This application claims priority to, and the benefit of, Chinese Patent Application No. 20190784150.9 filed on Aug. 23, 2019. The entire contents of the foregoing application are hereby incorporated by reference for all purposes.
This application contains a sequence listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Oct. 13, 2020, is named “M006_091_NPRUS_Sequence_list_revised.txt” and is 104468 bytes in size.
The present invention belongs to the field of biomedicine, relating to a method of preventing or treating a subject suffering from heart disease comprising administration of transfer RNA molecules isolated from or derived from a plant of the genus Panax to the subject. The invention further relates to a pharmaceutical composition comprising a nucleic acid for the treatment and use thereof.
Coronary heart disease (CHD) has become the top leading cause of mortality and morbidity worldwide. Traditional Chinese medicines (TCMs) have been widely applied for preventing or treating CHD whereas lots of research efforts have been contributed to investigate the effectiveness of isolated small molecules such as saponins, terpenoids, flavonoids or the like in treating CHD. Some ginsenosides have been found to have effect in protecting cardiomyocytes exposed to hypoxia/reoxygenation in vitro. However, most of them are often toxic to human. Also, macromolecules such as DNAs, RNAs, and proteins are generally considered unstable and have poor effect in living human body and therefore have not been widely considered as suitable in said treatment.
Currently, some studies show that non-coding RNAs (ncRNAs) such as microRNAs have diverse regulatory roles through targeting different aspects of RNA transcription or post-transcription process in nearly all eukaryotic organisms. Lin Zhang et al. (Cell research 2012, 22, 107-126) suggested that exogenous plant microRNAs in foods could be taken up by the mammalian gastrointestinal (GI) tract and entering into the circulation to various organs, where they are capable of regulating the expression of mammalian genes. Goodarzi, H. et al. (Cell 2015, 161 (4), 790-802) revealed that endogenous tRNA derived fragments could suppress the stability of multiple oncogenic transcripts in breast cancer cells through binding and antagonizing activities of pathogenesis-related RNA-binding proteins. Nevertheless, there still remains a need to derive effective molecules from various sources such as plants for treatments.
Panax ginseng C. A. Mey, a species from the family of Araliaceae, is considered to be the most precious herbs distributed mountainous regions of China and Korea. The roots of P. ginseng have been a famous traditional Chinese medicine used worldwide for thousands of years to be a tonic to invigorate weak bodies. In addition, the main component of P. ginseng such as ginsenosides and polysaccharides had been proved to show significant effects on cardioprotection. However, the dosage of these components is massive, which may cause toxicity to human bodies. Therefore, there remains a continuing need for new and improved treatments for patients with CHD and/or associated with different complications.
Therefore, in view of the inadequacy of existing technology, the purpose of the present invention is to provide transfer RNA molecules isolated from or derived from plant of genus Panax in the preparation of drugs for the prevention or treatment of heart diseases. Specifically, the purpose of the present invention is to identify or discover the key role of transfer RNA molecules isolated from or derived from plant of genus Panax in treatment of myocardial ischemia reperfusion, myocardial infarction, coronary heart disease, myocardial fibrosis and other cardiac diseases, and further application of diagnosis and treatment of these heart diseases.
The purpose of the invention is realized through the following technical scheme.
In a first aspect, the invention provides transfer RNA molecules and fragments derived from transfer RNA or its functional variants or homologous in the preparation of drugs for the prevention or treatment of a subject suffering from heart diseases, wherein said RNA molecule isolated from or derived from a plant of the genus Panax.
In an embodiment, the plant of the genus Panax comprises Panax ginseng C. A. Mey, Panax notoginseng (Burkill) F. H. Chen or Panax quinquefolius Linn. Preferably, said plant of the genus Panax is Panax ginseng C. A. Mey.
Preferably, the transfer RNA molecule comprises a sequence selected from SEQ ID NO: 465 to SEQ ID NO: 522.
In an alternative embodiment, the fragments derived from transfer RNA molecule is a double-stranded RNA molecule comprising a sense sequence selected from SEQ ID NO: 1 to SEQ ID NO: 232 or a functional variant or homologue therefore, and a complementary antisense sequence.
Preferably, the fragments derived from transfer RNA molecule is a double-stranded RNA molecule comprising a sense sequence selected from SEQ ID NO: 1 to SEQ ID NO: 40 or a functional variant or homologue therefore, and a complementary antisense sequence.
Wherein, said complementary antisense sequences of nucleotide sequences shown in any of SEQ ID NO:1 to SEQ ID NO:232 are showed in any of SEQ ID NO:233 to SEQ ID NO:464.
Preferably, the transfer RNA molecules and fragments derived from transfer RNA or its functional variants or homologous contains a 2 mer of 3′ overhang.
Preferably, the transfer RNA molecules and fragments derived from transfer RNA or its functional variants or homologous contains a 3′ cholesterol conjugation.
Preferably, the double-stranded RNA molecule comprises at least one modified nucleoside selected from inosine, 1-methyladenosine, 2-methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, 2′-O-methyladenosine, N6-acetyladenosine, 1-methylinosine, pseudouridine, dihydrouridine, or 2-methylthio-N6-methyladenosine.
In an embodiment, said heart diseases are selected from one or more of angina pectoris, myocardial infarction, myocardial ischemic injury, coronary heart disease, cardiac hypertrophy, and myocardial fibrosis.
In an embodiment, the RNA molecule of the invention is a non-coding molecule has a sequence length of from about 50 to 200 nucleotides or 10 to 30 base pairs.
In another aspect, the invention provides a pharmaceutical composition for preventing or treating heart diseases comprising an effective amount of transfer RNA molecule, fragments derived from transfer RNA molecules or its functional variants or homologous and a pharmaceutically tolerable vector, virus or excipient, wherein the RNA molecule is isolated or derived from a plant of the genus Panax.
In an embodiment, the pharmaceutically tolerable vector selected from one or more of the gene delivery vectors, chitosan, cholesterol, liposomes and nanoparticles.
Preferably, transfer RNA molecules, fragments derived from transfer RNA molecule or its functional variants or homologous are provided as composition containing a gene delivery vector.
Preferably, the pharmaceutical composition is provided by intravenous, intramuscular, intracoronary or direct myocardial injection.
