriminated on the basis of cell size, granularity and, as needed, absence of viability dye 7-AAD (BD Biosciences) uptake. All flow cytometry analysis was performed using a BD LSR II instrument (BD Biosciences). Data acquisition was conducted using BD FACSDiva software (BD Biosciences) and analysis was performed using FlowJo software (Tree Star).
HSPC sorting and qRT-PCR analysis
To quantify MSI2 expression in human HSPCs, Lin− CB cells were stained with the appropriate antibody combinations to resolve HSC (CD34+CD38−CD45RA− CD90+), MPP (CD34+CD38−CD45RA− CD90−), CMP (CD34+CD38+CD71−) and EP (CD34+CD38+CD71+) fractions as similarly described previously (Doulatov et al., 2009; Majeti et al. 2007) with all antibodies from BD Biosciences: CD45RA (HI100), CD90 (5E10), CD34 (581), CD38 (HB7) and CD71 (M-A712). Cell viability was assessed using the viability dye 7AAD (BD Biosciences). All cell subsets were isolated using a BD FACSAria II cell sorter (BD Biosciences) or a MoFlo XDP cell sorter (Beckman Coulter). HemaExplorer (Bagger et al., 2013) analysis was used to confirm MSI2 expression in human HSPCs and across the hierarchy. For all qRT-PCR determinations total cellular RNA was isolated with TRIzol LS reagent according to the manufacturer's instructions (Invitrogen) and cDNA was synthesized using the qScript cDNA Synthesis Kit (Quanta Biosciences). qRT-PCR was done in triplicate with PerfeCTa qPCR SuperMix Low ROX (Quanta Biosciences) with gene specific probes (Universal Probe Library, UPL, Roche) and primers: MSI2 UPL-26, F-ggcagcaagaggatcagg (SEQ ID NO: 1), R-ccgtagagatcggcgaca (SEQ ID NO: 2); HSP90 UPL-46, F-gggcaacacctctacaagga (SEQ ID NO: 3), R-cttgggtctgggtttcctc (SEQ ID NO: 4); CYP1B1 UPL-20, F-acgtaccggccactatcact (SEQ ID NO: 5), R-ctcgagtctgcacatcagga (SEQ ID NO: 6); GAPDH UPL-60, F-agccacatcgctcagacac (SEQ ID NO: 7), R-gcccaatacgaccaaatcc (SEQ ID NO: 8); ACTB (UPL Set Reference Gene Assays, Roche). The mRNA content of samples compared by qRT-PCR was normalized based on the amplification of GAPDH or ACTB.
MSI2 shRNAs were designed with the Dharmacon algorithm (http://www.dharmacon.com). Predicted sequences were synthesized as complimentary oligonucleotides, annealed and cloned downstream of the H1 promoter of the modfied cppt-PGK-EGFP-IRES-PAC-WPRE lentiviral expression vector (Doulatov et al., 2009). Sequences for the MSI2 targeting and control RFP targeting shRNAs were as follows: shMSI2, 5′-gagagatcccactacgaaa-3′ (SEQ ID NO: 9); shRFP, 5′-gtgggagcgcgtgatgaac-3′ (SEQ ID NO: 10). Human MSI2 cDNA (B0001526; Open Biosystems) was subcloned into the MA bi-directional lentiviral expression vector (Amendola et al., 2005). Human CYP1B1 cDNA (B0012049; Open Biosystems) was cloned in to psMALB (van Galen et al., 2014). All lentivirus was prepared by transient transfection of 293FT (Invitrogen) cells with pMD2.G and psPAX2 packaging plasmids (Addgene) to create VSV-G pseudotyped lentiviral particles. All viral preparations were titrated on HeLa cells before use on cord blood. Standard SDS-PAGE and western blotting procedures were performed to validate the effect of knockdown on transduced NB4 cells (DSMZ) and over expression on 293FT cells. Immunoblotting was performed with anti-MSI2 rabbit monoclonal IgG (EP1305Y, Epitomics) and β-actin mouse monoclonal IgG (ACTBD11B7, Santa Cruz Biotechnology) antibodies. Secondary antibodies used were IRDye 680 goat anti-rabbit IgG and IRDye 800 goat anti-mouse IgG (LI-COR). 293FT and NB4 cell lines tested negative for mycoplasma. NB4 cells were authenticated by ATRA treatment prior to use.
