Methods and compositions for weed control using EPSPS polynucleotides

Information

  • Patent Grant
  • 10334848
  • Patent Number
    10,334,848
  • Date Filed
    Wednesday, January 14, 2015
    10 years ago
  • Date Issued
    Tuesday, July 2, 2019
    5 years ago
Abstract
Provided are novel polynucleotide compositions for enhancing the herbicidal activity of glyphosate. Specifically provided are methods and compositions for modulating 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) in plant species. The present compositions and methods are useful in controlling glyphosate resistant weeds.
Description
INCORPORATION OF SEQUENCE LISTING

A computer readable form of a sequence listing is filed with this application by electronic submission and is incorporated into this application by reference in its entirety. The sequence listing is contained in the file named P34158US01_SEQ.txt, which is 16,933 bytes in size (measured in operating system MS windows) and was created on Jul. 14, 2016.


FIELD

The embodiments relate generally to the field of weed management. More specifically, embodiments relate compositions and methods for controlling weed species utalizing polynucleotide molecules. Further provided are compositions containing polynucleotide molecules and methods of utilizing such compositions for altering the physiology of plants and modulating the effect of herbicide treatment.


BACKGROUND

Weeds are plants that are unwanted in a particular environment. For example, in an agronomic environment, weeds are plants that compete with cultivated plants. Weeds can also serve as hosts for crop diseases and insect pests. In agricultural production environments, weeds can cause decreases in crop yield, reduced crop quality, increased irrigation costs, increased harvesting costs, reduced land value, injury to livestock, and crop damage from insects and diseases harbored by the weeds. The principal means by which weeds cause these effects are: 1) competing with crop plants for water, nutrients, sunlight and other essentials for growth and development, 2) production of toxic or irritant chemicals that cause human or animal health problems, 3) production of immense quantities of seed or vegetative reproductive parts or both that contaminate agricultural products and perpetuate the weed species in agricultural lands, and 4) production on agricultural and nonagricultural lands of vast amounts of vegetation requiring disposal. Weeds cost farmers billions of dollars annually in crop losses and weed control expenses.


Chemical herbicides are often used to control the growth and spread of weeds. Chemical herbicides are active at one or more target sites within a plant where they interrupt normal plant functions. For example, the herbicide N-phosphonomethyl glycine, also known as glyphosate, targets EPSPS (5-enolpyruvylshikimate-3-phosphate synthase), the enzyme that catalyzes the conversion of shikimate-3-phosphate into 5-enolpyruvyl-shikimate-3-phosphate, which is an intermediate in the biochemical pathway for creating three essential aromatic amino acids (tyrosine, phenylalanine, and tryptophan).


One limitation on the use of chemical herbicides to control weeds is the emergence of herbicide-resistant weeds. Herbicide resistance is the ability of a plant to survive and reproduce following exposure to a dose of herbicide that would normally be lethal. In weeds, herbicide resistance may occur naturally as the result of random and infrequent mutations. Where chemical herbicide application provides selection pressure, herbicide resistant plants survive to reproduce without competition from herbicide-susceptible plants. This selective pressure can lead to the appearance of increasing numbers of herbicide resistant weeds in a weed population. Herbicide tolerant weeds have been observed for nearly all herbicides in use. There are over 365 weed biotypes currently identified as being herbicide resistant to one or more herbicides by the Herbicide Resistance Action Committee (HRAC), the North American Herbicide Resistance Action Committee (NAHRAC), and the Weed Science Society of America (WSSA). There is a need to effectively manage these herbicide resistant weeds and to provide new compositions and techniques for weed management.


SUMMARY

The present embodiments relate to compositions and methods useful for sensitizing weeds to herbicides targeting 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) for the purpose of enhancing control of weeds and for the management of herbicide resistant weeds.


Several embodiments relate to a bioactive trigger polynucleotide comprising a nucleotide sequence that is essentially identical or essentially complementary to SEQ ID NOs: 3, 5, or 9-66, or a fragment thereof. The bioactive trigger polynucleotide may be a single-stranded DNA, a single-stranded RNA, a double-stranded RNA, a double-stranded DNA, or a double-stranded DNA/RNA hybrid. In several embodiments, the bioactive trigger polynucleotide comprises a nucleotide sequence that is essentially identical or essentially complementary to SEQ ID NO 3 or SEQ ID NO 5. In some embodiments, the bioactive trigger polynucleotide comprises a nucleotide sequence that is essentially identical or essentially complementary to a sequence selected from the group consisting of SEQ ID NO: 36, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 65, SEQ ID NO: 66, or a fragment thereof. In some embodiments, the bioactive trigger polynucleotide is double-stranded RNA and the double-stranded RNA comprises SEQ ID NOs: 3 and 4. In some embodiments, the bioactive trigger polynucleotide is double-stranded RNA and the double-stranded RNA comprises SEQ ID NOs: 5 and 6. Several embodiments relate to plant cell comprising a bioactive trigger polynucleotide as described herein. Several embodiments relate to plant comprising a bioactive trigger polynucleotide as described herein.


Several embodiments relate to a composition comprising one or more bioactive trigger polynucleotides and a transfer agent, wherein one or more bioactive trigger polynucleotides comprises a nucleotide sequence that is essentially identical or essentially complementary to SEQ ID NO: 3, 5, or 9-66, or a fragment thereof. The one or more bioactive trigger polynucleotides may each, independently, be selected from the group consisting of single-stranded DNA, single-stranded RNA, double-stranded RNA, double-stranded DNA, and double-stranded DNA/RNA hybrids. In some embodiments, the composition comprises one or more bioactive trigger polynucleotides comprising a nucleotide sequence that is essentially identical or essentially complementary to a sequence selected from the group consisting of SEQ ID NO: 36, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 65, SEQ ID NO: 66, or a fragment thereof. In some embodiments, the composition comprises one or more bioactive trigger polynucleotides comprising a nucleotide sequence that is essentially identical or essentially complementary to SEQ ID NO: 3 or SEQ ID NO: 5, or a fragment thereof. In some embodiments, the composition comprises one or more bioactive double-stranded RNA trigger polynucleotides comprising SEQ ID NOs: 3 and 4, or fragments thereof. In some embodiments, the composition comprises one or more bioactive double-stranded RNA trigger polynucleotides comprising SEQ ID NOs: 5 and 6, or fragments thereof. In some embodiments, the composition comprises a first bioactive trigger polynucleotide and one or more additional bioactive trigger polynucleotides that comprise a different nucleotide sequence than the first bioactive trigger polynucleotide. In some embodiments, the composition comprises a bioactive trigger polynucleotides that comprises a nucleotide sequence that is essentially identical or essentially complementary to SEQ ID NO: 3, 5, or 9-66 and a bioactive trigger molecule that is not essentially identical or essentially complementary to an EPSPS gene sequence, or to the RNA transcript of the EPSPS gene sequence. The composition can include various components. For example, the composition can include one or more of bioactive trigger polynucleotides, transfer agents, and non-polynucleotide herbicides. In some embodiments, the transfer agent is selected from the group consisting of a surfactant, such as an organosilicone surfactant, a cationic liposomal reagent and a plant hormone, such as Brassinosteroid. Examples of organosilicone surfactants include, but are not limited to, BREAK-THRU® S 321, BREAK-THRU® S 200, BREAK-THRU® OE 441, BREAK-THRU® S 278, BREAK-THRU® S 243, SILWET L-77®, SILWET® HS 429, SILWET® HS 312, and BREAK-THRU® S 233. In some embodiments, the composition comprises an organosilicone surfactant and ammonium sulfate. In some embodiments, the composition comprises DOTAP. In some embodiments, the composition comprises a cationic lipid. In some embodiments, the composition comprises nucleic acid lipid particles. In some embodiments, the composition comprises an EPSPS-inhibitor herbicide, such as glyphosate. In some embodiments, the composition comprises a non-EPSPS-inhibitor herbicide, such as dicamba or 2,4-D.


Several embodiments relate to a method of plant control, comprising applying a bioactive trigger polynucleotide comprising a nucleotide sequence that is essentially identical or essentially complementary to an EPSPS gene sequence, or to the RNA transcript of the EPSPS gene sequence, to an external surface of a plant, plant part or seed, wherein the plant is not mechanically permiabilized and the bioactive trigger polynucleotide is incorporated into the interior of a plant cell. Examples of plants that may be controlled by such methods include, but are not limited to, Amaranthus palmeri, Amaranthus rudis, Amaranthus albus, Amaranthus chlorostachys, Amaranthus graecizans, Amaranthus hybridus, Amaranthus lividus, Amaranthus spinosus, Amaranthus thunbergii, Amaranthus viridis, Lolium multiflorum, Lolium rigidium, Ambrosia artemisiifolia, Ambrosia trifida, Euphorbia heterophylla, Kochia scoparia, Abutilon theophrasti, Sorghum halepense, Chenopodium album, Commelina diffusa, Convulvulus arvensis, Conyza candensis, Digitaria sanguinalis, and Xanthium strumarium. In some embodiments, the EPSPS gene sequence is selected from SEQ ID NOs: 1 or 2, or a fragment thereof. In some embodiments, the EPSPS gene sequence is selected from SEQ ID NOs: 9-66. In some embodiments, the EPSPS gene sequence is selected from SEQ ID NO 36, SEQ ID NO 42, SEQ ID NO 43, SEQ ID NO 44, SEQ ID NO 57, SEQ ID NO 58, SEQ ID NO 59, SEQ ID NO 65, and SEQ ID NO 66. In some embodiments, the bioactive trigger polynucleotide comprises a nucleotide sequence that is essentially identical or essentially complementary to SEQ ID NO: 3, 5, or 9-66, or a fragment thereof. In some embodiments, the bioactive trigger polynucleotide is selected from the group consisting of single-stranded DNA, single-stranded RNA, double-stranded RNA, double-stranded DNA, and double-stranded DNA/RNA hybrids. In some embodiments, the bioactive trigger polynucleotide comprises a nucleotide sequence that is essentially identical or essentially complementary to SEQ ID NO 3 or SEQ ID NO 5, or a fragment thereof. In some embodiments, the bioactive trigger polynucleotide is double-stranded RNA comprising SEQ ID NOs: 3 and 4, or fragments thereof. In some embodiments, the bioactive trigger polynucleotide is double-stranded RNA comprising SEQ ID NOs: 5 and 6, or fragments thereof. In some embodiments of the method, a first bioactive trigger polynucleotide and one or more additional bioactive trigger polynucleotides that comprise a different nucleotide sequence than the first bioactive trigger polynucleotide is applied to the plant. In some embodiments, a bioactive trigger polynucleotide that comprises a nucleotide sequence that is essentially identical or essentially complementary to SEQ ID NO: 3, 5, or 9-66 and a bioactive trigger molecule that is not essentially identical or essentially complementary to an EPSPS gene sequence, or to the RNA transcript of the EPSPS gene sequence is applied to the plant. The method may further comprise applying one or more of a transfer agent, an EPSPS-inhibitor herbicide and other non-polynucleotide herbicides. Examples of transfer agents include, but are not limited to, surfactants, such as organosilicone surfactants, cationic lipid reagents, and plant hormones, such as Brassinosteroid. In some embodiments, the composition further comprises a non-polynucleotide herbicide. In some embodiments, the non-polynucleotide herbicide is glyphosate. In some embodiments, the non-polynucleotide herbicide is applied separately from the bioactive trigger polynucleotide. In some embodiments, the non-polynucleotide herbicide is applied concurrently with the bioactive trigger polynucleotide.


Several embodiments relate to a method of controlling growth, development or reproductive ability of a plant by topically treating the plant with a composition comprising a bioactive trigger polynucleotide and a transfer agent, wherein the bioactive trigger polynucleotide comprises a nucleotide sequence that is essentially identical or essentially complementary to SEQ ID NO: 3, 5, or 9-66, or a fragment thereof, whereby the growth, development or reproductive ability of the plant is reduced. In some embodiments, the bioactive trigger polynucleotide is selected from the group consisting of single-stranded DNA, single-stranded RNA, double-stranded RNA, double-stranded DNA, and double-stranded DNA/RNA hybrids. In some embodiments, the bioactive trigger polynucleotide comprises a nucleotide sequence that is essentially identical or essentially complementary to SEQ ID NO 3 or SEQ ID NO 5, or a fragment thereof. In some embodiments, the bioactive trigger polynucleotide comprises a nucleotide sequence that is essentially identical or essentially complementary to a sequence selected from the group consisting of SEQ ID NO 36, SEQ ID NO 42, SEQ ID NO 43, SEQ ID NO 44, SEQ ID NO 57, SEQ ID NO 58, SEQ ID NO 59, SEQ ID NO 65, SEQ ID NO 66, or a fragment thereof. In some embodiments, the bioactive trigger polynucleotide is double-stranded RNA comprising SEQ ID NOs: 3 and 4, or fragments thereof. In some embodiments, the bioactive trigger polynucleotide is double-stranded RNA comprising SEQ ID NOs: 5 and 6, or fragments thereof. In some embodiments of the method, the plant is treated with a first bioactive trigger polynucleotide and one or more additional bioactive trigger polynucleotides that comprise a different nucleotide sequence than the first bioactive trigger polynucleotide. In some embodiments, the plant is treated with a bioactive trigger polynucleotide that comprises a nucleotide sequence that is essentially identical or essentially complementary to SEQ ID NO: 3, 5, or 9-66 and a bioactive trigger molecule that is not essentially identical or essentially complementary to an EPSPS gene sequence, or to the RNA transcript of the EPSPS gene sequence. The method may further comprise treating the plant with one or more of a transfer agent, an EPSPS-inhibitor herbicide and other non-polynucleotide herbicides. Examples of transfer agents include, but are not limited to, surfactants, such as organosilicone surfactants, cationic lipid reagents, and plant hormones, such as Brassinosteroid. In some embodiments, the plant is treated with a non-polynucleotide herbicide. In some embodiments, the non-polynucleotide herbicide is glyphosate. In some embodiments, the non-polynucleotide herbicide is applied separately from the bioactive trigger polynucleotide. In some embodiments, the non-polynucleotide herbicide is applied concurrently with the bioactive trigger polynucleotide.