In an embodiment, the pharmaceutical composition comprising the RNA molecule isolated or derived from the plant of the genus Panax comprises Panax ginseng C. A. Mey, Panax notoginseng (Burkill) F. H. Chen or Panax quinquefolius Linn. Preferably, said plant of the genus Panax is Panax ginseng C. A. Mey.
In an embodiment, wherein the transfer RNA molecule comprises a sequence selected from SEQ ID NO: 465 to SEQ ID NO: 522.
In an alternative embodiment, the fragments derived from transfer RNA molecule is a double-stranded RNA molecule comprising a sense sequence selected from SEQ ID NO: 1 to SEQ ID NO: 232 or a functional variant or homologue therefore, and a complementary antisense sequence.
Preferably, the fragments derived from transfer RNA molecule is a double-stranded RNA molecule comprising a sense sequence selected from SEQ ID NO: 1 to SEQ ID NO: 40 or a functional variant or homologue therefore, and a complementary antisense sequence.
Wherein, said complementary antisense sequences of nucleotide sequences shown in any of SEQ ID NO:1 to SEQ ID NO:232 are showed in any of SEQ ID NO:233 to SEQ ID NO:464.
Preferably, the transfer RNA molecules and fragments derived from transfer RNA or its functional variants or homologous comprises a 2 mer of 3′ overhang.
Preferably, the transfer RNA molecules and fragments derived from transfer RNA or its functional variants or homologous comprises a 3′ cholesterol conjugation.
Preferably, the transfer RNA molecules and fragments derived from transfer RNA or its functional variants or homologous comprises at least one modified nucleoside selected from inosine, 1-methyladenosine, 2-methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, 2′-O-methyladenosine, N6-acetyladenosine, 1-methylinosine, pseudouridine, dihydrouridine, or 2-methylthio-N6-methyladenosine.
In an embodiment, said heart diseases are selected from one or more of angina pectoris, myocardial infarction, myocardial ischemic injury, coronary heart disease, cardiac hypertrophy, and myocardial fibrosis.
In an embodiment, the RNA molecule of the invention is a non-coding molecule has a sequence length of from about 50 to 200 nucleotides or 10 to 30 base pairs.
In a further aspect, the invention provides a method of preventing or treating a subject suffering from heart diseases, said method comprises the step of administering of an effective amount of transfer RNA molecules and fragments derived from transfer RNA or its functional variants or homologous thereof.
In an embodiment, said method comprising a step of contacting said cardiomyocytes with an effective amount of transfer RNA molecules and fragments derived from transfer RNA or its functional variants or homologous which are isolated or derived from a plant of the genus Panax.
In an embodiment, said plant of the genus Panax comprises Panax ginseng C. A. Mey, Panax notoginseng (Burkill) F. H. Chen or Panax quinquefolius Linn. Preferably, said plant of the genus Panax is Panax ginseng C. A. Mey.
Preferably, the transfer RNA molecule comprises a sequence selected from SEQ ID NO: 465 to SEQ ID NO: 522.
In an alternative embodiment, the fragments derived from transfer RNA molecule is a double-stranded RNA molecule comprising a sense sequence selected from SEQ ID NO: 1 to SEQ ID NO: 232 or a functional variant or homologue therefore, and a complementary antisense sequence.
Preferably, the fragments derived from transfer RNA molecule is a double-stranded RNA molecule comprising a sense sequence selected from SEQ ID NO: 1 to SEQ ID NO: 40 or a functional variant or homologue therefore, and a complementary antisense sequence.
Wherein, said complementary antisense sequences of nucleotide sequences shown in any of SEQ ID NO:1 to SEQ ID NO:232 are showed in any of SEQ ID NO:233 to SEQ ID NO:464.
Preferably, the transfer RNA molecules and fragments derived from transfer RNA or its functional variants or homologous contains a 2 mer of 3′ overhang.
Preferably, the transfer RNA molecules and fragments derived from transfer RNA or its functional variants or homologous contains a 3′ cholesterol conjugation.
Preferably, the double-stranded RNA molecule comprises at least one modified nucleoside selected from inosine, 1-methyladenosine, 2-methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, 2′-O-methyladenosine, N6-acetyladenosine, 1-methylinosine, pseudouridine, dihydrouridine, or 2-methylthio-N6-methyladenosine.
In an embodiment, said heart diseases are selected from one or more of angina pectoris, myocardial infarction, myocardial ischemic injury, coronary heart disease, cardiac hypertrophy, and myocardial fibrosis.
In an embodiment, the RNA molecule of the invention is a non-coding molecule has a sequence length of from about 50 to 200 nucleotides or 10 to 30 base pairs.
Still further, the invention provides a recombinant vector comprising the double-stranded RNA molecule, wherein the double-stranded RNA molecule comprising a sense sequence selected from SEQ ID NO: 1 to SEQ ID NO: 232 or a functional variant or homologue therefore, and a complementary antisense sequence.
Preferably, the double-stranded RNA molecule comprising a sense sequence selected from SEQ ID NO: 1 to SEQ ID NO: 40 or a functional variant or homologue therefore, and a complementary antisense sequence.
Preferably, the double-stranded RNA molecule comprises a 2 mer of 3′ overhang.
Preferably, the double-stranded RNA molecule comprises a 3′ cholesterol conjugation.
Preferably, the double-stranded RNA molecule comprises at least one modified nucleoside selected from inosine, 1-methyladenosine, 2-methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, 2′-O-methyladenosine, N6-acetyladenosine, 1-methylinosine, pseudouridine, dihydrouridine, or 2-methylthio-N6-methyladenosine.
Further, the invention provides the application in the preparation of drugs for the prevention or treatment of heart disease, wherein the drug comprises the transfer RNA molecule, fragments derived from transfer RNA molecule or its functional variant or homologous, the pharmaceutical composition and the recombinant vector.
The invention provides a novel and effective approach for treating heart diseases by administration of RNA molecules that are isolated or derived from a plant of the genus Panax, or in particular double-stranded RNA molecules comprising a sequence selected from SEQ ID NO: 1 to 232. Administration of said RNA molecules is also suitable for promoting the growth and proliferation of cardiomyocytes.
