Patent Application
20140154691
The field of the invention relates to cancer and the diagnosis and treatment of cancer.
Bladder cancer is a type of malignant growths of the urinary bladder. The most common type of bladder cancer begins in cells lining the inside of the bladder and is called transitional cell carcinoma (sometimes urothelial cell carcinoma). Types of bladder cancers include transitional cell carcinoma, squamous cell carcinoma, adenocarcinoma, sarcoma, small cell carcinoma and secondary deposits from cancers elsewhere in the body. Bladder cancer characteristically causes blood in the urine; this may be visible to the naked eye (gross hematuria) or detectable only by microscope (microscopic hematuria). Other possible symptoms include pain during urination, frequent urination (polyuria) or feeling the need to urinate without results
The gold standard for diagnosing bladder cancer is biopsy obtained during cystoscopy. Sometimes it is an incidental finding during cystoscopy. Urine cytology can be obtained in voided urine or at the time of the cystoscopy (“bladder washing”). Cytology is very specific (a positive result is highly indicative of bladder cancer) but suffers from low sensitivity (inability of a negative result to reliably exclude bladder cancer). There are newer urine bound markers for the diagnosis of bladder cancer. These markers are not currently used routinely in clinical practice due to absence of clear professional guidelines. They are much more expensive as well. Bladder cancer may also be diagnosed with a Cysview™ guided fluorescence cystoscopy, as an adjunct to conventional white-light cystoscopy. This procedure improves the detection of bladder cancer and reduces the rate of early tumor recurrence, compared with white-light cystoscopy alone.
Many patients with a history, signs, and symptoms of bladder cancer are referred to a urologist or other physician trained in cystoscopy, a procedure in which a flexible tube bearing a camera and various instruments is introduced into the bladder through the urethra. Suspicious lesions may be biopsied and sent for pathologic analysis. These procedures are invasive.
There is a need in the field of cancer diagnostics for a highly specific, highly sensitive, rapid, inexpensive, and relatively non-invasive method of diagnosing bladder cancer. Various embodiments of the invention described below meet this need as well as other needs in the field of diagnosing and treating bladder cancer.
Embodiments of the disclosure provide for methods of diagnosis, prognosis and treatment of bladder cancer.
In certain embodiments the invention provides a method of detecting bladder cancer in a subject comprising a) contacting a sample obtained from the subject with one or more agents that detect one or more markers expressed by a bladder cancer cell b) contacting a non-cancerous cell with the one or more agents from a); and c) comparing the expression level of the marker in the sample obtained from the subject with the expression level in the non-cancerous cell, wherein a higher level of expression of the marker in the sample compared to the non-cancerous cell indicates that the subject has bladder cancer.
In certain embodiments the invention provides a method of detecting bladder cancer in a subject comprising a) contacting a sample obtained from the subject with one or more agents that detect expression of at least one of the markers listed in Table 2 or 3; b) contacting a non-cancerous cell, e.g., a non-cancerous cell from bladder tissue or a noncancerous bladder cell line, with the one or more agents from a); and c) comparing the expression level of one or more of the markers listed in Table 2 or 3 in the sample obtained from the subject with the expression level of one or more of the markers listed in Table 2 or 3 in the non-cancerous cell, wherein a higher level of expression of one or more of the markers listed in Table 2 or 3 in the sample compared to the non-cancerous cell indicates that the subject has bladder cancer.
In some embodiments the invention provides a method of detecting bladder cancer in a subject comprising a) contacting a sample obtained from the subject with one or more agents that detect expression of at least one of the markers chosen from MAGEA10, DSCR8, MMP12, CXCL9, DSCR8, KRT81, LOC729826, PTHLH, MMP11, S100A7, WISP3, CXCL10, NMU, GBP5, TOP2A, SERPINB4, GNLY, GTSF1, PI3, S100A7A, IDO1, GJB6, CALML3, SERPINB3, CXCL6, OLFM4, TCN1, VSNL1, UBD, AIM2, ABCC9, SERPINB13, INDO, KRT5, LOC100130897, KRT14, FAM83A, FAM181B, GZMB, DSG3, TYMP, KRT6A, KRT6B, HLA-DRB1, LCN2, KRT4, IFI30, LOC100134370, KIAA1618, S100A8, MMP7, MMP7, SPRR2A, GJB2, COL10A1, FCRLB, SFN, S100A2, IL1A, KRT16 SLC1A6, and SERPINB5; b) contacting a non-cancerous cell, e.g. a non-cancerous cell from bladder tissue or a non-cancerous bladder cell line, with the one or more agents that detect expression of at least one of the markers chosen from MAGEA10, DSCR8, MMP12, CXCL9, DSCR8, KRT81, LOC729826, PTHLH, MMP11, S100A7, WISP3, CXCL10, NMU, GBP5, TOP2A, SERPINB4, GNLY, GTSF1, PI3, S100A7A, IDO1, GJB6, CALML3, SERPINB3, CXCL6, OLFM4, TCN1, VSNL1, UBD, AIM2, ABCC9, SERPINB13, INDO, KRT5, LOC100130897, KRT14, FAM83A, FAM181B, GZMB, DSG3, TYMP, KRT6A, KRT6B, HLA-DRB1, LCN2, KRT4, IFI30, LOC100134370, KIAA1618, S100A8, MMP7, MMP7, SPRR2A, GJB2, COL10A1, FCRLB, SFN, S100A2 IL1A, KRT16 SLC1A6, and SERPINB5; and c) comparing the expression level of one or more of the markers chosen from MAGEA10, DSCR8, MMP12, CXCL9, DSCR8, KRT81, LOC729826, PTHLH, MMP11, S100A7, WISP3, CXCL10, NMU, GBP5, TOP2A, SERPINB4, GNLY, GTSF1, PI3, S100A7A, IDO1, GJB6, CALML3, SERPINB3, CXCL6, OLFM4, TCN1, VSNL1, UBD, AIM2, ABCC9, SERPINB13, INDO, KRT5, LOC100130897, KRT14, FAM83A, FAM181B, GZMB, DSG3, TYMP, KRT6A, KRT6B, HLA-DRB1, LCN2, KRT4, IFI30, LOC100134370, KIAA1618, S100A8, MMP7, MMP7, SPRR2A, GJB2, COL10A1, FCRLB, SFN, S100A IL1A, KRT16 SLC1A6, and SERPINB52 in the sample obtained from the subject with the expression level of one or more of the markers chosen from MAGEA10, DSCR8, MMP12, CXCL9, DSCR8, KRT81, LOC729826, PTHLH, MMP11, S100A7, WISP3, CXCL10, NMU, GBP5, TOP2A, SERPINB4, GNLY, GTSF1, PI3, S100A7A, IDO1, GJB6, CALML3, SERPINB3, CXCL6, OLFM4, TCN1, VSNL1, UBD, AIM2, ABCC9, SERPINB13, INDO, KRT5, LOC100130897, KRT14, FAM83A, FAM181B, GZMB, DSG3, TYMP, KRT6A, KRT6B, HLA-DRB1, LCN2, KRT4, IFI30, LOC100134370, KIAA1618, S100A8, MMP7, MMP7, SPRR2A, GJB2, COL10A1, FCRLB, SFN, S100A2 IL1A, KRT16 SLC1A6, and SERPINB5 in the non-cancerous cell, wherein a higher level of expression of one or more of the markers chosen from MAGEA10, DSCR8, MMP12, CXCL9, DSCR8, KRT81, LOC729826, PTHLH, MMP11, S100A7, WISP3, CXCL10, NMU, GBP5, TOP2A, SERPINB4, GNLY, GTSF1, PI3, S100A7A, IDO1, GJB6, CALML3, SERPINB3, CXCL6, OLFM4, TCN1, VSNL1, UBD, AIM2, ABCC9, SERPINB13, INDO, KRT5, LOC100130897, KRT14, FAM83A, FAM181B, GZMB, DSG3, TYMP, KRT6A, KRT6B, HLA-DRB1, LCN2, KRT4, IFI30, LOC100134370, KIAA1618, S100A8, MMP7, MMP7, SPRR2A, GJB2, COL10A1, FCRLB, SFN, S100A2 IL1A, KRT16 SLC1A6, and SERPINB5 in the sample compared to the non-cancerous cell indicates that the subject has bladder cancer.
With regard to the embodiments described in the preceding paragraphs, the sample may be any sample as described infra, for example, a bodily fluid, such as blood, serum or urine. The sample may be a cellular sample, a tissue sample or the extract of a cellular or tissue sample. The agent may be one or more molecules that bind specifically to one or more proteins expressed by the cancer cell or one or more nucleic acids expressed by the cell. For example, the agent may be a protein such as an antibody that binds specifically to the protein expressed by one of the marker genes identified infra. The agent may be one or more nucleic acids that hybridize to a nucleic acid expressed by the cancer cell. The nucleic acid expressed by the cancer cell may be an RNA molecule, e.g. an mRNA molecule. The nucleic acid molecule that hybridizes to the nucleic acid expressed by the cancer cell may be a DNA molecule, such as a DNA probe.
In still other embodiments the invention provides a composition of matter useful in distinguishing a bladder cancer cell from a non-cancerous cell comprising one or more molecules that specifically bind to a molecule expressed at higher levels on a bladder cancer cell compared to a non-cancer cell. As an example, the composition may comprise a protein, that binds to one or more molecules expressed by the cancer cell at higher levels compared to the non-cancer cell. As another example, the composition may comprise a nucleic acid that binds to one or more molecules expressed by the bladder cancer cell at higher levels compared to the non-cancer cell.
In some embodiments the invention provides a composition of matter comprising a protein, such as an antibody, that specifically binds to a molecule expressed by a bladder cancer cell chosen from the markers listed in Table 3. The molecule expressed by the bladder cancer cell may be expressed by the bladder cancer cell at level that is higher than the level expressed by a non-cancerous cell such as a non-cancerous bladder tissue cell or non-cancerous bladder cell line.
In certain embodiments the invention provides a composition of matter comprising a protein, such as an antibody, that specifically binds to a molecule expressed by a bladder cancer cell chosen from MAGEA10, DSCR8, MMP12, CXCL9, DSCR8, KRT81, LOC729826, PTHLH, MMP11, S100A7, WISP3, CXCL10, NMU, GBP5, TOP2A, SERPINB4, GNLY, GTSF1, PI3, S100A7A, IDOL GJB6, CALML3, SERPINB3, CXCL6, OLFM4, TCN1, VSNL1, UBD, AIM2, ABCC9, SERPINB13, INDO, KRT5, LOC100130897, KRT14, FAM83A, FAM181B, GZMB, DSG3, TYMP, KRT6A, KRT6B, HLA-DRB1, LCN2, KRT4, IFI30, LOC100134370, KIAA1618, S100A8, MMP7, MMP7, SPRR2A, GJB2, COL10A1, FCRLB, SFN, S100A2 IL1A, KRT16 SLC1A6, and SERPINB5. The molecule expressed by the bladder cancer cell may be expressed by the bladder cancer cell at level that is higher than the level expressed by a non-cancerous cell such as a non-cancerous bladder tissue cell.
In other embodiments the invention provides a composition of matter comprising a nucleic acid that specifically binds to a molecule, such as an mRNA molecule, expressed by a bladder cancer cell wherein the molecule is chosen from a marker listed in Table 1 or 2. The molecule expressed by the bladder cancer cell may be expressed by the bladder cancer cell at level that is higher than the level expressed by a non-cancerous cell such as a non-cancerous bladder tissue cell.
In other embodiments the invention provides a composition of matter comprising a nucleic acid that specifically binds to a molecule, such as an mRNA molecule, expressed by a bladder cancer cell wherein the molecule is chosen from a nucleic acid encoding MAGEA10, DSCR8, MMP12, CXCL9, DSCR8, KRT8I, LOC729826, PTHLH, MMP11, S100A7, WISP3, CXCL10, NMU, GBP5, TOP2A, SERPINB4, GNLY, GTSF1, PI3, S100A7A, IDO1, GJB6, CALML3, SERPINB3, CXCL6, OLFM4, TCN1, VSNL1, UBD, AIM2, ABCC9, SERPINB13, INDO, KRT5, LOC100130897, KRT14, FAM83A, FAM181B, GZMB, DSG3, TYMP, KRT6A, KRT6B, HLA-DRB1, LCN2, KRT4, IFI30, LOC100134370, KIAA1618, S100A8, MMP7, MMP7, SPRR2A, GJB2, COL10A1, FCRLB, SFN, S100A2 IL1A, KRT16 SLC1A6, and SERPINB5. The molecule expressed by the bladder cancer cell may be expressed by the bladder cancer cell at level that is higher than the level expressed by a non-cancerous cell such as a non-cancerous bladder tissue cell.
In still further embodiments the invention provides a method of determining if a cancer in a subject is advancing comprising a) measuring the expression level of one or more markers associated with cancer at a first time point; b) measuring the expression level of the one or more markers measured in a) at a second time point, wherein the second time point is subsequent to the first time point; and c) comparing the expression level measured in a) and b), wherein an increase in the expression level of the one or more markers in b) compared to a) indicates that the subject's cancer is advancing. In certain embodiments the cancer is bladder cancer.
In some embodiments the invention provides a method of determining if a bladder cancer in a subject is advancing comprising a) measuring the expression level of one or more markers listed in Table 2 or 3 at a first time point; b) measuring the expression level of the one or more markers measured in a) at a second time point, wherein the second time point is subsequent to the first time point; and c) comparing the expression level measured in a) and b), wherein an increase in the expression level of the one or more markers at the second time point compared to the first time point indicates that the subject's bladder cancer is advancing.
In other embodiments the invention provides a method of determining if a bladder cancer in a subject is advancing comprising a) measuring the expression level of one or more markers chosen from MAGEA10, DSCR8, MMP12, CXCL9, DSCR8, KRT81, LOC729826, PTHLH, MMP11, S100A7, WISP3, CXCL10, NMU, GBP5, TOP2A, SERPINB4, GNLY, GTSF1, PI3, S100A7A, IDO1, GJB6, CALML3, SERPINB3, CXCL6, OLFM4, TCN1, VSNL1, UBD, AIM2, ABCC9, SERPINB13, INDO, KRT5, LOC100130897, KRT14, FAM83A, FAM181B, GZMB, DSG3, TYMP, KRT6A, KRT6B, HLA-DRB1, LCN2, KRT4, IFI30, LOC100134370, KIAA1618, S100A8, MMP7, MMP7, SPRR2A, GJB2, COL10A1, FCRLB, SFN, S100A2 IL1A, KRT16 SLC1A6, and SERPINB5 at a first time point; b) measuring the expression level of the one or more markers measured in a) at a second time point, wherein the second time point is subsequent to the first time point; and c) comparing the expression level measured in a) and b), wherein an increase in the expression level of the one or more markers at the second time point compared to the first time point indicates that the subject's bladder cancer is advancing.
In some embodiments the invention provides antigens (i.e. cancer-associated polypeptides) associated with bladder cancer as targets for diagnostic and/or therapeutic antibodies. In some embodiments, the antigen may be chosen from a protein encoded by, a gene listed in Table 2, a fragment thereof, or a combination of proteins encoded by a gene listed in Table 2.
In some embodiments the invention provides antigens (i.e. cancer-associated polypeptides) associated with bladder cancer as targets for diagnostic and/or therapeutic antibodies. In some embodiments, the antigen may be chosen from a protein encoded by, a gene chosen from MAGEA10, DSCR8, MMP12, CXCL9, DSCR8, KRT81, LOC729826, PTHLH, MMP11, S100A7, WISP3, CXCL10, NMU, GBP5, TOP2A, SERPINB4, GNLY, GTSF1, PI3, S100A7A, IDO1, GJB6, CALML3, SERPINB3, CXCL6, OLFM4, TCN1, VSNL1, UBD, AIM2, ABCC9, SERPINB13, INDO, KRT5, LOC100130897, KRT14, FAM83A, FAM181B, GZMB, DSG3, TYMP, KRT6A, KRT6B, HLA-DRB1, LCN2, KRT4, IFI130, LOC100134370, KIAA1618, S100A8, MMP7, MMP7, SPRR2A, GJB2, COL10A1, FCRLB, SFN, S100A2 IL1A, KRT16 SLC1A6, and SERPINB5, a fragment thereof, or a combination of proteins encoded by a gene chosen from MAGEA10, DSCR8, MMP12, CXCL9, DSCR8, KRT81, LOC729826, PTHLH, MMP11, S100A7, WISP3, CXCL10, NMU, GBP5, TOP2A, SERPINB4, GNLY, GTSF1, PI3, S100A7A, IDO1, GJB6, CALML3, SERPINB3, CXCL6, OLFM4, TCN1, VSNL1, UBD, AIM2, ABCC9, SERPINB13, INDO, KRT5, LOC100130897, KRT14, FAM83A, FAM181B, GZMB, DSG3, TYMP, KRT6A, KRT6B, HLA-DRB1, LCN2, KRT4, IFI30, LOC100134370, KIAA1618, S100A8, MMP7, MMP7, SPRR2A, GJB2, COL10A1, FCRLB, SFN, S100A2 IL1A, KRT16 SLC1A6, and SERPINB5.
In yet other embodiments the invention provides a method of eliciting an immune response to a bladder cancer cell comprising contacting a subject with a protein or protein fragment that is expressed by a bladder cancer cell thereby eliciting an immune response to the cancer cell. As an example the subject may be contacted intravenously or intramuscularly.
In further embodiments the invention provides a method of eliciting an immune response to a bladder cancer cell comprising contacting a subject with one or more proteins or protein fragments that is encoded by a gene chosen from the genes listed in Table 3, thereby eliciting an immune response to a bladder cancer cell. As an example the subject may be contacted intravenously or intramuscularly.