CB transductions were conducted as described previously (Doulatov et al., 2009; Lechman et al., 2012). Briefly, thawed Lin− CB, flow-sorted Lin− CD34+CD38−or Lin− CD34+CD38+ cells were prestimulated for 8-12 hours in StemSpan™ medium (StemCell Technologies) supplemented with growth factors Interleukin 6 (IL-6; 20 ng/ml, Peprotech), Stem cell factor (SCF; 100 ng/ml, R&D Systems), Flt3 ligand (FLT3-L; 100 ng/ml, R&D Systems) and Thrombopoietin (TPO; 20 ng/ml, Peprotech). Lentivirus was then added in the same medium at a multiplicity of infection of 30-100 for 24 hours. Cells were then given 2 days post transduction before use in in vitro or in vivo assays. For in vitro CB studies biological (experimental) replicates were performed with three independent CB samples.
Human clonogenic progenitor cell assays were done in semi-solid methylcellulose medium (Methocult H4434; Stem Cell Technologies) with flow-sorted GFP+ cells post transduction (500 cells/ml) or from day seven cultured transduced cells (12000 cells/ml). Colony counts were carried out after 14 days of incubation. CFU-GEMMs can seed secondary colonies due to their limited self-renewal potential (Carow et al., 2993). MSI2 OE and control CFU-GEMM replating for secondary CFU analysis was performed by picking single CFU-GEMMs at day 14 and disassociating colonies by vortexing. Cells were spun and resuspended in fresh methocult, mixed with a blunt end needle and syringe, and then plated into single wells of a 24-well plate. Secondary CFU analysis for shMSI2 and shControl expressing cells was performed by harvesting total colony growth from a single dish (since equivalent numbers of CFU-GEMMs), resuspending cells in fresh methocult by mixing vigorously with a blunt end needle and syringe and then plating into replicate 35 mm tissue culture dishes. In both protocols, secondary colony counts were done following incubation for 10 days. For primary and secondary colony forming assays performed with the AHR agonist 6-Formylindolo(3,2-b)carbazole (FICZ; Santa Cruz Biotechnology), 200 nM FICZ or 0.1% DMSO was added directly to H4434 methocult medium. 2-way ANOVA analysis was performed examining secondary CFU output and FICZ treatment for MSI2 OE or control conditions. Colonies were imaged with a Q-Colour3 digital camera (Olympus) mounted to an Olympus IX5 microscope with a 10× objective lens. Image-Pro Plus imaging software (Media Cybernetics) was used to acquire pictures and subsequent image processing was performed with ImageJ software (NIH).
Lin− CB and Lin− CD34+ Suspension Cultures
Transduced human Lin− CB cells were sorted for GFP expression and seeded at a density of 1×105 cells/ml in IMDM 10% FBS supplemented with human growth factors IL-6 (10 ng/ml), SCF (50 ng/ml), FLT3-L (50 ng/ml), and TPO (20 ng/ml) as previously described (Milyaysky et al., 2010). To generate growth curves, every seven days cells were counted, washed, and resuspended in fresh medium with growth factors at a density of 1×105 cells/ml. Cells from suspension cultures were also used in clonogenic progenitor assays, cell cycle and apoptosis assays. Experiments performed on transduced Lin− CD34+CB cells used serum free conditions as described in the CB transduction subsection of the Methods. For in vitro CB studies biological (experimental) replicates were performed with three independent CB samples.
Monitoring cell cycle progression was performed with the addition of BrdU to day 10 suspension cultures at a final concentration of 10 μM. After three hours of incubation, cells were assayed with the BrdU Flow Kit (BD Biosciences) according to the manufacture's protocol. Cell proliferation and quiescence was measured by Ki67 (BD Bioscience) and Hoechst 33342 (Sigma) on day 4 suspension cultures after fixing and permeabilizing cells with the Cytofix/Cytoperm kit (BD Biosciences). For apoptosis analysis, Annexin V (Invitrogen) and 7-AAD (BD Bioscience) staining on day 7 suspension cultures was performed according to the manufacture's protocol.