The inventors have found that non-coding RNA molecules isolated from a plant of the genus Panax, particularly transfer RNA molecules, and RNA molecules derived from Panax are particularly useful in treatment of heart diseases. The RNA molecules with a sequence length of about 10 to 200 nucleotides are highly effective at promoting the growth and proliferation of cardiomyocytes. Besides, said RNA molecules have restorative effects on the myocardial cytoskeleton after ischemia-reperfusion injury.
Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. The invention includes all such variations and modifications. The invention also includes all steps and features referred to or indicated in the specification, individually or collectively, and any and all combinations of the steps or features.
Other features and aspects of the invention will become apparent by consideration of the following detailed description and accompanying figures.
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
The details about the implementation plan of the invention are elaborated in combination with the attached figures.
Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by one skilled in the art to which the invention belongs.
As used herein, “comprising” means including the following elements but not excluding others. “Essentially consisting of” means that the material consists of the respective element along with usually and unavoidable impurities such as side products and components usually resulting from the respective preparation or method for obtaining the material such as traces of further components or solvents. “Consisting of” means that the material solely consists of, i.e. is formed by the respective element. As used herein, the forms “a,” “an,” and “the,” are intended to include the singular and plural forms unless the context clearly indicates otherwise.
The present invention in the first aspect provides a method of preventing or treating a subject suffering from heart disease comprising administration of transfer RNA molecules and fragments derived from transfer RNA molecules or its functional variants or homologous to the subject, wherein the RNA molecules isolated from or derived from a plant of the genus Panax. The RNA molecule administered according to the present invention may be naturally present, modified or artificially synthesized according to the sequences disclosed in the present invention, and preferably the RNA molecule is isolated or derived from a plant of the genus Panax. The RNA molecule of the present invention is not provided in the form of boiled extract obtained from the plant such as decoction, as it would be appreciated that RNA molecule is susceptible to spontaneous degradation at elevated temperature, alkaline pH, and the presence of nucleases or divalent metal ions.
The RNA molecule of the present invention has a sequence length of from about 10 to 200 nucleotides which can be regarded as a small RNA molecule. Preferably, the RNA molecule has a sequence length of from about 50 to about 200 nucleotides, from about 60 to about 150 nucleotides, in particular from about 70 to about 100 nucleotides.
The RNA molecule of the present invention comprises a sequence selected from SEQ ID NO: 1 to SEQ ID NO: 232 or a functional variant or homologue thereof. The term “functional variant” of the RNA molecule refers to a molecule substantially similar to said RNA molecule with one or more sequence alterations that do not affect the biological activity or function of the RNA molecule. The alterations in sequence that do not affect the functional properties of the resultant RNA molecules are well known in the art. For example, nucleotide changes which result in alteration of the -5′-terminal and -3′-terminal portions of the molecules would not be expected to alter the activity of the polynucleotides. In an embodiment, the RNA molecule of the present invention comprises at least one modified nucleoside selected from inosine, 1-methyladenosine, 2-methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, 2′-O-methyladenosine, N6-acetyladenosine, 1-methylinosine, pseudouridine, dihydrouridine, or 2-methylthio-N6-methyladenosine.
In particular, the functional variant of the RNA molecule has at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% overall sequence identity to the non-variant RNA molecule according to the present invention.
The term “homologue” used herein refers to nucleotides having a sequence identity of at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 95% to the RNA molecules according to the present invention. In an embodiment, the homologue of the RNA molecule has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% overall sequence identity to the RNA molecule.
In an embodiment, the RNA molecule is a non-coding molecule preferably selected from a transfer RNA molecule, a micro RNA molecule or a siRNA molecule; and more preferably is a transfer RNA molecule. tRNA molecules are highly conserved RNAs with function in various cellular processes such as reverse transcription, porphyrin biosynthesis or the like. In a particular embodiment, the RNA molecule of the invention comprises a sequence selected from SEQ ID NO: 465 to SEQ ID NO: 522 or a functional variant or homologue thereof; or the RNA molecule comprises SEQ ID NO: 465 to SEQ ID NO: 468 or a functional variant or homologue thereof; or the RNA molecule consists of a sequence selected from SEQ ID NO: 465 to SEQ ID NO: 522 or SEQ ID NO: 465 to SEQ ID NO: 468 or a functional variant or homologue thereof.
In an alternative embodiment where the RNA molecule is a small RNA molecule having a sequence length of from about 10 to about 30 base pairs, from about 15 to about 25 base pairs, from about 19 to about 22 base pairs, 19 base pairs or 22 base pairs. The RNA molecule comprises a sequence selected from SEQ ID NO: 1 to SEQ ID NO: 232 or a functional variant or homologue thereof, in particular SEQ ID NO: 1 to SEQ ID NO: 40 or a functional variant or homologue thereof; or consists of a sequence selected from SEQ ID NO: 1 to SEQ ID NO: 232, in particular SEQ ID NO: 1 to SEQ ID NO: 40 or a functional variant or homologue thereof.
Preferably, the RNA molecule is a double-stranded RNA molecule having a sense sequence selected from SEQ ID NO: 1 to SEQ ID NO: 232 or a functional variant or homologue thereof, and a complementary antisense sequence.
The antisense sequence is complementary to the sense sequence and therefore the antisense sequence is preferably selected from SEQ ID NO: 233 to 464 or functional variant or homologue thereof. In a particular embodiment, the double-stranded RNA molecule of the present invention has a sense sequence selected from SEQ ID NO: 1 to SEQ ID NO: 40 or a functional variant or homologue thereof, and a complementary antisense sequence selected from SEQ ID NO: 233 to SEQ ID NO: 272 or a functional variant or homologue thereof. The inventors unexpectedly found that the double-stranded RNA molecules of the present invention are particularly useful in treatment of heart diseases as described in detail below.
The RNA molecule of the present invention is preferably isolated or derived from the plant of the genus Panax. The plant of the genus Panax includes but is not limited to Panax ginseng C. A. Mey, Panax quinquefolius Linn., Panax notoginseng (Burkill) F. H. Chen, Panax pseudoginseng Wall, Panax zingiberensis C. Y. Wu et K. M. Feng. The plant of the genus Panax may be the source of Ginsenosides Rg1. In an embodiment, the RNA molecule is isolated or derived from Panax ginseng C. A. Mey.