In still other embodiments the invention provides a method of eliciting an immune response to a bladder cancer cell comprising contacting a subject with one or more proteins or protein fragments that is encoded by a gene chosen from MAGEA10, DSCR8, MMP12, CXCL9, DSCR8, KRT81, LOC729826, PTHLH, MMP11, S100A7, WISP3, CXCL10, NMU, GBP5, TOP2A, SERPINB4, GNLY, GTSF1, PI3, S100A7A, IDO1, GJB6, CALML3, SERPINB3, CXCL6, OLFM4, TCN1, VSNL1, UBD, AIM2, ABCC9, SERPINB13, INDO, KRT5, LOC100130897, KRT14, FAM83A, FAM181B, GZMB, DSG3, TYMP, KRT6A, KRT6B, HLA-DRB1, LCN2, KRT4, IFI30, LOC100134370, KIAA1618, S100A8, MMP7, MMP7, SPRR2A, GJB2, COL10A1, FCRLB, SFN, S100A2 IL1A, KRT16 SLC1A6, and SERPINB5, thereby eliciting an immune response to a bladder cancer cell. As an example the subject may be contacted intravenously or intramuscularly.
In other embodiments the invention provides a kit for detection of cancer in a sample obtained from a subject. The kit may comprise one or more agents that bind specifically to a molecule expressed by a bladder cancer cell. The molecule may be expressed at a higher level in the bladder cancer cell compared to a non-cancerous cell, such as a non-cancerous bladder cell. The kit may comprise one or more containers and instructions for determining if the sample is positive for cancer. The kit may optionally contain one or more multiwell plates, a detectable substance or label such as a dye, a radioactively labeled molecule, a chemiluminescently labeled molecule and the like. The kit may further contain a positive control (e.g. one or more cancerous bladder cells; or specific known quantities of the molecule expressed by the cancer cell) and a negative control (e.g. a tissue or cell sample that is non-cancerous).
In some embodiments the invention provides a kit for the detection of bladder cancer comprising one or more agents that specifically bind one or more markers chosen from MAGEA10, DSCR8, MMP12, CXCL9, DSCR8, KRT81, LOC729826, PTHLH, MMP11, S100A7, WISP3, CXCL10, NMU, GBP5, TOP2A, SERPINB4, GNLY, GTSF1, PI3, S100A7A, IDO1, GJB6, CALML3, SERPINB3, CXCL6, OLFM4, TCN1, VSNL1, UBD, AIM2, ABCC9, SERPINB13, INDO, KRT5, LOC100130897, KRT14, FAM83A, FAM181B, GZMB, DSG3, TYMP, KRT6A, KRT6B, HLA-DRB1, LCN2, KRT4, IFI30, LOC100134370, KIAA1618, S100A8, MMP7, MMP7, SPRR2A, GJB2, COL10A1, FCRLB, SFN, S100A2 IL1A, KRT16 SLC1A6, and SERPINB5. The kit may comprise one or more containers and instructions for determining if the sample is positive for cancer. The kit may optionally contain one or more multiwell plates, a detectable substance such as a dye, a radioactively labeled molecule, a chemiluminescently labeled molecule and the like. The kit may further contain a positive control (e.g. one or more cancerous cells; or specific known quantities of the molecule expressed by the cancer cell) and a negative control (e.g. a tissue or cell sample that is non-cancerous). As an example the kit may take the form of an ELISA or a DNA microarray.
Some embodiments herein are directed to a method of treating bladder cancer in a subject, the method comprising administering to a subject in need thereof a therapeutic agent capable of modulating the activity of a cancer associated protein, wherein the cancer associated protein is encoded by gene listed in Table 2, homologs thereof, combinations thereof, or a fragment thereof. In some embodiments, the therapeutic agent binds to the bladder cancer associated protein. In some embodiments, the therapeutic agent is an antibody. In some embodiments, the antibody may be a monoclonal antibody or a polyclonal antibody. In some embodiments, the antibody is a humanized or human antibody.
Some embodiments herein are directed to a method of treating bladder cancer in a subject, the method comprising administering to a subject in need thereof a therapeutic agent modulating the activity of a cancer associated protein, wherein the cancer associated protein is encoded by gene chosen from MAGEA10, DSCR8, MMP12, CXCL9, DSCR8, KRT81, LOC729826, PTHLH, MMP11, S100A7, WISP3, CXCL10, NMU, GBP5, TOP2A, SERPINB4, GNLY, GTSF1, PI3, S100A7A, IDO1, GJB6, CALML3, SERPINB3, CXCL6, OLFM4, TCN1, VSNL1, UBD, AIM2, ABCC9, SERPINB13, INDO, KRT5, LOC100130897, KRT14, FAM83A, FAM181B, GZMB, DSG3, TYMP, KRT6A, KRT6B, HLA-DRB1, LCN2, KRT4, IFI130, LOC100134370, KIAA1618, S100A8, MMP7, MMP7, SPRR2A, GJB2, COL10A1, FCRLB, SFN, S100A2 IL1A, KRT16 SLC1A6, and SERPINB5, homologs thereof, combinations thereof, or a fragment thereof. In some embodiments, the therapeutic agent binds to the bladder cancer associated protein. In some embodiments, the therapeutic agent is an antibody. In some embodiments, the antibody may be a monoclonal antibody or a polyclonal antibody. In some embodiments, the antibody is a humanized or human antibody.
In some embodiments, a method of treating bladder cancer in a subject may comprise administering to a subject in need thereof a therapeutic agent that modulates the activity of one or more genes chosen from those listed in Table 2.
In some embodiments, a method of treating bladder cancer in a subject may comprise administering to a subject in need thereof a therapeutic agent that modulates the activity of one or more genes chosen from MAGEA10, DSCR8, MMP12, CXCL9, DSCR8, KRT81, LOC729826, PTHLH, MMP11, S100A7, WISP3, CXCL10, NMU, GBP5, TOP2A, SERPINB4, GNLY, GTSF1, PI3, S100A7A, IDO1, GJB6, CALML3, SERPINB3, CXCL6, OLFM4, TCN1, VSNL1, UBD, AIM2, ABCC9, SERPINB13, INDO, KRT5, LOC100130897, KRT14, FAM83A, FAM181B, GZMB, DSG3, TYMP, KRT6A, KRT6B, HLA-DRB1, LCN2, KRT4, IFI30, LOC100134370, KIAA1618, S100A8, MMP7, MMP7, SPRR2A, GJB2, COL10A1, FCRLB, SFN, S100A2 IL1A, KRT16 SLC1A6, and SERPINB5.
In further embodiments, the invention provides a method of treating bladder cancer may comprise a gene knockdown of one or more genes listed in Table 2. In some embodiments, a method of treating bladder cancer may comprise treating cells to knockdown or inhibit expression of a gene encoding an mRNA of one or more genes chosen from those listed n Table 2.
In other embodiments, a method of treating bladder cancer may comprise gene knockdown of one or more genes selected from MAGEA10, DSCR8, MMP12, CXCL9, DSCR8, KRT81, LOC729826, PTHLH, MMP11, S100A7, WISP3, CXCL10, NMU, GBP5, TOP2A, SERPINB4, GNLY, GTSF1, PI3, S100A7A, IDO1, GJB6, CALML3, SERPINB3, CXCL6, OLFM4, TCN1, VSNL1, UBD, AIM2, ABCC9, SERPINB13, INDO, KRT5, LOC100130897, KRT14, FAM83A, FAM181B, GZMB, DSG3, TYMP, KRT6A, KRT6B, HLA-DRB1, LCN2, KRT4, IFI30, LOC100134370, KIAA1618, S100A8, MMP7, MMP7, SPRR2A, GJB2, COL10A1, FCRLB, SFN, S100A2 IL1A, KRT16 SLC1A6, and SERPINB5. In some embodiments, a method of treating bladder cancer may comprise treating cells to knockdown or inhibit expression of a gene encoding an mRNA of one or more genes chosen from MAGEA10, DSCR8, MMP12, CXCL9, DSCR8, KRT81, LOC729826, PTHLH, MMP11, S100A7, WISP3, CXCL10, NMU, GBP5, TOP2A, SERPINB4, GNLY, GTSF1, PI3, S100A7A, IDO1, GJB6, CALML3, SERPINB3, CXCL6, OLFM4, TCN1, VSNL1, UBD, AIM2, ABCC9, SERPINB13, INDO, KRT5, LOC100130897, KRT14, FAM83A, FAM181B, GZMB, DSG3, TYMP, KRT6A, KRT6B, HLA-DRB1, LCN2, KRT4, IFI30, LOC100134370, KIAA1618, S100A8, MMP7, MMP7, SPRR2A, GJB2, COL10A1, FCRLB, SFN, S100A2 IL1A, KRT16 SLC1A6, and SERPINB5
In still other embodiments, the present invention provides methods of screening a drug candidate for activity against bladder cancer, the method comprising: (a) contacting a cell that expresses one or more cancer associated genes chosen from those listed in Table 2 with a drug candidate; (b) detecting an effect of the drug candidate on an expression of the one or more bladder cancer associated genes in the cell from a); and (c) comparing the level of expression of one or more of the genes recited in a) in the absence of the drug candidate to the level of expression of the one or more genes in the presence of the drug candidate; wherein a decrease in the expression of the bladder cancer associated gene in the presence of the drug candidate indicates that the candidate has activity against bladder cancer.
In further embodiments, the present invention provides methods of screening a drug candidate for activity against bladder cancer, the method comprising: (a) contacting a cell that expresses one or more bladder cancer associated genes chosen from MAGEA10, DSCR8, MMP12, CXCL9, DSCR8, KRT81, LOC729826, PTHLH, MMP11, S100A7, WISP3, CXCL10, NMU, GBP5, TOP2A, SERPINB4, GNLY, GTSF1, PI3, S100A7A, IDO1, GJB6, CALML3, SERPINB3, CXCL6, OLFM4, TCN1, VSNL1, UBD, AIM2, ABCC9, SERPINB13, INDO, KRT5, LOC100130897, KRT14, FAM83A, FAM181B, GZMB, DSG3, TYMP, KRT6A, KRT6B, HLA-DRB1, LCN2, KRT4, IFI30, LOC100134370, KIAA1618, S 100A8, MMP7, MMP7, SPRR2A, GJB2, COL10A1, FCRLB, SFN, S100A2 IL1A, KRT16 SLC1A6, and SERPINB5 with a drug candidate; (b) detecting an effect of the drug candidate on an expression of the one or more bladder cancer associated genes in the cell from a); and (c) comparing the level of expression of one or more of the genes recited in a) in the absence of the drug candidate to the level of expression in the presence of the drug candidate; wherein a decrease in the expression of the bladder cancer associated gene in the presence of the drug candidate indicates that the candidate has activity against bladder cancer.
In some embodiments, the present invention provides methods of visualizing a bladder cancer tumor in a subject comprising a) targeting one or more bladder cancer associated proteins with a labeled molecule that binds specifically to the bladder cancer tumor, wherein the cancer associated protein is selected from a protein encoded for by one or more genes chosen from those listed in Table 2; and b) detecting the labeled molecule, wherein the labeled molecule visualizes the tumor in the subject.
In still other embodiments, the present invention provides methods of visualizing a bladder cancer tumor in a subject comprising a) targeting one or more bladder cancer associated proteins with a labeled molecule that binds specifically to the bladder cancer associated protein, wherein the cancer associated protein is selected from a protein encoded for by one or more genes chosen from MAGEA10, DSCR8, MMP12, CXCL9, DSCR8, KRT81, LOC729826, PTHLH, MMP11, S100A7, WISP3, CXCL10, NMU, GBP5, TOP2A, SERPINB4, GNLY, GTSF1, PI3, S100A7A, IDO1, GJB6, CALML3, SERPINB3, CXCL6, OLFM4, TCN1, VSNL1, UBD, AIM2, ABCC9, SERPINB13, INDO, KRT5, LOC100130897, KRT14, FAM83A, FAM181B, GZMB, DSG3, TYMP, KRT6A, KRT6B, HLA-DRB1, LCN2, KRT4, IFI30, LOC100134370, KIAA1618, S100A8, MMP7, MMP7, SPRR2A, GJB2, COL10A1, FCRLB, SFN, S100A2 IL1A, KRT16 SLC1A6, and SERPINB5; and b) detecting the labeled molecule, wherein the labeled molecule visualizes the tumor in the subject.
The invention also provides the use of one or more of the markers disclosed infra in the detection of bladder cancer in a subject.
The invention also provides the use of one or more of the markers disclosed infra in estimating the risk of morbidity of bladder cancer in a subject.
For a fuller understanding of the nature and advantages of the present invention, reference should be had to the following detailed description taken in connection with the accompanying drawings, in which:
Before the present compositions and methods are described, it is to be understood that this invention is not limited to the particular processes, compositions, or methodologies described, as these may vary. It is also to be understood that the terminology used in the description is for the purpose of describing the particular versions or embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the present invention, specific methods, devices, and materials are now described.
The invention provides for the rapid, accurate, and cost effective means to detect bladder cancer in a subject. The method comprises detecting one or more markers that are specifically expressed on bladder cancer tumors in a sample as disclosed infra. The sample may be a bodily fluid such as serum, or urine. Thus in some embodiments the invention provides for a non-invasive test for detecting bladder cancer in a subject. In other embodiments the sample may be a tissue or cell sample. Also provided are methods of screening for drugs having activity against bladder cancer, therapeutics for bladder cancer as well as compositions and kits useful in detecting, and prognosing bladder cancer.
As used herein, the singular forms “a,” “an,” and “the” include plural reference unless the context clearly dictates otherwise. Thus, for example, reference to a “therapeutic” is a reference to one or more therapeutics and equivalents thereof known to those skilled in the art, and so forth.
As used herein, the term “about” means plus or minus 10% of the numerical value of the number with which it is being used. Therefore, about 50% means in the range of 45% to 55%.
“Administering,” when used in conjunction with a therapeutic, means to administer a therapeutic directly into or onto a target tissue or to administer a therapeutic to a patient whereby the therapeutic positively impacts the tissue to which it is targeted. Thus, as used herein, the term “administering”, when used in conjunction with elastin digest, can include, but is not limited to, providing an elastin digest into or onto the target tissue; providing an elastin digest systemically to a patient by, e.g., intravenous injection whereby the therapeutic reaches the target tissue; providing an elastin digest in the form of the encoding sequence thereof to the target tissue (e.g., by so-called gene-therapy techniques). “Administering” a composition may be accomplished by oral administration, intravenous injection, intraperitoneal injection, intramuscular injection, subcutaneous injection, transdermal diffusion or electrophoresis, local injection, extended release delivery devices including locally implanted extended release devices such as bioerodible or reservoir-based implants, as protein therapeutics or as nucleic acid therapeutic via gene therapy vectors, topical administration, or by any of these methods in combination with other known techniques. Such combination techniques include heating, radiation and ultrasound.
The term “animal,” “patient” or “subject” as used herein includes, but is not limited to mammals, including humans and non-human primates, farm animals such as pigs, goats, horses, sheep, cows, rodents including rats and mice, rabbits, cats, dogs and the like. In some embodiments, the term “subject,” may refer to humans. In some embodiments, the term “subject,” may refer to a male. In some embodiments, the term “subject,” may refer to a female.
The term “bladder cancer” as used herein, may include transitional cell carcinoma, squamous cell carcinoma, adenocarcinoma, sarcoma, small cell carcinoma, secondary deposits from cancers elsewhere in the body or a combination thereof.
The term “inhibiting” includes the administration of a compound of the present invention to prevent the onset of the symptoms, alleviating the symptoms, or eliminating the disease, condition or disorder.
By “pharmaceutically acceptable”, it is meant the carrier, diluent or excipient must be compatible with the other ingredients of the formulation and not deleterious to the recipient thereof.
In some embodiments, the present disclosure provides for nucleic acid and protein sequences that are associated with cancer, herein termed “cancer associated” or “CA” sequences. In some embodiments, the present disclosure provides nucleic acid and protein sequences that are associated with cancers or carcinomas that originate in bladder or urinary tissue, herein termed “bladder cancer associated” sequences.
The term “pluripotent stem cells” refers to animal cells capable of differentiating into more than one differentiated cell type. Such cells include hES cells, hED cells, hEG cells, hEC cells, and adult-derived cells including mesenchymal stem cells, neuronal stem cells, and bone marrow-derived stem cells. Pluripotent stem cells may be genetically modified or not genetically modified. Genetically modified cells may include markers such as fluorescent proteins to facilitate their identification.
The term “embryonic stem cells” (ES cells) refers to cells derived from the inner cell mass of blastocysts, blastomeres, or morulae that have been serially passaged as cell lines while maintaining an undifferentiated state (e.g. expressing TERT, OCT4, and SSEA and TRA antigens specific for ES cells of the species). Established cell lines may be available from cell banks such as WiCell. The ES cells may be derived from in vitro fertilization of an egg cell with sperm or DNA, nuclear transfer, parthenogenesis, or by means to generate hES cells with hemizygosity or homozygosity in the MHC region. The term “human embryonic stem cells” (hES cells) refers to human ES cells.
The term “human embryonic germ cells” (hEG cells) refer to pluripotent stem cells derived from the primordial germ cells of fetal tissue or maturing or mature germ cells such as oocytes and spermatogonial cells, that can differentiate into various tissues in the body. The hEG cells may also be derived from pluripotent stem cells produced by gynogenetic or androgenetic means, i.e., methods wherein the pluripotent cells are derived from oocytes containing only DNA of male or female origin and therefore will comprise all female-derived or male-derived DNA (see U.S. application Nos. 60/161,987, filed Oct. 28, 1999; Ser. No. 09/697,297, filed Oct. 27, 2000; Ser. No. 09/995,659, filed Nov. 29, 2001; Ser. No. 10/374,512, filed Feb. 27, 2003; PCT application no. PCT/US/00/29551, filed Oct. 27, 2000; the disclosures of which are incorporated herein in their entirety).
The term human iPS cells refers to cells with properties similar to hES cells, including the ability to form all three germ layers when transplanted into immunocompromised mice wherein said iPS cells are derived from cells of varied somatic cell lineages following exposure to hES cell-specific transcription factors such as KLF4, SOX2, MYC, and OCT4 or the factors SOX2, OCT4, NANOG, and LIN28. Said iPS cells may be produced by the expression of these gene through vectors such as retroviral vectors as is known in the art, or through the introduction of these factors by permeabilization or other technologies taught by PCT application number PCT/US2006/030632 (WO2007/019398).