Lin− CB cells were initially stained with anti-CD34 PE (581) and anti-CD38 APC (HB7) antibodies (BD Biosciences) then fixed with the Cytofix/Cytoperm kit (BD Biosciences) according to the manufacturer's instructions. Fixed and permeabilized cells were immunostained with anti-MSI2 rabbit monoclonal IgG antibody (EP1305Y, Abcam) and detected by Alexa-488 goat anti-rabbit IgG antibody (Invitrogen).
CD34+ cells were transduced with MSI2 OE or KD lentivirus along with their corresponding controls and then sorted for GFP expression 3 days later. Transductions for MSI2 OE and KD were each performed on two independent CB samples. Total RNA from transduced cells (>1×105) was isolated using TRIzol LS as recommended by the manufacturer (Invitrogen), and then further purified using RNeasy columns (Qiagen). Sample quality was assessed using Bioanalyzer RNA Nano chips (Agilent). Paired-end, barcoded RNA-seq sequencing libraries were then generated using the TruSeq RNA Sample Prep Kit (v2) (Illumina) following the manufacturer's protocols starting from 1 ug of total RNA. Quality of library generation was then assessed using a Bioanalyzer platform (Agilent) and Illumina MiSeq-QC run was performed or quantified by qPCR using KAPA quantification kit (KAPA Biosystems). Sequencing was performed using an Illumina HiSeq2000 using TruSeq SBS v3 chemistry at the Institute for Research in Immunology and Cancer's Genomics Platform (University of Montreal) with cluster density targeted at 750 k clusters/mm2 and paired-end 2×100 bp read lengths. For each sample, 90-95M reads were produced and mapped to the hg19 (GRCh37) human genome assembly using CASAVA (version 1.8). Read counts generated by CASAVA were processed in EdgeR (edgeR_3.12.0, R 3.2.2) using TMM normalization, paired design, and estimation of differential expression using a generalized linear model (glmFit). The false discovery rate (FDR) was calculated from the output p-values using the Benjamini-Hochberg method. The fold change of logarithm of base 2 of TMM normalized data (log FC) was used to rank the data from top up-regulated to top down-regulated genes and FDR (0.05) was used to define significantly differentially expressed genes. RNA-seq data has been deposited in NCBI's Gene Expression Omnibus and are accessible through GEO Series accession number GSE70685.
GSEA and iRegulon AHR Target Prediction
iRegulon (Janky et al., 2014) was used to retrieve the top 100 AHR predicted targets with a minimal occurrence count threshold of 5. The data were analyzed using GSEA (Subramanian et al., 2005) with ranked data as input with parameters set to 2000 gene-set permutations.
The Gene Expression Omnibus (GEO) dataset GSE28359 that contains Affymetrix Human Genome U133 Plus 2.0 Array gene expression data of CD34+ cells treated with SR1 at 30 nM, 100 nM, 300 nM and 1000 nM was used to obtain lists of genes differentially expressed in the treated samples compared to the control ones (0 nM) (Boitano et al., 2010). Data were background corrected using Robust Multi-Array Average (RMA) and quantile normalized using the expresso( ) function of the affy Bioconductor package (affy_1.38.1, R 3.0.1). Lists of genes were created from the 150 genes top up regulated and top down regulated by the SR1 treated samples at each dose compared to the non-treated samples (0 nM). The data were analyzed using GSEA with ranked data as input with parameters set to 2000 gene-set permutations. Normalized enrichment score (NES) and false discovery rate (FDR) were calculated for each comparison.
The GEO dataset GSE24759 that contains Affymetrix GeneChip HT-HG_U133A Early Access Array gene expression data of 38 distinct hematopoietic cell states (Novershtern et al., 2011) was compared to the OE and KD data. GSE24759 data were background corrected using Robust Multi-Array Average (RMA), quantile normalized using the expresso( ) function of the affy Bioconductor package (affy_1.38.1, R 3.0.1), batch corrected using the ComBat( ) function of the sva package (sva_3.6.0) and scaled using the standard score. Bar graphs were created by calculating for significantly differentially expressed genes the number of scaled data that were above (>0) or below (<0) the mean for each population. Percentages indicating time the observed value (set of up or downregulated genes) was better represented in that population than random values were calculated from 1000 trials.