In more detail, the RNA molecule of the present invention is preferably isolated or derived from the different plant organs of the genus Panax. The plant organs of the genus Panax includes but is not limited to leaves, roots, and fruits. In an embodiment, the RNA molecule is isolated or derived from the roots of Panax ginseng C. A. Mey.
In more detail, the preferred sequences of the RNA molecules of the present invention are listed in Tables 1 and 2 below. In an embodiment, RNA molecules of SEQ ID NO: 465 to SEQ ID NO: 522 as shown in Table 1 are isolated from a plant of genus Panax in particular from Panax ginseng C. A. Mey. These sequences are obtained by extraction, RNA isolation and purification of the plant. The inventors determined these RNA molecules are associated with chloroplasts, cytoplast and mitochondria. One possible approach to obtain the RNA molecules from a particular plant Panax ginseng C. A. Mey is illustrated in Example 1. It would be appreciated that other suitable methods for obtaining the isolated and purified RNA molecules of the present invention according to the disclosure herein can be applied, and the methods can be subject to appropriate modification to obtain an improved yield of the RNA molecules, without departing from the scope of the present invention.
The sense sequences of SEQ ID NO: 1 to SEQ ID NO: 232 and the antisense sequences of SEQ ID NO: 233 to SEQ ID NO: 464 as shown in Table 2 are artificially synthesized in accordance with the present invention. In particular, these sequences are derived sequence fragments prepared according to the sequences in Table 1 isolated from Panax ginseng C. A. Mey. The double-stranded RNA molecules are classified into 3 groups: the first group is 5′-terminal group (5′-t) containing a 5′ terminal portion of the corresponding full-length mature tRNA molecules, forming segments of 2-35 nucleotides in length that are cut off in the D-ring, D-arm, anti-codon ring, or anti-codon ring arm. The second group is 3′-terminal group (3′-t) containing a 3′ terminal portion with CCA tail of the corresponding full-length mature tRNA molecules, forming segments of 2-35 nucleotides in length that are cut off in the T-ring, T-arm, anti-codon ring, or anti-codon ring arm. The third group is anticodon group RNA molecules containing the anticodon loop portion of the corresponding full-length mature tRNA molecules, forming segments of 2-24 nucleotides in length that are cut off in anti-codon ring, or anti-codon ring arm. In the embodiment, tRFs derived from tRNAHis(GUG) comprises 5′-tRFs “GCGGAUGUAGCCAAGUGGAUCA” that belongs to the family of 5′-tRFs with a length of 22 mer, 3′-tRFs “UCAAUUCCCGUCGUUCGCCCCA” that belongs to the family of 3′-tRFs with a length of 22 mer, 5′-tRFs “GCGGAUGUAGCCAAGUGGA” that belongs to the family of 5′-tRFs with a length of 19 mer, and 3′-tRFs “AUUCCCGUCGUUCGCCCCA” that belongs to the family of 3′-tRFs with a length of 19 mer, and anti-codon-tRFs “GUGGAUUGUGAAUCCAC” belongs to the family of anti-codon-tRFs with length of 17 mer.
Each of the sense sequences together with the corresponding antisense sequence form a double-stranded RNA molecule. As shown in Table 2, the sense sequence of SEQ ID NO: 1 and the antisense sequence of SEQ ID NO: 233 form a double-stranded RNA molecule with a length of 22 base pairs, and the resultant RNA molecule is denoted as HC70 for easy reference. Similarly, the sense sequence of SEQ ID NO: 2 and the antisense sequence of SEQ ID NO: 234 form a double-stranded RNA molecule with a length of 19 base pairs, and the resultant RNA molecule is denoted as HC50. Other RNA molecules of the present invention are presented in the Table 2.
The double-stranded RNA molecules are classified into 2 groups, namely a 5′-terminal group (5′-t), and a 3′-terminal group (3′-t). The 5′-t group RNA molecules contain a 5′ terminal portion of the corresponding full-length RNA molecules isolated from the plant; and the 3′-t group RNA molecules contain a 3′ terminal portion of the corresponding full-length RNA molecules isolated from the plant.
In another embodiment, RNA molecules may contain the anticodon loop portion of the corresponding full-length RNA molecules isolated from the plant and referred as anticodon group RNA molecules. The sense sequences of SEQ ID NO: 1 to SEQ ID NO: 232 can be generated by cleavage at different sites on the full-length RNA molecules SEQ ID NO: 465 to 522.
In addition, the RNA molecule of the present invention may comprise a 3′ overhang, preferably comprise 2 mer of 3′ overhangs. The provision of the 3′ overhang improves the stability of the RNA molecules.
The inventors unexpectedly found that the RNA molecules isolated or derived from a plant of genus Panax in particular Panax ginseng C. A. Mey are effective on protecting cardiomyocytes, in particular they are capable of promoting the growth, proliferation and/or metastasis of cardiomyocytes.
Turning back to the method of treatment, the method comprises the step of administering an effective amount of RNA molecule as described above to the subject suffering from heart diseases. In an embodiment, the step of administering the RNA molecule to the subject comprises contacting cardiomyocytes of the subject with the RNA molecule.
The term “CHD” describes a physiological condition in subjects in which heart arteries are narrowed, less blood and oxygen reach the heart muscle. In an embodiment, the CHD to be treated is atherosclerosis, angina, heart attack and myocardial infarction. In a particular embodiment, the CHD is myocardial infarction. Accordingly, the method of the present invention can be applied to treat a subject suffering from a coronary heart disease and related disorders.
The term “subject” used herein refers to a living organism and can include but is not limited to a human and an animal. The subject is preferably a mammal, preferably a human. The RNA molecules may be administered through injection to the subject, preferably a human. The term injection encompasses intravenous, intramuscular, subcutaneous and intradermal administration. In an embodiment, the RNA molecule of the present invention is administered together with suitable excipient(s) to the subject through intravenous injection. For instance, the RNA molecule may be delivered to the subject or cells via transfection, electroporation or viral-mediated delivery.
The expression “effective amount” generally denotes an amount sufficient to produce therapeutically desirable results, wherein the exact nature of the result varies depending on the specific condition which is treated. In this invention, CHD is the condition to be treated and therefore the result is usually a promotion or protection of the growth and proliferation of cardiomyocytes, a protection or amelioration of symptoms related to CHD. In an embodiment, where the injury is hypoxia/reoxygenation (ischemia/reperfusion) injury, the result is usually a promotion of the growth and proliferation of cardiomyocytes, relief of destruction of the cytoskeleton or amelioration of symptoms related to injured cardiomyocytes.