Several embodiments relate to a method of sensitizing a weed to an EPSPS-inhibitor herbicide, comprising treating the weed with a bioactive trigger polynucleotide that is essentially identical or essentially complementary to a nucleotide sequence selected from the group consisting of SEQ ID NO:3, 5, and 9-66, or a fragment thereof, whereby the weed is more sensitive to an EPSPS-inhibitor herbicide relative to a weed not treated with the bioactive trigger polynucleotide. In some embodiments, the bioactive trigger polynucleotide is essentially identical or essentially complementary to a nucleotide sequence selected from the group consisting of SEQ ID NO 36, SEQ ID NO 42, SEQ ID NO 43, SEQ ID NO 44, SEQ ID NO 57, SEQ ID NO 58, SEQ ID NO 59, SEQ ID NO 65, SEQ ID NO 66, or a fragment thereof. In some embodiments, the method further comprises treating the plant with an EPSPS-inhibitor herbicide. In some embodiments, the weed is resistant to one or more of glyphosate, dicamba and sulfonylurea. In some embodiments, the weed is selected from the group consisting of Amaranthus palmeri, Amaranthus rudis, Amaranthus albus, Amaranthus chlorostachys, Amaranthus graecizans, Amaranthus hybridus, Amaranthus lividus, Amaranthus spinosus, Amaranthus thunbergii, Amaranthus viridis, Lolium multiflorum, Lolium rigidium, Ambrosia artemisiifolia, Ambrosia trifida, Euphorbia heterophylla, Kochia scoparia, Abutilon theophrasti, Sorghum halepense, Chenopodium album, Commelina diffusa, Convulvulus arvensis, Conyza candensis, Digitaria sanguinalis, and Xanthium strumarium. In some embodiments, the weed is growing in a field of herbicide-resistant crop plants. The bioactive trigger polynucleotide may be single-stranded DNA, single-stranded RNA, double-stranded RNA, double-stranded DNA, or a double-stranded DNA/RNA hybrid. In some embodiments, the bioactive trigger polynucleotide is double-stranded RNA and the double-stranded RNA comprises SEQ ID NOs: 3 and 4. In some embodiments, the bioactive trigger polynucleotide is double-stranded RNA and the double-stranded RNA comprises SEQ ID NOs: 5 and 6. In several embodiments, the bioactive trigger polynucleotide is provide with a transfer agent. In some embodiments, the transfer agent is an organosilicone surfactant. For example, the organosilicone surfactant may be BREAK-THRU® S 321, BREAK-THRU® S 200, BREAK-THRU® OE 441, BREAK-THRU® S 278, BREAK-THRU® S 243, SILWET L-77®, SILWET® HS 429, SILWET® HS 312, BREAK-THRU® S 233, or any combination thereof. In some embodiments, the transfer agent is a cationic liposomal reagent, for example, N-[1-(2,3-Dioleoyloxy)propyl]-N,N,N-trimethylammonium methyl-sulfate (DOTAP). In some embodiments, the transfer agent is a plant hormone, for example, Brassinosteroid. In some embodiments, the method further comprises treating the weed with an auxin-like herbicide, such as dicamba or 2,4-D.


Several embodiments relate to a method of controlling one or more plants of the following species: Amaranthus, Ambrosia, Lolium, Digitaria, Euphorbia, Kochia, Sorghum, Conyza, Chloris, Echinochola, Eleusine, Poa, Plantago, Avena, Chenopodium, Setaria, Abutilon, Ipomoea, Sesbania, Cassia, Sida, Brachiaria and Solanum by applying a bioactive trigger molecule as described herein.


Several embodiments relate to a method of controlling one or more of Alopecurus myosuroides, Avena sterilis, Avena sterilis ludoviciana, Brachiaria plantaginea, Bromus diandrus, Bromus rigidus, Cynosurus echinatus, Digitaria ciliaris, Digitaria ischaemum, Digitaria sanguinalis, Echinochloa oryzicola, Echinochloa phyllopogon, Eriochloa punctata, Hordeum glaucum, Hordeum leporinum, Ischaemum rugosum, Leptochloa chinensis, Lolium persicum, Phalaris minor, Phalaris paradoxa, Rottboellia exalta, Setaria faberi, Setaria viridis var, robusta-alba schreiber, Setaria viridis var, robusta-purpurea, Snowdenia polystachea, Sorghum sudanese, Alisma plantago-aquatica, Amaranthus lividus, Amaranthus quitensis, Ammania auriculata, Ammania coccinea, Anthemis cotula, Apera spica-venti, Bacopa rotundifolia, Bidens pilosa, Bidens subalternans, Brassica tournefortii, Bromus tectorum, Camelina microcarpa, Chrysanthemum coronarium, Cuscuta campestris, Cyperus difformis, Damasonium minus, Descurainia sophia, Diplotaxis tenuifolia, Echium plantagineum, Elatine triandra var, pedicellate, Euphorbia heterophylla, Fallopia convolvulus, Fimbristylis miliacea, Galeopsis tetrahit, Galium spurium, Helianthus annuus, Iva xanthifolia, Ixophorus unisetus, Ipomoea indica, Ipomoea purpurea, Ipomoea sepiaria, Ipomoea aquatic, Ipomoea triloba, Lactuca serriola, Limnocharis flava, Limnophila erecta, Limnophila sessiliflora, Lindernia dubia, Lindernia dubia var, major, Lindernia micrantha, Lindernia procumbens, Mesembryanthemum crystallinum, Monochoria korsakowii, Monochoria vaginalis, Neslia paniculata, Papaver rhoeas, Parthenium hysterophorus, Pentzia suffruticosa, Phalaris minor, Raphanus raphanistrum, Raphanus sativus, Rapistrum rugosum, Rotala indica var, uliginosa, Sagittaria guyanensis, Sagittaria montevidensis, Sagittaria pygmaea, Salsola iberica, Scirpus juncoides var, ohwianus, Scirpus mucronatus, Setaria lutescens, Sida spinosa, Sinapis arvensis, Sisymbrium orientale, Sisymbrium thellungii, Solanum ptycanthum, Sonchus aspen, Sonchus oleraceus, Sorghum bicolor, Stellaria media, Thlaspi arvense, Xanthium strumarium, Arctotheca calendula, Conyza sumatrensis, Crassocephalum crepidiodes, Cuphea carthagenenis, Epilobium adenocaulon, Erigeron philadelphicus, Landoltia punctata, Lepidium virginicum, Monochoria korsakowii, Solanum americanum, Solanum nigrum, Vulpia bromoides, Youngia japonica, Hydrilla verticillata, Carduus nutans, Carduus pycnocephalus, Centaurea solstitialis, Cirsium arvense, Commelina diffusa, Convolvulus arvensis, Daucus carota, Digitaria ischaemum, Echinochloa crus-pavonis, Fimbristylis miliacea, Galeopsis tetrahit, Galium spurium, Limnophila erecta, Matricaria perforate, Papaver rhoeas, Ranunculus acris, Soliva sessilis, Sphenoclea zeylanica, Stellaria media, Nassella trichotoma, Stipa neesiana, Agrostis stolonifera, Polygonum aviculare, Alopecurus japonicus, Beckmannia syzigachne, Bromus tectorum, Chloris inflate, Echinochloa erecta, Portulaca oleracea, and Senecio vulgaris by applying a bioactive trigger polynucleotide as described herein.





BRIEF DESCRIPTION OF THE FIGURES

The following drawings form part of the specification and are included to further demonstrate certain aspects of the disclosed embodiments:



FIG. 1 shows glyphosate-tolerant Palmer plants treated with trigger polynucleotides for SEQ ID NOs: 7 and 8 and glyphosate (panel A), treated with trigger polynucleotides for SEQ ID NOs: 3 and 4 and glyphosate (panel B), or treated with trigger polynucleotides for SEQ ID NOs: 5 and 6 and glyphosate (panel C).



FIG. 2 shows a graph of % EPSPS mRNA reduction vs. control in Palmer protoplasts in response to 6 ug of SEQ ID NOs: 3 and 4 or SEQ ID NOs: 5 and 6 trigger.



FIG. 3 shows glyphosate-tolerant Waterhemp plants treated with SEQ ID NOs: 7 and 8 trigger polynucleotides and glyphosate (panel A), treated with trigger polynucleotides for SEQ ID NOs: 3 and 4 and glyphosate (panel B), or treated with trigger polynucleotides for SEQ ID NOs: 5 and 6 and glyphosate (panel C).



FIG. 4 shows the fresh weight (in grams) of plants treated with trigger polynucleotides for SEQ ID NOs: 3, 5, 7 and SEQ ID NOs: 36-64 and glyphosate.





DETAILED DESCRIPTION

Provided are methods and compositions containing a trigger polynucleotide that provide for regulation, repression or delay of 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene expression and enhanced control of weeds. In some embodiments, the methods and compositions disclosed herein provide for increased sensitivity to an EPSPS-inhibitor herbicide. In some embodiments, the methods and compositions disclosed herein provide for regulation, repression or delay of EPSPS gene expression in glyphosate-resistant weed biotypes. Aspects of the methods and compositions disclosed herein can be applied to manage various weeds in agronomic and other cultivated environments.


Definitions

The following terms are used throughout the present disclosure and the following definitions are provided to help guide those of ordinary skill in the art. Unless otherwise noted, terms are to be understood according to conventional usage by those of ordinary skill in the relevant art. Where a term is provided in the singular, the plural of that term is also contemplated unless otherwise noted.


As used herein, “a” or “an” may mean one or more than one.


As used herein, the term “about” indicates that a value includes the inherent variation or error for the device or method being employed to determine the value, or the variation that exists among the studied organism.


As used herein, the terms “DNA”, “DNA molecule”, and “DNA polynucleotide molecule” refer to a polymer of deoxyribonucleotide bases of genomic or synthetic origin. DNA may be wholly or partially single-stranded (ssDNA) or wholly or partially double-stranded (dsDNA). In some embodiments, a DNA molecule may comprise single-stranded and double-stranded regions.


As used herein, the terms “RNA”, “RNA molecule”, and “RNA polynucleotide molecule” refer to a polymer of ribonucleotide bases of cellular or synthetic origin. RNA may be wholly or partially single-stranded (ssRNA) or wholly or partially double-stranded (dsRNA). In some embodiments, a RNA molecule may comprise single-stranded and double-stranded regions.


As used herein, the terms “sequence”, “nucleotide sequence” or “polynucleotide sequence” refer to the nucleotide sequence of a DNA molecule, an RNA molecule or a portion thereof. Unless otherwise stated, nucleotide sequences in the text of this specification are given, when read from left to right, in the 5′ to 3′ direction. It is understood that any Sequence Identification Number (SEQ ID NO) disclosed in the instant application can refer to either a DNA sequence or a RNA sequence, depending on the context where that SEQ ID NO is mentioned, even if that SEQ ID NO is expressed only in a DNA sequence format or a RNA sequence format. Further, disclosure of a nucleic acid sequence discloses the sequence of its reverse complement, as one necessarily defines the other, as is known by one of ordinary skill in the art.


The term “polynucleotide” refers to any polymer of mononucleotides that are linked by internucleotide bonds. Polynucleotides may be composed of naturally-occurring ribonucleotides, naturally-occurring deoxyribonucleotides, analogs of naturally-occurring nucleotides (e.g., enantiomeric forms of naturally-occurring nucleotides), or any combination thereof. Where a polynucleotide is single-stranded, its length can be described in terms of the number of nucleotides. Where a polynucleotide is double-stranded, its length can be described in terms of the number of base pairs.


As used herein, the term “non-transcribable polynucleotide” refers to a polynucleotide that does not comprise a complete polymerase II transcription unit.


As used herein, the term “trigger” or “trigger polynucleotide” refers to a bioactive polynucleotide molecule that is substantially homologous or complementary to a polynucleotide sequence of a target gene or an RNA expressed from the target gene or a fragment thereof and functions to suppress the expression of the target gene or produce a knock-down phenotype. Trigger polynucleotides are generally described in relation to their “target sequence.” Trigger polynucleotides may be single-stranded DNA (ssDNA), single-stranded RNA (ssRNA), double-stranded RNA (dsRNA), double-stranded DNA (dsDNA), or double-stranded DNA/RNA hybrids. Trigger polynucleotides may comprise naturally-occurring nucleotides, modified nucleotides, nucleotide analogues or any combination thereof. In some embodiments, a trigger polynucleotide may be incorporated within a larger polynucleotide, for example in a pri-miRNA molecule. In some embodiments, a trigger polynucleotide may be processed into a small interfering RNA (siRNA).


As used herein, the term “target sequence” refers to a nucleotide sequence that occurs in a gene or gene product against which a trigger polynucleotide is directed. In this context, the term “gene” means a locatable region of genomic sequence, corresponding to a unit of inheritance, which includes regulatory regions, such as promoters, enhancers, 5′ untranslated regions, intron regions, 3′ untranslated regions, transcribed regions, and other functional sequence regions that may exist as native genes or transgenes in a plant genome. Depending upon the circumstances, the term target sequence can refer to the full-length nucleotide sequence of the gene or gene product targeted for suppression or the nucleotide sequence of a portion of the gene or gene product targeted for suppression. Disclosure of a target sequence necessarily discloses the sequence of its corresponding trigger polynucleotide, as one necessarily defines the other, as is known by one of ordinary skill in the art.