A unique list of genes closest to AHR bound regions previously identified from TCDD-treated MCF7 ChIP-seq data (Lo et al., 2012) was used to calculate the overlap with genes showing >1.5-fold down regulation with UM171 (35 nM) and SR1 (500 nM) relative to DMSO treated samples3 as well as with genes significantly down regulated in MSI2 OE versus control treated samples (FDR<0.05). Percentage of down regulated genes with AHR bound regions was then graphed for each gene set. P-values were generated with Fisher's exact test between gene lists.
oPOSSUM Analysis for Promoter AHR Binding Sites in Downregulated Gene Sets
AHR transcription factor binding sites in downregulated gene sets were identified with oPOSSUM-3 (Kwon et al. 2012). Genes showing >1.5-fold down regulation with UM171 (35 nM) and SR1 (500 nM) relative to DMSO treated samples (Fares et al., 2014) were used along with significantly downregulated genes (FDR<0.05) with EdgeR analyzed MSI2 OE versus control treated samples. The three gene lists uploaded into oPOSSUM-3 and the AHR:ARNT transcription factor binding site profile was used with the matrix score threshold set at 80% and analyzing the region 1500 bp upstream and 1000 bp downstream of transcription start site. Percentage of downregulated genes with AHR binding sites in the promoter was then graphed for each gene set. Fisher's exact test was used to identify significant overrepresentation of AHR binding sites in gene lists relative to background.
NSG mice were sublethally irradiated (315 cGy) one day prior to intrafemoral injection with transduced cells carried in IMDM 1% FBS at 25 μl per mouse. Injected mice were analyzed for human hematopoietic engraftment at 12-14 weeks post transplantation or 3 and 6.5 weeks for STRC experiments. Mouse bones (femurs, tibiae and pelvis) and spleen were harvested and bones were crushed with a mortar and pestle then filtered in to single cell suspensions. Bone marrow and spleen cells were blocked with mouse Fc block (BD Biosciences) and human IgG (Sigma) and then stained with fluorochrome-conjugated antibodies specific to human hematopoietic cells. For multilineage engraftment analysis, cells from mice were stained with CD45 (H130) (Invitrogen), CD33 (P67.6), CD15 (H198), CD14 (MφP9), CD19 (H1B19), CD235a/GlyA (GA-R2), CD41a (HIP8) and CD34 (581) (BD Biosciences).
For MSI2 KD in HSCs 5.0×104 and 2.5×104 sorted Lin− CD34+CD38− cells were used per short-hairpin transduction experiment leading to transplantation of day zero equivalent cell doses of 10×103 and 6.25×103, respectively per mouse. For STRC LDA transplantation experiments 1×105 sorted CD34+CD38+ cells were used per control and MSI2 OE transduction. After assessing levels of gene transfer, day zero equivalent GFP+ cell doses were calculated to perform the LDA. Recipients with greater than 0.1% GFP+CD45+/− cells were considered to be repopulated. For STRC experiments that readout extended engraftment at 6.5 weeks, 2×105 CD34+CD38+ cells were used per OE and control transduction allowing for non-limiting 5×104 day zero equivalent cell doses per mouse. For HSC expansion and LDA experiments CD34+CD38− cells were sorted and transduced with MSI2 OE or control vectors (50,000 cells per condition) for three days and then analyzed for gene-transfer levels (% GFP+/−) and primitive cell marker expression (% CD34 and CD133). To ensure equal numbers of GFP+ cells were transplanted in both control and MSI2 OE mice, we added identically cultured GFP− cells to the MSI2 culture to match % GFP+of the control culture (necessary due to the differing efficiency of transduction). The adjusted OE culture was recounted and aliquoted (63,000 cells) to match the output of half the control culture. Three day 0 equivalent GFP+ cell doses (1000, 300 and 62) were then transplanted per mouse to perform the D3 primary LDA. A second aliquot of the adjusted OE culture was then taken and put in to culture in parallel with the remaining half of the control culture for performing another LDA after 7 days of growth (10 days total growth, D10 primary LDA). Altogether, 4 cell doses were transplanted, if converted back to day 0 equivalents these equaled approximately 1000, 250, 100, and 20 GFP+ cells per mouse, respectively. Pooled bone marrow from six engrafted primary mice that received D10 cultured control or MSI2 OE cells (from 2 highest doses transplanted) was aliquoted in to 4 cell doses of 15 million, 10 million, 6 million, 2 million and 1 million cells. Numbers of GFP+ cells within primary mice was estimated from nucleated cell counts obtained from NSG femurs, tibias and pelvis and from Colvin et al., 2004. The cutoff for HSC engraftment was a demonstration of multilineage reconstitution which was set at BM having >0.1% GFP+ CD33+ and >0.1% GFP+CD19+ cells. Assessment of HSC and STRC frequency was carried out by using ELDA software (Hu & Smyth, 2009). For all mouse transplantation experiments, mice were aged (6-12 wk) and sex matched. All transplanted mice were included for analysis unless mice died from radiation sickness before the experimental endpoint. No randomization or blinding was performed for animal experiments. Approximately 3-6 mice were used per cell dose for each CB transduction and transplantation experiment.