The RNA molecule of the present invention may be administered in form of a pharmaceutical composition comprising the RNA molecule and at least one pharmaceutically tolerable excipient. The pharmaceutically tolerable excipient may be one or more of a diluent, a filler, a binder, a disintegrant, a lubricant, a coloring agent, a surfactant, a gene delivery carrier and a preservative. The pharmaceutical composition can be present in solid, semisolid or liquid form, preferably in liquid form. The pharmaceutical composition can be liposome freeze-dried powder, polypeptide nanometer freeze-dried powder, spray and tablets. The pharmaceutical composition may comprise further pharmaceutical effective ingredients such as therapeutic compounds which are used for treating CHD such as Rg1. The skilled technician is able to select suitable pharmaceutically tolerable excipients depending on the form of the pharmaceutical composition and is aware of methods for manufacturing pharmaceutical compositions as well as able to select a suitable method for preparing the pharmaceutical composition depending on the kind of pharmaceutically tolerable excipients and the form of the pharmaceutical composition.
In an embodiment, RNA molecules provided as a composition containing a gene delivery vector. A gene delivery vector is any molecule that act as a carrier to deliver a gene to a cell. In embodiments where RNA molecules are transfected into cells, gene delivery vectors are considered to be transfection agents. In the embodiment of delivering RNA molecules by a recombinant viral vector, the gene delivery vector is a viral vector carrying a double-stranded RNA molecule describe above in the present invention. Gene delivery vectors include but are not limited to vectors such as virus vectors, collagens such as terminated peptide collagens, polymers such as polyetenimine (PEI), polypeptides such as poly (L-lysine) and protamine, and liposomes such as Lipofectamine. Gene delivery vectors can be commercially available, such as transfection reagents from Thermo Fisher, U.S.A. including Lipofectamine RNAiMAX, Lipofectamine 3000, Lipofectamine 2000 and DharmaFECT series from Dharmacon; RNAi-Mate from GenePharma, China; terminated peptide collagens from Koken Co. Ltd, Japan; and Histidine-lysine peptide copolymer from siRNAomics, China. Gene delivery vectors can be viral vectors based on retroviruses, adeno-associated viruses, adenoviruses, and lentiviruses. The gene delivery vector should be of low toxicity and not induce significant immune response in subjects. In an embodiment, the pharmaceutical composition may further comprise a nucleic acid stabilizer. The nucleic acid stabilizer refers to any chemicals that are capable of maintaining the stability of the RNA molecule in the composition to minimize or avoid degradation, in particular those having ability to deactivate activity of nucleases or the like degrading the RNA molecules.
Accordingly, the present invention also pertains to a pharmaceutical composition as described above, in particular comprising the RNA molecule and a pharmaceutically tolerable excipient as defined above. In an embodiment, the RNA molecule comprises at least one sequence selected from SEQ ID NO: 1 to 232 or a functional variant or homologue thereof.
Preferably, the RNA molecule is isolated or derived from a plant of the genus Panax as described above, in particular from Panax ginseng C. A. Mey.
The RNA molecules of the present invention are also suitable for promoting the growth and proliferation of cardiomyocytes. In another aspect of the invention, there is provided a method of promoting the growth and proliferation of cardiomyocytes comprising a step of contacting said cells with an effective amount of a RNA molecule as defined above. Preferably the RNA molecule is isolated or derived from a plant of the genus Panax or comprises a sequence selected from SEQ ID NO: 1 to SEQ ID NO: 232 or a functional variant or homologue thereof.
In an embodiment, the RNA molecule has a sequence length of from about 50 to 200 nucleotides, more preferably has a length of from about 60 to about 150 nucleotides, in particular from about 70 to about 100 nucleotides. The RNA molecule is a non-coding molecule preferably a transfer RNA molecule. Preferably, the RNA molecule comprises a sequence selected from SEQ ID NO: 465 to SEQ ID NO: 522 or a functional variant or homologue thereof; or the RNA molecule comprises SEQ ID NO: 465 to SEQ ID NO: 468 or a functional variant or homologue thereof; or the RNA molecule consists of a sequence selected from SEQ ID NO: 465 to SEQ ID NO: 522 or SEQ ID NO: 465 to SEQ ID NO: 468 or a functional variant or homologue thereof.
In an alternative embodiment, the RNA molecule has a sequence length of from about 10 to about 30 base pairs, from about 15 to about 25 base pairs, from about 19 to about 22 base pairs, 19 base pairs or 22 base pairs. Preferably, the RNA molecule is a double-stranded RNA molecule comprising a sense sequence selected from SEQ ID NO: 1 to SEQ ID NO: 232 or a functional variant or homologue thereof, in particular SEQ ID NO: 1 to SEQ ID NO: 40 or a functional variant or homologue thereof; or consists of a sequence selected from SEQ ID NO: 1 to SEQ ID NO: 232, in particular SEQ ID NO: 1 to SEQ ID NO: 40 or a functional variant or homologue thereof. The double-stranded RNA molecule comprises a complementary antisense sequence. The RNA molecule may further comprise 2 mer of 3′ overhangs.
The step of contacting the cardiomyocytes with the RNA molecule of the present invention may be carried out by applying a composition in particular an incubation solution comprising the RNA molecule to said cardiomyocytes which incubation solution may further comprise suitable excipients as defined above, a buffer or a suitable growth medium. In such embodiment of the present invention, the cardiomyocytes are taken from a subject such as an animal or human, in particular a human. The RNA molecule is provided in the composition at a concentration of at least 0.3 nM, at least 3 nM, from about 0.3 nM to about 900 nM, from about 10 nM to about 100 nM, or from about 50 nM to about 300 nM. In addition, excipients may include gene delivery vectors, such as, but not limited to, collagen-based vectors or liposome formers.