The term “gene expression” refers to the process of converting genetic information encoded in genomic DNA into RNA (e.g., mRNA, rRNA, tRNA, or snRNA) through transcription of the gene via the enzymatic action of an RNA polymerase, and into protein, through translation of mRNA. Gene expression can be regulated at many stages in the process.


As used herein, the phrases “inhibition of gene expression” or “gene suppression” or “silencing a target gene” and similar terms and phrases refer to the absence or observable reduction in the level of protein and/or mRNA product from the target gene. The consequences of inhibition, suppression, or silencing can be confirmed by examination of the outward properties of a cell or organism or by biochemical techniques.


As used herein, the term “sequence identity”, “sequence similarity” or “homology” is used to describe the degree of similarity between two or more nucleotide sequences. The percentage of “sequence identity” between two sequences is determined by comparing two optimally aligned sequences over a comparison window, such that the portion of the sequence in the comparison window may comprise additions or deletions (gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity. A sequence that is identical at every position in comparison to a reference sequence is said to be identical to the reference sequence and vice-versa. An alignment of two or more sequences may be performed using any suitable computer program. For example, a widely used and accepted computer program for performing sequence alignments is CLUSTALW v1.6 (Thompson, et al. Nucl. Acids Res., 22: 4673-4680, 1994).


As used herein “solution” refers to homogeneous mixtures and non-homogeneous mixtures such as suspensions, colloids, micelles, and emulsions.


As used herein, the term “weed” refers to any plant that is not valued where it is growing. Weeds usually exhibit vigorous growth and tend to overgrow or choke out more desirable plants. Weeds include volunteer plants, which grow on their own, rather than being planted by a farmer or gardener. For example, corn plants growing in a soybean field.


Weedy plants include, but are not limited to, important invasive and noxious weeds and herbicide resistant biotypes in crop production, such as: Amaranthus species, e.g., A. albus, A. blitoides, A. hybridus, A. palmeri, A. powellii, A. retroflexus, A. spinosus, A. tuberculatus, and A. viridis; Ambrosia species, e.g., A. trifida, and A. artemisifolia; Lolium species, e.g., L. multiflorum, L. rigidium, and L. perenne; Digitaria species, e.g., D. insularis; Euphorbia species, e.g., E. heterophylla; Kochia species, e.g., K. scoparia; Sorghum species, e.g., S. halepense; Conyza species, e.g., C. bonariensis, C. canadensis, and C. sumatrensis; Chloris species, e.g., C. truncate; Echinochola species, e.g., E. colona and E. crus-galli; Eleusine species, e.g., E. indica; Poa species, e.g., P. annua; Plantago species, e.g., P. lanceolata; Avena species, e.g., A. fatua; Chenopodium species, e.g., C. album; Setaria species, e.g., S. viridis; Abutilon theophrasti; Ipomoea species; Sesbania species; Cassia species; Sida species; Brachiaria species and Solanum species.


Additional weedy plant species found in cultivated areas include Alopecurus myosuroides, Avena sterilis, Avena sterilis ludoviciana, Brachiaria plantaginea, Bromus diandrus, Bromus rigidus, Cynosurus echinatus, Digitaria ciliaris, Digitaria ischaemum, Digitaria sanguinalis, Echinochloa oryzicola, Echinochloa phyllopogon, Eriochloa punctata, Hordeum glaucum, Hordeum leporinum, Ischaemum rugosum, Leptochloa chinensis, Lolium persicum, Phalaris minor, Phalaris paradoxa, Rottboellia exalta, Setaria faberi, Setaria viridis var, robusta-alba schreiber, Setaria viridis var, robusta-purpurea, Snowdenia polystachea, Sorghum sudanese, Alisma plantago-aquatica, Amaranthus lividus, Amaranthus quitensis, Ammania auriculata, Ammania coccinea, Anthemis cotula, Apera spica-venti, Bacopa rotundifolia, Bidens pilosa, Bidens subalternans, Brassica tournefortii, Bromus tectorum, Camelina microcarpa, Chrysanthemum coronarium, Cuscuta campestris, Cyperus difformis, Damasonium minus, Descurainia sophia, Diplotaxis tenuifolia, Echium plantagineum, Elatine triandra var, pedicellate, Euphorbia heterophylla, Fallopia convolvulus, Fimbristylis miliacea, Galeopsis tetrahit, Galium spurium, Helianthus annuus, Iva xanthifolia, Ixophorus unisetus, Ipomoea indica, Ipomoea purpurea, Ipomoea sepiaria, Ipomoea aquatic, Ipomoea triloba, Lactuca serriola, Limnocharis flava, Limnophila erecta, Limnophila sessiliflora, Lindernia dubia, Lindernia dubia var, major, Lindernia micrantha, Lindernia procumbens, Mesembryanthemum crystallinum, Monochoria korsakowii, Monochoria vaginalis, Neslia paniculata, Papaver rhoeas, Parthenium hysterophorus, Pentzia suffruticosa, Phalaris minor, Raphanus raphanistrum, Raphanus sativus, Rapistrum rugosum, Rotala indica var, uliginosa, Sagittaria guyanensis, Sagittaria montevidensis, Sagittaria pygmaea, Salsola iberica, Scirpus juncoides var, ohwianus, Scirpus mucronatus, Setaria lutescens, Sida spinosa, Sinapis arvensis, Sisymbrium orientale, Sisymbrium thellungii, Solanum ptycanthum, Sonchus aspen, Sonchus oleraceus, Sorghum bicolor, Stellaria media, Thlaspi arvense, Xanthium strumarium, Arctotheca calendula, Conyza sumatrensis, Crassocephalum crepidiodes, Cuphea carthagenenis, Epilobium adenocaulon, Erigeron philadelphicus, Landoltia punctata, Lepidium virginicum, Monochoria korsakowii, Solanum americanum, Solanum nigrum, Vulpia bromoides, Youngia japonica, Hydrilla verticillata, Carduus nutans, Carduus pycnocephalus, Centaurea solstitialis, Cirsium arvense, Commelina diffusa, Convolvulus arvensis, Daucus carota, Digitaria ischaemum, Echinochloa crus-pavonis, Fimbristylis miliacea, Galeopsis tetrahit, Galium spurium, Limnophila erecta, Matricaria perforate, Papaver rhoeas, Ranunculus acris, Soliva sessilis, Sphenoclea zeylanica, Stellaria media, Nassella trichotoma, Stipa neesiana, Agrostis stolonifera, Polygonum aviculare, Alopecurus japonicus, Beckmannia syzigachne, Bromus tectorum, Chloris inflate, Echinochloa erecta, Portulaca oleracea, and Senecio vulgaris. The embodiments disclosed herein may be utilized to control any of these species.


As used herein, the term “herbicide” refers to molecules that affect plant growth, development and/or reproductive ability. Herbicides may be polynucleotide or non-polynucleotide. Glyphosate is an example of a non-polynucleotide herbicide that inhibits EPSPS.


“Glyphosate” (N-phosphonomethylglycine) herbicide inhibits the shikimic acid pathway, which leads to the biosynthesis of aromatic compounds including amino acids, plant hormones and vitamins Specifically, glyphosate curbs the conversion of phosphoenolpyruvic acid (PEP) and 3-phosphoshikimic acid to 5-enolpyruvyl-3-phosphoshikimic acid by inhibiting the enzyme 5-enolpyruvylshikimate-3-phosphate synthase (referred to herein as EPSP synthase or EPSPS). The term “glyphosate” should be considered to include any herbicidally effective form of N-phosphonomethylglycine (including any salt thereof) and other forms which result in the production of the glyphosate anion in planta. Glyphosate is commercially available in numerous formulations. Examples of these formulations of glyphosate include, without limitation, those sold by Monsanto Company (St. Louis, Mo.) as ROUNDUP®, ROUNDUP® ULTRA, ROUNDUP® ULTRAMAX, ROUNDUP® CT, ROUNDUP® EXTRA, ROUNDUP® BIACTIVE, ROUNDUP® BIOFORCE, RODEO®, POLARIS®, SPARK® and ACCORD® herbicides, all of which contain glyphosate as its isopropylammonium salt; ROUNDUP® WEATHERMAX, which contains glyphosate as its potassium salt; ROUNDUP® DRY and RIVAL® herbicides, which contain glyphosate as its ammonium salt; ROUNDUP® GEOFORCE, which contains glyphosate as its sodium salt. Other examples include TOUCHDOWN® herbicide (Syngenta, Greensboro, N.C.), which contains glyphosate as its trimethylsulfonium salt. Various other salts of glyphosate are available for example, dimethylamine salt, isopropylamine salt, trimesium salt, potassium salt, monoammonium salt, and diammonium salt. Commerical formulations and application rates thereof are often defined in terms of acid equivalent pounds per acre (a.e. lb/ac).


Bioactive Polynucleotide Triggers


Several embodiments described herein relate to compositions comprising a bioactive trigger polynucleotide targeting an EPSPS gene. Such compositions and methods of their use are useful for modulating the expression of endogenous EPSPS genes or transgenic EPSPS genes (for example, CP4 EPSPS, U.S. Pat. No. RE39,247 and 2mEPSPS, U.S. Pat. No. 6,040,497) in a plant cell. In various embodiments, a targeted EPSPS gene includes coding (protein-coding or translatable) sequence, non-coding (non-translatable) sequence, or both coding and non-coding sequence. A plant treated with a bioactive EPSPS trigger polynucleotide is more sensitive to an EPSPS-inhibitor herbicide relative to a plant that has not been treated with a bioactive EPSPS trigger polynucleotide. It is contemplated that in some embodiments the composition may contain multiple bioactive trigger polynucleotides. Where multiple bioactive trigger polynucleotides are used, the bioactive trigger polynucleotides can target multiple consecutive segments of a target gene, multiple non-consecutive segments of a target gene, multiple alleles of a target gene, or multiple different target genes from one or more species. For example, in some embodiments the composition may comprise two or more bioactive EPSPS trigger polynucleotides that are capable of binding to different EPSPS target sequences. In some embodiments, the different EPSPS target sequences may be from different plant species. In some embodiments, the different EPSPS target sequences may be from different regions of an EPSPS gene. In some embodiments, the EPSPS target sequences may be selected from the group consisting of SEQ ID NOs: 9-66.


Several embodiments described herein relate to compositions comprising one or more bioactive trigger polynucleotides targeting an EPSPS gene and one or more bioactive trigger polynucleotides that modulate the expression of a gene other than EPSPS. In some embodiments, compositions can include one or more bioactive trigger polynucleotides targeting essential genes. Essential genes are genes in a plant that provide key enzymes or other proteins that are essential to the growth, survival, development or reproduction of the plant (Meinke, et al., Trends Plant Sci. 2008:13(9):483-91). Examples of essential genes include, but are not limited to, genes encoding biosynthetic enzymes, metabolizing enzymes, receptors, signal transduction proteins, structural proteins, transcription factors, transport proteins and regulatory RNAs, such as, microRNAs. In some embodiments, the suppression of an essential gene enhances the effect of a herbicide that affects the function of a gene product different than the suppressed essential gene.


Bioactive trigger polynucleotides used in the various embodiments may comprise single-stranded RNA, double-stranded RNA, single-stranded DNA, double-stranded DNA, RNA/DNA hybrids, chemically modified polynucleotides or any mixture thereof. In some embodiments, the bioactive trigger polynucleotide may comprise a combination of ribonucleotides and deoxyribonucleotides, for example, synthetic polynucleotides consisting mainly of ribonucleotides but with one or more terminal deoxyribonucleotides or synthetic polynucleotides consisting mainly of deoxyribonucleotides but with one or more terminal dideoxyribonucleotides. In some embodiments, the bioactive trigger polynucleotide includes non-canonical nucleotides such as inosine, thiouridine, or pseudouridine. In some embodiments, the bioactive trigger polynucleotide includes chemically modified nucleotides. For example, the naturally occurring phosphodiester backbone of a bioactive trigger polynucleotide can be partially or completely modified with phosphorothioate, phosphorodithioate, or methylphosphonate internucleotide linkage modifications, modified nucleoside bases or modified sugars can be used in the synthesis of bioactive trigger polynucleotides, and trigger polynucleotides can be labeled with a fluorescent moiety (for example, fluorescein or rhodamine) or other label (for example, biotin). Examples of chemically modified oligonucleotides or polynucleotides are well known in the art; see, for example, US Patent Publication 20110171287, US Patent Publication 20110171176, and US Patent Publication 20110152353, US Patent Publication, 20110152346, US Patent Publication 20110160082, herein incorporated in its entirety by reference hereto.


Several embodiments relate to bioactive trigger polynucleotides that modulate an endogenous EPSPS gene in a plant. In some embodiments, the bioactive EPSPS trigger polynucleotides comprise a nucleotide sequence that is essentially identical or essentially complementary to at least 10 contiguous nucleotides of an endogenous EPSPS gene of a plant, or an RNA transcribed therefrom. In some embodiments, the bioactive EPSPS trigger polynucleotides comprise a nucleotide sequence that is essentially identical or essentially complementary to 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70 or more contiguous nucleotides of an endogenous EPSPS gene of a plant, or an RNA transcribed therefrom. In some embodiments, the endogenous EPSPS gene is an Abutilon theophrasti, Amaranthus graecizans, Amaranthus hybrid, Amaranthus lividus, Amaranthus palmeri, Amaranthus rudis, Amaranthus thunbergii, Amaranthus viridis, Ambrosia trifida, Chenopodium album, Convolvulus arvensis, Conyza Canadensis, Digitaria sanguinalis, Echinochloa colona, Echinochloa crus-galli, Euphorbia heterophylla, Ipomoea hederacea, Lolium multiflorum, Senna obtusifolia, Sorghum halepense, or Xanthium strumarium gene. In some embodiments, the sequence of the endogenous EPSPS gene is selected from SEQ ID NOs: 1 and 2.