The term “differentiated cells” when used in reference to cells made by methods of this invention from pluripotent stem cells refer to cells having reduced potential to differentiate when compared to the parent pluripotent stem cells. The differentiated cells of this invention comprise cells that could differentiate further (i.e., they may not be terminally differentiated).
The term embryonal carcinoma (“EC”) cells, including human EC cells, refers to embryonal carcinoma cells such as TERA-1, TERA-2, and NTera-2.
As used herein, the term “naturally occurring” refers to sequences or structures that may be in a form normally found in nature. “Naturally occurring” may include sequences in a form normally found in any animal.
As used herein, the term “cancer associated sequences” refers to nucleotide or protein sequences that are either differentially expressed, activated, inactivated or altered in cancers as compared to normal tissue. Cancer associated sequences may include those that are up-regulated (i.e. expressed at a higher level), as well as those that are down-regulated (i.e. expressed at a lower level), in cancers when compared to a non-cancerous or normal sample. Cancer associated sequences can also include sequences that have been altered (i.e., translocations, truncated sequences or sequences with substitutions, deletions or insertions, including, but not limited to, point mutations) and show either the same expression profile or an altered profile. In some embodiments, the cancer associated sequences are from humans; however, as will be appreciated by those in the art, cancer associated sequences from other subjects may be useful in animal models of disease and drug evaluation; thus, other cancer associated sequences may be useful such as any subject, e.g., without limitation, sequences from vertebrates, including mammals, including rodents (rats, mice, hamsters, guinea pigs, etc.), primates, and farm animals (including sheep, goats, pigs, cows, horses, etc). Cancer associated sequences from other organisms may be obtained using the techniques outlined below.
The term “homology,” as used herein, refers to a degree of complementarity. There may be partial homology or complete homology. The word “identity” may substitute for the word “homology.” A partially complementary nucleic acid sequence that at least partially inhibits an identical sequence from hybridizing to a target nucleic acid is referred to as “substantially homologous.” The inhibition of hybridization of the completely complementary sequence to the target sequence may be examined using a hybridization assay (Southern or northern blot, solution hybridization, and the like) under conditions of reduced stringency. A substantially homologous sequence or hybridization probe will compete for and inhibit the binding of a completely homologous sequence to the target sequence under conditions of reduced stringency. This is not to say that conditions of reduced stringency are such that non-specific binding is permitted, as reduced stringency conditions require that the binding of two sequences to one another be a specific (i.e., a selective) interaction. The absence of non-specific binding may be tested by the use of a second target sequence which lacks even a partial degree of complementarity (e.g., less than about 30% homology or identity). In the absence of non-specific binding, the substantially homologous sequence or probe will not hybridize to the second non-complementary target sequence.
The phrases “percent homology,” “% homology,” “percent identity” or “% identity” refer to the percentage of sequence similarity found in a comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, e.g., by using the MEGALIGN program (LASERGENE software package, DNASTAR). The MEGALIGN program can create alignments between two or more sequences according to different methods, e.g., the Clustal Method. (Higgins, D. G. and P. M. Sharp (1988) Gene 73:237-244.) The Clustal algorithm groups sequences into clusters by examining the distances between all pairs. The clusters are aligned pairwise and then in groups. The percentage similarity between two amino acid sequences, e.g., sequence A and sequence B, is calculated by dividing the length of sequence A, minus the number of gap residues in sequence A, minus the number of gap residues in sequence B, into the sum of the residue matches between sequence A and sequence B, times one hundred. Gaps of low or of no homology between the two amino acid sequences are not included in determining percentage similarity. Percent identity between nucleic acid sequences can also be calculated by the Clustal Method, or by other methods known in the art, such as the Jotun Hein Method. (See, e.g., Hein, J. (1990) Methods Enzymol. 183:626-645.) Identity between sequences can also be determined by other methods known in the art, e.g., by varying hybridization conditions.
As used herein, a polynucleotide “derived from” a designated sequence refers to a polynucleotide sequence which is comprised of a sequence of approximately at least about 6 nucleotides, at least about 8 nucleotides, at least about 10-12 nucleotides, and at least about 15-20 nucleotides corresponding to a region of the designated nucleotide sequence. “Corresponding” means homologous to or complementary to the designated sequence. Preferably, the sequence of the region from which the polynucleotide is derived is homologous to or complementary to a sequence that is unique to a cancer associated gene.
In the broadest sense, use of “nucleic acid,” “polynucleotide” or “oligonucleotide” or equivalents herein means at least two nucleotides covalently linked together. In some embodiments, an oligonucleotide is all oligomer of 6, 8, 10, 12, 20, 30 or up to 100 nucleotides. In some embodiments, an oligonucleotide is an oligomer of at least 6, 8, 10, 12, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 300, 400, or 500 nucleotides. A “polynucleotide” or “oligonucleotide” may comprise DNA, RNA, PNA or a polymer of nucleotides linked by phosphodiester and/or any alternate bonds. The nucleic acid, polynucleotide or oligonucleotide may be modified by linking a detectable substance or label to it.
Similarly, a “recombinant protein” is a protein made using recombinant techniques, for example, but not limited to, through the expression of a recombinant nucleic acid as depicted above. A recombinant protein may be distinguished from naturally occurring protein by at least one or more characteristics. For example, the protein may be isolated or purified away from some or all of the proteins and compounds with which it is normally associated in its wild type host, and thus may be substantially pure. For example, an isolated protein is unaccompanied by at least some of the material with which it is normally associated in its natural state, preferably constituting at least about 0.5%, more preferably at least about 5% by weight of the total protein in a given sample. A substantially pure protein comprises about 50-75%, about 80%, or 90% by weight of the total protein. In some embodiments, a substantially pure protein comprises about 80-99%, 85-99%, 90-99%, 95-99%, or 97-99% by weight of the total protein. A recombinant protein can also include the production of a cancer associated protein from one organism (e.g. human) in a different organism (e.g. yeast, E. coli, and the like) or host cell (e.g. yeast, E. coli, and the like). Alternatively, the protein may be made at a significantly higher concentration than is normally seen, through the use of an inducible promoter or high expression promoter, such that the protein is made at increased concentration levels. Alternatively, the protein may be in a form not normally found in nature, as in the addition of an epitope tag e.g. a detectable substance or label, or amino acid substitutions, insertions and deletions, as discussed herein.
As used herein, the term “tag,” “sequence tag” or “primer tag sequence” refers to an oligonucleotide with specific nucleic acid sequence that serves to identify a batch of polynucleotides bearing such tags therein. Polynucleotides from the same biological source are covalently tagged with a specific sequence tag so that in subsequent analysis the polynucleotide can be identified according to its source of origin. The sequence tags also serve as primers for nucleic acid amplification reactions.
A “microarray” is a linear or two-dimensional array of, for example, discrete regions, each having a defined area, formed on the surface of a solid support. The density of the discrete regions on a microarray is determined by the total numbers of target polynucleotides to be detected on the surface of a single solid phase support, preferably at least about 50/cm2, more preferably at least about 100/cm2, even more preferably at least about 500/cm2, and still more preferably at least about 1,000/cm2. As used herein, a DNA microarray is an array of oligonucleotide primers placed on a chip or other surfaces used to identify, amplify, detect, or clone target polynucleotides. Since the position of each particular group of primers in the array is known, the identities of the target polynucleotides can be determined based on their binding to a particular position in the microarray.
The term “label” or “detectable substance” refers to a composition capable of producing a detectable signal indicative of the presence of the target polynucleotide in an assay sample. Suitable labels include radioisotopes, nucleotide chromophores, enzymes, substrates, fluorescent molecules, chemiluminescent moieties, magnetic particles, bioluminescent moieties, and the like. As such, a label is any composition detectable by a device or method, such as but not limited to, a spectroscopic, photochemical, biochemical, immunochemical, electrical, optical, chemical detection device or any other appropriate device. The label can also be detectable visually without the aid of a device. The term “label” is used to refer to any chemical group or moiety having a detectable physical property or any compound capable of causing a chemical group or moiety to exhibit a detectable physical property, such as an enzyme that catalyzes conversion of a substrate into a detectable product. The term “label” also encompasses compounds that inhibit the expression of a particular physical property. The label may also be a compound that is a member of a binding pair, the other member of which bears a detectable physical property.
The term “support” refers to conventional supports such as beads, particles, dipsticks, fibers, filters, membranes, and silane or silicate supports such as glass slides.
The term “amplify” is used in the broad sense to mean creating an amplification product which may include, for example, additional target molecules, or target-like molecules or molecules complementary to the target molecule, which molecules are created by virtue of the presence of the target molecule in the sample. In the situation where the target is a nucleic acid, an amplification product can be made enzymatically with DNA or RNA polymerases or reverse transcriptases, or any combination thereof.
As used herein, a “biological sample” refers to a sample of tissue or fluid isolated from a subject, including but not limited to, for example, blood, plasma, serum, spinal fluid, lymph fluid, skin, respiratory, intestinal and genitourinary tracts, tears, saliva, milk, cells (including but not limited to blood cells), tumors, organs, and also samples of in vitro cell culture constituents.
The term “biological sources” as used herein refers to the sources from which the target polynucleotides may be derived. The source can be of any form of “sample” as described above, including but not limited to, cell, tissue or fluid. “Different biological sources” can refer to different cells/tissues/organs of the same individual, or cells/tissues/organs from different individuals of the same species, or cells/tissues/organs from different species.
As used herein, the term “therapeutic” or “therapeutic agent” means an agent that can be used to treat, combat, ameliorate, prevent or improve an unwanted condition or disease of a patient. In part, embodiments of the present invention are directed to the treatment of cancer or the decrease in proliferation of cells. In some embodiments, the term “therapeutic” or “therapeutic agent” may refer to any molecule that associates with or affects the target marker, its expression or its function. In various embodiments, such therapeutics may include molecules such as, for example, a therapeutic cell, a therapeutic peptide, a therapeutic gene, a therapeutic compound, or the like, that associates with or affects the target marker, its expression or its function.
A “therapeutically effective amount” or “effective amount” of a composition is a predetermined amount calculated to achieve the desired effect, i.e., to inhibit, block, or reverse the activation, migration, or proliferation of cells. In some embodiments, the effective amount is a prophylactic amount. In some embodiments, the effective amount is an amount used to medically treat the disease or condition. The specific dose of a composition administered according to this invention to obtain therapeutic and/or prophylactic effects will, of course, be determined by the particular circumstances surrounding the case, including, for example, the composition administered, the route of administration, and the condition being treated. It will be understood that the effective amount administered will be determined by the physician in the light of the relevant circumstances including the condition to be treated, the choice of composition to be administered, and the chosen route of administration. A therapeutically effective amount of composition of this invention is typically an amount such that when it is administered in a physiologically tolerable composition, it is sufficient to achieve an effective systemic concentration or local concentration in the targeted tissue.
The terms “treat,” “treated,” or “treating” as used herein can refer to both therapeutic treatment or prophylactic or preventative measures, wherein the object is to prevent or slow down (lessen) an undesired physiological condition, disorder or disease, or to obtain beneficial or desired clinical results. In some embodiments, the term may refer to both treating and preventing. For the purposes of this disclosure, beneficial or desired clinical results include, but are not limited to, alleviation of symptoms; diminishment of the extent of the condition, disorder or disease; stabilization (i.e., not worsening) of the state of the condition, disorder or disease; delay in onset or slowing of the progression of the condition, disorder or disease; amelioration of the condition, disorder or disease state; and remission (whether partial or total), whether detectable or undetectable, or enhancement or improvement of the condition, disorder or disease. Treatment includes eliciting a clinically significant response without excessive levels of side effects. Treatment also includes prolonging survival as compared to expected survival if not receiving treatment. Treat, treated, or treating may include inhibiting the growth a bladder cancer tumor and/or inhibiting the metastasis of a bladder cancer tumor.
Generally speaking, the term “tissue” refers to any aggregation of similarly specialized cells that are united in the performance of a particular function.
“Optional” or “optionally” means that the subsequently described structure, event or circumstance may or may not occur, and that the description includes instances where the event occurs and instances where it does not.
Some embodiments herein are directed to one or more of sequences associated with cancers, such as, bladder cancer. A list of genes associated with bladder cancer is provided in Table 2 and the corresponding nucleic acid sequences are provided in Table 5.
In some embodiments, the cancer associated sequences are nucleic acids. As will be appreciated by those skilled in the art and is described herein, cancer associated sequences of embodiments herein may be useful in a variety of applications including diagnostic applications to detect nucleic acids or their expression levels in a subject, therapeutic applications or a combination thereof. Further, the cancer associated sequences of embodiments herein may be used in screening applications; for example, generation of biochips comprising nucleic acid probes to the cancer associated sequences.
In some embodiments, cancer associated sequences may include nucleic acid and/or amino acid sequences. In some embodiments, the cancer associated sequences may include sequences having at least about 60% homology with the disclosed sequences. In some embodiments, the cancer associated sequences may have at least about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 99%, about 99.8% homology with the disclosed sequences. In some embodiments, the cancer associated sequences may be “mutant nucleic acids”. As used herein, “mutant nucleic acids” refers to deletion mutants, insertions, point mutations, substitutions, translocations.
A nucleic acid of the present invention may include phosphodiester bonds, although in some cases, as outlined below (for example, in antisense applications or when a nucleic acid is a candidate drug agent), nucleic acid analogs may have alternate backbones, comprising, for example, phosphoramidate (Beaucage et al., Tetrahedron 49(10):1925 (1993) and references therein; Letsinger, J. Org. Chem. 35:3800 (1970); Sprinzl et al., Eur. J. Biochem. 81:579 (1977); Letsinger et al., Nucl. Acids Res. 14:3487 (1986); Sawai et al., Chem. Lett. 805 (1984), Letsinger et al., J. Am. Chem. Soc. 110:4470 (1988); and Pauwels et al., Chemica Scripta 26:141 91986)), phosphorothioate (Mag et al., Nucleic Acids Res. 19:1437 (1991); and U.S. Pat. No. 5,644,048), phosphorodithioate (Briu et al., J. Am. Chem. Soc. 111:2321 (1989), O-methylphosphoroamidite linkages (see Eckstein, Oligonucleotides and Analogues: A Practical Approach, Oxford University Press), and peptide nucleic acid backbones and linkages (see Egholm, J. Am. Chem. Soc. 114:1895 (1992); Meier et al., Chem. Int. Ed. Engl. 31:1008 (1992); Nielsen, Nature, 365:566 (1993); Carlsson et al., Nature 380:207 (1996), all of which are incorporated by reference). Other analog nucleic acids include those with positive backbones (Denpcy et al., Proc. Natl. Acad. Sci. USA 92:6097 (1995); non-ionic backbones (U.S. Pat. Nos. 5,386,023, 5,637,684, 5,602,240, 5,216,141 and 4,469,863; Kiedrowshi et al., Angew. Chem. Intl. Ed. English 30:423 (1991); Letsinger et al., J. Am. Chem. Soc. 110:4470 (1988); Letsinger et al., Nucleoside & Nucleotide 13:1597 (1994); Chapters 2 and 3, ASC Symposium Series 580, “Carbohydrate Modifications in Antisense Research”, Ed. Y. S. Sanghui and P. Dan Cook; Mesmaeker et al., Bioorganic & Medicinal Chem. Lett. 4:395 (1994); Jeffs et al., J. Biomolecular NMR 34:17 (1994); Tetrahedron Lett. 37:743 (1996)) and non-ribose backbones, including those described in U.S. Pat. Nos. 5,235,033 and 5,034,506, and Chapters 6 and 7, ASC Symposium Series 580, “Carbohydrate Modifications in Antisense Research”, Ed. Y. S. Sanghui and P. Dan Cook. Nucleic acids containing one or more carbocyclic sugars are also included within one definition of nucleic acids (see Jenkins et al., Chem. Soc. Rev. (1995) pp 169-176). Several nucleic acid analogs are described in Rawls, C & E News Jun. 2, 1997 page 35. These modifications of the ribose-phosphate backbone may be done for a variety of reasons, for example to increase the stability and half-life of such molecules in physiological environments for use in anti-sense applications or as probes on a biochip.
As will be appreciated by those skilled in the art, such nucleic acid analogs can be used in some embodiments. In addition, mixtures of naturally occurring nucleic acids and analogs can be made; alternatively, mixtures of different nucleic acid analogs, and mixtures of naturally occurring nucleic acids and analogs may be made.
In some embodiments, the nucleic acids may be single stranded or double stranded or may contain portions of both double stranded or single stranded sequence. As will be appreciated by those skilled in the art, the depiction of a single strand also defines the sequence of the other strand; thus the sequences described herein also includes the complement of the sequence. The nucleic acid may be DNA, both genomic and cDNA, RNA, or a hybrid, where the nucleic acid contains any combination of deoxyribo- and ribo-nucleotides, and any combination of bases, including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine, hypoxanthine, isocytosine, isoguanine, etc. As used herein, the term “nucleoside” includes nucleotides and nucleoside and nucleotide analogs, and modified nucleosides such as amino modified nucleosides. In addition, “nucleoside” includes non-naturally occurring analog structures. Thus, for example, the subject units of a peptide nucleic acid, each containing a base, are referred to herein as a nucleoside.
In some embodiments, the cancer associated sequences may be recombinant nucleic acids. By the term “recombinant nucleic acid” herein refers to nucleic acid molecules, originally formed in vitro, in general, by the manipulation of nucleic acid by polymerases and endonucleases, in a form not normally found in nature. Thus a recombinant nucleic acid may also be an isolated nucleic acid, in a linear form, or cloned in a vector formed in vitro by ligating DNA molecules that are not normally joined, are both considered recombinant for the purposes of this invention. It is understood that once a recombinant nucleic acid is made and reintroduced into a host cell or organism, it can replicate using the in vivo cellular machinery of the host cell rather than in vitro manipulations; however, such nucleic acids, once produced recombinantly, although subsequently replicated in vivo, are still considered recombinant or isolated for the purposes of the invention. As used herein, a “polynucleotide” or “nucleic acid” is a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. This term includes double- and single-stranded DNA and RNA. It also includes known types of modifications, for example, labels which are known in the art, methylation, “caps”, substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications—such as, for example, those with uncharged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), those containing pendant moieties, such as, for example proteins (including e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), those with intercalators (e.g., acridine, psoralen, etc.), those containing chelators (e.g., metals, radioactive metals, etc.), those containing alkylators, those with modified linkages (e.g., alpha anomeric nucleic acids, etc.), as well as unmodified forms of the polynucleotide.