In addition to the above, the present invention pertains to a double-stranded RNA molecule as described above, i.e. comprising a sense sequence selected from SEQ ID NO: 1 to SEQ ID NO: 232 or a functional variant or homologue thereof, and a complementary antisense sequence. In particular, the double-stranded RNA molecule consists of a sense sequence selected from SEQ ID NO: 1 to SEQ ID NO: 232 or a functional variant or homologue thereof, a complementary antisense sequence selected from SEQ ID NO: 233 to SEQ ID NO: 464, and optionally a 3′ overhang. Example embodiments of the double-stranded RNA molecule are presented in Table 2. The double-stranded RNA may be subject to modification and therefore may carry at least one modified nucleoside selected form inosine, 1-methyladenosine, 2-methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, 2′-O-methyladenosine, N6-acetyladenosine, 1-methylinosine, pseudouridine, dihydrouridine, or 2-methylthio-N6-methyladenosine.
In further aspect of the invention, there is provided a vector comprising a nucleic acid molecule, wherein the nucleic acid molecule is a RNA molecule as described above. In particular, the RNA molecule having a sequence selected from SEQ ID NO: 1 to SEQ ID NO: 232 or a functional variant or homologue thereof. In an embodiment, the vector is a recombinant vector comprising the double-stranded RNA molecule as described above. The vector may be viral-based vector derived from retrovirus, adeno-associated virus, adenovirus, or lentivirus. An ordinary skilled in the art would appreciate suitable approach to incorporate the RNA molecule of the present invention into a vector.
Still further, the present invention pertains to use of a nucleic acid molecule in the preparation of a medicament for treating CHD. The nucleic acid is a RNA molecule as described above including a functional variant or homologue thereof. It would also be appreciated that the RNA molecule of the present invention can be used as a small interfering RNA molecule to interfere the expression of certain genes in the target CHD, thereby to cause gene silencing, inhibition of apoptosis and injury, or the like to achieve the desired therapeutic effect.
Accordingly, the present invention provides a novel and effective approach for treating CHD from various origins by administration of a RNA molecule that is isolated or derived from a plant of the genus Panax, or in particular a RNA molecule comprising a sequence selected from SEQ ID NO: 1 to 232. Administration of said RNA molecule is also suitable for promoting the growth and proliferation of cardiomyocytes. The RNA molecules are found to be highly effective at promoting the growth and proliferation of cardiomyocytes in vitro.
The invention is now described in the following non-limiting examples.
Fresh roots of Panax ginseng C. A. Mey were collected from Fusong Town in the year of 2017 from Jilin Province, China. Cetrimonium bromide (CTAB) and sodium chloride were purchased from Kingdin Industrial Co., Ltd. (Hong Kong, China). Water-saturated phenol was purchased from Leagene Co., Ltd. (Beijing, China). Chloroform and ethanol were purchased from Anaqua Chemicals Supply Inc. Ltd. (U.S.A.). Isopentanol and guanidinium thiocyanate were purchased from Tokyo Chemical Industry CO., Ltd. (Japan). Tris-HCl and ethylenediaminetetraacetic acid (EDTA) were purchased from Acros Organics (U.S.A), low range ssRNA ladder was purchased from New England Biolabs (Beverly, Mass., U.S.A.). TRIzol® Reagent (Invitrogen), mirVana™ miRNA isolation kit, SYBR gold nucleic acid gel stain and gel loading buffer II were purchased from Thermo Fisher Scientific (U.S.A.). 40% acrylamide/bis solution (19:1), tris/borate/EDTA (TBE), ammonium persulphate (APS) and tetramethylethylenediamine (TEMED) were purchased from Biorad Laboratories Inc. (U.S.A). Rat cardiomyocyte cell line (H9C2) were purchased from ATCC (Manassas, Va., U.S.A.). Opti-MEM I Reduced Serum Media, Dulbecco's Modified Eagle Medium (DMEM), Glucose free Dulbecco's Modified Eagle Medium (glucose free DMEM), Fetal Bovine Serum (FBS), Penicillin-Streptomycin were purchased from Gibco (Life Technologies, Auckland, New Zealand). 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (MTT) and DAPI was purchased from Sigma (St. Louis, Mo., U.S.A.). Mitochondrial viability stain solution was purchased from Abcam (Cambridge, England). Rhodamine Phalloidin was purchased from Cytoskeleton, Inc. (Denver, U.S.A.).
Isolation of RNA molecules from a plant of genus Panax Roots of Panax ginseng C. A. Mey were freshly collected and immediately stored in liquid nitrogen until use. RNAs having a length of 200 nucleotides or below, i.e. small RNAs species, were extracted from Panax ginseng C. A. Mey by using a polysaccharase-aided RNA isolation (PARI) method, which method is described for the first time. Briefly, plant tissues were ground into a fine powder in liquid nitrogen and then homogenized in TRIzol reagent using a digital dispersing device (IKA, Germany). After fully lysed for 10 min at room temperature, an equal volume of chloroform was added and followed by centrifugation at 12,000×g for 15 min at 4° C. The supernatant was collected and precipitated by adding 1/25 volume of 5 M sodium chloride and 1.25 volume of cold absolute ethanol, and stored at −20° C. for 30 min. Then precipitation was hydrolyzed by polysaccharase, until the pellet was completely dissolved. The hydrolysate was mixed with 2×CTAB buffer, and extracted with an equal volume of phenol:chloroform:isopentanol (50:48:1) by vortexing vigorously. Phases were separated at 4° C. by centrifugation at 12,000×g for 15 min and the supernatant was extracted again as described above with chloroform:isopentanol (24:1). The supernatant was collected and mixed with an equal volume of 6 M guanidinium thiocyanate, followed by adding 100% ethanol to a final concentration of 55%. The mixture was passed through a filter cartridge containing a silica membrane, which immobilizes the RNAs. The filter was then washed for several times with 80% (v/v) ethanol solution, and finally all RNAs were eluted with a low ionic-strength solution or RNase-free water. The small RNA species were isolated and enriched by using a mirVana™ miRNA isolation kit following the manufacturer's instruction.
Further, the total tRNAs in the isolated small RNA species were separated by electrophoresis in 6% polyacrylamide TBE gels containing 8 M urea prepared according to the manufacturer's protocol (Biorad, U.S.A.). After staining with SYBR Gold nucleic acid gel stain, polyacrylamide gels were examined using a UV lamp and the region of gels containing total tRNAs were cut off by using a clean and sharp scalpel.