By “essentially identical” or “essentially complementary” is meant that the bioactive trigger polynucleotide (or at least one strand of a double-stranded polynucleotide or portion thereof, or a portion of a single strand polynucleotide) hybridizes under physiological conditions to the endogenous gene, an RNA transcribed therefrom, or a fragment thereof, to effect regulation or suppression of the endogenous gene. For example, in some embodiments, a bioactive trigger polynucleotide has 100 percent sequence identity or at least about 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence identity when compared to a sequence of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60 or more contiguous nucleotides in the target gene or RNA transcribed from the target gene. In some embodiments, a bioactive trigger polynucleotide has 100 percent sequence complementarity or at least about 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence complementarity when compared to a sequence of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60 or more contiguous nucleotides in the target gene or RNA transcribed from the target gene. In some embodiments, a bioactive trigger polynucleotide has 100 percent sequence identity with or complementarity to one allele or one family member of a given target gene (coding or non-coding sequence of a gene). In some embodiments, a bioactive trigger polynucleotide has at least about 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence identity with or complementarity to multiple alleles or family members of a given target gene. In some embodiments, a bioactive trigger polynucleotide has 100 percent sequence identity with or complementarity to multiple alleles or family members of a given target gene.


Embodiments include bioactive trigger polynucleotides having a length of 40-60 nucleotides (40-mers, 41-mers, 42-mers, 43-mers, 44-mers, 45-mers, 46-mers, 47-mers, 48-mers, 49-mers, 50-mers, 51-mers, 52-mers, 53-mers, 54-mers, 55-mers, 56-mers, 57-mers, 58-mers, 59-mers, or 60-mers). Several embodiments relate to a bioactive EPSPS trigger polynucleotide that comprises a nucleotide sequence that is substantially homologous or substantially complementary to one or more of SEQ ID NOs: 9-66 and suppresses, represses or otherwise delays the expression of a targeted EPSPS gene in one or more plant species. In some embodiments, the bioactive EPSPS trigger polynucleotide comprises a nucleotide sequence that is identical or complementary to one or more of SEQ ID NOs: 9-66. In some embodiments, the bioactive EPSPS trigger polynucleotide comprises a sequence selected from SEQ ID NOs: 3-6.


Bioactive trigger polynucleotides can be single- or double-stranded RNA or single- or double-stranded DNA or double-stranded DNA/RNA hybrids or modified analogues thereof. In some embodiments, the trigger polynucleotides are selected from the group consisting of (a) a single-stranded RNA molecule (ssRNA), (b) a ssRNA molecule that self-hybridizes to form a double-stranded RNA molecule, (c) a double-stranded RNA molecule (dsRNA), (d) a single-stranded DNA molecule (ssDNA), (e) a ssDNA molecule that self-hybridizes to form a double-stranded DNA molecule, and (f) a single-stranded DNA molecule including a modified Pol III gene that is transcribed to an RNA molecule, (g) a double-stranded DNA molecule (dsDNA), (h) a double-stranded DNA molecule including a modified Pol III gene that is transcribed to an RNA molecule, (i) a double-stranded, hybridized RNA/DNA molecule, or combinations thereof. In some embodiments these polynucleotides include chemically modified nucleotides or non-canonical nucleotides.


In some embodiments, double-stranded trigger polynucleotides may be blunt-ended or may comprise a 3′ or 5′ overhang of one, two, three, four, five, or more nucleotides on one or both sides of the double-stranded region. In some embodiments, the overhang has identity or complementarity to the target gene. In some embodiments, the overhang does not have identity or complementarity to the target gene. In some embodiments, the overhang may comprise one, two, three, four, or more nucleotides such as 2′-deoxy (21H) nucleotides. In some embodiments, the overhang may comprise deoxythymidine (dT) nucleotides.


Double-stranded bioactive trigger polynucleotides may be formed by intramolecular hybridization or intermolecular hybridization. In some embodiments, the bioactive trigger polynucleotide may comprise single-stranded DNA or single-stranded RNA that self-hybridizes to form a hairpin structure having an at least partially double-stranded structure including at least one segment that will hybridize to an RNA transcribed from the gene targeted for suppression. In some embodiments, the bioactive trigger polynucleotide may be contained in a longer polynucleotide sequence, for example a in a pri-miRNA. Other configurations of the bioactive trigger polynucleotides are known in the field and are contemplated herein.


Methods of making bioactive trigger polynucleotides are well known in the art. For example, bioactive trigger polynucleotides can be can be expressed in host cells from a vector, chemically synthesized using known methods, or they can be transcribed in vitro by conventional enzymatic synthetic methods using, for example, the bacteriophage T7, T3 or SP6 RNA polymerases. Commercial preparation of oligonucleotides often provides two deoxyribonucleotides on the 3′ end of the sense strand. Polynucleotide molecules can be synthesized from commercially available kits, for example, kits from Applied Biosystems/Ambion (Austin, Tex.) have DNA ligated on the 5′ end in a microbial expression cassette that includes a bacterial T7 polymerase promoter that makes RNA strands that can be assembled into a dsRNA and kits provided by various manufacturers that include T7 RiboMax Express (Promega, Madison, Wis.), AmpliScribe T7-Flash (Epicentre, Madison, Wis.), and TranscriptAid T7 High Yield (Fermentas, Glen Burnie, Md.). dsRNA molecules can be produced from microbial expression cassettes in bacterial cells (Ongvarrasopone et al. ScienceAsia 33:35-39; Yin, Appl. Microbiol. Biotechnol 84:323-333, 2009; Liu et al., BMC Biotechnology 10:85, 2010) that have regulated or deficient RNase III enzyme activity or the use of various viral vectors to produce sufficient quantities of dsRNA. EPSPS gene fragments are inserted into the microbial expression cassettes in a position in which the fragments are expressed to produce ssRNA or dsRNA useful in the methods described herein to regulate expression on a target EPSPS gene. Several embodiments relate to expression constructs encoding bioactive trigger polynucleotides as described herein.


Following synthesis, the trigger polynucleotides may optionally be purified. For example, polynucleotides can be purified from a mixture by extraction with a solvent or resin, precipitation, electrophoresis, chromatography, or a combination thereof. Alternatively, trigger polynucleotides may be used with no, or a minimum of, purification to avoid losses due to sample processing. The trigger polynucleotides may be dried for storage or dissolved in an aqueous solution. The solution may contain buffers or salts to promote annealing, and/or stabilization of the duplex strands.


Compositions and Methods for Weed Control


Bioactive trigger polynucleotides may be provided to a plant at any dose effective to modulate the expression of the target gene or produce a knock-down phenotype. While there is no upper limit on the concentrations and dosages of bioactive trigger polynucleotides used in the compositions and methods disclosed herein, several embodiments relate to a minimum effective concentration or dosage of bioactive trigger polynucleotide. The concentration of bioactive trigger polynucleotide provided to a plant can be adjusted in consideration of the volume of spray or treatment applied to plant leaves or other plant part surfaces, such as flower petals, stems, tubers, fruit, anthers, pollen, or seed. In one embodiment, a treatment for herbaceous plants comprises providing bioactive trigger polynucleotides at about 1 nanomole (nmol) per plant. In some embodiments, a treatment for herbaceous plants comprises providing from about 0.05 to 1 nmol of bioactive trigger polynucleotide per plant. Several embodiments for herbaceous plants include ranges of about 0.05 to about 100 nmol, or about 0.1 to about 20 nmol, or about 1 nmol to about 10 nmol of bioactive trigger polynucleotides per plant. In some embodiments, a treatment for herbaceous plants comprises providing 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, or 20 nmol of bioactive trigger polynucleotides per plant.


To illustrate embodiments, the factor 1×, when applied to oligonucleotide molecules is arbitrarily used to denote a treatment of 0.8 nmol of bioactive trigger polynucleotide molecule per plant; 10×, 8 nmol of bioactive trigger polynucleotide molecule per plant; and 100×, 80 nmol of bioactive trigger polynucleotide molecule per plant. The amount of bioactive trigger polynucleotide provided can vary based upon the size of the treated plant. For example, for very large plants, trees, or vines a correspondingly larger amount of bioactive trigger polynucleotide may be used; while for smaller plants, a correspondingly smaller amount of bioactive trigger polynucleotide may be used. In some embodiments where long dsRNA molecules, which are processed into multiple oligonucleotides, are used, the effective concentration or dosage of bioactive trigger polynucleotide may be lower.


In several embodiments, bioactive trigger polynucleotides are incorporated into a plant cell following topical application of the bioactive trigger polynucleotides to a surface of the plant, for example, by spraying the plant with the bioactive trigger polynucleotides. In some embodiments, bioactive trigger polynucleotides are applied without wounding plant tissue and cells, such as, by mechanical-type wounding or particle bombardment. In some embodiments, bioactive trigger polynucleotides are incorporated into a plant cell without infection with viral vector.


Several embodiments relate to compositions comprising an effective amount of a bioactive trigger polynucleotide, alone or in combination with other components, for example, one or more non-polynucleotide herbicide molecules, and/or one or more transfer agents. In some embodiments, one or more bioactive trigger polynucleotides are provided in the same composition as a transfer agent. In other embodiments, the bioactive trigger polynucleotides and the transfer agent are separately applied. In some embodiments, one or more bioactive trigger polynucleotides and one or more non-polynucleotide herbicide molecules are provided in the same composition. In other embodiments, one or more bioactive trigger polynucleotides and one or more non-polynucleotide herbicide molecules are provided in separately applied compositions. In some embodiments, the transfer agent and non-polynucleotide herbicide are provided in the same composition. Several embodiments relate to a composition comprising one or more bioactive trigger polynucleotides, one or more transfer agents and one or more non-polynucleotide herbicides. In some embodiments, one or more of the bioactive trigger polynucleotide, the non-polynucleotide herbicide and the transfer agent is provided in a liquid composition.


Non-polynucleotide herbicides may be applied concomitantly with a bioactive trigger polynucleotide or the bioactive trigger polynucleotide and the non-polynucleotide herbicide may be applied at different times. In some embodiments, a composition comprising a bioactive trigger polynucleotide is provided to a plant prior to providing a composition comprising a non-polynucleotide herbicide. In some embodiments, a composition comprising a bioactive trigger polynucleotide is provided to a plant subsequent to providing a non-polynucleotide herbicide. In some embodiments, bioactive trigger polynucleotides may be applied concomitantly with a transfer agent. In other embodiments, the bioactive trigger polynucleotides and the transfer agent are applied at different times. In some embodiments, a composition comprising a bioactive trigger polynucleotide is provided to a plant prior to providing a composition comprising a transfer agent. In some embodiments, a composition comprising a bioactive trigger polynucleotide is provided to a plant subsequent to providing a transfer agent.