In some embodiments, a method of identifying a target marker comprises the steps of: 1) obtaining a molecular profile of the mRNAs, miRNAs, proteins, or protein modifications of immortal pluripotent stem cells (such as embryonic stem (“ES”) cells, induced pluripotent stem (“iPS”) cells, and germ-line cells such as embryonal carcinoma (“EC”) cells); 2) ES, iPS, or EC-derived clonal embryonic progenitor (“EP”) cell lines malignant cancer cells including cultured cancer cell lines or human tumor tissues, and comparing those molecules to those present in mortal somatic cell types such as cultured clonal human embryonic progenitors, cultured somatic cells from fetal or adult sources, or normal tissue counterparts to malignant cancer cells. Target markers that are shared between pluripotent stem cells such as hES cells and malignant cancer cells, but are not present in a majority of somatic cell types may be candidate diagnostic markers and therapeutic targets.
Some embodiments are directed to a biochip comprising a nucleic acid segment which encodes a cancer associated protein, for example, but not limited to, selected from the sequences outlined in Table 2 (SEQ ID NOs: 1-55).
Also provided herein is a method for diagnosing or determining the propensity to cancers, e.g., bladder cancer. The method of diagnosing may comprise measuring the level of expression of a cancer associated marker disclosed herein in a suitable sample and comparing the level of expression with a non-cancerous or normal sample.
In some embodiments, an isolated nucleic acid comprises at least 10, 12, 15, 20 or 30 contiguous nucleotides of a sequence selected from the group consisting of the cancer associated polynucleotide sequences disclosed in Table 2 (SEQ ID NOs: 1-55).
In some embodiments, the polynucleotide, or its complement or a fragment thereof, further comprises a detectable label, is attached to a solid support, is prepared at least in part by chemical synthesis, is an antisense fragment, is single stranded, is double stranded or comprises a microarray.
Cancer associated sequences associated with bladder cancer are disclosed in Table 2. These sequences were extracted from hotpop, fold-change and filter analysis KCKC110608.1. Once expression was determined, the gene sequence results were further filtered by considering fold-change in bladder cancer vs. normal bladder; general specificity; secreted or not, level of expression in bladder cancer; and signal to noise ratio. The cancer associated polynucleotide sequences include SEQ ID NOs: 1-55 shown in Table 2. In some embodiments, the polynucleotide sequences may be mRNA sequences selected from: Homo sapiens melanoma antigen family A, 10 (MAGEA10), transcript variant 2; Homo sapiens Down syndrome critical region gene 8 (DSCR8), transcript variant 2; Homo sapiens matrix metallopeptidase 12 (macrophage elastase) (MMP12); Homo sapiens chemokine (C-X-C motif) ligand 9 (CXCL9); Homo sapiens Down syndrome critical region gene 8 (DSCR8), transcript variant 3; Homo sapiens keratin 81 (KRT81); Homo sapiens hypothetical protein LOC729826 (LOC729826); Homo sapiens parathyroid hormone-like hormone (PTHLH), transcript variant 3; Homo sapiens matrix metallopeptidase 11 (stromelysin 3) (MMP11); Homo sapiens S100 calcium binding protein A7 (S100A7); Homo sapiens WNT1 inducible signaling pathway protein 3 (WISP3), transcript variant 1; Homo sapiens chemokine (C-X-C motif) ligand 10 (CXCL10); Homo sapiens neuromedin U (NMU); Homo sapiens guanylate binding protein 5 (GBP5); Homo sapiens topoisomerase (DNA) II alpha 170 kDa (TOP2A); Homo sapiens serpin peptidase inhibitor, clade B (ovalbumin), member 4 (SERPINB4); Homo sapiens granulysin (GNLY), transcript variant 519; Homo sapiens gametocyte specific factor 1 (GTSF1); Homo sapiens peptidase inhibitor 3, skin-derived (SKALP) (PI3); Homo sapiens S100 calcium binding protein A7A (S100A7A); Homo sapiens indoleamine 2,3-dioxygenase 1 (IDO1); Homo sapiens gap junction protein, beta 6 (GJB6); Homo sapiens calmodulin-like 3 (CALML3); Homo sapiens serpin peptidase inhibitor, clade B (ovalbumin), member 3 (SERPINB3); Homo sapiens chemokine (C-X-C motif) ligand 6 (granulocyte chemotactic protein 2) (CXCL6); Homo sapiens olfactomedin 4 (OLFM4); Homo sapiens transcobalamin I (vitamin B12 binding protein, R binder family) (TCN1); Homo sapiens visinin-like 1 (VSNL1); Homo sapiens ubiquitin D (UBD); Homo sapiens absent in melanoma 2 (AIM2); Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 9 (ABCC9), transcript variant SUR2B; Homo sapiens serpin peptidase inhibitor, clade B (ovalbumin), member 13 (SERPINB13); Homo sapiens indoleamine-pyrrole 2,3 dioxygenase (INDO); Homo sapiens keratin 5 (KRT5); Homo sapiens hypothetical LOC100130897 (LOC100130897); Homo sapiens keratin 14 (epidermolysis bullosa simplex, Dowling-Meara, Koebner) (KRT14); Homo sapiens family with sequence similarity 83, member A (FAM83A), transcript variant 1; Homo sapiens family with sequence similarity 181, member B (FAM181B); RST24587 Athersys RAGE Library Homo sapiens cDNA mRNA sequence; Homo sapiens granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1) (GZMB); Homo sapiens desmoglein 3 (pemphigus vulgaris antigen) (DSG3); Homo sapiens thymidine phosphorylase (TYMP), transcript variant 3; Homo sapiens keratin 6A (KRT6A); Homo sapiens keratin 6B (KRT6B); a polynucleotide derived therefrom or any combination thereof. In some embodiments, the bladder cancer associated sequences may be DNA sequences encoding the above mRNA or the cancer associated protein or cancer associated polypeptide expressed by the above mRNA. In some embodiments, the cancer associated sequence may be a mutant nucleic acid of the above disclosed sequences. In some embodiments, the cancer associated protein or polypeptide sequence may be selected from SEQ ID NOs: 56-110 or a homolog thereof. In some embodiments, the homolog may have at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, at least about 99.5% identity with the disclosed polypeptide sequence.
In some embodiments, a method for diagnosing cancer comprises a) determining the expression of one or more genes comprising a nucleic acid sequence selected from the group consisting of the human genomic and mRNA sequences described in Table 2, in a first sample type (e.g. tissue) of a first individual; and b) comparing said expression of said gene(s) from a second normal sample type from said first individual or a second unaffected individual; wherein a difference in said expression indicates that the first individual has cancer. In some embodiments, the expression is increased as compared to the normal sample. In some embodiments, the expression is decreased as compared to the normal sample.
In some embodiments, the present invention provides methods of diagnosing bladder cancer in a subject, the method comprising: a) determining the expression of one or more genes or gene products or homologs thereof; and b) comparing said expression of the one or more nucleic acid sequences from a second normal sample from said first subject or a second unaffected subject, wherein a difference in said expression indicates that the first subject has cancer, wherein the gene or the gene product is referred to as a gene selected from the group consisting of: MAGEA10, DSCR8, MMP12, CXCL9, DSCR8, KRT81, LOC729826, PTHLH, MMP1, S100A7, WISP3, CXCL10, NMU, GBP5, TOP2A, SERPINB4, GNLY, GTSF1, PI3, S100A7A, IDO1, GJB6, CALML3, SERPINB3, CXCL6, OLFM4, TCN1, VSNL1, UBD, AIM2, ABCC9, SERPINB13, INDO, KRT5, LOC100130897, KRT14, FAM83A, FAM181B, GZMB, DSG3, TYMP, KRT6A, KRT6B, HLA-DRB1, LCN2, KRT4, IFI30, LOC100134370, KIAA1618, S100A8, MMP7, MMP7, SPRR2A, and GJB2.
In some embodiments, the present invention provides methods of detecting bladder cancer in a test sample, comprising: (i) detecting a level of activity of at least one polypeptide that is a gene product; and (ii) comparing the level of activity of the polypeptide in the test sample with a level of activity of polypeptide in a normal sample, wherein an altered level of activity of the polypeptide in the test sample relative to the level of polypeptide activity in the normal sample is indicative of the presence of bladder cancer in the test sample, wherein said gene product is a product of a gene selected from the group consisting of MAGEA10, DSCR8, MMP12, CXCL9, DSCR8, KRT81, LOC729826, PTHLH, MMP11, S100A7, WISP3, CXCL10, NMU, GBP5, TOP2A, SERPINB4, GNLY, GTSF1, PI3, S100A7A, IDO1, GJB6, CALML3, SERPINB3, CXCL6, OLFM4, TCN1, VSNL1, UBD, AIM2, ABCC9, SERPINB13, INDO, KRT5, LOC100130897, KRT14, FAM83A, FAM181B, GZMB, DSG3, TYMP, KRT6A, KRT6B, HLA-DRB1, LCN2, KRT4, IFI30, LOC100134370, KIAA1618, S100A8, MMP7, MMP7, SPRR2A, and GJB2.
In certain embodiments the invention provides a panel of markers associated with bladder cancer comprising nucleic acid sequences, or fragments thereof of the genes: MMP11, MMP12, COL10A1, FCRLB, SFN, KRT6A, S100A2, S100A7 FCRLB, IL1A, KRT16, SLC1A6.
In other embodiments the invention provides a method of detecting bladder cancer in a subject comprising measuring the expression level of the genes MMP11, MMP12, COL10A1, FCRLB, SFN, KRT6A, S100A2, S100A7 IL1A, KRT16, SLC1A6. in a sample, comparing the expression level of the genes MMP11, MMP12, COL10A1, FCRLB, SFN, KRT6A, S100A2, S100A7, IL1A, KRT16, SLC1A6 in a non-cancerous sample such as normal bladder tissue, wherein elevated expression of at least one of the genes MMP11, MMP12, COL10A1, FCRLB, SFN, KRT6A, S100A2, S100A7, IL1A, KRT16, SLC1A6 relative to the non-cancerous sample indicates the subject has cancer. The method may also include comparing the expression level of the genes MMP11, MMP12, COL10A1, FCRLB, SFN, KRT6A, S100A2, S100A7, IL1A, KRT16, SLC1A6 to a known cancerous sample, e.g., a bladder cancer sample, wherein an expression level of at least one of the genes in the subject sample that is at least as high as the known cancer sample indicates the subject has cancer.
In still other embodiments the invention provides a method of detecting bladder cancer in a subject comprising measuring the expression level of the genes MMP11, MMP12, COL10A1, FCRLB, SFN, KRT6A, S100A2, S100A7, IL1A, KRT16, SLC1A6 in sample, comparing the expression level of the genes MMP11, MMP12, COL10A1, FCRLB, SFN, KRT6A, S100A2, S100A7, IL1A, KRT16, SLC1A6 in a non-cancerous sample such as normal bladder tissue, wherein elevated expression of a plurality of the genes MMP11, MMP12, COL10A1, FCRLB, SFN, KRT6A, S100A2, S100A7, IL1A, KRT16, SLC1A6 relative to the non-cancerous sample indicates the subject has cancer. The method may also include comparing the expression level of the genes MMP11, MMP12, COL10A 1, FCRLB, SFN, KRT6A, S100A2, S100A7, IL1A, KRT16, SLC1A6 to a known cancerous sample, e.g., a bladder cancer sample, wherein an expression level of a plurality of the genes in the subject sample that is at least as high as the known cancer sample indicates the subject has cancer.
In still other embodiments the invention provides a method of detecting bladder cancer in a subject comprising measuring the expression level of the genes MMP11, MMP12, COL10A1, FCRLB, SFN, KRT6A, S100A2, S100A7 in sample, comparing the expression level of the genes MMP11, MMP12, COL10A1, FCRLB, SFN, KRT6A, S100A2, S100A7, IL1A, KRT16, SLC1A6 in a non-cancerous sample such as normal bladder tissue, wherein elevated expression of the genes MMP11, MMP12, COL10A1, FCRLB, SFN, KRT6A, S100A2, S100A7, IL1A, KRT16, SLC1A6 relative to the non-cancerous sample indicates the subject has cancer. The method may also include comparing the expression level of the genes MMP11, MMP12, COL10A1, FCRLB, SFN, KRT6A, S100A2, S100A7, IL1A, KRT16, SLC1A6 to a known cancerous sample, e.g., a bladder cancer sample, wherein an expression level of the genes in the subject sample that is at least as high as the known cancer sample indicates the subject has cancer.
Cancer associated sequences may also include proteins or peptides encoded by the nucleic acid sequences described above. A list of proteins or peptides associated with bladder cancer is provided in Table 3. The amino acid sequences encoding these proteins or peptides are provided in Table 6.
In some embodiments, the cancer associated sequence comprises a sequence of a naturally occurring protein. In some embodiments, the cancer associate sequence does not comprise a naturally occurring sequence. Thus in some embodiments the cancer associated sequence may encode a mutant protein or a fragment of a naturally occurring protein.
In some embodiments, the invention provides a method for detecting a cancer associated sequence with the expression of a polypeptide in a test sample, comprising detecting a level of expression of at least one polypeptide selected from the group consisting of SEQ ID NOs: 56-110 shown in Table 3, or a fragment thereof. In some embodiments, the method comprises comparing the level of expression of the polypeptide in the test sample with a level of expression of polypeptide in a normal sample, wherein an altered level of expression of the polypeptide, e.g. elevated expression, in the test sample relative to the level of polypeptide expression in the normal sample is indicative of the presence of cancer in the test sample. In some embodiments, the polypeptide expression is compared to a cancer sample, wherein the level of expression is at least the same as the cancer is indicative of the presence of cancer in the test sample. In some embodiments, the sample is a cell sample.
In some embodiments, the invention provides an isolated polypeptide, encoded within an open reading frame of a cancer associated sequence selected from the polynucleotide sequences of SEQ ID NOs: 56-110 shown in Table 3, or its complement. In some embodiments, the invention provides an isolated polypeptide, wherein said polypeptide comprises the amino acid sequence encoded by a polynucleotide selected from the group consisting of SEQ ID NOs: 1-55. In some embodiments, the invention provides an isolated polypeptide, wherein said polypeptide comprises the amino acid sequence encoded by a polypeptide selected from the group consisting of SEQ ID NOs: 56-110, shown in Table 3.
In some embodiments, the invention further provides an isolated polypeptide, comprising the amino acid sequence of an epitope of the amino acid sequence of a cancer associated polypeptide selected from the group consisting of SEQ ID. NOs: 56-110 shown in Table 3, wherein the polypeptide or fragment thereof may be attached to a solid support. In some embodiments the invention provides an isolated antibody (monoclonal or polyclonal) or antigen binding fragment thereof, that binds to such a polypeptide. The isolated antibody or antigen binding fragment thereof may be attached to a solid support, or further comprises a detectable label.
In some embodiments, the invention provides a method for detecting cancer by detecting the presence of an antibody in a test serum sample. In some embodiments, the antibody recognizes a polypeptide or an epitope thereof disclosed herein. In some embodiments, the antibody recognizes a polypeptide or epitope thereof encoded by a nucleic acid sequence disclosed herein. In some embodiments, the method comprises detecting a level of an antibody against an antigenic polypeptide selected from the group consisting of SEQ ID NOs: 56-110 shown in Table 3, or antigenic fragment thereof. In some embodiments, the method comprises comparing the level of the antibody in the test sample with a level of the antibody in the control sample, wherein an altered level of antibody in said test sample relative to the level of antibody in the control sample is indicative of the presence of cancer in the test sample. In some embodiments, the control sample is a sample derived from a normal cell or non-cancerous sample. In some embodiments, the control is derived from a cancer sample, and, therefore, in some embodiments, the method comprises comparing the levels of binding and/or the amount of antibody in the sample, wherein when the levels or amount are the same as the cancer control sample is indicative of the presence of cancer in the test sample.
In some embodiments, the invention also provides a method for detecting presence or absence of cancer cells in a subject. In some embodiments, the method comprises contacting one or more cells from the subject with an antibody as described herein. In some embodiments, the method comprises detecting a complex of a cancer associated protein (CAP) and the antibody, wherein detection of the complex indicates with the presence of cancer cells in the subject.
In still other embodiments the invention provides a method of detecting bladder cancer in a subject comprising measuring the protein expression level of the protein encoded for by the genes MMP11, MMP12, COL10A1, FCRLB, SFN, KRT6A, S100A2, S100A7, IL1A, KRT16, SLC1A6 in sample, comparing the expression level of the protein encoded for by the genes MMP11, MMP12, COL10A1, FCRLB, SFN, KRT6A, S100A2, S100A7, IL1A, KRT16, SLC1A6 in a non-cancerous sample such as normal bladder tissue, wherein elevated expression of at least one of the protein encoded for by the genes MMP11, MMP12, COL10A1, FCRLB, SFN, KRT6A, S100A2, S100A7, IL1A, KRT16, SLC1A6 relative to the non-cancerous sample indicates the subject has cancer. The method may also include comparing the expression level of the protein encoded for by the genes MMP11, MMP12, COL10A1, FCRLB, SFN, KRT6A, S100A2, S100A7, IL1A, KRT16, SLC1A6 to a known cancerous sample, e.g., a bladder cancer sample, wherein an expression level of at least one of the proteins encoded for by the genes in the subject sample that is at least as high as the known cancer sample indicates the subject has cancer.