The inventors then constructed the total tRNAs library and performed sequencing. Sequencing libraries were generated by using TruSeq small RNA Library Preparation Kit (Illumina, U.S.A.), followed by a round of adaptor ligation, reverse transcription and PCR enrichment. PCR products were then purified and libraries were quantified on the Agilent Bioanalyzer 2100 system (Agilent Technologies, U.S.A.). The library preparations were sequenced at the Novogene Bioinformatics Institute (Beijing, China) on an Illumina HiSeq platform using the 150 bp paired-end (PE150) strategy to generate over 15 million raw paired reads. U.S. Pat. No. 5,772,569 clean reads were obtained by removing low quality regions and adaptor sequences.
Each of the tRNAs was then isolated from a mixture of small RNAs (<200 mer) from Panax ginseng C. A. Mey by immobilization of the target tRNAs onto the streptavidin-coated magnetic beads with specific biotinylated capture DNA probes. To bind specific tRNA molecules, a corresponded single stranded DNA oligonucleotide (20 to 45-mer) were synthesized, which was designed based on the sequence information of Illumina sequencing and should be complementary to a unique segment of the target tRNA. Cognate DNA probes were incubated with small RNA mixture for about 1.5 h in annealing buffer and allowed to hybridize to the targeted tRNA molecules in solution at the proper annealing temperatures that were generally 5° C. lower than the melting temperature (Tm). Streptavidin-coated magnetic beads were then added to the mixture and incubated for 30 min at the annealing temperatures. After the hybridized sequences are immobilized onto the magnetic beads via the streptavidin-biotin bond, the biotinylated DNA/tRNA coated beads were separated with a magnet for 1-2 min and washed 3-4 times in washing buffer at 40° C. The magnetic beads were resuspended to a desired concentration in RNase-free water and thereby to release the immobilized tRNA molecules by incubation at 70° C. for 5 min. Accordingly, the isolated and purified tRNA molecules of SEQ ID NO: 465 to 522 were obtained.
The inventors designed and synthesized RNA molecules having a length of about 19 to 22 bp based on the 58 isolated tRNA sequences in Example 1. In particular, the tRNA sequences are considered to have at least 3 portions, namely a 5′-terminal portion (5′-t), a 3′-terminal portion (3′-t) and an anticodon portion. Each of the specifically designed RNA molecules contains any one of the portions. For instance, designed RNA molecules containing a 5′ terminal portion of the corresponding full-length tRNA sequence are referred as 5′-t group RNA molecules; designed RNA molecules containing a 3′ terminal portion of the corresponding full-length tRNA sequence are referred as 3′-t group RNA molecules; designed RNA molecules containing an anticodon portion of the corresponding full-length tRNA sequence are referred as anticodon group RNA molecules. The RNA molecules having a sense sequence selected from SEQ ID NO: 1 to SEQ ID NO: 232 and a complementary antisense sequence selected from SEQ ID NO: 233 to SEQ ID NO: 464, as shown in Table 2, were designed and synthesized by cleavage at different sites on the tRNA sequences in Table 1.
H9C2 cell lines were cultured in Dulbecco's Modified Eagle Medium (DMEM) containing 10% FBS and 1% penicillin/streptomycin at humidified atmosphere containing 5% CO2 at 37° C.
In the cell viability assay or mitochondrial viability assay, exponentially growing cells of H9C2 cell line were plated in 96-well microplate at a density of 5000 cells per well in 100 μL of culture medium and allowed to adhere for 24 h before treatment. For hypoxia, hypoxic treatment was achieved by exposing cells to KRB buffer (composition in: NaCl 115 mM, KCl 4.7 mM, CaCl2 2.5 mM, KH2PO4 1.2 mM, MgSO4 1.2 mM, NaHCO3 24 mM, HEPES 10 mM; pH 7.4) at 37° C. for 3 hr in an oxygen-free hypoxic chamber (Stem Cell Technologies, United States), serial concentrations of RNA molecules obtained in Example 1 were then added to the cells before hypoxic treatment. For hypoxia/reoxygenation (H/R), Hypoxic treatment was achieved by exposing cells in glucose-free DMEM under conditions of 94.9% N2/5% CO2/0.1% O2 for 12 hr at a hypoxystation (whitley H35 hypoxystation, Don Whitley Scientific Ltd., England), serial concentrations of RNA molecules obtained in Example 1 and 2 were then added to the cells and reoxygenation by incubating in the normoxic condition (95% air/5% CO2) at 37° C. for 6 hr. After hypoxia or hypoxia/reoxygenation, MTT solution (100 μL per well, 0.5 mg/mL solution) or mitochondrial viability stain solution (follow the manufacture's instruction) was added to each well and incubated for 4 h at 37° C. Subsequently, for cell viability assay, 150 μL dimethyl sulfoxide (DMSO) were added and the optical densities of the resulting solutions were calorimetrically determined at 570 nm using a SpectraMax Paradigm multi-mode microplate reader (Molecular Devices, Sunnyvale, Calif., U.S.A). For mitochondrial viability assay, fluorescence detected at 550 nM excitation and 590 nM emission using SpectraMax Paradigm multi-mode microplate reader. Dose-response curves were obtained and calculated by GraphPad Prism 6 (GraphPad, La Jolla, Calif., USA). Each experiment was carried out for three times and expressed as means±standard deviation.
With reference to
With reference to
A comparative example of ginsenoside Rg1 implementation was used, and the results were shown in
The inventors then specifically determined the cardioprotective effect of RNA molecule HC50 and HC83 on H9C2 cells, at different concentrations, i.e. 900 nM, 300 nM, 30 nM, 3 nM and 0.3 nM. As shown in
H9C2 cells were plated in p-slide 8 well plate (Ibidi GmbH, Germany) at a density of 10000 cells per well in 200 μL of culture medium and allowed to adhere for 24 h before treatment. Hypoxic treatment was achieved by exposing cells in glucose-free DMEM under conditions of 94.9% N2/5% CO2/0.1% O2 for 12 hr at a hypoxystation (whitley H35 hypoxystation, Don Whitley Scientific Ltd., England), serial concentrations of RNA molecules obtained in Example 2 were then added to the cells and reoxygenation by incubating in the normoxic condition (95% air/5% CO2) at 37° C. for 6 hr. After hypoxia/reoxygenation, cells were stained with Rhodamine Phalloidin and DAPI following the manufacturer's instruction. Images were acquired on a Leica TCS SP8 Confocal Microscopy with a 20× objective.