Several embodiments relate to compositions and methods that provide multi-species weed control. Numerous non-polynucleotide herbicides are known and can be added, either alone or in combination with one or more non-polynucleotide herbicides having similar or different modes of action (herein referred to as co-herbicides), to a composition comprising a bioactive EPSPS trigger polynucleotide or can be used in conjunction with a bioactive EPSPS trigger polynucleotide to control weeds. For example, members of the herbicide families include, but are not limited to: amide herbicides, aromatic acid herbicides, arsenical herbicides, benzothiazole herbicides, benzoylcyclohexanedione herbicides, benzofuranyl alkylsulfonate herbicides, carbamate herbicides, cyclohexene oxime herbicides, cyclopropylisoxazole herbicides, dicarboximide herbicides, dinitroaniline herbicides, dinitrophenol herbicides, diphenyl ether herbicides, dithiocarbamate herbicides, halogenated aliphatic herbicides, imidazolinone herbicides, inorganic herbicides, nitrile herbicides, organophosphorus herbicides, oxadiazolone herbicides, oxazole herbicides, phenoxy herbicides, phenylenediamine herbicides, pyrazole herbicides, pyridazine herbicides, pyridazinone herbicides, pyridine herbicides, pyrimidinediamine herbicides, pyrimidinyloxybenzylamine herbicides, quaternary ammonium herbicides, thiocarbamate herbicides, thiocarbonate herbicides, thiourea herbicides, triazine herbicides, triazinone herbicides, triazole herbicides, triazolone herbicides, triazolopyrimidine herbicides, uracil herbicides, and urea herbicides. Representative herbicides of the families include but are not limited to acetochlor, acifluorfen, acifluorfen-sodium, aclonifen, acrolein, alachlor, alloxydim, allyl alcohol, ametryn, amicarbazone, amidosulfuron, aminopyralid, amitrole, ammonium sulfamate, anilofos, asulam, atraton, atrazine, azimsulfuron, BCPC, beflubutamid, benazolin, benfluralin, benfuresate, bensulfuron, bensulfuron-methyl, bensulide, bentazone, benzfendizone, benzobicyclon, benzofenap, bifenox, bilanafos, bispyribac, bispyribac-sodium, borax, bromacil, bromobutide, bromoxynil, butachlor, butafenacil, butamifos, butralin, butroxydim, butylate, cacodylic acid, calcium chlorate, cafenstrole, carbetamide, carfentrazone, carfentrazone-ethyl, CDEA, CEPC, chlorflurenol, chlorflurenol-methyl, chloridazon, chlorimuron, chlorimuron-ethyl, chloroacetic acid, chlorotoluron, chlorpropham, chlorsulfuron, chlorthal, chlorthal-dimethyl, cinidon-ethyl, cinmethylin, cinosulfuron, cisanilide, clethodim, clodinafop, clodinafop-propargyl, clomazone, clomeprop, clopyralid, cloransulam, cloransulam-methyl, CMA, 4-CPB, CPMF, 4-CPP, CPPC, cresol, cumyluron, cyanamide, cyanazine, cycloate, cyclosulfamuron, cycloxydim, cyhalofop, cyhalofop-butyl, 2,4-D, 3,4-DA, daimuron, dalapon, dazomet, 2,4-DB, 3,4-DB, 2,4-DEB, desmedipham, dicamba, dichlobenil, ortho-dichlorobenzene, para-dichlorobenzene, dichlorprop, dichlorprop-P, diclofop, diclofop-methyl, diclosulam, difenzoquat, difenzoquat metilsulfate, diflufenican, diflufenzopyr, dimefuron, dimepiperate, dimethachlor, dimethametryn, dimethenamid, dimethenamid-P, dimethipin, dimethylarsinic acid, dinitramine, dinoterb, diphenamid, diquat, diquat dibromide, dithiopyr, diuron, DNOC, 3,4-DP, DSMA, EBEP, endothal, EPTC, esprocarb, ethalfluralin, ethametsulfuron, ethametsulfuron-methyl, ethofumesate, ethoxyfen, ethoxysulfuron, etobenzanid, fenoxaprop-P, fenoxaprop-P-ethyl, fentrazamide, ferrous sulfate, flamprop-M, flazasulfuron, florasulam, fluazifop, fluazifop-butyl, fluazifop-P, fluazifop-P-butyl, flucarbazone, flucarbazone-sodium, flucetosulfuron, fluchloralin, flufenacet, flufenpyr, flufenpyr-ethyl, flumetsulam, flumiclorac, flumiclorac-pentyl, flumioxazin, fluometuron, fluoroglycofen, fluoroglycofen-ethyl, flupropanate, flupyrsulfuron, flupyrsulfuron-methyl-sodium, flurenol, fluridone, fluorochloridone, fluoroxypyr, flurtamone, fluthiacet, fluthiacet-methyl, fomesafen, foramsulfuron, fosamine, glufosinate, glufosinate-ammonium, glyphosate, halosulfuron, halosulfuron-methyl, haloxyfop, haloxyfop-P, HC-252, hexazinone, imazamethabenz, imazamethabenz-methyl, imazamox, imazapic, imazapyr, imazaquin, imazethapyr, imazosulfuron, indanofan, iodomethane, iodosulfuron, iodosulfuron-methyl-sodium, ioxynil, isoproturon, isouron, isoxaben, isoxachlortole, isoxaflutole, karbutilate, lactofen, lenacil, linuron, MAA, MAMA, MCPA, MCPA-thioethyl, MCPB, mecoprop, mecoprop-P, mefenacet, mefluidide, mesosulfuron, mesosulfuron-methyl, mesotrione, metam, metamifop, metamitron, metazachlor, methabenzthiazuron, methylarsonic acid, methyldymron, methyl isothiocyanate, metobenzuron, metolachlor, S-metolachlor, metosulam, metoxuron, metribuzin, metsulfuron, metsulfuron-methyl, MK-66, molinate, monolinuron, MSMA, naproanilide, napropamide, naptalam, neburon, nicosulfuron, nonanoic acid, norflurazon, oleic acid (fatty acids), orbencarb, orthosulfamuron, oryzalin, oxadiargyl, oxadiazon, oxasulfuron, oxaziclomefone, oxyfluorfen, paraquat, paraquat dichloride, pebulate, pendimethalin, penoxsulam, pentachlorophenol, pentanochlor, pentoxazone, pethoxamid, petrolium oils, phenmedipham, phenmedipham-ethyl, picloram, picolinafen, pinoxaden, piperophos, potassium arsenite, potassium azide, pretilachlor, primisulfuron, primisulfuron-methyl, prodiamine, profluazol, profoxydim, prometon, prometryn, propachlor, propanil, propaquizafop, propazine, propham, propisochlor, propoxycarbazone, propoxycarbazone-sodium, propyzamide, prosulfocarb, prosulfuron, pyraclonil, pyraflufen, pyraflufen-ethyl, pyrazolynate, pyrazosulfuron, pyrazosulfuron-ethyl, pyrazoxyfen, pyribenzoxim, pyributicarb, pyridafol, pyridate, pyriftalid, pyriminobac, pyriminobac-methyl, pyrimisulfan, pyrithiobac, pyrithiobac-sodium, quinclorac, quinmerac, quinoclamine, quizalofop, quizalofop-P, rimsulfuron, sethoxydim, siduron, simazine, simetryn, SMA, sodium arsenite, sodium azide, sodium chlorate, sulcotrione, sulfentrazone, sulfometuron, sulfometuron-methyl, sulfosate, sulfosulfuron, sulfuric acid, tar oils, 2,3,6-TBA, TCA, TCA-sodium, tebuthiuron, tepraloxydim, terbacil, terbumeton, terbuthylazine, terbutryn, thenylchlor, thiazopyr, thifensulfuron, thifensulfuron-methyl, thiobencarb, tiocarbazil, topramezone, tralkoxydim, tri-allate, triasulfuron, triaziflam, tribenuron, tribenuron-methyl, tricamba, triclopyr, trietazine, trifloxysulfuron, trifloxysulfuron-sodium, trifluralin, triflusulfuron, triflusulfuron-methyl, trihydroxytriazine, tritosulfuron, [3-[2-chloro-4-fluoro-5-(-methyl-6-trifluoromethyl-2,4-dioxo-,2,3,4-t-etrahydropyrimidin-3-yl)phenoxy]-2-pyridyloxy]acetic acid ethyl ester (CAS RN 353292-3-6), 4-[(4,5-dihydro-3-methoxy-4-methyl-5-oxo)-H-,2,4-triazol-1-ylcarbonyl-sulfamoyl]-5-methylthiophene-3-carboxylic acid (BAY636), BAY747 (CAS RN 33504-84-2), topramezone (CAS RN 2063-68-8), 4-hydroxy-3-[[2-[(2-methoxyethoxy)methyl]-6-(trifluoro-methyl)-3-pyridi-nyl]carbonyl]-bicyclo[3.2.]oct-3-en-2-one (CAS RN 35200-68-5), and 4-hydroxy-3-[[2-(3-methoxypropyl)-6-(difluoromethyl)-3-pyridinyl]carbon-yl]-bicyclo[3.2.]oct-3-en-2-one. Additionally, including herbicidal compounds of unspecified modes of action as described in CN101279950A, CN101279951A, DE10000600A1, DE10116399A1, DE102004054666A1, DE102005014638A1, DE102005014906A1, DE102007012168A1, DE102010042866A1, DE10204951A1, DE10234875A1, DE10234876A1, DE10256353A1, DE10256354A1, DE10256367A1, EP1157991A2, EP1238586A1, EP2147919A1, EP2160098A2, JP03968012B2, JP2001253874A, JP2002080454A, JP2002138075A, JP2002145707A, JP2002220389A, JP2003064059A, JP2003096059A, JP2004051628A, JP2004107228A, JP2005008583A, JP2005239675A, JP2005314407A, JP2006232824A, JP2006282552A, JP2007153847A, JP2007161701A, JP2007182404A, JP2008074840A, JP2008074841A, JP2008133207A, JP2008133218A, JP2008169121A, JP2009067739A, JP2009114128A, JP2009126792A, JP2009137851A, US20060111241A1, US20090036311A1, US20090054240A1, US20090215628A1, US20100099561A1, US20100152443A1, US20110105329A1, US20110201501A1, WO2001055066A2, WO2001056975A1, WO2001056979A1, WO2001090071A2, WO2001090080A1, WO2002002540A1, WO2002028182A1, WO2002040473A1, WO2002044173A2, WO2003000679A2, WO2003006422A1, WO2003013247A1, WO2003016308A1, WO2003020704A1, WO2003022051A1, WO2003022831A1, WO2003022843A1, WO2003029243A2, WO2003037085A1, WO2003037878A1, WO2003045878A2, WO2003050087A2, WO2003051823A1, WO2003051824A1, WO2003051846A2, WO2003076409A1, WO2003087067A1, WO2003090539A1, WO2003091217A1, WO2003093269A2, WO2003104206A2, WO2004002947A1, WO2004002981A2, WO2004011429A1, WO2004029060A1, WO2004035545A2, WO2004035563A1, WO2004035564A1, WO2004037787A1, WO2004067518A1, WO2004067527A1, WO2004077950A1, WO2005000824A1, WO2005007627A1, WO2005040152A1, WO2005047233A1, WO2005047281A1, WO2005061443A2, WO2005061464A1, WO2005068434A1, WO2005070889A1, WO2005089551A1, WO2005095335A1, WO2006006569A1, WO2006024820A1, WO2006029828A1, WO2006029829A1, WO2006037945A1, WO2006050803A1, WO2006090792A1, WO2006123088A2, WO2006125687A1, WO2006125688A1, WO2007003294A1, WO2007026834A1, WO2007071900A1, WO2007077201A1, WO2007077247A1, WO2007096576A1, WO2007119434A1, WO2007134984A1, WO2008009908A1, WO2008029084A1, WO2008059948A1, WO2008071918A1, WO2008074991A1, WO2008084073A1, WO2008100426A2, WO2008102908A1, WO2008152072A2, WO2008152073A2, WO2009000757A1, WO2009005297A2, WO2009035150A2, WO2009063180A1, WO2009068170A2, WO2009068171A2, WO2009086041A1, WO2009090401A2, WO2009090402A2, WO2009115788A1, WO2009116558A1, WO2009152995A1, WO2009158258A1, WO2010012649A1, WO2010012649A1, WO2010026989A1, WO2010034153A1, WO2010049270A1, WO2010049369A1, WO2010049405A1, WO2010049414A1, WO2010063422A1, WO2010069802A1, WO2010078906A2, WO2010078912A1, WO2010104217A1, WO2010108611A1, WO2010112826A3, WO2010116122A3, WO2010119906A1, WO2010130970A1, WO2011003776A2, WO2011035874A1, WO2011065451A1, all of which are incorporated herein by reference. In some embodiments, two or more non-polynucleotide herbicides with similar modes of action are used in conjunction with a bioactive EPSPS trigger polynucleotide to control weeds. In several embodiments, compositions and methods that utilize alternative modes of action are used for difficult to control weed species. In some embodiments, two or more non-polynucleotide herbicides with different modes of action are used in conjunction with a bioactive EPSPS trigger polynucleotide to control weeds. In some embodiments, one or more non-polynucleotide herbicides with similar or different modes of action are used in conjunction with a bioactive EPSPS trigger polynucleotide and a bioactive trigger polynucleotide targeting a herbicide target gene other than EPSPS to control weeds. In some embodiments, a bioactive EPSPS trigger polynucleotide is used in conjunction with an EPSPS-inhibitor herbicide and an herbicide having a different mode of action. In some embodiments, a bioactive EPSPS trigger polynucleotide is used in conjunction with an EPSPS-inhibitor herbicide, a herbicide having a different mode of action and a bioactive trigger polynucleotide targeting a herbicide target gene other than EPSPS.


Several embodiments relate to compositions and methods that enhance the activity of non-polynucleotide herbicides. In some embodiments, the rates of use of the non-polynucleotide herbicides can be reduced in compositions comprising bioactive EPSPS trigger polynucleotides. For example, reductions in use rate of 10-25 percent, 26-50 percent, 51-75 percent or more can be achieved. In some embodiments, a bioactive EPSPS trigger polynucleotide can reduce the amount of an EPSPS-inhibitor herbicide used to effectively kill weeds by at least 10, 15, 20, 25, 30, 35, 40, 50, 55, 60, 65, 70, 75, or 80 percent.


In some embodiments, a bioactive EPSPS trigger polynucleotide is utilized in conjunction with one or more auxin-like herbicides to control weeds. Auxin-like herbicides include benzoic acid herbicide, phenoxy carboxylic acid herbicide, pyridine carboxylic acid herbicide, quinoline carboxylic acid herbicide, pyrimidine carboxylic acid herbicide, and benazolin-ethyl herbicide. Auxin-like herbicides also include phenoxy carboxylic acid compounds, pyridine carboxylic acid compounds, quinoline carboxylic acid compounds, and benazolin-ethyl compounds. Examples of phenoxy carboxylic acid compounds include, but are not limited to 2,4-dichlorophenoxyacetic acid, (4-chloro-2-methylphenoxy) acetic acid, diclorprop (2,4-DP), mecoprop (MCPP), and clomeprop. Examples of pyridine herbicides include, but are not limited to clopryalid, picloram, fluroxypyr, aminocyclopyrachlor and triclopyr. These auxin-like herbicides are useful in a tank mix, concomitantly, or pre or post treatment with the compositions. Auxin-like herbicides include commercially available formulations, for example, including but not limited to, 2,4-D, 2,4-DB (BUTYRAC® 200, Albaugh, LLC, Ankeny, Iowa; Bakker), MCPA (RHONOX®, RHOMENE®, Nufarm US, Morrisville, N.C.), mecoprop, dichlorprop, 2,4,5-T, triclopyr (GARLON®, Dow AgroSciences, Indianapolis, Ind.), chloramben, dicamba (BANVEL®, BASF Corporation, Ludwigshafen, Germany; CLARITY®, BASF Corporation, Ludwigshafen, Germany; ORACLE®, Gharda Chemicals Limited, Newtown, Pa.; STERLING BLUE®, Winfield Solutions, LLC, St. Paul, Minn.), 2,3,6-TBA, tricamba, clopyralid (STINGER®, Dow AgroSciences, Indianapolis, Ind.), picloram (TORDON®, Dow AgroSciences, Indianapolis, Ind.), quinmerac, quinclorac, benazolin, fenac, IAA, NAA, orthonil and fluroxypyr (VISTA®, STARANE®, Dow AgroSciences, Indianapolis, Ind.), aminopyralid (MILESTONE®, Dow AgroSciences, Indianapolis, Ind.) and aminocyclopyrachlor (Dupont, Wilmington, Del.).