CLIP-seq was performed as previously described (Yeo et al., 2009). Briefly, 25 million NB4 cells, a transformed human cell line of hematopoietic origin, were washed in PBS and UV-cross-linked at 400mJ/cm2 on ice. Cells were pelleted, lysed in wash buffer (PBS, 0.1% SDS, 0.5% Na-Deoxycholate, 0.5% NP-40), DNAse treated, and supernatants from lysates were collected for immunoprecipitation. MSI2 was immunoprecipitated overnight using 5 μg of anti-MSI2 antibody (EP1305Y, Abcam) and Protein A Dynabeads (Invitrogen). Beads containing immunoprecipated RNA were washed twice with wash buffer, high-salt wash buffer (5×PBS, 0.1% SDS, 0.5% Na-Deoxycholate, 0.5% NP-40), and PNK buffer (50 mM Tris-CI pH 7.4, 10 mM MgCl2, 0.5% NP-40). Samples were then treated with 0.2 U MNase for 5 minutes at 37 degrees with shaking to trim immunopreciptated RNA. MNase inactivation was then carried out with PNK+EGTA buffer (50 mM Tris-CI pH 7.4, 20 mM EGTA, 0.5% NP-40). The sample was dephosphorylated using alkaline phosphatase (CIP, NEB) at 37 degrees for 10 followed by washing with PNK+EGTA, PNK buffer, and then 0.1 mg/mL BSA in nuclease free water. 3′ RNA linker ligation was performed at 16 degrees overnight with the following adapter: 5′ P-UGGAAUUCUCGGGUGCCAAGG-puromycin (SEQ ID NO: 11). Samples were then washed with PNK buffer, radiolabelled using P32-y-ATP (Perkin Elmer), run on a 4-12% Bis-Tris gel and then transferred to a nitrocellulose membrane. The nitrocellulose membrane was developed via autoradiography and RNA-protein complexes 15-20 kDa above the molecular weight of MSI2 was extracted with Proteinase K followed by RNA extraction with acid phenol-chloroform. A 5′ RNA linker (5′ HO-GUUCAGAGUUCUACAGUCCGACGAUC-OH) (SEQ ID NO: 12) was ligated to the extracted RNA using T4 RNA ligase (Fermentas) for two hours and the RNA was again purified using acid phenol-chloroform. Adapter ligated RNA was re-suspended in nuclease free water and reverse transcribed using Superscript III reverse transcriptase (Invitrogen). 20 cycles of PCR were performed using NEB Phusion Polymerase using a 3′ PCR primer that contained a unique Illumina barcode sequence. PCR products were run on an 8% TBE gel. Products ranging between 150-200 bp were extracted using the QIAquick gel extraction kit (Qiagen) and re-suspended in nuclease free water. Two separate libraries were prepared and sent for single-end 50 bp Illumina sequencing at the Institute for Genomic Medicine at the University of California, San Diego. 47,098,127 reads from the first library passed quality filtering of which 73.83% mapped uniquely to the human genome. 57,970,220 reads from the second library passed quality filtering of which 69.53% mapped uniquely to the human genome. CLIP-data reproducibility was verified through high correlation between gene RPKMs and statistically significant overlaps in the clusters and genes within replicates. CLIP-seq data has been deposited in NCBI's Gene Expression Omnibus and are accessible through GEO Series accession number GSE69583.