The inventors specifically determined the protective effects of RNA molecule HC50 and HC83 on H9C2 cell cytoskeleton at different concentrations, i.e. 900 nM, 300 nM, 100 nM, 30 nM, 10 nM, 3 nM, and 0.3 nM. With reference to
Further, the inventors determined the protective effects of cholesterol-conjugated RNA molecule HC50 and HC83 on H9C2 cells at different concentrations, i.e. 900 nM, 300 nM, 100 nM, 30 nM, 10 nM, 3 nM, and 0.3 nM. With reference to
The inventors further compared the results to a control group and H/R along with DharmaFECT4 treated group (H/R+ DharmaFECT4), as shown in
Based on the above results, it is found that the small tRNA molecules isolated or derived from Panax ginseng C. A. Mey are highly effective on cardioprotection in vitro.
The embodiments described above are some examples of the present invention. For ordinary technicians in this field, several deformations and improvements can be made on the premise of not separating from the creative idea of the present invention, which belong to the protection scope of the present invention.
The implementation is further described with reference to the following numbered embodiments:
1. A method of preventing or treating a subject suffering from heart disease comprising administering a transfer RNA molecule, a fragment derived from the transfer RNA molecule or a functional variant or homolog thereof, wherein the transfer RNA molecule is isolated from or derived from a plant of a genus Panax.
2. The method of embodiment 1, wherein the plant of the genus Panax is Panax ginseng C. A. Mey, Panax notoginseng (Burkill) F. H. Chen or Panax quinquefolius Linn.
3. The method of embodiment 1, wherein the transfer RNA molecule is a nucleic acid sequence selected from any one of SEQ ID NO: 465 to SEQ ID NO: 522.
4. The method of embodiment 1, wherein the fragment derived from the transfer RNA molecule is a double-stranded RNA molecule comprising a sense sequence selected from any one of SEQ ID NO: 1 to SEQ ID NO: 232 or a functional variant or homolog thereof, and a complementary antisense sequence.
5. The method of embodiment 1, wherein the transfer RNA molecule, the fragment derived from the transfer RNA molecule or the functional variant or homolog thereof comprises a 2 mer of 3′ overhang.
6. The method of embodiment 1, wherein the transfer RNA molecule, the fragment derived from the transfer RNA molecule or the functional variant or homolog thereof comprises a 3′ cholesterol conjugation.
7. The method of embodiment 1, wherein the transfer RNA molecule, the fragment derived from the transfer RNA molecule or the functional variant or homolog thereof comprises at least one modified nucleoside selected from inosine, 1-methyladenosine, 2-methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, 2′-O-methyladenosine, N6-acetyladenosine, 1-methylinosine, pseudouridine, dihydrouridine, or 2-methylthio-N6-methyladenosine.
8. The method of embodiment 1, wherein the heart disease is selected from one or more of angina pectoris, myocardial infarction, myocardial ischemic injury, coronary heart disease, cardiac hypertrophy, and myocardial fibrosis.
9. A pharmaceutical composition for preventing or treating heart disease, wherein the pharmaceutical composition comprises an effective amount of a transfer RNA molecule, a fragment derived from the transfer RNA molecule or a functional variant or homolog thereof and a pharmaceutically tolerable vector, virus or excipient, wherein the transfer RNA molecule is isolated or derived from a plant of a genus Panax.
10. The pharmaceutical composition of embodiment 9, wherein the plant of the genus Panax is Panax ginseng C. A. Mey, Panax notoginseng (Burkill) F. H. Chen or Panax quinquefolius Linn.
11. The pharmaceutical composition of embodiment 9, wherein the transfer RNA molecule is a nucleic acid sequence selected from any one of SEQ ID NO: 465 to SEQ ID NO: 522.
12. The pharmaceutical composition of embodiment 9, wherein the fragment derived from the transfer RNA molecule is a double-stranded RNA molecule comprising a sense sequence selected from any one of SEQ ID NO: 1 to SEQ ID NO: 232 or a functional variant or homolog thereof, and a complementary antisense sequence.
13. The pharmaceutical composition of embodiment 9, wherein the transfer RNA molecule, the fragment derived from the transfer RNA molecule or the functional variant or homolog thereof comprises a 2 mer of 3′ overhang.
14. The pharmaceutical composition of embodiment 9, wherein the transfer RNA molecule, the fragment derived from the transfer RNA molecule or the functional variant or homolog thereof comprises a 3′ cholesterol conjugation.
15. The pharmaceutical composition of embodiment 9, wherein the transfer RNA molecule, the fragment derived from the transfer RNA molecule or the functional variant or homolog thereof comprises at least one modified nucleoside selected from inosine, 1-methyladenosine, 2-methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, 2′-O-methyladenosine, N6-acetyladenosine, 1-methylinosine, pseudouridine, dihydrouridine, or 2-methylthio-N6-methyladenosine.
16. The pharmaceutical composition of embodiment 9, wherein the heart disease is selected from one or more of angina pectoris, myocardial infarction, myocardial ischemic injury, coronary heart disease, cardiac hypertrophy, and myocardial fibrosis.
17. A recombinant vector comprising a double-stranded RNA molecule, wherein the double-stranded RNA molecule comprises a sense sequence selected from any one of SEQ ID NO: 1 to SEQ ID NO: 232 or a functional variant or homolog thereof, and a complementary antisense sequence.
18. The recombinant vector of embodiment 17, wherein the double-stranded RNA molecule comprises a 2 mer of 3′ overhang.
19. The recombinant vector of embodiment 17, wherein the double-stranded RNA molecule comprises a 3′ cholesterol conjugation.
20. The recombinant vector of embodiment 17, wherein the double-stranded RNA molecule comprises at least one modified nucleoside selected from inosine, 1-methyladenosine, 2-methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, 2′-O-methyladenosine, N6-acetyladenosine, 1-methyl inosine, pseudouridine, dihydrouridine, or 2-methylthio-N6-methyladenosine.
| Number | Date | Country | Kind |
|---|---|---|---|
| 201910784150.9 | Aug 2019 | CN | national |