In some embodiments, a bioactive EPSPS trigger polynucleotide is utilized in conjunction with one or more benzoic acid herbicides to control weeds. Benzoic acid herbicides are effective herbicides for both pre-emergence and post-emergence weed management. The benzoic acid herbicide group includes dicamba (3,6-dichloro-o-anisic acid), chloramben (3-amino-2,5-dichlorobenzoic acid), and TBA (2,3,6-trichlorobenzoic acid). Dicamba is one of the many auxin-like herbicides that is a low-cost, environmentally friendly herbicide that has been used as a pre-emergence and post-emergence herbicide to effectively control annual and perennial broadleaf weeds and several grassy weeds in corn, sorghum, small grains, pasture, hay, rangeland, sugarcane, asparagus, turf, and grass seed crops (Crop Protection Chemicals Reference, pp. 1803-1821, Chemical & Pharmaceutical Press, Inc., New York, N.Y., 11th ed., 1995). Dicamba refers to 3,6-dichloro-o-anisic acid or 3,6-dichloro-2-methoxy benzoic acid and its acids and salts. Its salts include isopropylamine, diglycoamine, dimethylamine, potassium and sodium. Examples of commercial formulations of dicamba include BANVEL™ (as DMA salt, BASF, Research Triangle Park, N.C.), CLARITY® (DGA salt, BASF Corporation, Ludwigshafen, Germany), VEL58CS11™ (BASF) and VANQUISH™ (DGA salt, BASF Corporation, Ludwigshafen, Germany). Dicamba is a useful herbicide as a tank mix, concomitantly, or pre or post treatment with the compositions.


Several embodiments relate to a method comprising providing a bioactive trigger polynucleotide to a herbicide-tolerant plant. In some embodiments, the herbicide-tolerant plant comprises a transgene that confers herbicide tolerance. Herbicides for which transgenes for plant tolerance have been demonstrated include, but are not limited to: auxin-like herbicides, glyphosate, glufosinate, sulfonylureas, imidazolinones, bromoxynil, delapon, dicamba, cyclohezanedione, protoporphyrionogen oxidase inhibitors, and 4-hydroxyphenyl-pyruvate-dioxygenase inhibitors. Transgenes and their polynucleotide molecules that encode proteins involved in herbicide tolerance are known in the art. For example, transgenes and their polynucleotide molecules that encode proteins involved in herbicide tolerance include, but are not limited to: 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), for example, as more fully described in U.S. Pat. Nos. 7,807,791, 6,248,876 B1, 5,627,061, 5,804,425, 5,633,435, 5,145,783, 4,971,908, 5,312,910, 5,188,642, 4,940,835, 5,866,775, 6,225,114 B1, 6,130,366, 5,310,667, 4,535,060, 4,769,061, 5,633,448, 5,510,471, U.S. Pat. No. Re. 36,449; U.S. Pat. No. RE 37,287 E; and U.S. Pat. No. 5,491,288; tolerance to sulfonylurea and/or imidazolinone, for example, as described more fully in U.S. Pat. Nos. 5,605,011, 5,013,659, 5,141,870, 5,767,361, 5,731,180, 5,304,732, 4,761,373, 5,331,107, 5,928,937, 5,378,824, and International Publication WO96/33270; tolerance to hydroxyphenylpyruvatedioxygenases inhibiting herbicides in plants, for example, as described more fully in U.S. Pat. No. 6,245,968 B1, 6,268,549, 6,069,115, 7,312,379, 7,935,869, 7,304,209; aryloxyalkanoate dioxygenase polynucleotides, which confer tolerance to 2,4-D and other phenoxy auxin herbicides as well as to aryloxyphenoxypropionate herbicides as described, for example, in U.S. Pat. No. 7,838,733 and International Publication WO2005/107437; and dicamba-tolerance polynucleotides as described, for example, in Herman et al. (2005) J. Biol. Chem. 280: 24759-24767. Other examples of herbicide-tolerance traits include those conferred by polynucleotides encoding an exogenous phosphinothricin acetyltransferase, such as described in U.S. Pat. Nos. 5,969,213; 5,489,520; 5,550,318; 5,874,265; 5,919,675; 5,561,236; 5,648,477; 5,646,024; 6,177,616; and 5,879,903. Plants containing an exogenous phosphinothricin acetyltransferase can exhibit improved tolerance to glufosinate herbicides, which inhibit the enzyme glutamine synthase. Additionally, herbicide-tolerance polynucleotides include those conferred by polynucleotides conferring altered protoporphyrinogen oxidase (protox) activity, as described in U.S. Pat. No. 6,288,306 B1; 6,282,837 B1; and 5,767,373; and International Publication WO2001/12825. Plants containing such polynucleotides can exhibit improved tolerance to any of a variety of herbicides which target the protox enzyme (also referred to as protox inhibitors). Polynucleotides encoding a glyphosate oxidoreductase and a glyphosate-N-acetyl transferase (GOX described in U.S. Pat. No. 5,463,175 and GAT described in U.S. Patent publication 20030083480, dicamba monooxygenase U.S. Pat. Nos. 7,022,896 and 7,884,262, all of which are incorporated herein by reference); a polynucleotide molecule encoding bromoxynil nitrilase (Bxn described in U.S. Pat. No. 4,810,648 for Bromoxynil tolerance, which is incorporated herein by reference); a polynucleotide molecule encoding phytoene desaturase (crtl) described in Misawa et al, (1993) Plant J. 4:833-840 and Misawa et al, (1994) Plant J. 6:481-489 for norflurazon tolerance; a polynucleotide molecule encoding acetohydroxyacid synthase (AHAS, aka ALS) described in Sathasiivan et al. (1990) Nucl. Acids Res. 18:2188-2193 for tolerance to sulfonylurea herbicides; and the bar gene described in DeBlock, et al. (1987) EMBO J. 6:2513-2519 for glufosinate and bialaphos tolerance. The transgenic coding regions and regulatory elements of the herbicide tolerance genes are targets in which bioactive polynucleotide triggers and herbicides can be included in the composition and combinations thereof to provide for enhanced methods of weed control.


Transgenic crops with one or more herbicide tolerances may need specialized methods of management to control weeds. Several embodiments enable the targeting of a transgene for herbicide tolerance to permit the treated plants to become sensitive to the herbicide. For example, an EPSPS DNA contained in a transgenic crop event can be a target for bioactive trigger polynucleotides in order to render the transgenic crop sensitive to application of the corresponding glyphosate containing herbicide. Such transgenic events are known in the art and include but are not limited to DAS-44406-6, MON883302, MON87427, FG72, HCEM485, H7-1, ASR368, J101, J163, DP-098140, GHB614, 356043, MON89788, MON88913, RT200, NK603, GTSB77, GA21, MON1445, and 40-3-2 and US patent publications: 20110126310, 20090137395, herein incorporated in their entirety by reference hereto.


Several embodiments relate to the use of a bioactive EPSPS trigger polynucleotide in conjunction with one or more transfer agents. As used herein, a “transfer agent” is an agent that, when combined with a polynucleotide in a composition that is topically applied to a target plant surface, enables the polynucleotide to enter a plant cell. In some embodiments, a transfer agent is an agent that conditions the surface of plant tissue, e.g., leaves, stems, roots, flowers, or fruits, to permeation by bioactive trigger polynucleotides into plant cells. In certain aspects, methods include one or more applications of a bioactive trigger polynucleotide composition and one or more applications of a transfer agent for conditioning of a plant to permeation by bioactive trigger polynucleotides. The transfer of bioactive trigger polynucleotides into plant cells can be facilitated by the prior or contemporaneous application of a polynucleotide-transferring agent to the plant tissue. In some embodiments the transferring agent is applied subsequent to the application of the polynucleotide composition. Not wishing to be bound by a particular theory, the transfer agent enables bioactive trigger polynucleotides to pass through cuticle wax barriers, stomata and/or cell wall or membrane barriers into plant cells. Suitable transfer agents to facilitate transfer of the bioactive trigger polynucleotide into a plant cell include agents that increase permeability of the exterior of the plant or that increase permeability of plant cells to oligonucleotides or polynucleotides. Such agents to facilitate transfer of the bioactive trigger polynucleotide into a plant cell include a chemical agent, or a physical agent, or combinations thereof. Chemical agents for conditioning or transfer include (a) surfactants, (b) organic solvents or an aqueous solution or aqueous mixtures of organic solvents, (c) oxidizing agents, (d) acids, (e) bases, (f) oils, (g) enzymes, or combinations thereof. Embodiments of a method of providing a bioactive polynucleotide trigger to plant cells can optionally include an incubation step, a neutralization step (e.g., to neutralize an acid, base, or oxidizing agent, or to inactivate an enzyme), a rinsing step, or combinations thereof. Embodiments of agents or treatments for conditioning of a plant to permeation by bioactive trigger polynucleotides include emulsions, reverse emulsions, liposomes, and other micellar-like compositions. Embodiments of agents or treatments for conditioning of a plant to permeation by bioactive trigger polynucleotides include counter-ions or other molecules that are known to associate with nucleic acid molecules, e.g., inorganic ammonium ions, alkyl ammonium ions, lithium ions, polyamines such as spermine, spermidine, or putrescine, and other cations. Organic solvents useful in conditioning a plant to permeation by bioactive trigger polynucleotides include DMSO, DMF, pyridine, N-pyrrolidine, hexamethylphosphoramide, acetonitrile, dioxane, polypropylene glycol, other solvents miscible with water or that will dissolve phosphonucleotides in non-aqueous systems (such as is used in synthetic reactions). Naturally derived or synthetic oils with or without surfactants or emulsifiers can be used, e.g., plant-sourced oils, crop oils (such as those listed in the 9th Compendium of Herbicide Adjuvants, publicly available on the worldwide web (internet) at herbicide.adjuvants.com) can be used, e.g., paraffinic oils, polyol fatty acid esters, or oils with short-chain molecules modified with amides or polyamines such as polyethyleneimine or N-pyrrolidine.


In several embodiments, the transfer agent is an organosilicone preparation. In certain embodiments, an organosilicone preparation that is commercially available as SILWET® L-77 surfactant having CAS Number 27306-78-1 and EPA Number: CAL.REG.NO. 5905-50073-AA, and currently available from Momentive Performance Materials, Albany, N.Y. can be used to prepare a bioactive trigger polynucleotide composition. In certain embodiments where a SILWET® L-77 organosilicone preparation is used as a pre-spray treatment of plant leaves or other plant surfaces, freshly made concentrations in the range of about 0.015 to about 2 percent by weight (wt percent) (e.g., about 0.01, 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 wt percent) are efficacious in preparing a leaf or other plant surface for transfer of bioactive trigger polynucleotide molecules into plant cells from a topical application on the surface. In certain embodiments of the methods and compositions provided herein, a composition that comprises a bioactive trigger polynucleotide molecule and an organosilicone preparation comprising SILWET® L-77 in the range of about 0.015 to about 2 percent by weight (wt percent) (e.g., about 0.01, 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 wt percent) is used or provided.


In certain embodiments, any commercially available organosilicone preparation is used or provided. For example, one or more of the following commercially available organosilicone preparations can be used as transfer agents in a bioactive trigger polynucleotide composition or applied as a pre-spray treatment to prepare a leaf or other plant surface for transfer of bioactive trigger polynucleotide molecules into plant cells: BREAK-THRU® S 321, BREAK-THRU® S 200 Cat#67674-67-3, BREAK-THRU® OE 441 Cat#68937-55-3, BREAK-THRU® S 278 Cat #27306-78-1, BREAK-THRU® S 243, BREAK-THRU® S 233 Cat#134180-76-0, available from manufacturer Evonik Goldschmidt (Germany), SILWET® HS 429, SILWET® HS 312, SILWET® HS 508, SILWET® HS 604 (Momentive Performance Materials, Albany, N.Y.). In certain embodiments where an organosilicone preparation is used as a pre-spray treatment of plant leaves or other surfaces, freshly made concentrations in the range of about 0.015 to about 2 percent by weight (wt percent) (e.g., about 0.01, 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 wt percent) are efficacious in preparing a leaf or other plant surface for transfer of bioactive trigger polynucleotide molecules into plant cells from a topical application on the surface. In certain embodiments of the methods and compositions provided herein, a composition that comprises a bioactive trigger polynucleotide molecule and an organosilicone preparation in the range of about 0.015 to about 2 percent by weight (wt percent) (e.g., about 0.01, 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 wt percent) is used or provided.


Organosilicone preparations used in the methods and compositions provided herein can comprise one or more effective organosilicone compounds. As used herein, the phrase “effective organosilicone compound” is used to describe any organosilicone compound that is found in an organosilicone preparation that promotes internalization of a bioactive trigger polynucleotide into a plant cell. In certain embodiments, an effective organosilicone compound can enable a bioactive trigger polynucleotide to enter a plant cell in a manner permitting bioactive trigger polynucleotide mediated suppression of target gene expression in the plant cell. In general, effective organosilicone compounds include, but are not limited to, compounds that can comprise: i) a trisiloxane head group that is covalently linked to, ii) an alkyl linker including, but not limited to, an n-propyl linker, that is covalently linked to, iii) a poly glycol chain, that is covalently linked to, iv) a terminal group. Trisiloxane head groups of such effective organosilicone compounds include, but are not limited to, heptamethyltrisiloxane. Alkyl linkers can include, but are not limited to, an n-propyl linker. Poly glycol chains include, but are not limited to, polyethylene glycol or polypropylene glycol. Poly glycol chains can comprise a mixture that provides an average chain length “n” of about “7.5”. In certain embodiments, the average chain length “n” can vary from about 5 to about 14. Terminal groups can include, but are not limited to, alkyl groups such as a methyl group. Effective organosilicone compounds are believed to include, but are not limited to, trisiloxane ethoxylate surfactants or polyalkylene oxide modified heptamethyl trisiloxane.




embedded image


In certain embodiments, an organosilicone preparation that comprises an organosilicone compound comprising a trisiloxane head group is used in the methods and compositions provided herein. In certain embodiments, an organosilicone preparation that comprises an organosilicone compound comprising a heptamethyltrisiloxane head group is used in the methods and compositions provided herein. In certain embodiments, an organosilicone composition that comprises Compound I is used in the methods and compositions provided herein. In certain embodiments, an organosilicone composition that comprises Compound I is used in the methods and compositions provided herein. In certain embodiments of the methods and compositions provided herein, a composition that comprises a bioactive trigger polynucleotide molecule and one or more effective organosilicone compound in the range of about 0.015 to about 2 percent by weight (wt percent) (e.g., about 0.01, 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 wt percent) is used or provided.