Before sequence alignment of CLIP-seq reads to the human genome was performed, sequencing reads from libraries were trimmed of polyA tails, adapters, and low quality ends using Cutadapt with parameters—match-read-wildcards—times 2-e 0-O 5—quality-cutoff’ 6-m 18-b TCGTATGCCGTCTTCTGCTTG-b ATCTCGTATGCCGTCTTCTGCTTG-b CGACAGGTTCAGAGTTCTACAGTCCGACGATC-b TGGAATTCTCGGGTGCCAAGG-b AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-b TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT. (SEQ ID NOs: 13-18). Reads were then mapped against a database of repetitive elements derived from RepBase (version 18.05). Bowtie (version 1.0.0) with parameters-S-q-p 16-e 100-l 20 was used to align reads against an index generated from Repbase sequences (Langmead et al., 2001). Reads not mapped to Repbase sequences were aligned to the hg19 human genome (UCSC assembly) using STAR (version 2.3.0e) (Dobin et al., 2013) with parameters—outSAMunmapped Within—outFilterMultimapNmax 1—outFilterMultimapScoreRange 1. To identify clusters in the genome of significantly enriched CLIP-seq reads, reads that were PCR replicates were removed from each CLIP-seq library using a custom script of the same method as33, otherwise reads were kept at each nucleotide position when more than one read's 5′ end was mapped. Clusters were then assigned using the CLIPper software with parameters—bonferroni—superlocal—threshold-(Lovci et al., 2013). The ranked list of significant targets was calculated assuming a Poisson distribution, where the observed value is the number of reads in the cluster, and the background is the number of reads across the entire transcript and or across a window of 1000 bp+/− the predicted cluster.
Transcriptomic regions and gene classes were defined using annotations found in gencode v17. Depending on the analysis clusters were either associated by the Gencode annotated 5′ UTR, 3′ UTR, CDS or intronic regions. If a cluster overlapped multiple regions, or a single part of a transcript was annotated as multiple regions, clusters were iteratively assigned first as CDS, then 3′ UTR, 5′ UTR and finally as proximal (<500 bases from an exon) and distal (>500 bases from an exon) introns. Overlapping peaks were calculated using bedtools and pybedtools (Quinlan et al., 2010; Dale et al., 2011).
Significantly enriched gene ontology (GO) terms were identified using a hypergeometric test that compared the number of genes that were MSI2 targets in each GO term to genes expressed in each GO term as the proper background. Expressed genes were identified by using the control samples in SRA study SRP012062. Mapping was performed identically to CLIP-seq mapping, without peak calling and changing the STAR parameter outFilterMultimapNmax to 10. Counts were calculated with feature Counts (Liao et al., 2014) and RPKMs were then computed. Only genes with a mean RPKM>1 between the two samples were used in the background expressed set.
Randomly located clusters within the same genic regions as predicted MSI2 clusters were used to calculate a background distribution for motif and conservation analyses. Motif analysis was performed using the HOMER algorithm as in Lovci et al., 2013. For evolutionary sequence conservation analysis the mean (mammalian) phastCons score for each cluster was used.
CD34+ cells (>5×104) were transduced with MSI2 OE or control lentivirus, after 3 days GFP+ cells were sorted and then put back in to StemSpan medium containing growth factors IL-6 (20 ng/ml), SCF (100 ng/ml), FLT3-L (100 ng/ml) and TPO (20 ng/ml). A minimum of 10,000 cells were used for immunostaining at culture days 3 and 7 post GFP-sort. Cells were fixed in 2% PFA for 10 minutes, washed with PBS and then cytospun on to glass slides. Cytospun cells were then permeabilized (PBS 0.2% Triton X-100) for 20 minutes, blocked (PBS 0.1% saponin 10% donkey serum) for 30 minutes and stained with primary antibodies (anti-CYP1B1 antibody, EPR14972, Abcam; anti-HSP90 antibody, 68/hsp90, BD Biosciences) in PBS 10% donkey serum for 1 hour. Detection with secondary antibody was performed in PBS 10% donkey serum with Alexa-647 donkey anti-rabbit antibody or Alexa-647 donkey anti-mouse antibody for 45 minutes. Slides were mounted with Prolong Gold Antifade containing DAPI (Invitrogen). Several images (200-1000 cells total) were captured per slide at 20× magnification using an Operetta HCS Reader (Perkin Elmer) with epifluorescence illumination and standard filter sets. Columbus software (Perkin Elmer) was used to automate the identification of nuclei and cytoplasm boundaries in order quantify mean cell fluorescence.