In still other embodiments the invention provides a method of detecting bladder cancer in a subject comprising measuring the protein expression level of the protein encoded for by the genes MMP11, MMP12, COL10A1, FCRLB, SFN, KRT6A, S100A2, S100A7, IL1A, KRT16, SLC1A6 in sample, comparing the expression level of the protein encoded for by the genes MMP11, MMP12, COL10A1, FCRLB, SFN, KRT6A, S100A2, S100A7, IL1A, KRT16, SLC1A6 in a non-cancerous sample such as normal bladder tissue, wherein elevated expression of a plurality of the protein encoded for by the genes MMP11, MMP12, COL10A1, FCRLB, SFN, KRT6A, S100A2, S100A7, IL1A, KRT16, SLC1A6 relative to the non-cancerous sample indicates the subject has cancer. The method may also include comparing the expression level of the protein encoded for by the genes MMP11, MMP12, COL10A1, FCRLB, SFN, KRT6A, S100A2, S100A7, IL1A, KRT16, SLC1A6 to a known cancerous sample, e.g., a bladder cancer sample, wherein an expression level of a plurality of the proteins encoded for by the genes in the subject sample that is at least as high as the known cancer sample indicates the subject has cancer.
In still other embodiments the invention provides a method of detecting bladder cancer in a subject comprising measuring the protein expression level of the protein encoded for by the genes MMP11, MMP12, COL10A1, FCRLB, SFN, KRT6A, S100A2, S100A7, IL1A, KRT16, SLC1A6 in sample, comparing the expression level of the protein encoded for by the genes MMP11, MMP12, COL10A1, FCRLB, SFN, KRT6A, S100A2, S100A7, IL1A, KRT16, SLC1A6 in a non-cancerous sample such as normal bladder tissue, wherein elevated expression of the proteins encoded for by the genes MMP11, MMP12, COL10A1, FCRLB, SFN, KRT6A, S100A2, S100A7, IL1A, KRT16, SLC1A6 relative to the non-cancerous sample indicates the subject has cancer. The method may also include comparing the expression level of the protein encoded for by the genes MMP11, MMP12, COL10A1, FCRLB, SFN, KRT6A, S100A2, S100A7, IL1A, KRT16, SLC1A6 to a known cancerous sample, e.g., a bladder cancer sample, wherein an expression level of the proteins encoded for by the genes in the subject sample that is at least as high as the known cancer sample indicates the subject has cancer.
Some embodiments are directed to the use of cancer associated polypeptides and polynucleotides encoding a cancer associated sequence, a fragment thereof, or a mutant thereof, and antigen presenting cells (such as, without limitation, dendritic cells), to elicit an immune response against cells expressing a cancer-associated polypeptide sequence, such as, without limitation, cancer cells, (in a subject, or in vitro) such as bladder cancer cells. In some embodiments, the method of eliciting an immune response against cells expressing a cancer associated sequence comprises (1) isolating a hematopoietic stem cell, (2) genetically modifying the cell to express a cancer associated sequence, (3) differentiating the cell into DCs; and (4) administering the DCs to the subject (e.g., human patient). In some embodiments, antigen presenting cells (APCs) may used to activate T lymphocytes in vivo or ex vivo, to elicit an immune response against cells expressing a cancer associated sequence. APCs are highly specialized cells and may include, without limitation, macrophages, monocytes, and dendritic cells (DCs). APCs may process antigens and display their peptide fragments on the cell surface together with molecules required for lymphocyte activation. In some embodiments, the APCs may be dendritic cells. DCs may be classified into subgroups, including, e.g., follicular dendritic cells, Langerhans dendritic cells, and epidermal dendritic cells. In some embodiments, dendritic cell precursor cells are isolated for transduction with a cancer associated sequence, and induced to differentiate into dendritic cells. The genetically modified DCs express the cancer associated sequence, and may display peptide fragments on the cell surface.
In some embodiments, the method of eliciting an immune response includes (1) isolating DCs (or isolation and differentiation of DC precursor cells), (2) pulsing the cells with a cancer associated sequence, and; (3) administering the DCs to the subject. These approaches are discussed in greater detail, infra. In some embodiments, the pulsed or expressing DCs may be used to activate T lymphocytes ex vivo. These general techniques and variations thereof may be within the skill of those in the art (see, e.g., WO97/29182; WO 97/04802; WO 97/22349; WO 96/23060; WO 98/01538; Hsu et al., 1996, Nature Med. 2:52-58), and that still other variations may be discovered in the future.
In some embodiments, the cancer associated sequence is contacted with a subject to stimulate an immune response. In some embodiments, the immune response is a therapeutic immune response. In some embodiments, the immune response is a prophylactic immune response. For example, the cancer associated sequence can be contacted with a subject under conditions effective to stimulate an immune response. The cancer associated sequence can be administered as, for example, a DNA molecule (e.g. DNA vaccine), RNA molecule, or polypeptide, or any combination thereof. Administering sequence to stimulate an immune responses are known, but the identity of which sequences to use was not known prior to the present disclosure. Any sequence or combination of sequences disclosed herein or a homolog thereof can be administered to a subject to stimulate an immune response.
In some embodiments, the cancer associated sequence comprises a sequence of a naturally occurring protein. In some embodiments, the cancer associate sequence does not comprise a naturally occurring sequence. As already noted, fragments of naturally occurring proteins may be used; in addition, the expressed polypeptide may comprise mutations such as deletions, insertions, or amino acid substitutions when compared to a naturally occurring polypeptide, so long as at least one peptide epitope can be processed by the DC and presented on a MHC class I or II surface molecule. In some embodiments, it may be desirable to use sequences other than “wild type,” in order to, for example, increase antigenicity of the peptide or to increase peptide expression levels. In some embodiments, the introduced cancer associated sequences may encode variants such as polymorphic variants (e.g., a variant expressed by a particular human patient) or variants characteristic of a particular cancer (e.g., a cancer in a particular subject).
In some embodiments, a cancer associated expression sequence may be introduced (transduced) into DCs or stem cells in any of a variety of standard methods, including transfection, recombinant vaccinia viruses, adeno-associated viruses (AAVs), retroviruses, etc.
In some embodiments, the transformed DCs of the invention may be introduced into the subject (e.g., without limitation, a human patient) where the DCs may induce an immune response. Typically, the immune response includes a cytotoxic T-lymphocyte (CTL) response against target cells bearing antigenic peptides (e.g., in a MHC class I/peptide complex). These target cells are typically cancer cells.
In some embodiments, when the DCs of the invention are to be administered to a subject, they may preferably isolated from, or derived from precursor cells from, that subject (i.e., the DCs may administered to an autologous subject). However, the cells may be infused into HLA-matched allogeneic, or HLA-mismatched allogeneic subject. In the latter case, immunosuppressive drugs may be administered to the subject.
In some embodiments, the cells tray be administered in any suitable manner. In some embodiments, the cell may be administered with a pharmaceutically acceptable carrier (e.g., saline). In some embodiments, the cells may be administered through intravenous, intra-articular, intramuscular, intradermal, intraperitoneal, or subcutaneous routes. Administration (i.e., immunization) may be repeated at time intervals. Infusions of DC may be combined with administration of cytokines that act to maintain DC number and activity (e.g., GM-CSF, IL-12).
In some embodiments, the dose administered to a subject may be a dose sufficient to induce an immune response as detected by assays which measure T cell proliferation, T lymphocyte cytotoxicity, and/or effect a beneficial therapeutic response in the patient over time, e.g., to inhibit growth of cancer cells or result in reduction in the number of cancer cells or the size of a tumor.
In some embodiments, DCs are obtained (either from a patient or by in vitro differentiation of precursor cells) and pulsed with antigenic peptides having a cancer associated sequence. The pulsing results in the presentation of peptides onto the surface MHC molecules of the cells. The peptide/MHC complexes displayed on the cell surface may be capable of inducing a MHC-restricted cytotoxic T-lymphocyte response against target cells expressing cancer associated polypeptides (e.g., without limitations, cancer cells).
In some embodiments, cancer associated sequences used for pulsing may have at least about 6 or 8 amino acids and fewer than about 30 amino acids or fewer than about 50 amino acid residues in length. In some embodiments, an immunogenic peptide sequence may have from about 8 to about 12 amino acids. In some embodiments, a mixture of human protein fragments may be used; alternatively a particular peptide of defined sequence may be used. The peptide antigens may be produced by de novo peptide synthesis, enzymatic digestion of purified or recombinant human peptides, by purification of the peptide sequence from a natural source (e.g., a subject or tumor cells from a subject), or expression of a recombinant polynucleotide encoding a human peptide fragment.
In some embodiments, the amount of peptide used for pulsing DC may depend on the nature, size and purity of the peptide or polypeptide. In some embodiments, an amount of from about 0.05 ug/ml to about 1 mg/ml, from about 0.05 ug/ml to about 500 ug/ml, from about 0.05 ug/ml to about 250 ug/ml, from about 0.5 ug/ml to about 1 mg/ml, from about 0.5 ug/ml to about 500 ug/ml, from about 0.5 ug/ml to about 250 ug/ml, or from about 1 ug/ml to about 100 ug/ml of peptide may be used. After adding the peptide antigen(s) to the cultured DC, the cells may then be allowed sufficient time to take up and process the antigen and express antigen peptides on the cell surface in association with either class I or class II MHC. In some embodiments, the time to take up and process the antigen may be about 18 to about 30 hours, about 20 to about 30 hours, or about 24 hours.
Numerous examples of systems and methods for predicting peptide binding motifs for different MHC Class I and II molecules have been described. Such prediction could be used for predicting peptide motifs that will bind to the desired MHC Class I or II molecules. Examples of such methods, systems, and databases that those of ordinary skill in the art might consult for such purpose include NIH's Center for Information Technology and Peptide Binding Motifs for MHC Class I and II Molecules; William E. Biddison, Roland Martin, Current Protocols in Immunology, Unit 1I (DOI: 10.1002/0471142735.ima01 is 36; Online Posting Date: May, 2001), which provides an overview of the use of peptide-binding motifs to predict interaction with a specific MHC class I or II allele, and gives examples for the use of MHC binding motifs to predict T-cell recognition.
Table I provides an exemplary result for a HLA peptide motif search at the NIH Center for Information Technology website, BioInformatics and Molecular Analysis Section. The fill length MAGEA10 peptide sequence (SEQ ID NO: 56 as shown in Table 3 and 5) was used as the search query.
In some embodiments, the present invention provides methods of eliciting an immune response against cells expressing a cancer associated sequence comprising contacting a subject with a a cancer associated sequence under conditions effective to elicit an immune response in the subject, wherein said cancer associated sequence comprises a sequence or fragment thereof a gene selected from the group consisting of MAGEA10, DSCR8, MMP12, CXCL9, DSCR8, KRT81, LOC729826, PTHLH, MMP11, S100A7, WISP3, CXCL10, NMU, GBP5, TOP2A, SERPINB4, GNLY, GTSF1, PI3, S100A7A, IDO1, GJB6, CALML3, SERPINB3, CXCL6, OLFM4, TCN1, VSNL1, UBD, AIM2, ABCC9, SERPINB13, INDO, KRT5, LOC100130897, KRT14, FAM83A, FAM181B, GZMB, DSG3, TYMP, KRT6A, KRT6B, HLA-DRB1, LCN2, KRT4, IFI30, LOC100134370, KIAA1618, S100A8, MMP7, MMP7, SPRR2A, and GJB2.
In some embodiments, implementation of an immunotherapy strategy for treating, reducing the symptoms of, or preventing cancer or neoplasms, (e.g., a vaccine) may be achieved using many different techniques available to the skilled artisan.
Immunotherapy, or the use of antibodies for therapeutic purposes has been used in recent years to treat cancer. Passive immunotherapy involves the use of monoclonal antibodies in cancer treatments. See for example, Cancer: Principles and Practice of Oncology, 6th Edition (2001) Chapt. 20 pp. 495-508. Inherent therapeutic biological activity of these antibodies include direct inhibition of tumor cell growth or survival, and the ability to recruit the natural cell killing activity of the body's immune system. These agents may be administered alone or in conjunction with radiation or chemotherapeutic agents. Alternatively, antibodies may be used to make antibody conjugates where the antibody is linked to a toxic agent and directs that agent to the tumor by specifically binding to the tumor.
Some embodiments also provide for antigens (cancer-associated polypeptides) associated with a variety of cancers, including bladder cancer, as targets for diagnostic and/or therapeutic antibodies. These antigens may also be useful for drug discovery (e.g., small molecules) and for further characterization of cellular regulation, growth, and differentiation.
Homo sapiens melanoma antigen family A, 10 (MAGEA10),
Homo sapiens Down syndrome critical region gene 8
Homo sapiens matrix metallopeptidase 12 (macrophage
Homo sapiens chemokine (C-X-C motif) ligand 9 (CXCL9),
Homo sapiens Down syndrome critical region gene 8
Homo sapiens keratin 81 (KRT81), mRNA.
Homo sapiens parathyroid hormone-like hormone (PTHLH),
Homo sapiens matrix metallopeptidase 11 (stromelysin 3)
Homo sapiens S100 calcium binding protein A7 (S100A7),
Homo sapiens WNT1 inducible signaling pathway protein 3
Homo sapiens chemokine (C-X-C motif) ligand 10
Homo sapiens neuromedin U (NMU), mRNA.
Homo sapiens guanylate binding protein 5 (GBP5), mRNA.
Homo sapiens topoisomerase (DNA) II alpha 170 kDa
Homo sapiens serpin peptidase inhibitor, clade B
Homo sapiens granulysin (GNLY), transcript variant 519,
Homo sapiens gametocyte specific factor 1 (GTSF1),
Homo sapiens peptidase inhibitor 3, skin-derived (SKALP)
Homo sapiens S100 calcium binding protein A7A
Homo sapiens indoleamine 2,3-dioxygenase 1 (IDO1),
Homo sapiens gap junction protein, beta 6 (GJB6), mRNA.
Homo sapiens calmodulin-like 3 (CALML3), mRNA.
Homo sapiens serpin peptidase inhibitor, clade B
Homo sapiens chemokine (C-X-C motif) ligand 6
Homo sapiens olfactomedin 4 (OLFM4), mRNA.
Homo sapiens transcobalamin I (vitamin B12 binding
Homo sapiens visinin-like 1 (VSNL1), mRNA.
Homo sapiens ubiquitin D (UBD), mRNA.
Homo sapiens absent in melanoma 2 (AIM2), mRNA.
Homo sapiens ATP-binding cassette, sub-family C
Homo sapiens serpin peptidase inhibitor, clade B
Homo sapiens indoleamine-pyrrole 2,3 dioxygenase (INDO),
Homo sapiens keratin 5 (KRT5), mRNA.
Homo sapiens keratin 14 (epidermolysis bullosa simplex,
Homo sapiens family with sequence similarity 83, member
Homo sapiens family with sequence similarity 181, member
Homo sapiens granzyme B (granzyme 2, cytotoxic T-
Homo sapiens desmoglein 3 (pemphigus vulgaris antigen)
Homo sapiens thymidine phosphorylase (TYMP), transcript
Homo sapiens keratin 6A (KRT6A), mRNA.
Homo sapiens keratin 6B (KRT6B), mRNA.
Homo sapiens major histocompatibility complex, class II,
Homo sapiens lipocalin 2 (LCN2), mRNA.
Homo sapiens keratin 4 (KRT4), mRNA.
Homo sapiens interferon, gamma-inducible protein 30
Homo sapiens KIAA1618 (KIAA1618), mRNA.
Homo sapiens S100 calcium binding protein A8 (S100A8),
Homo sapiens matrix metallopeptidase 7 (matrilysin,
Homo sapiens matrix metallopeptidase 7 (matrilysin,
Homo sapiens small proline-rich protein 2A (SPRR2A),
Homo sapiens gap junction protein, beta 2, 26 kDa (GJB2),
Homo sapiens melanoma antigen family A, 10 (MAGEA10), transcript
Homo sapiens Down syndrome critical region gene 8 (DSCR8), transcript
Homo sapiens matrix metallopeptidase 12 (macrophage elastase) (MMP12)
Homo sapiens chemokine (C-X-C motif) ligand 9 (CXCL9)
Homo sapiens Down syndrome critical region gene 8 (DSCR8), transcript
Homo sapiens keratin 81 (KRT81).
Homo sapiens parathyroid hormone-like hormone (PTHLH), transcript
Homo sapiens matrix metallopeptidase 11 (stromelysin 3) (MMP11)
Homo sapiens S100 calcium binding protein A7 (S100A7)
Homo sapiens WNT1 inducible signaling pathway protein 3 (WISP3),
Homo sapiens chemokine (C-X-C motif) ligand 10 (CXCL10)
Homo sapiens neuromedin U (NMU)
Homo sapiens guanylate binding protein 5 (GBP5)
Homo sapiens topoisomerase (DNA) II alpha 170 kDa (TOP2A)
Homo sapiens serpin peptidase inhibitor, clade B (ovalbumin), member 4
Homo sapiens granulysin (GNLY), transcript variant 519
Homo sapiens gametocyte specific factor 1 (GTSF1)
Homo sapiens peptidase inhibitor 3, skin-derived (SKALP) (PI3)
Homo sapiens S100 calcium binding protein A7A (S100A7A)
Homo sapiens indoleamine 2,3-dioxygenase 1 (IDO1)
Homo sapiens gap junction protein, beta 6 (GJB6)
Homo sapiens calmodulin-like 3 (CALML3)
Homo sapiens serpin peptidase inhibitor, clade B (ovalbumin), member 3
Homo sapiens chemokine (C-X-C motif) ligand 6 (granulocyte chemotactic
Homo sapiens olfactomedin 4 (OLFM4)
Homo sapiens transcobalamin I (vitamin B12 binding protein, R binder
Homo sapiens visinin-like 1 (VSNL1)
Homo sapiens ubiquitin D (UBD)
Homo sapiens absent in melanoma 2 (AIM2)
Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member
Homo sapiens serpin peptidase inhibitor, clade B (ovalbumin), member 13
Homo sapiens indoleamine-pyrrole 2,3 dioxygenase (INDO)
Homo sapiens keratin 5 (KRT5)
Homo sapiens keratin 14 (epidermolysis bullosa simplex, Dowling-Meara,
Homo sapiens family with sequence similarity 83, member A (FAM83A),
Homo sapiens family with sequence similarity 181, member B (FAM181B)
Homo sapiens granzyme B (granzyme 2, cytotoxic T-lymphocyte-
Homo sapiens desmoglein 3 (pemphigus vulgaris antigen) (DSG3)
Homo sapiens thymidine phosphorylase (TYMP), transcript variant 3
Homo sapiens keratin 6A (KRT6A)
Homo sapiens keratin 6B (KRT6B)
Homo sapiens major histocompatibility complex, class II, DR beta 1 (HLA-
Homo sapiens lipocalin 2 (LCN2)
Homo sapiens keratin 4 (KRT4)
Homo sapiens interferon, gamma-inducible protein 30 (IFI30)
Homo sapiens KIAA1618 (KIAA1618)
Homo sapiens S100 calcium binding protein A8 (S100A8)
Homo sapiens matrix metallopeptidase 7 (matrilysin, uterine) (MMP7)
Homo sapiens matrix metallopeptidase 7 (matrilysin, uterine) (MMP7)
Homo sapiens small proline-rich protein 2A (SPRR2A)
Homo sapiens gap junction protein, beta 2, 26 kDa (GJB2)
In some embodiments, the cancer cell may be targeted specifically with a therapeutic based upon the differentially expressed gene or gene product. For example, in some embodiments, the differentially expressed gene product is an enzyme, which can convert a anticancer prodrug into its active form. Therefore, in normal cells, where the differentially expressed gene product is not expressed or expressed at significantly lower levels, the prodrug is either not activated or activated in a lesser amount, and is, therefore less toxic to normal cells. Therefore, the cancer prodrug can, in some embodiments, be given in a higher dosage so that the cancer cells can metabolize the prodrug, which will, for example, kill the cancer cell, and the normal cells will not metabolize the prodrug or not as well, and, therefore, be less toxic to the patient. An example of this is where tumor cells overexpress a metalloprotease, which is described in Atkinson et al., British Journal of Pharmacology (2008) 153, 1344-1352. Using proteases to target cancer cells is also described in Carl et al., PNAS, Vol. 77, No. 4, pp. 2224-2228, April 1980. For example, doxorubicin or other type of chemotherapeutic can be linked to a peptide sequence that is specifically cleaved or recognized by the differentially expressed gene product. The doxorubicin or other type of chemotherapeutic is then cleaved from the peptide sequence and is activated such that it can kill or inhibit the growth of the cancer cell whereas in the normal cell the chemotherapeutic is never internalized into the cell or is not metabolized as efficiently, and is, therefore, less toxic.