In several embodiments, the transfer agent is a plant hormone. Examples of plant hormones include abscisic acid, auxin, cytokinin, gibberellin, jasmonate, ethylene, salicyclic acid, nitric oxide, a strigolactone. In some embodiments, the transfer agent is the plant hormone, Brassinosteroid.


In several embodiments, the transfer agent is a cationic lipid. As used herein, “cationic lipid” refers to a compound that includes at least one lipid moiety and a positively charged quaternary nitrogen associated with a counterion. “Lipids” are understood to be comprised of a hydrophobic alkyl or alkenyl moiety and a carboxylic acid or ester moiety. In some embodiments one ore more bioactive trigger molecules interact with cationic lipids to form nucleic acid lipid particles. In some embodiments, the bioactive trigger molecules are encapsulated in a liposome so that the bioactive trigger molecules is inaccessible to an aqueous medium. In some embodiments, the liposome will have a solid core comprised of bioactive trigger molecules; such liposomes encapsulating bioactive trigger molecules and having a solid core are termed “lipid nanoparticles” herein. In some embodiments, the bioactive trigger molecules are not encapsulated by a liposome. In such embodiments, the bioactive trigger molecules can be complexed on the outer surface of the. In these embodiments, the bioactive trigger molecules is accessible to the aqueous medium. In some embodiments, the cationic lipids can be used in combination with other lipid components such as cholesterol and PEG-lipids to form lipid nanoparticles with bioactive trigger molecules.


In several embodiments, expression of an EPSPS gene in a plant is modulated by (a) conditioning of a plant to permeation by bioactive trigger polynucleotides and (b) treatment of the plant with the bioactive trigger polynucleotides, wherein the bioactive trigger polynucleotides include at least one segment of 18 or more contiguous nucleotides cloned from or otherwise identified from the target EPSPS gene in either anti-sense or sense orientation, whereby the bioactive trigger polynucleotide molecules permeate the interior of the plant and induce modulation of the target gene. The conditioning and polynucleotide application can be performed separately or in a single step. When the conditioning and bioactive trigger polynucleotide application are performed in separate steps, the conditioning can precede or can follow the bioactive trigger polynucleotide application within minutes, hours, or days. In some embodiments more than one conditioning step or more than one application of bioactive trigger polynucleotide molecules can be performed on the same plant.


In some embodiments, ligands can be tethered to a bioactive trigger polynucleotide, for example a dsRNA, ssRNA, dsDNA or ssDNA trigger polynucleotide. Ligands in general can include modifiers, e.g., for enhancing uptake; diagnostic compounds or reporter groups e.g., for monitoring distribution; cross-linking agents; nuclease-resistance conferring moieties; and natural or unusual nucleobases. General examples include lipophiles, lipids (e.g., cholesterol, a bile acid, or a fatty acid (e.g., lithocholic-oleyl, lauroyl, docosnyl, stearoyl, palmitoyl, myristoyl oleoyl, linoleoyl), steroids (e.g., uvaol, hecigenin, diosgenin), terpenes (e.g., triterpenes, e.g., sarsasapogenin, Friedelin, epifriedelanol derivatized lithocholic acid), vitamins (e.g., folic acid, vitamin A, biotin, pyridoxal), carbohydrates, proteins, protein binding agents, integrin targeting molecules, polycationics, peptides, polyamines, and peptide mimics. The ligand may also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., polyethylene glycol (PEG), PEG-40K, PEG-20K and PEG-5K. Other examples of ligands include lipophilic molecules, e.g., cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, glycerol (e.g., esters and ethers thereof, e.g., C10, C11, C12, C13, C14, C15, C16, C17, C18, C19, or C20 alkyl; e.g., lauroyl, docosnyl, stearoyl, oleoyl, linoleoyl 1,3-bis-O(hexadecyl)glycerol, 1,3-bis-O(octaadecyl)glycerol), geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dodecanoyl, lithocholyl, 5β-cholanyl, N,N-distearyl-lithocholamide, 1,2-di-O-stearoylglyceride, dimethoxytrityl, or phenoxazine) and PEG (e.g., PEG-5K, PEG-20K, PEG-40K). In some embodiments, the lipophilic moieties are selected from a group consisting of lipid, cholesterols, oleyl, retinyl, and cholesteryl residues.


In some embodiments, conjugating a ligand to a bioactive trigger polynucleotide, for example dsRNA, enhances its cellular absorption. In some embodiments, a lipophilic moiety is conjugated to a bioactive trigger polynucleotide, for example dsRNA. Lipophilic compounds that may be conjugated to a bioactive trigger polynucleotide include, but are not limited to, 1-pyrene butyric acid, 1,3-bis-O-(hexadecyl)glycerol, and menthol. One example of a ligand for receptor-mediated endocytosis is folic acid. Folic acid enters the cell by folate-receptor-radiated endocytosis. Bioactive trigger polynucleotides bearing folic acid would be efficiently transported into the cell via the folate-receptor-mediated endocytosis. Other ligands that have been conjugated to polynucleotides include polyethylene glycols, carbohydrate clusters, cross-linking agents, porphyrin conjugates, delivery peptides and lipids such as cholesterol. In certain instances, conjugation of a cationic ligand to polynucleotides results in improved resistance to nucleases. Representative examples of cationic ligands are propylammonium and dimethylpropylammonium. Interestingly, antisense polynucleotides were reported to retain their high binding affinity to mRNA when the cationic ligand was dispersed, throughout the oligonucleotide. See M. Manoharan Antisense & Nucleic Acid Drug Development 2002, 12, 103 and references therein.


Delivery of bioactive trigger nucleotides to the interior of a plant cell can be accomplished by a variety of methods including, without limitation, (1) loading liposomes with a trigger polynucleotide provided herein and (2) complexing a trigger polynucleotide with lipids or liposomes to form nucleic acid-lipid or nucleic acid-liposome complexes. The liposome can be composed of cationic and neutral lipids commonly used to transfect cells in vitro. Cationic lipids can complex (e.g., charge-associate) with negatively charged, nucleic acids to form liposomes. Examples of cationic liposomes include, without limitation, LIPOFECTIN® (Invitrogen/Life Technologies, Carlsbad, Calif.; a 1:1 (w/w) liposome formulation of the cationic lipid N-[1-(2,3-dioleyloxy)propyl]-n,n,n-trimethylammonium chloride (DOTMA)), LIPOFECTAMINE® (Invitrogen/Life Technologies, Carlsbad, Calif.; a cationic liposome formulation with a neutral co-lipid), LIPOFECTACE® (Invitrogen/Life Technologies, Carlsbad, Calif.; a 1:2.5 (w/w) formulation of dimethyldioctadecylammonium bromide and dioleoylphosphatidylethanolamine), and DOTAP. Procedures for forming liposomes are well known in the art. Liposome compositions can be formed, for example, from phosphatidylcholine, dimyristoyl phosphatidylcholine, dipalmitoyl phosphatidylcholine, dimyristoyl phosphatidyl glycerol, dioleoyl phosphatidylethanolamine or liposomes comprising dihydrosphingomyelin (DHSM). Numerous lipophilic agents are commercially available, including LIPOFECTIN® (Invitrogen/Life Technologies, Carlsbad, Calif.) and EFFECTENE™ (Qiagen, Valencia, Calif.; a non-liposomal lipid formulation in conjunction with a DNA-condensing enhancer). In addition, systemic delivery methods can be optimized using commercially available cationic lipids such as DDAB or DOTAP, each of which can be mixed with a neutral lipid such as DOPE or cholesterol. In some eases, liposomes such as those described by Templeton et al. (Nature Biotechnology, 15:647-652 (1997)) can be used. In other embodiments, polycations such as polyethyleneimine can be used to achieve delivery in vivo and ex vivo (Boletta et al., J. Am Soc. Nephrol. 7:1728 (1996)). Additional information regarding the use of liposomes to deliver nucleic acids can be found in U.S. Pat. No. 6,271,359, PCT Publication WO 96/40964 and Morrissey, D. et al. 2005. Nat Biotechnol. 23(8):1002-7.


In some embodiments, the bioactive trigger polynucleotide compositions may also be used as mixtures with various agricultural chemicals and/or insecticides, miticides and fungicides, pesticidal and biopesticidal agents. Examples include but are not limited to azinphos-methyl, acephate, isoxathion, isofenphos, ethion, etrimfos, oxydemeton-methyl, oxydeprofos, quinalphos, chlorpyrifos, chlorpyrifos-methyl, chlorfenvinphos, cyanophos, dioxabenzofos, dichlorvos, disulfoton, dimethylvinphos, dimethoate, sulprofos, diazinon, thiometon, tetrachlorvinphos, temephos, tebupirimfos, terbufos, naled, vamidothion, pyraclofos, pyridafenthion, pirimiphos-methyl, fenitrothion, fenthion, phenthoate, flupyrazophos, prothiofos, propaphos, profenofos, phoxime, phosalone, phosmet, formothion, phorate, malathion, mecarbam, mesulfenfos, methamidophos, methidathion, parathion, methyl parathion, monocrotophos, trichlorphon, EPN, isazophos, isamidofos, cadusafos, diamidaphos, dichlofenthion, thionazin, fenamiphos, fosthiazate, fosthietan, phosphocarb, DSP, ethoprophos, alanycarb, aldicarb, isoprocarb, ethiofencarb, carbaryl, carbosulfan, xylylcarb, thiodicarb, pirimicarb, fenobucarb, furathiocarb, propoxur, bendiocarb, benfuracarb, methomyl, metolcarb, XMC, carbofuran, aldoxycarb, oxamyl, acrinathrin, allethrin, esfenvalerate, empenthrin, cycloprothrin, cyhalothrin, gamma-cyhalothrin, lambda-cyhalothrin, cyfluthrin, beta-cyfluthrin, cypermethrin, alpha-cypermethrin, zeta-cypermethrin, silafluofen, tetramethrin, tefluthrin, deltamethrin, tralomethrin, bifenthrin, phenothrin, fenvalerate, fenpropathrin, furamethrin, prallethrin, flucythrinate, fluvalinate, flubrocythrinate, permethrin, resmethrin, ethofenprox, cartap, thiocyclam, bensultap, acetamiprid, imidacloprid, clothianidin, dinotefuran, thiacloprid, thiamethoxam, nitenpyram, chlorfluazuron, diflubenzuron, teflubenzuron, triflumuron, novaluron, noviflumuron, bistrifluoron, fluazuron, flucycloxuron, flufenoxuron, hexaflumuron, lufenuron, chromafenozide, tebufenozide, halofenozide, methoxyfenozide, diofenolan, cyromazine, pyriproxyfen, buprofezin, methoprene, hydroprene, kinoprene, triazamate, endosulfan, chlorfenson, chlorobenzilate, dicofol, bromopropylate, acetoprole, fipronil, ethiprole, pyrethrin, rotenone, nicotine sulphate, BT (Bacillus Thuringiensis) agent, spinosad, abamectin, acequinocyl, amidoflumet, amitraz, etoxazole, chinomethionat, clofentezine, fenbutatin oxide, dienochlor, cyhexatin, spirodiclofen, spiromesifen, tetradifon, tebufenpyrad, binapacryl, bifenazate, pyridaben, pyrimidifen, fenazaquin, fenothiocarb, fenpyroximate, fluacrypyrim, fluazinam, flufenzin, hexythiazox, propargite, benzomate, polynactin complex, milbemectin, lufenuron, mecarbam, methiocarb, mevinphos, halfenprox, azadirachtin, diafenthiuron, indoxacarb, emamectin benzoate, potassium oleate, sodium oleate, chlorfenapyr, tolfenpyrad, pymetrozine, fenoxycarb, hydramethylnon, hydroxy propyl starch, pyridalyl, flufenerim, flubendiamide, flonicamid, metaflumizole, lepimectin, TPIC, albendazole, oxibendazole, oxfendazole, trichlamide, fensulfothion, fenbendazole, levamisole hydrochloride, morantel tartrate, dazomet, metam-sodium, triadimefon, hexaconazole, propiconazole, ipconazole, prochloraz, triflumizole, tebuconazole, epoxiconazole, difenoconazole, flusilazole, triadimenol, cyproconazole, metconazole, fluquinconazole, bitertanol, tetraconazole, triticonazole, flutriafol, penconazole, diniconazole, fenbuconazole, bromuconazole, imibenconazole, simeconazole, myclobutanil, hymexazole, imazalil, furametpyr, thifluzamide, etridiazole, oxpoconazole, oxpoconazole fumarate, pefurazoate, prothioconazole, pyrifenox, fenarimol, nuarimol, bupirimate, mepanipyrim, cyprodinil, pyrimethanil, metalaxyl, mefenoxam, oxadixyl, benalaxyl, thiophanate, thiophanate-methyl, benomyl, carbendazim, fuberidazole, thiabendazole, manzeb, propineb, zineb, metiram, maneb, ziram, thiuram, chlorothalonil, ethaboxam, oxycarboxin, carboxin, flutolanil, silthiofam, mepronil, dimethomorph, fenpropidin, fenpropimorph, spiroxamine, tridemorph, dodemorph, flumorph, azoxystrobin, kresoxim-methyl, metominostrobin, orysastrobin, fluoxastrobin, trifloxystrobin, dimoxystrobin, pyraclostrobin, picoxystrobin, iprodione, procymidone, vinclozolin, chlozolinate, flusulfamide, dazomet, methyl isothiocyanate, chloropicrin, methasulfocarb, hydroxyisoxazole, potassium hydroxyisoxazole, echlomezol, D-D, carbam, basic copper chloride, basic copper sulfate, copper nonylphenolsulfonate, oxine copper, DBEDC, anhydrous copper sulfate, copper sulfate pentahydrate, cupric hydroxide, inorganic sulfur, wettable sulfur, lime sulfur, zinc sulfate, fentin, sodium hydrogen carbonate, potassium hydrogen carbonate, sodium hypochlorite, silver, edifenphos, tolclofos-methyl, fosetyl, iprobenfos, dinocap, pyrazophos, carpropamid, fthalide, tricyclazole, pyroquilon, diclocymet, fenoxanil, kasugamycin, validamycin, polyoxins, blasticiden S, oxytetracycline, mildiomycin, streptomycin, rape seed oil, machine oil, benthiavalicarbisopropyl, iprovalicarb, propamocarb, diethofencarb, fluoroimide, fludioxanil, fenpiclonil, quinoxyfen, oxolinic acid, chlorothalonil, captan, folpet, probenazole, acibenzolar-S-methyl, tiadinil, cyflufenamid, fenhexamid, diflumetorim, metrafenone, picobenzamide, proquinazid, famoxadone, cyazofamid, fenamidone, zoxamide, boscalid, cymoxanil, dithianon, fluazinam, dichlofluanide, triforine, isoprothiolane, ferimzone, diclomezine, tecloftalam, pencycuron, chinomethionat, iminoctadine acetate, iminoctadine albesilate, ambam, polycarbamate, thiadiazine, chloroneb, nickel dimethyldithiocarbamate, guazatine, dodecylguanidine-acetate, quintozene, tolylfluanid, anilazine, nitrothalisopropyl, fenitropan, dimethirimol, benthiazole, harpin protein, flumetover, mandipropamide and penthiopyrad.