A 271 bp region of the CYP1B1 3′UTR that flanked CLIP-seq identified MSI2 blinding sites was cloned from human HEK293FT genomic DNA using the forward primer GTGACACAACTGTGTGATTAAAAGG (SEQ ID NO: 19) and reverse primer TGATTTTTATTATTTTGGT AATGGTG (SEQ ID NO: 20) and placed downstream of renilla luciferase in the dual-luciferase reporter vector, pGL4 (Promega). A 271 bp geneblock (IDT) with 6 TAG>TCC mutations was cloned in to pGL4 using XbaI and NotI. The HSP90 3′UTR was amplified from HEK293FT genomic DNA with the forward primer TCTCTGGCTGAGGGATGACT (SEQ ID NO: 21) and reverse primer TTTTAAGGCCAAGGAATTAAGTGA (SEQ ID NO: 22) and cloned in pGL4. A geneblock of the HSP90 3′UTR (IDT) with 14 TAG>TCC mutations was cloned in to pGL4 using SfaAI and NotI. Co-transfection of wild type or mutant luciferase reporter (40 ng) and control or MSI2 OE lentiviral expression vector (100 ng) was performed in the non-Musashil and 2 expressing NIH-3T3 cell line. 50,000 cells were used per co-transfection. Reporter activity was measured using the Dual-Luciferase Reporter Assay System (Promega) 36-40 hours later.
MSI2 OE Suspension Cultures with AHR Antagonist SR1 and Agonist FICZ
For MSI2 OE cultures with the AHR antagonist SR1, Lin− CD34+ cells were transduced with MSI2 OE or control lentivirus in medium supplemented with SR1 (750 nM; Abcam) or DMSO vehicle (0.1%). GFP+ cells were isolated (20,000 cells per culture) and allowed to proliferate with or without SR1 for an additional 7 days at which point they were counted and immunophenotyped for CD34 and CD133 expression. For MSI2 OE cultures with the AHR agonist FICZ, Lin− CD34+ cells were transduced with MSI2 OE or control lentivirus. GFP+ cells were isolated (20,000 cells per culture) and allowed to proliferate with FICZ (200 nM; Santa Cruz Biotechnology) or DMSO (0.1%) for an additional 3 days at which point they were immunophenotyped for CD34 and CD133 expression.
HSPC Expansion with (E)-2,3′,4,5′-Tetramethoxystilbene (TMS)
Lin− CD34+ cells were cultured for 72 hours (lentiviral treated but non-transduced flow-sorted GFP− cells) in StemSpan medium containing growth factors IL-6 (20 ng/ml), SCF (100 ng/ml), FLT3-L (100 ng/ml) and TPO (20 ng/ml) before the addition of the CYP1B1 inhibitor TMS (Abcam) at a concentration of 10 μM or mock treatment with 0.1% DMSO. Equal numbers of cells (12,000 per condition) were then allowed to proliferate for 7 days at which point they were counted and immunophenotyped for CD34 and CD133 expression.
Unless stated otherwise (i.e., analysis of RNA-seq and CLIP-seq data sets), all statistical analysis was performed using GraphPad Prism (GraphPad Software version 5.0). Unpaired student t-tests or Mann-Whitney tests were performed with p<0.05 as the cut-off for statistical significance.