In some embodiments, a method of treating cancer may comprise gene knockdown of one or more cancer associated sequences described herein. Gene knockdown refers to techniques by which the expression of one or more of an organism's genes is reduced, either through genetic modification (a change in the DNA of one of the organism's chromosomes such as, without limitation, chromosomes encoding cancer associated sequences) or by treatment with a reagent such as a short DNA or RNA oligonucleotide with a sequence complementary to either an mRNA transcript or a gene. In some embodiments, the oligonucleotide used may be selected from RNase-H competent antisense, such as, without limitation, ssDNA oligonucleotides, ssRNA oligonucleotides, phosphorothioate oligonucleotides, or chimeric oligonucleotides; RNase-independent antisense, such as morpholino oligonucleotides, 2′-O-methyl phosphorothioate oligonucleotides, locked nucleic acid oligonucleotides, or peptide nucleic acid oligonucleotides; RNAi oligonucleotides, such as, without limitation, siRNA duplex oligonucleotides, or shRNA oligonucleotides; or any combination thereof. In some embodiments, a plasmid may be introduced into a cell, wherein the plasmid expresses either an antisense RNA transcript or an shRNA transcript. The oligo introduced or transcript expressed may interact with the target mRNA (ex. SEQ ID NOs. 1-55) by complementary base pairing (a sense-antisense interaction).
The specific mechanism of silencing may vary with the oligo chemistry. In some embodiments, the binding of a oligonucleotide described herein to the active gene or its transcripts may cause decreased expression through blocking of transcription, degradation of the mRNA transcript (e.g. by small interfering RNA (siRNA) or RNase-H dependent antisense) or blocking either mRNA translation, pre-mRNA splicing sites or nuclease cleavage sites used for maturation of other functional RNAs such as miRNA (e.g. by Morpholino oligonucleotides or other RNase-H independent antisense). For example, RNase-H competent antisense oligonucleotides (and antisense RNA transcripts) may form duplexes with RNA that are recognized by the enzyme RNase-H, which cleaves the RNA strand. As another example, RNase-independent oligonucleotides may bind to the mRNA and block the translation process application. In some embodiments, the oligonucleotides may bind in the 5′-UTR and halt the initiation complex as it travels from the 5′-cap to the start codon, preventing ribosome assembly. A single strand of RNAi oligonucleotides may be loaded into the RISC complex, which catalytically cleaves complementary sequences and inhibits translation of some mRNAs bearing partially-complementary sequences. The oligonucleotides may be introduced into a cell by any technique including, without limitation, electroporation, microinjection, salt-shock methods such as, for example, CaCl2 shock; transfection of anionic oligo by cationic lipids such as, for example, Lipofectamine; transfection of uncharged oligonucleotides by endosomal release agents such as, for example, Endo-Porter; or any combination thereof. In some embodiments, the oligonucleotides may be delivered from the blood to the cytosol using techniques selected from nanoparticle complexes, virally-mediated transfection, oligonucleotides linked to octaguanidinium dendrimers (Morpholino oligonucleotides), or any combination thereof.
In some embodiments, a method of treating bladder cancer may comprise treating cells to knockdown or inhibit expression of a gene encoding the mRNA disclosed in SEQ ID NOs. 1-55. The method may comprise culturing hES cell-derived clonal embryonic progenitor cell lines CM02 and EN13 (see U.S. Patent Publication 20080070303, entitled “Methods to accelerate the isolation of novel cell strains from pluripotent stem cells and cells obtained thereby”; and U.S. patent application Ser. No. 12/504,630 filed on Jul. 16, 2009 and titled “Methods to Accelerate the Isolation of Novel Cell Strains from Pluripotent Stem Cells and Cells Obtained Thereby”, each of which is incorporated by reference herein in its entirety) with a retrovirus expressing silencing RNA directed to a cancer-associated sequence. In some embodiments, the method may further comprise confirming down-regulation by qPCR. In some embodiments, the method further comprises cryopreserving the cells. In some embodiments, the method further comprises reprogramming the cells. In some embodiments, the method comprises cryopreserving or reprogramming the cells within two days by the exogenous administration of OCT4, MYC, KLF4, and SOX2 (see Takahashi and Yamanaka 2006 Aug. 25; 126(4):663-76; U.S. patent application Ser. No. 12/086,479, published as US2009/0068742 and entitled “Nuclear Reprogramming Factor”) and by the method described in PCT/US06/30632, published as WO/2007/019398 and entitled “Improved Methods of Reprogramming Animal Somatic Cells”. In some embodiments, the method may comprise culturing mammalian differentiated cells under conditions that promote the propagation of ES cells. In some embodiments, any convenient ES cell propagation condition may be used, e.g., on feeders or in feeder free media capable of propagating ES cells. In some embodiments, the method comprises identifying cells from ES colonies in the culture. Cells from the identified ES colony may then be evaluated for ES markers, e.g., Oct4, TRA 1-60, TRA 1-81, SSEA4, etc., and those having ES cell phenotype may be expanded. Control lines that have not been preconditioned by the knockdown may be reprogrammed in parallel to demonstrate the effectiveness of the preconditioning.
In some embodiments, a method for treating bladder cancer comprises administering to a subject in need thereof a therapeutic agent modulating the activity of a cancer associated protein (CAP), wherein said CAP is encoded by a nucleic acid comprising a nucleic acid sequence selected from the group consisting of the human nucleic acid sequences in Table 2 and further wherein the therapeutic agent binds to the cancer associated protein; wherein the cancer associated protein is selected from the group consisting of SEQ ID NOs: 56-110 shown in Table 3.
In some embodiments, a method of treating bladder cancer comprises administering an antibody (e.g. monoclonal antibody, human antibody, humanized antibody, chimeric antibody, and the like) that specifically binds to a cancer associated protein (CAP) that is expressed on a cell surface, wherein the cancer associated protein is selected from the group consisting of SEQ ID NOs: 56-110. In some embodiments, the antibody binds to an extracellular domain of the cancer associated protein. In some embodiments, the antibody binds to a cancer associated protein differentially expressed on a cancer cell surface relative to a normal cell surface, or, in some embodiments, to at least one human cancer cell line. In some embodiments, the antibody is linked to a therapeutic agent. Kits and pharmaceutical compositions for detecting a presence or an absence of cancer cells in a subject, and comprising such antibodies are also provided.
In some embodiments the invention provides a method for inhibiting growth of cancer cells in a subject. In some embodiments, the method comprises administering to the subject an effective amount of a pharmaceutical composition as described herein. In some embodiments the invention provides a method for delivering a therapeutic agent to cancer cells in a subject, the method comprising: administering to the subject an effective amount of a pharmaceutical composition according to according to the invention.
The pattern of gene expression in a particular living cell may be characteristic of its current state. Nearly all differences in the state or type of a cell are reflected in the differences in RNA levels of one or more genes. Comparing expression patterns of uncharacterized genes may provide clues to their function. High throughput analysis of expression of hundreds or thousands of genes can help in (a) identification of complex genetic diseases, (b) analysis of differential gene expression over time, between tissues and disease states, and (c) drug discovery and toxicology studies. Increase or decrease in the levels of expression of certain genes correlate with cancer biology. For example, oncogenes are positive regulators of tumorigenesis, while tumor suppressor genes are negative regulators of tumorigenesis. (Marshall, Cell, 64: 313-326 (1991); Weinberg, Science, 254: 1138-1146 (1991)). Accordingly, some embodiments herein provide for polynucleotide and polypeptide sequences involved in cancer and, in particular, in oncogenesis.
Oncogenes are genes that can cause cancer. Carcinogenesis can occur by a wide variety of mechanisms, including infection of cells by viruses containing oncogenes, activation of protooncogenes in the host genome, and mutations of protooncogenes and tumor suppressor genes. Carcinogenesis is fundamentally driven by somatic cell evolution (i.e. mutation and natural selection of variants with progressive loss of growth control). The genes that serve as targets for these somatic mutations are classified as either protooncogenes or tumor suppressor genes, depending on whether their mutant phenotypes are dominant or recessive, respectively.
The detection of the expression level of the one or more markers disclosed infra may be by any means known in the art. For example where the marker is a protein associated with breast cancer an ELISA may used to detect the expression level of the marker. Other suitable assays for detecting the presence of a protein marker include a radio-immunoassay, a western blot, an immunoprecipitation assay, such as a bead based assay, e.g. a magnetic bead based assay. In some embodiments the marker may be isolated from the sample before detection, but in other embodiments it is not isolated from the sample. In some embodiments the protein marker may be expressed in a cellular context (i.e., on the surface of the cell or within the cell). In these instances immunoecytochemistry may be used to detect the marker. Alternatively, the flow cytometry can used to detect the marker. Where the marker is contained within the cell, the cells may be treated with a detergent to make the marker accessible to a detection reagent. Suitable detection reagents would include any molecule that specifically binds the marker, such as an antibody that specifically binds to an epitope on the marker.
Suitable agents for detecting a protein marker as disclosed infra include any specific binding partner of the breast cancer marker. For example the specific binding partner may be a protein that binds the breast cancer marker, such as an antibody. Other suitable specific binding partners may include a receptor that binds the breast cancer marker or an enzyme that specifically binds the breast cancer marker.
The cancer can also be diagnosed to a specific tissue type as well by visualizing the labeled molecule. The molecule can be visualized or detected using any method, such as but not limited to, MRI, CAT scan, PET scan, and the like. In some embodiments, an antibody can bind to the protein and then be detected. In some embodiments, the level of antibody binding can be quantified to determine whether the protein is overexpressed. Differential expression can also be determined by known methods. Accordingly, embodiments hereof provide a method for imaging structures in tissues and cells of a subject having cancer, is suspected of having cancer, or is undergoing a diagnostic procedure to determine if the person has cancer. If the imaging demonstrates that the cancer associated protein is overexpressed or differentially expressed then the patient is diagnosed as having cancer or suspected of having cancer. Other tests can also be done, such as but not limited to, a biopsy to confirm, or otherwise aid, the diagnosis.
The label molecules can also be labeled by, but not limited to, any radioisotopes that can be imaged with a PET or SPECT camera. For example, radiopharmaceuticals of various embodiments may be radiolabeled with radioisotopes such as, but not limited to, 76Br, 123I, 125I, 131I, 99mTc, 11C, 18F, or other gamma- or positron-emitting radionuclides. In other embodiments, the label molecules may be radiolabeled with a combination of radioisotopes.
In some embodiments the marker associated with breast cancer may be a nucleic acid, e.g. an mRNA molecule. The nucleic acid may be isolated from the sample. Detection of the nucleic acid may be by any means known in the art. For example the nucleic acid molecule may be detected by Southern blot or northern blot mass spectroscopy, microarray and the like. The nucleic acid may be detected using PCR, for example where the nucleic acid is an RNA molecule, such as an mRNA molecule, rtPCR may be used. The PCR may be quantitative PCR (e.g. qPCT) or real time PCR. The nucleic acid may be detected by in situ hybridization where the sample includes breast cancer cells.
The assays described above may include the use of a probe to detect the nucleic acid marker. Probes are described infra. Briefly, the probe may be a nucleic acid molecule ranging from 5-40, 10-35, 15-30 nucleotides long. The probe may be about 5, about 10, about 20, about 25, about 30, about 35 nucleotides long. The probe may include a portion of a gene encoding the breast cancer marker, or a complement of a gene encoding a breast cancer marker.
It will be appreciated that there are various methods of obtaining expression data and uses of the expression data. For example, the expression data that can be used to detect or diagnose a subject with cancer can be obtained experimentally. In some embodiments, obtaining the expression data comprises obtaining the sample and processing the sample to experimentally determine the expression data. The expression data can comprise expression data for one or more of the cancer associated sequences described herein. The expression data can be experimentally determined by, for example, using a microarray or quantitative amplification method such as, but not limited to, those described herein. In some embodiments, obtaining expression data associated with a sample comprises receiving the expression data from a third party that has processed the sample to experimentally determine the expression data.
The use of microarray analysis of gene expression allows the identification of sequences associated with cancer. These sequences may then be used in a number of different ways, including diagnosis, prognosis, screening for modulators (including both agonists and antagonists), antibody generation (for immunotherapy and imaging), etc. However, as will be appreciated by those skilled in the art, sequences that are identified in one type of cancer may have a strong likelihood of being involved in other types of cancers as well. Thus, while the sequences outlined herein are initially identified as correlated with bladder cancer, they may also be found in other types of cancers as well.
The comparison of gene expression on an mRNA level using Illumina gene expression microarrays hybridized to RNA probe sequences (SEQ ID NOs: 111-165, shown in Table 4) prepared from the diverse categories of cell types: 1) human embryonic stem (“ES”) cells, or gonadal tissues 2) ES, iPS, or EC-derived clonal embryonic progenitor (“EP”) cell lines, 3) nucleated blood cells including but not limited to CD34+ cells and CD133+ cells; 4) Normal mortal somatic adult-derived tissues and cultured cells including: skin fibroblasts, vascular endothelial cells, normal non-lymphoid and non-cancerous tissues, and the like, and 5) malignant cancer cells including cultured cancer cell lines or human tumor tissue and filters was performed to detect genes that are generally expressed (or not expressed) in categories 1, 3, and 5, or categories 1 and 5 but not expressed (or expressed) in categories 2 and 4. Therapies in these cancers based on this observation would be based on reducing the expression of the above referenced transcripts up-regulated in cancer, or otherwise reducing the expression of the gene products.
Gene Expression Assays: Measurement of the gene expression levels may be performed by any known methods in the art, including but not limited to quantitative PCR, or microarray gene expression analysis, bead array gene expression analysis and Northern analysis. The gene expression levels may be represented as relative expression normalized to the ADPRT (Accession number NM—001618.2), GAPD (Accession number NM—002046.2), or other housekeeping genes known in the art. In the case of microarrayed probes of mRNA expression, the gene expression data may also be normalized by a median of medians method. In this method, each array gives a different total intensity. Using the median value is a robust way of comparing cell lines (arrays) in an experiment. As an example, the median was found for each cell line and then the median of those medians became the value for normalization. The signal from the each cell line was made relative to each of the other cell lines.
RNA extraction. Cells from a suitable subject may be incubated with 0.05% trypsin and 0.5 mM EDTA, followed by collecting in DMEM (Gibco, Gaithersburg, Md.) with 0.5% BSA. Total RNA is purified from cells using the RNeasy Mini kit (Qiagen, Hilden, Germany).
Isolation of total and miRNA may be obtained from human embryonic stem cells and differentiated progeny cells. Total RNA or samples enriched for small RNA species were isolated from cell cultures that underwent serum starvation prior to harvesting RNA to approximate cellular growth arrest observed in many mature tissues. Cellular growth arrest was performed by changing to medium containing 0.5% serum for 5 days, with one medium change 2-3 days after the first addition of low serum medium. RNA were harvested according to the vendors instructions for Qiagen RNEasy kits to isolate total RNA or Ambion mirVana kits to isolate RNA enriched for small RNA species. The RNA concentrations were determined by spectrophotometry and RNA quality determined by denaturing agarose gel electrophoresis to visualize 28S and 18S RNA. Samples with clearly visible 28S and 18S bands without signs of degradation and at a ratio of approximately 2:1, 28S:18S, were used for subsequent miRNA analysis.
Assay for miRNA in samples isolated from human embryonic stem cells and differentiated progeny cells. The miRNAs were quantitated using a Human Panel TaqMan MicroRNA Assay from Applied Biosystems, Inc. This is a two-step assay that uses stem-loop primers for reverse transcription (RT) followed by real-time TaqMan®. A total of 330 miRNA assays were performed to quantitate the levels of miRNA in the H9 human embryonic stem cell line, a differentiated fibroblast cell line, and nine cell lines differentiated from human embryonic stem cells. The assay includes two steps, reverse transcription (RT) and quantitative PCR. Real-time PCR was performed on an Applied Biosystems 7500 Real-Time PCR System. The copy number per cell was estimated based on the standard curve of synthetic mir-16 miRNA and assuming a total RNA mass of approximately 15 pg/cell.
The reverse transcription reaction was performed using 1× cDNA archiving buffer, 3.35 units MMLV reverse transcriptase, 5 mM each dNTP, 1.3 units AB RNase inhibitor, 2.5 nM 330-plex reverse primer (RP), 3 ng of cellular RNA in a final volume of 5 μl. The reverse transcription reaction was performed on a BioRad or MJ thermocycler with a cycling profile of 20° C. for 30 sec; 42° C. for 30 see; 50° C. for 1 see, for 60 cycles followed by one cycle of 85° C. for 5 min.
Real-time PCR. Two microlitres of 1:400 diluted Pre-PCR product is used for a 20 ul reaction. All reactions are duplicated. Because the method is very robust, duplicate samples are sufficient and accurate enough to obtain values for miRNA expression levels. TaqMan universal PCR master mix of ABI is used according to manufacturer's suggestion. Briefly, 1× TaqMan Universal Master Mix (ABI), 1 uM Forward Primer, 1 uM Universal Reverse Primer and 0.2 uM TaqMan Probe is used for each real-time PCR. The conditions used are as follows: 95° C. for 10 min, followed by 40 cycles at 95° C. for 15 s, and 60° C. for 1 min. All the reactions are run on ABI Prism 7000 Sequence Detection System.
Microarray hybridization and data processing. cDNA samples and cellular total RNA (5 μg in each of eight individual tubes) are subjected to the One-Cycle Target Labeling procedure for biotin labeling by in vitro transcription (IVT) (Affymetrix, Santa Clara, Calif.) or using the Illumina Total Prep RNA Labelling kit. For analysis on Affymetix gene chips, the cRNA is subsequently fragmented and hybridized to the Human Genome U133 Plus 2.0 Array (Affymetrix) according to the manufacturer's instructions. The microarray image data are processed with the GeneChip Scanner 3000 (Affymetrix) to generate CEL data. The CEL data are then subjected to analysis with dChip software, which has the advantage of normalizing and processing multiple datasets simultaneously. Data obtained from the eight nonamplified controls from cells, from the eight independently amplified samples from the diluted cellular RNA, and from the amplified cDNA samples from 20 single cells are normalized separately within the respective groups, according to the program's default setting. The model based expression indices (MBEI) are calculated using the PM/MM difference mode with log-2 transformation of signal intensity and truncation of low values to zero. The absolute calls (Present, Marginal and Absent) are calculated by the Affymetrix Microarray Software 5.0 (MAS 5.0) algorithm using the dChip default setting. The expression levels of only the Present probes are considered for all quantitative analyses described below. The GEO accession number for the microarray data is GSE4309. For analysis on Illumina Human HT-12 v4 Expression Bead Chips, labeled cRNA are hybridized according to the manufacturer's instructions.
Calculation of coverage and accuracy. A true positive is defined as probes called Present in at least six of the eight nonamplified controls, and the true expression levels are defined as the log-averaged expression levels of the Present probes. The definition of coverage is (the number of truly positive probes detected in amplified samples)/(the number of truly positive probes). The definition of accuracy is (the number of truly positive probes detected in amplified samples)/(the number of probes detected in amplified samples). The expression levels of the amplified and nonamplified samples are divided by the class interval of 20.5 (20, 20.5, 21, 21.5 . . . ), where accuracy and coverage are calculated. These expression level bins are also used to analyze the frequency distribution of the detected probes.
Analysis of gene expression profiles of cells. The unsupervised clustering and class neighbor analyses of the microarray data from cells are performed using GenePattern software available online from MIT, which performs the signal-to-noise ratio analysis/T-test in conjunction with the permutation test to preclude the contribution of any sample variability, including those from methodology and/or biopsy, at high confidence. The analyses are conducted on the 14,128 probes for which at least 6 out of 20 single cells provided Present calls and at least 1 out of 20 samples provided expression levels >20 copies per cell. The expression levels calculated for probes with Absent/Marginal calls were truncated to zero. To calculate relative gene expression levels, the Ct values obtained with Q-PCR analyses are corrected using the efficiencies of the individual primer pairs quantified either with whole human genome (BD Biosciences) or plasmids that contain gene fragments. The relative expression levels are further transformed into copy numbers with a calibration line calculated using the spike RNAs included in the reaction mixture (log10 [expression level]=1.05×log10 [copy number]+4.65). The Chi-square test for independence is performed to evaluate the association of gene expressions with Gata4, which represents the difference between cluster 1 and cluster 2 determined by the unsupervised clustering and which is restricted to PE at later stages. The expression levels of individual genes measured with Q-PCR are classified into three categories: high (>100 copies per cell), middle (10-100 copies per cell), and low (<10 copies per cell). The Chi-square and P-values for independence from Gata4 expression are calculated based on this classification. Chi squared is defined as follows: χ2=ΣΣ(n fij−fi fj)2/n fi fj, where i and j represent expression level categories (high, middle or low) of the reference (Gata4) and the target gene, respectively; fi, fj, and fij represent the observed frequency of categories i, j and ij, respectively; and n represents the sample number (n=24). The degrees of freedom are defined as (r−1)×(c−1), where r and c represent available numbers of expression level categories of Gata4 and of the target gene, respectively.
Electroporation may be used to introduce the cancer associated nucleic acids described herein into mammalian cells (Neumann, E. et al. (1982) EMBO J. 1, 841-845), plant and bacterial cells, and may also be used to introduce proteins (Marrero, M. B. et al. (1995) J. Biol. Chem. 270, 15734-15738; Nolkrantz, K. et al. (2002) Anal. Chem. 74, 4300-4305; Rui, M. et al. (2002) Life Sci. 71, 1771-1778). Cells (such as the cells of this invention) suspended in a buffered solution of the purified protein of interest are placed in a pulsed electrical field. Briefly, high-voltage electric pulses result in the formation of small (nanometer-sized) pores in the cell membrane. Proteins enter the cell via these small pores or during the process of membrane reorganization as the pores close and the cell returns to its normal state. The efficiency of delivery may be dependent upon the strength of the applied electrical field, the length of the pulses, temperature and the composition of the buffered medium. Electroporation is successful with a variety of cell types, even some cell lines that are resistant to other delivery methods, although the overall efficiency is often quite low. Some cell lines may remain refractory even to electroporation unless partially activated.
Microinjection may be used to introduce femtoliter volumes of DNA directly into the nucleus of a cell (Capecchi, M. R. (1980) Cell 22, 470-488) where it can be integrated directly into the host cell genome, thus creating an established cell line bearing the sequence of interest. Proteins such as antibodies (Abarzua, P. et al. (1995) Cancer Res. 55, 3490-3494; Theiss, C. and Meller, K. (2002) Exp. Cell Res. 281, 197-204) and mutant proteins (Naryanan, A. et al. (2003) J. Cell Sci. 116, 177-186) can also be directly delivered into cells via microinjection to determine their effects on cellular processes firsthand. Microinjection has the advantage of introducing macromolecules directly into the cell, thereby bypassing exposure to potentially undesirable cellular compartments such as low-pH endosomes.
Several proteins and small peptides have the ability to transduce or travel through biological membranes independent of classical receptor-mediated or endocytosis-mediated pathways. Examples of these proteins include the HIV-1 TAT protein, the herpes simplex virus 1 (HSV-1) DNA-binding protein VP22, and the Drosophila Antennapedia (Antp) homeotic transcription factor. In some embodiments, protein transduction domains (PTDs) from these proteins may be fused to other macromolecules, peptides or proteins such as, without limitation, a cancer associated polypepdtide to successfully transport the polypeptide into a cell (Schwarze, S. R. et al (2000) Trends Cell Biol. 10, 290-295). Exemplary advantages of using fusions of these transduction domains is that protein entry is rapid, concentration-dependent and appears to work with difficult cell types (Fenton, M. et al. (1998) J. Immunol. Methods 212, 41-48.).
In some embodiments, liposomes may be used as vehicles to deliver oligonucleotides, DNA (gene) constructs and small drug molecules into cells (Zabner, J. et al. (1995) J. Biol. Chem. 270, 18997-19007; Felgner, P. L. et al. (1987) Proc. Natl. Acad. Sci. USA 84, 7413-7417). Certain lipids, when placed in an aqueous solution and sonicated, form closed vesicles consisting of a circularized lipid bilayer surrounding an aqueous compartment. The vesicles or liposomes of embodiments herein may be formed in a solution containing the molecule to be delivered. In addition to encapsulating DNA in an aqueous solution, cationic liposomes may spontaneously and efficiently form complexes with DNA, with the positively charged head groups on the lipids interacting with the negatively charged backbone of the DNA. The exact composition and/or mixture of cationic lipids used can be altered, depending upon the macromolecule of interest and the cell type used (Felgner, J. H. et al. (1994) J. Biol. Chem. 269, 2550-2561). The cationic liposome strategy has also been applied successfully to protein delivery (Zelphati, O, et al. (2001) J. Biol. Chem. 276, 35103-35110). Because proteins are more heterogeneous than DNA, the physical characteristics of the protein, such as its charge and hydrophobicity, may influence the extent of its interaction with the cationic lipids.
In some embodiments, a method of screening drug candidates includes comparing the level of expression of the cancer-associated sequence in the absence of the drug candidate to the level of expression in the presence of the drug candidate.
Some embodiments are directed to a method of screening for a therapeutic agent capable of binding to a cancer-associated sequence (nucleic acid or protein), the method comprising combining the cancer-associated sequence and a candidate therapeutic agent, and determining the binding of the candidate agent to the cancer-associated sequence.
Further provided herein is a method for screening for a therapeutic agent capable of modulating the activity of a cancer-associated sequence. In some embodiments, the method comprises combining the cancer-associated sequence and a candidate therapeutic agent, and determining the effect of the candidate agent on the bioactivity of the cancer-associated sequence. An agent that modulates the bioactivity of the cancer associate sequence is said to be a therapeutic agent capable of modulating the activity of the cancer-associated sequence
A method of screening for anticancer activity, the method comprising: (a) contacting a cell that expresses a cancer associated gene which transcribes a cancer associated sequence selected from SEQ ID NOs: 1-55, homologs thereof, combinations thereof, or fragments thereof with an anticancer drug candidate; (b) detecting an effect of the anticancer drug candidate on an expression of the cancer associated polynucleotide in the cell; and (c) comparing the level of expression in the absence of said drug candidate to the level of expression in the presence of the drug candidate; wherein an effect on the expression of the cancer associate polynucleotide indicates that the candidate has anticancer activity.
In some embodiments, a method of evaluating the effect of a candidate cancer drug may comprise administering the drug to a patient and removing a cell sample from the patient. The expression profile of the cell is then determined. In some embodiments, the method may further comprise comparing the expression profile of the patient to an expression profile of a healthy individual. In some embodiments, the expression profile comprises measuring the expression of one or more or any combination thereof of the sequences disclosed herein. In some embodiments, where the expression profile of one or more or any combination thereof of the sequences disclosed herein is modified (increased or decreased) the candidate cancer drug is said to be effective.
In some embodiments, the invention provides a method of screening for anticancer activity comprising: (a) providing a cell that expresses a cancer associated gene encoded by a nucleic acid sequence selected from the group consisting of the cancer associated sequences shown in Table 2 (SEQ ID NOs: 1-55), or fragment thereof, (b) contacting the cell, which can be derived from a cancer cell with an anticancer drug candidate; (c) monitoring an effect of the anticancer drug candidate on an expression of the cancer associated sequence in the cell sample, and optionally (d) comparing the level of expression in the absence of said drug candidate to the level of expression in the presence of the drug candidate. The drug candidate may be an inhibitor of transcription, a G-protein coupled receptor antagonist, a growth factor antagonist, a serine-threonine kinase antagonist, a tyrosine kinase antagonist. In some embodiments, where the candidate modulates the expression of the cancer associated sequence the candidate is said to have anticancer activity. In some embodiments, the anticancer activity is determined by measuring cell growth. In some embodiments, the candidate inhibits or retards cell growth and is said to have anticancer activity. In some embodiments, the candidate causes the cell to die, and thus, the candidate is said to have anticancer activity.
In some embodiments, the invention provides a method for screening for a therapeutic agent capable of modulating the activity of a cancer associated sequence, wherein said sequence can be encoded by a nucleic acid comprising a nucleic acid sequence selected from the group consisting of the polynucleotide sequences SEQ ID NOs: 1-55 shown in Table 2, said method comprising: a) combining said cancer associated sequence and a candidate therapeutic agent; and b) determining the effect of the candidate agent on the bioactivity of said cancer associated sequence. According to the method the therapeutic agent: affects the expression of the cancer associated sequence; affects the activity of the cancer associated sequence, wherein such activity is selected from the activities listed in Table 21. In some embodiments, the cancer associated sequence is a cancer associate protein (CAP). In some embodiments, the cancer associated sequence is a cancer associate nucleic acid molecule.
Modes of administration for a therapeutic (either alone or in combination with other pharmaceuticals) can be, but are not limited to, sublingual, injectable (including short-acting, depot, implant and pellet forms injected subcutaneously or intramuscularly), or by use of vaginal creams, suppositories, pessaries, vaginal rings, rectal suppositories, intrauterine devices, and transdermal forms such as patches and creams.
Specific modes of administration will depend on the indication. The selection of the specific route of administration and the dose regimen is to be adjusted or titrated by the clinician according to methods known to the clinician in order to obtain the optimal clinical response. The amount of therapeutic to be administered is that amount which is therapeutically effective. The dosage to be administered will depend on the characteristics of the subject being treated, e.g., the particular animal treated, age, weight, health, types of concurrent treatment, if any, and frequency of treatments, and can be easily determined by one of skill in the art (e.g., by the clinician).
Pharmaceutical formulations containing the therapeutic of the present invention and a suitable carrier can be solid dosage forms which include, but are not limited to, tablets, capsules, cachets, pellets, pills, powders and granules; topical dosage forms which include, but are not limited to, solutions, powders, fluid emulsions, fluid suspensions, semi-solids, ointments, pastes, creams, gels and jellies, and foams; and parenteral dosage forms which include, but are not limited to, solutions, suspensions, emulsions, and dry powder; comprising an effective amount of a polymer or copolymer of the present invention. It is also known in the art that the active ingredients can be contained in such formulations with pharmaceutically acceptable diluents, fillers, disintegrants, binders, lubricants, surfactants, hydrophobic vehicles, water soluble vehicles, emulsifiers, buffers, humectants, moisturizers, solubilizers, preservatives and the like. The means and methods for administration are known in the art and an artisan can refer to various pharmacologic references for guidance. For example, Modern Pharmaceutics, Banker & Rhodes, Marcel Dekker, Inc. (1979); and Goodman & Gilman's The Pharmaceutical Basis of Therapeutics, 6th Edition, MacMillan Publishing Co., New York (1980) can be consulted.
The compositions of the present invention can be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. The compositions can be administered by continuous infusion subcutaneously over a period of about 15 minutes to about 24 hours. Formulations for injection can be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The compositions can take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and can contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
For oral administration, the compositions can be formulated readily by combining the therapeutic with pharmaceutically acceptable carriers well known in the art. Such carriers enable the therapeutic of the invention to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a patient to be treated. Pharmaceutical preparations for oral use can be obtained by adding a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients include, but are not limited to, fillers such as sugars, including, but not limited to, lactose, sucrose, mannitol, and sorbitol; cellulose preparations such as, but not limited to, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose, and polyvinylpyrrolidone (PVP). If desired, disintegrating agents can be added, such as, but not limited to, the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
Dragee cores can be provided with suitable coatings. For this purpose, concentrated sugar solutions can be used, which can optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments can be added to the tablets or dragee coatings for identification or to characterize different combinations of active therapeutic doses.
Pharmaceutical preparations which can be used orally include, but are not limited to, push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules can contain the active ingredients in admixture with filler such as, e.g., lactose, binders such as, e.g., starches, and/or lubricants such as, e.g., talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active therapeutic can be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers can be added. All formulations for oral administration should be in dosages suitable for such administration.
For buccal administration, the pharmaceutical compositions can take the form of, e.g., tablets or lozenges formulated in a conventional manner.
For administration by inhalation, the therapeutic for use according to the present invention is conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit can be determined by providing a valve to deliver a metered amount. Capsules and cartridges of, e.g., gelatin for use in an inhaler or insufflator can be formulated containing a powder mix of the therapeutic and a suitable powder base such as lactose or starch.
The compositions can also be formulated in rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.
In addition to the formulations described previously, the therapeutic of the present invention can also be formulated as a depot preparation. Such long acting formulations can be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection.
Depot injections can be administered at about 1 to about 6 months or longer intervals. Thus, for example, the compositions can be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
In transdermal administration, the compositions of the present invention, for example, can be applied to a plaster, or can be applied by transdermal, therapeutic systems that are consequently supplied to the organism.
Pharmaceutical compositions can include suitable solid or gel phase carriers or excipients. Examples of such carriers or excipients include but are not limited to calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin, and polymers such as, e.g., polyethylene glycols.
The compositions can also be administered in combination with other active ingredients, such as, for example, adjuvants, protease inhibitors, or other compatible drugs or compounds where such combination is seen to be desirable or advantageous in achieving the desired effects of the methods described herein.
In some embodiments, the disintegrant component comprises one or more of croscarmellose sodium, carmellose calcium, crospovidone, alginic acid, sodium alginate, potassium alginate, calcium alginate, an ion exchange resin, an effervescent system based on food acids and an alkaline carbonate component, clay, talc, starch, pregelatinized starch, sodium starch glycolate, cellulose floe, carboxymethylcellulose, hydroxypropylcellulose, calcium silicate, a metal carbonate, sodium bicarbonate, calcium citrate, or calcium phosphate.
In some embodiments, the diluent component may include one or more of mannitol, lactose, sucrose, maltodextrin, sorbitol, xylitol, powdered cellulose, microcrystalline cellulose, carboxymethylcellulose, carboxyethylcellulose, methylcellulose, ethylcellulose, hydroxyethylcellulose, methylhydroxyethylcellulose, starch, sodium starch glycolate, pregelatinized starch, a calcium phosphate, a metal carbonate, a metal oxide, or a metal aluminosilicate.