The role of MSI2 in post-transcriptionally controlling human HSPC self-renewal was investigated as it is known to regulate mouse HSCs, (Hope et al., 2010, de Andres-Aguayo et al., 2011; Park et al., 2014) and is predicted to impact mRNA translation (Ohyama et al., 2012). MSI2 was present and elevated in primitive CB HSPCs and decreased during differentiation, whereas its paralog, MSI1, was not expressed (
Short-term repopulating cells (STRC) produce a transient multilineage graft in NOD-scid-IL2Rγc−/− (NSG) mice (Glimm et al., 2001), and in patients reconstitute granulocytes and platelets critical for preventing post-transplant infection and bleeding (Miller et al., 2013). STRCs overexpressing MSI2 exhibited 1.8-fold more primitive CD34+ cells post-infection and a dramatic 17-fold increase in functional STRCs relative to control as readout through limiting dilution analysis (LDA) of human chimerism at 3 weeks post-transplant (
Next, the effect of shRNA-induced MSI2 knockdown (KD) on HSPC function was investigated. MSI2 OE did not alter clonogenic potential but did decrease CFU replating 3-fold (
To characterize the earliest transcriptional changes induced by modulating MSI2 expression, RNA-seq was performed on CD34+ MSI2 OE and KD cells immediately post-transduction. MSI2 OE-induced transcriptional changes anti-correlated with those of MSI2 KD, suggesting OE and KD have opposite effects (
Since MSI2 OE conferred an HSC gene expression program, it was hypothesized that it could facilitate HSC expansion ex vivo. Remarkably, MSI2 OE induced a 4-fold increase in CD34+CD133+ phenotypic HSCs relative to control after 7 days of culture (
Secondary LDA transplants were performed to fully explore the effects MSI2 OE and culturing has on self-renewal and long-term HSCs (LT-HSC). Robust engraftment with MSI2 OE showed no evidence of altered myelo-lymphopoiesis or leukemic development (
To gain mechanistic insights MSI2 OE-induced differentially expressed genes were examined and found Cytochrome P450 1B1 Oxidase (CYP1B1), an effector of AHR signaling (Mimura et al., 2003) amongst the most repressed. Pathway analysis revealed many predicted AHR targets were enriched in MSI2 OE downregulated (
To further elucidate the AHR connection, MSI2 OE and control cultures were treated with the AHR agonist 6-Formylindolo(3,2-b)carbazole (FICZ), whose induction of canonical AHR targets in MSI2 OE cells, demonstrates they remain competent for AHR activation (
To identify key RNA targets underlying MSI2 function, we analyzed global MSI2 protein-RNA interactions using CLIP-seq (
Strikingly, among the top 2% of enriched CLIP-seq targets were the 3′UTRs of heat shock protein 90 (HSP90) and CYP1B1, two AHR pathway components. Each exhibited multiple MSI2 binding motifs correlating with overlapping clusters of CLIP-seq reads (
MSI2 has been identified as an important new mediator of human HSPC self-renewal and ex vivo expansion by coordinating the post-transcriptional regulation of proteins belonging to a shared self-renewal regulatory pathway (
shRNA lentiviruses were tested against CYP1B1 by transducing lineage negative (Lin−) CD34+CB to read out the effects it has on HSPCs. Multiple short-hairpins were either purchased or cloned in to existing vectors (Origene, SKU:TL313605, pGFP-C-shLenti vector; shCYP1B1-C, 5′CTCCTCTTCACCAGGTATCCTGATGTGCA′3 (SEQ ID NO: 23); shCYP1B1-B, 5′TTCGAGCAGCTCAACCGCAACTTCAGCAA′3 (SEQ ID NO: 24) and tested for knockdown efficiency in the CYP1B1-expressing leukemia cell line, NB4 (
A screening approach was undertaken that tested the function of 3 alkaloid, 9 coumarin, and 17 flavonoid based compounds (27 total, Table 1). The screening approach used 96-well plates seeded with 1000 FACS-purified CD34+ cells and treatment with 3 concentrations of each compound performed in triplicate culture wells (9 wells total per compound). Cells were cultured for 10 days and resultant growth was measured for cell number and surface marker expression by automated flow cytometer (MACS Quant). Broad HSPC promoting effects were found across multiple compounds of the varying classes and concentrations tested (
#values derived experimentally by EROD activity (incubation of 7-Ethoxy recrufin (7ER) with CYP enzymes
The combinatorial HSPC promoting effects of AHR antagonist SR1 with TMS (SR1+TMS) during in vitro culture was explored. It was found that particularly during extended culturing timepoints (day 17), the combined treatment of SR1+TMS led to increased frequency and number of HSPCs (
While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosures as come within known or customary practice within the art to which the invention pertains and as may be applied to the essential features herein before set forth, and as follows in the scope of the appended claims.
All publications, patents and patent applications are herein incorporated by reference in their entirety to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety. Where a term in the present application is found to be defined differently in a document incorporated herein by reference, the definition provided herein is to serve as the definition for the term.
This application claims the benefit of priority to U.S. Provisional application No. 62/327,649 filed Apr. 26, 2016, the contents of which are incorporated herein by reference in their entirety.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/CA2017/050511 | 4/26/2017 | WO | 00 |
| Number | Date | Country | |
|---|---|---|---|
| 62327649 | Apr 2016 | US |