In some embodiments, the optional lubricant component, when present, comprises one or more of stearic acid, metallic stearate, sodium stearylfumarate, fatty acid, fatty alcohol, fatty acid ester, glycerylbehenate, mineral oil, vegetable oil, paraffin, leucine, silica, silicic acid, talc, propylene glycol fatty acid ester, polyethoxylated castor oil, polyethylene glycol, polypropylene glycol, polyalkylene glycol, polyoxyethylene-glycerol fatty ester, polyoxyethylene fatty alcohol ether, polyethoxylated sterol, polyethoxylated castor oil, polyethoxylated vegetable oil, or sodium chloride.
In some embodiments, the invention provides a kit for diagnosing the presence of cancer in a test sample, said kit comprising at least one polynucleotide that selectively hybridizes to a cancer associated polynucleotide sequence shown in Table 2, or its complement. In another embodiment the invention provides an electronic library comprising a cancer associated polynucleotide, a cancer associated polypeptide, or fragment thereof, shown in Table 2. In other embodiments the invention provides a kit for diagnosing the presence of cancer in a test sample, said kit comprising at least one polypeptide or protein shown in Table 3. In further embodiments the invention provides at least one polynucleotide that selectively hybridizes to a cancer associated polynucleotide chosen from MMP11, MMP12, COL10A1, FCRLB, SFN, KRT6A, S100A2, S100A7. In still other embodiments the invention provides a plurality of polynucleotide that selectively hybridizes to a cancer associated polynucleotide chosen from MMP11, MMP12, COL10A1, FCRLB, SFN, KRT6A, S100A2, S100A7
The kits and systems for practicing the subject methods, as described above, may be configured to diagnose cancer in a subject, treat cancer in a subject, or perform basic research experiments on cancer cells (e.g., either derived directly from a subject, grown in vitro or ex vivo, or from an animal model of cancer. The various components of the kits may be present in separate containers or certain compatible components may be precombined into a single container, as desired.
The subject systems and kits may also include one or more other reagents for performing any of the subject methods. The reagents may include one or more matrices, solvents, sample preparation reagents, buffers, desalting reagents, enzymatic reagents, denaturing reagents, probes, polynucleotides, vectors (e.g., plasmid or viral vectors), etc., where calibration standards such as positive and negative controls may be provided as well. As such, the kits may include one or more containers such as vials or bottles, with each container containing a separate component for carrying out a sample processing or preparing step and/or for carrying out one or more steps for producing a normalized sample according to the present invention.
In addition to above-mentioned components, the subject kits typically further include instructions for using the components of the kit to practice the subject methods. The instructions for practicing the subject methods are generally recorded on a suitable recording medium. For example, the instructions may be printed on a substrate, such as paper or plastic, etc. As such, the instructions may be present in the kits as a package insert, in the labeling of the container of the kit or components thereof (i.e., associated with the packaging or sub-packaging) etc. In other embodiments, the instructions are present as an electronic storage data file present on a suitable computer readable storage medium, e.g. CD-ROM, diskette, etc. In yet other embodiments, the actual instructions are not present in the kit, but means for obtaining the instructions from a remote source, e.g. via the internet, are provided. An example of this embodiment is a kit that includes a web address where the instructions can be viewed and/or from which the instructions can be downloaded. As with the instructions, this means for obtaining the instructions is recorded on a suitable substrate.
In addition to the subject database, programming and instructions, the kits may also include one or more control samples and reagents, e.g., two or more control samples for use in testing the kit.
The Differential Expression of SP100—We utilized the screen of the present invention with a large gene expression microarray dataset performed on Illumina microarrays including >400 samples comprised of normal human cell lines including such cell types derived from all three embryonic germ layers as normal human astrocytes, normal human articular chondrocytes, normal bronchial epithelial cells, adult-derived stein cells such as mesenchymal, adipocyte, and dental pulp stem cells, hES-derived clonal embryonic progenitor lines, pluripotent stem (hESCs), hESCs, iPS lines and an EC line. As shown in
Knockdown/inhibition of SP100 expression followed by transcriptional reprogramming accelerates reprogramming while reducing the accumulation of mutations. The hES cell-derived clonal embryonic progenitor cell lines CM02 and EN13 (see U.S. Patent Publication 20080070303, entitled “Methods to accelerate the isolation of novel cell strains from pluripotent stem cells and cells obtained thereby”; and U.S. patent application Ser. No. 12/504,630 filed on Jul. 16, 2009 and titled “Methods to Accelerate the Isolation of Novel Cell Strains from Pluripotent Stem Cells and Cells Obtained Thereby”, each of which is incorporated by reference herein in its entirety) are first cultured with retrovirus expressing silencing RNA directed to SP100 and the down-regulation is confirmed by qPCR. The cells are then cryopreserved or reprogrammed within two days by the exogenous administration of OCT4, MYC, KLF4, and SOX2 (see Takahashi and Yamanaka 2006 Aug. 25; 126(4):663-76; U.S. patent application Ser. No. 12/086,479, published as US2009/0068742 and entitled “Nuclear Reprogramming Factor”, each of which is incorporated herein by reference) and by the method described in PCT/US06/30632, published as WO/2007/019398 and entitled “Improved Methods of Reprogramming Animal Somatic Cells”, incorporated by reference herein in its entirety. The cells may also be conditioned to knockdown/inhibit the expression of the LMNA gene. Control lines that have not been preconditioned by the knockdown of SP100 or LMNA or both SP100 and LMNA are reprogrammed in parallel to demonstrate the shorted time to reprogramming to pluripotency and are sequenced to compare the accumulated mutations in the cells and the lower rate of mutations in the cells preconditioned to lower SP100, LMNA, or both gene products. LMNA expression has been shown previously to be low/absent from ES cells but present in many somatic cells.
Knockdown/inhibition of SP100 expression followed by culturing under conditions for propagating ES cells.—Differentiated mammalian cells (e.g., human cells) are treated to knockdown or inhibit SP100 gene expression (e.g., as described above). The cells may also be treated to knockdown/inhibit the expression of LMNA gene. The cells are cultured under conditions that promote the propagation of ES cells. Any convenient ES cell propagation condition can be used, e.g., on feeders or in feeder free media capable of propagating ES cells. ES colonies are identified in the culture. Cells from the identified ES colony are then evaluated for ES markers, e.g., Oct4, TRA 1-60, TRA 1-81, SSEA4, etc., and those having ES cell phenotype are expanded. In certain embodiments, LMNA-negative cells are used in the above protocol, such as peripheral mononuclear cells (e.g., CD34+ or CD133+ cells). Control lines that have not been preconditioned by the knockdown of SP100 or LMNA or both SP00 and LMNA can be reprogrammed in parallel to demonstrate the effectiveness of the preconditioning.
Additional genes differentially expressed in normal versus diverse cancer types. RNA was obtained from cultured diverse cultured human cell types, normal human tissues, and malignant human tumors and analyzed on Illumina gene expression microarrays. As shown in Table VI, genes are easily identified that provide novel diagnostics for cancer and targets for cancer therapy.
DSCR8 expression in diverse cancer types. RNA was obtained from cultured diverse cultured human cell types, normal human tissues, and malignant human tumors and analyzed on Illumina gene expression microarrays. The gene encoding the protein down syndrome critical region gene 8 DSCR8 also known as MMA-1a (Illumina Probe ID 4280132, accession number NM—203428.1) was detected as a gene expressed in relatively higher levels in testis and diverse cancers compared to normal cultured somatic cell types and tissues. There are reports that DSCR8 is expressed in testis and in melanoma (de Wit, N. J. et al Expression profiling of MMA-1a and splice variant MMA-1b: new cancer/testis antigens identified in human melanoma. Int. J. Cancer 98:547-553) and uterine (Risinger, J. I. et al (2007) Global expression analysis of cancer/testis genes in uterine cancers reveals a high incidence of BORIS expression. Clin. Cancer Res. 13:1713-1719) cancer. Measurements of DSCR8 may be useful for screening or diagnosing a wide array of cancers. While these previous reports suggest DSCR8 is expressed in relatively specifically in testis compared to other human tissues and report that it is expressed in uterine cancers and melanomas, they do not report that the relative expression of DSCR8 is diagnostic of the malignant tumors described herein. Surprisingly, as shown in
In addition, the specific expression of DSCR8 in varied malignancies may provide novel therapeutic strategies wherein the knockdown or inhibition of the activity of the protein encoded by DSCR8 or down-regulating the expression or translation of the gene may be used in reducing tumor mass and treating cancer.
qPCR was performed on bladder tumor tissue, normal bladder tissue and normal bladder tissue that was located adjacent to a bladder tumor. Positive controls were bladder tumors previously assayed by microarray.
Total RNA was extracted with the RNeasy Mini Kit (Qiagen) and cDNA generated using the SuperScript III reverse transcriptase in combination with random hexamer primers alone or in combination with oligo-dT primers (all reverse transcription components from Invitrogen/Life Technologies). PCRs were carried out on a 7900HT Sequence Detection System or a 7500 Real Time PCR System (Applied Biosystems/Life Technologies) utilizing SYBR Green or TaqMan chemistries. The primers used for the PCR reactions are listed in Tables 7 and 8, PCR parameters were: activation at 50° C. for 2 minutes; denature at 95° C. for 10 minutes; followed by 40-42 cycles of 95° C. for 15 seconds and 60° C. for 1 minute (72° C. for amplicons >than 120 bp) followed by dissociation at 95° C. for 15 seconds; 60° C. for 15 seconds, and 95° C. for 15 seconds.
The results are provided in
The UPL System contains a relatively small number of short hydrolysis probes that cover an extensive proportion of the human mRNA transcriptome. UPL probes contain locked nucleic acids (LNAs) lowering the probes' melting temperatures. This allowed the probe and the longer, unmodified, primers to anneal at the same temperature.
Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was performed as follows:
Total RNA was extracted with the RNeasy Mini Kit (Qiagen) and cDNA generated using the SuperScript III reverse transcriptase in combination with random hexamer primers alone or in combination with oligo-dT primers (all reverse transcription components from Invitrogen/Life Technologies). PCRs were carried out on a 7900HT Sequence Detection System or a 7500 Real Time PCR System (Applied Biosystems/Life Technologies) utilizing SYBR® Green I (Applied Biosystems/Life Technologies) or TaqMan chemistries. TaqMan PCR was conducted with probes from the Universal Probe Library (UPL) (Roche) in combination with correspondingly designed primers. Primers: AAGCCTGCTGACGATGATG (Forward) (SEQ ID NO:191) and GCGAGGTAATGTATGCCCTTT (Reverse) (SEQ ID NO:192) were used with UPL 60. The results were normalized to β-actin expression levels.
The result, indicating that S100A7A was elevated in bladder cancer, is shown in
Example 8 provides ELISA data for MMP12, ColX and MMP11 (
Levels of the three protein markers were assayed in serum using a USCN ELISA kit (USCN) according to the manufacturer's instructions. In brief, 100 μL of the blank, standards, and samples with specified dilutions were added to the appropriate wells of a 96 well plate followed by 2 hours of incubation at 37° C. After removal of the liquid, 100 ul of Detection Reagent A was added to each well and incubated for 1 hour at 37° C. After removal of Reagent A, each well was washed 3 times with 350 uL of wash solution. 100 uL of Detection Reagent B was added to each well and then incubated for 30 minutes at 37° C. After removal of Reagent B, each well was washed 5 times with 350 uL of wash solution. 90 uL of Substrate solution was added to each well and incubated for 15-25 minutes at 37° C. 50 uL of Stop Solution was added to each well. The plate was read either on the Molecular Devices SpectraMax250 or the BioTek Synergy H1 plate reader at 450 nm. A standard curve was derived from the standards supplied in the kit and the sample values were extrapolated from this curve.
The results are shown in
Human urine samples from healthy subjects and cancer patients were analyzed by qPCR for expression of the markers COL10A1, MMP11, SFN, FCRLB, as described below.
RNA was extracted from cells in voided urine with the ZR Urine RNA Isolation Kit™ (Zymo Research) then reverse-transcribed using SuperScript III reverse transcriptase in the presence of random hexamer and oligo-dT primers (Invitrogen/Life Technologies). Following PCR with 50 cycles, products were analyzed on pre-cast 4% Agarose (HR) gels containing ethidium bromide (E-Gel®, Invitrogen/Life Technologies). Urine specimens: all from male individuals, three with bladder cancer (1-3), and three healthy controls (A-C). GAPDH served as loading and/or positive control. The following primers were used: COL10A1: ES577-COL10A1-F and ES578-COL10A1-R, MMP11: JK1178-MMP11-F and JK1179-MMP111-R, SFN: JK1206-SFN-F and JK1207-SFN-R, FCRLB: JK1200-FCRLB-F and JK1201-FCRLB-R, GAPDH: ES312-GAPD-F2 and ES313-GAPD-R2.
The results shown in
qPCR was performed on bladder tumor tissue, normal bladder tissue and normal bladder tissue that was located adjacent to a bladder tumor. Positive controls were bladder tumors previously assayed by microarray.
Total RNA was extracted with the RNeasy Mini Kit (Qiagen) and cDNA generated using the SuperScript III reverse transcriptase in combination with random hexamer primers alone or in combination with oligo-dT primers (all reverse transcription components from Invitrogen/Life Technologies). PCRs were carried out on a 7900HT Sequence Detection System or a 7500 Real Time PCR System (Applied Biosystems/Life Technologies) utilizing SYBR Green or TaqMan chemistries. The primers used for the PCR reactions were: ACTGGTGGCAGGGGCTTCTAGC (SEQ ID NO:196) (Forward primer) and GCCATCTAAAGTAACTAAACCCATAGAC (SEQ ID NO: 197) (
The results are provided in
Although the present invention has been described in considerable detail with reference to certain preferred embodiments thereof, other versions are possible. Therefore the spirit and scope of the appended claims should not be limited to the description and the preferred versions contained within this specification.
Homo sapiens melanoma antigen family A, 10 (MAGEA10), transcript variant 2,
Homo sapiens Down syndrome critical region gene 8 (DSCR8), transcript variant
Homo sapiens matrix metallopeptidase 12 (macrophage elastase) (MMP12), mRNA
Homo sapiens chemokine (C—X—C motif) ligand 9 (CXCL9), mRNA
Homo sapiens Down syndrome critical region gene 8 (DSCR8), transcript variant
Homo sapiens keratin 81 (KRT81), mRNA
Homo sapiens parathyroid hormone-like hormone (PTHLH), transcript variant 3,
Homo sapiens matrix metallopeptidase 11 (stromelysin 3) (MPH), mRNA
Homo sapiens S100 calcium binding protein A7 (S100A7), mRNA
Homo sapiens WNT1 inducible signaling pathway protein 3 (WISP3), transcript
Homo sapiens chemokine (C—X—C motif) ligand 10 (CXCL10), mRNA
Homo sapiens neuromedin U (NMU), mRNA
Homo sapiens guanylate binding protein 5 (GBP5), mRNA
Homo sapiens topoisomerase (DNA) II alpha 170 kDa (TOP2A), mRNA
Homo sapiens serpin peptidase inhibitor, clade B (ovalbumin), member 4
Homo sapiens granulysin (GNLY), transcript variant 519, mRNA
Homo sapiens gametocyte specific factor 1 (GTSF1), mRNA
Homo sapiens peptidase inhibitor 3, skin-derived (SKALP) (PI3), mRNA
Homo sapiens S100 calcium binding protein A7A (S100A7A), mRNA
Homo sapiens indoleamine 2,3-dioxygenase 1 (IDO1), mRNA
Homo sapiens gap junction protein, beta 6 (GJB6), mRNA
Homo sapiens calmodulin-like 3 (CALML3), mRNA
Homo sapiens serpin peptidase inhibitor, clade B (ovalbumin), member 3
Homo sapiens chemokine (C—X—C motif) ligand 6 (granulocyte chemotactic
Homo sapiens olfactomedin 4 (OLFM4), mRNA
Homo sapiens transcobalamin I (vitamin B12 binding protein, R binder family)
Homo sapiens visinin-like 1 (VSNL1), mRNA
Homo sapiens ubiquitin D (UBD), mRNA
Homo sapiens absent in melanoma 2 (AIM2), mRNA
Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 9 (ABCC9),
Homo sapiens serpin peptidase inhibitor, glade B (ovalbumin), member 13
Homo sapiens indoleamine-pyrrole 2,3 dioxygenase (INDO), mRNA
Homo sapiens keratin 5 (KRT5), mRNA
Homo sapiens keratin 14 (epidermolysis bullosa simplex, Dowling-Meara,
Homo sapiens family with sequence similarity 83, member A (FAM83A),
Homo sapiens family with sequence similarity 181, member B (FAM181B), mRNA.
Homo sapiens granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine
Homo sapiens thymidine phosphorylase (TYMP), transcript variant 3, mRNA
Homo sapiens keratin 6A (KRT6A), mRNA
Homo sapiens keratin 6B (KRT6B), mRNA
Homo sapiens major histocompatibility complex, class II, DR beta 1 (HLA-
Homo sapiens lipocalin 2 (LCN2), mRNA
Homo sapiens keratin 4 (KRT4), mRNA
Homo sapiens interferon, gamma-inducible protein 30 (IFI30), mRNA
Homo sapiens ring finger protein 213 (RNF213), transcript variant 2, mRNA
Homo sapiens S100 calcium binding protein A8 (S100A8), mRNA
Homo sapiens matrix metallopeptidase 7 (matrilysin, uterine) (MMP7), mRNA
Homo sapiens small proline-rich protein 2A (SPRR2A), mRNA
Homo sapiens gap junction protein, beta 2, 26 kDa (GJB2), mRNA
Homo sapiens interleukin 1, alpha (IL1A), mRNA.
Homo sapiens keratin 16 (KRT16), mRNA.
Homo sapiens solute carrier family 1 (high affinity
This application claims priority to U.S. Provisional Application Ser. No. 61/500,085 filed Jun. 22, 2011, the entire contents of which is hereby incorporated by reference.
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/US2012/043852 | 6/22/2012 | WO | 00 | 12/23/2013 |
| Number | Date | Country | |
|---|---|---|---|
| 61500085 | Jun 2011 | US |