In some embodiments, an agronomic field in need of weed control is treated by application of an agricultural chemical composition directly to the surface of the growing plants, such as by a spray. For example, a composition comprising a bioactive trigger polynucleotide and one or more of a transfer agent and a non-polynucleotide herbicide is applied to control weeds in a field of crop plants by spraying the field with the composition. The composition can be provided as a tank mix with one or more herbicidal chemicals and additional pesticidal chemicals to control pests and diseases of the crop plants in need of pest and disease control. In some embodiments, a sequential treatment of components (for example, the bioactive trigger polynucleotide-containing composition followed by the herbicide), or a simultaneous treatment or mixing of one or more of the components of the composition from separate containers is contemplated. Treatment of the field can occur as often as needed to provide weed control and the components of the composition can be adjusted to target specific weed species or weed families through utilization of specific bioactive trigger polynucleotides or bioactive trigger polynucleotide-containing compositions capable of selectively targeting the specific species or plant family to be controlled. The composition can be applied at effective use rates according to the time of application to the field, for example, preplant, at planting, post planting, and post harvest. Glyphosate can be applied to a field at rates of 11-44 ounces/acre up to 7.2875 pounds/acre. The bioactive trigger polynucleotides of the composition can be applied at rates of 1 to 30 grams per acre depending on the number of bioactive trigger polynucleotide molecules needed for the scope of weeds in the field.


Crop plants in which weed control may be needed include but are not limited to corn, soybean, cotton, canola, sugar beet, alfalfa, sugarcane, rice, and wheat; vegetable plants including, but not limited to, tomato, sweet pepper, hot pepper, melon, watermelon, cucumber, eggplant, cauliflower, broccoli, lettuce, spinach, onion, peas, carrots, sweet corn, Chinese cabbage, leek, fennel, pumpkin, squash or gourd, radish, Brussels sprouts, tomatillo, garden beans, dry beans, or okra; culinary plants including, but not limited to, basil, parsley, coffee, or tea; or fruit plants including but not limited to apple, pear, cherry, peach, plum, apricot, banana, plantain, table grape, wine grape, citrus, avocado, mango, or berry; a tree grown for ornamental or commercial use, including, but not limited to, a fruit or nut tree; ornamental plant (e.g., an ornamental flowering plant or shrub or turf grass). The methods and compositions provided herein can also be applied to plants that are not grown from seed, including fruit trees and plants that include, but are not limited to, avocados, tomatoes, eggplant, cucumber, melons, watermelons, and grapes as well as various ornamental plants. For example, methods and compositions provided herein can also be applied to plants produced by a cutting, cloning, or grafting process.


All publications, patents and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.


The following Examples are presented for the purposes of illustration and should not be construed as limitations.


EXAMPLES
Example 1. EPSPS Target and Trigger Sequences

A major mechanism of glyphosate resistance in weeds is through amplification of the gene encoding 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). For example, genotyping of glyphosate-resistant Palmer amaranth has revealed glyphosate-resistant plants with 4 to more than 100 copies of the EPSPS gene. Bioactive trigger polynucleotide molecules targeting the EPSPS gene for down regulation are useful in controlling herbicide resistant weeds.


As shown in Table 1, two dsRNA molecules were designed using Palmer amaranth EPSPS cDNA sequence (SEQ ID NO: 1) to comprise an anti-sense strand that is complementary to positions 398-447 (SEQ ID NO: 4) or positions 1189-1241 (SEQ ID NO: 6) of Amaranthus palmeri EPSPS cDNA. The Palmer amaranth EPSPS sequences targeted by the bioactive dsRNA triggers are indicated by the lowercase nucleotides. The two bioactive dsRNA trigger molecules are further capable of hybridizing with mRNA transcribed from the Amaranthus rudis (waterhemp) EPSPS gene (SEQ ID NO: 2). As shown in Table 1, SEQ ID NO: 4 complements Amaranthus rudis EPSPS at positions 398-427, 429-433, and 435-447 as indicated by the lowercase nucleotides, with two mismatches at positions 428 and 434 (underlined). SEQ ID NO: 6 complements Amaranthus rudis EPSPS at positions 1189-1202, and 1204-1241 as indicated by the lowercase nucleotides, with one mismatch at position 1203 (underlined).









TABLE 1







EPSPS target and trigger sequences SEQ ID NOs: 1-8









SEQ ID




NO:
Description
Sequence





1
EPSPS cDNA
ATGGCTCAAGCTACTACCATCAACAATGGTGTCCATACTGGTCAAT




Amaranthus

TGCACCATACTTTACCCAAAACCCAGTTACCCAAATCTTCAAAAAC




palmeri

TCTTAATTTTGGATCAAACTTGAGAATTTCTCCAAAGTTCATGTCTT




TAACCAATAAAAGAGTTGGTGGGCAATCATCAATTGTTCCCAAGA




TTCAAGCTTCTGTTGCTGCTGCAGCTGAGAAACCTTCATCTGTCCC




AGAAATTGTGTTACAACCCATCAAAGAGATCTCTGGTACTGTTCAA




TTGCCTGGGTCAAAGTCTTTATCCAATCGAATCCTTCTTTTAGCTGC




TTTGTCTGAGGGCACAACAGTGGTCGACAACTTGCTGTATAGTGAT




GATATTCTTTATATGTTGGACGCTCTCAgaactcttggtttaaaagtggaggatgata




gtacagccaaaagggcagtcGTAGAGGGTTGTGGTGGTCTGTTTCCTGTTGGT




AAAGATGGAAAGGAAGAGATTCAACTTTTCCTTGGTAATGCAGGA




ACAGCGATGCGCCCATTGACAGCTGCGGTTGCCGTTGCTGGAGGA




AATTCAAGTTATGTGCTTGATGGAGTACCAAGAATGAGGGAGCGC




CCCATTGGGGATCTGGTAGCAGGTCTAAAGCAACTTGGTTCAGATG




TAGATTGTTTTCTTGGCACAAATTGCCCTCCTGTTCGGGTCAATGCT




AAAGGAGGCCTTCCAGGGGGCAAGGTCAAGCTCTCTGGATCGGTT




AGTAGCCAATATTTAACTGCACTTCTCATGGCTACTCCTTTGGGTCT




TGGAGACGTGGAGATTGAGATAGTTGATAAATTGATTTCTGTACCG




TATGTTGAAATGACAATAAAGTTGATGGAACGCTTTGGAGTATCCG




TAGAACATAGTGATAGTTGGGACAGGTTCTACATTCGAGGTGGTC




AGAAATACAAATCTCCTGGAAAGGCATATGTTGAGGGTGATGCTT




CAAGTGCTAGCTACTTCCTAGCCGGAGCCGCCGTCACTGGTGGGAC




TGTCACTGTCAAGGGTTGTGGAACAAGCAGTTTACAGGGTGATGT




AAAATTTGCCGAAGTTCTTGAGAAGATGGGTTGCAAGGTCACCTG




GACAGAGAATAGTGTAACTGTTACTGGACCACCCAGGGATTCATC




TGGAAAGAAACATCTGCGTGCTATCgacgtcaacatgaacaaaatgccagatgttgct




atgactcttgcagttgttgcCTTGTATGCAGATGGGCCCACCGCCATCAGAGAT




GTGGCTAGCTGGAGAGTGAAGGAAACCGAACGGATGATTGCCATT




TGCACAGAACTGAGAAAGCTTGGGGCAACAGTTGAGGAAGGATCT




GATTACTGTGTGATCACTCCGCCTGAAAAGCTAAACCCCACCGCCA




TTGAAACTTATGACGATCACCGAATGGCCATGGCATTCTCTCTTGC




TGCCTGTGCAGATGTTCCCGTCACTATCCTTGATCCGGGATGCACC




CGTAAAACCTTCCCGGACTACTTTGATGTTTTAGAAAAGTTCGCCA




AGCATTGA





2
EPSPS
ATGGCTCAAGCTACTACCATCAACAATGGTGTCCAAACTGGTCAAT




Amaranthus

TGCACCATACTTTACCCAAAACCCACTTACCCAAATCTTCAAAAAC




rudis

TGTTAATTTTGGATCAAACTTTAGAATTTCTCCAAAGTTCATGTCTT




TAACCAATAAAAGAGTTGGTGGGCAATCATCAATTATTCCCAAGA




TTCAAGCTTCAGTTGCTGCTGCAGCTGAGAAACCTTCATCTGTCCC




AGAAATTGTGTTACAACCCATCAAAGAGATCTCTGGTACCATTCAA




TTGCCTGGGTCAAAGTCTCTATCTAATCGAATCCTTCTTTTAGCTGC




TTTGTCTCAGGGCACAACTGTGGTCGACAACTTGCTGTATAGTGAT




GATATTCTTTATATGTTGGACGCTCTCAgaactcttggtttaaaagtggaggatgata




AtacagAcaaaagggcagtcGTGGAGGGTTGTGGTGGTCTGTTTCCTGTTGG




TAAAGATGGAAAGGAAGAGATTCAACTTTTCCTTGGAAATGCAGG




AACAGCGATGCGCCCATTGACAGCTGCGGTTGCCGTTGCTGGAGG




AAATTCAAGCTATGTTCTTGACGGAGTACCAAGAATGAGGGAGCG




CCCCATTGGGGATCTGGTAGCAGGTCTAAAGCAACTTGGTTCAGAT




GTTGACTGTTTTCTTGGCACAAATTGCCCTCCTGTTCGGGTCAATGC




TAAAGGAGGCCTTCCAGGGGGCAAGGTCAAGCTCTCTGGATCGGT




TAGTAGCCAATATTTAACTGCACTTCTGATGGCTACTCCTTTGGGT




CTTGGAGATGTGGAGATTGAGATAGTTGATAAATTGATTTCCGTAC




CGTATGTTGAAATGACAATAAGGTTGATGGAACGCTTTGGAGTATC




TGTTGAACATAGTGATAGTTGGGACAGGTTCTTCATCCGAGGTGGT




CAGAAATACAAATCTCCTGGAAAGGCATATGTTGAGGGTGACGCT




TCAAGTGCTAGCTACTTCCTAGCTGGAGCCGCCGTCACTGGGGGGA




CTGTGACTGTCAAGGGTTGTGGAACAAGCAGTTTACAGGGTGATG




TAAAATTTGCCGAAGTTCTTGAGAAGATGGGTTGCAAGGTCACCTG




GACAGACAATAGCGTAACTGTTACTGGACCACCCAGGGAATCATC




TGGAAGGAAACATTTGCGCGCTATCgacgtcaacatgaaTaaaatgccagatgttgct




atgactcttgcagttgttgcCTTGTATGCAGATGGGCCCACCGCCATTAGAGAT




GTGGCTAGCTGGAGAGTGAAGGAAACCGAACGGATGATTGCCATT




TGCACAGAACTGAGAAAGCTTGGGGCAACAGTTGAGGAAGGATCT




GATTACTGTGTGATCACTCCGCCTGAAAAGCTGATACCCACCGCCA




TCGAAACTTATGACGATCACCGAATGGCCATGGCATTCTCTCTTGC




TGCCTGTGCTGATGTTCCCGTCACTATCCTTGATCCGGGATGTACA




CGTAAAACCTTCCCGGACTACTTTGATGTCTTAGAAAAGTTCGCCA




AGCATTGA





3
50mer EPSPS
GAACUCUUGGUUUAAAAGUGGAGGAUGAUAGUACAGCCAAAAG



Trigger
GGCAGUC





4
Reverse
GACUGCCCUUUUGGCUGUACUAUCAUCCUCCACUUUUAAACCAA



Complement
GAGUUC





5
53mer EPSPS
GACGUCAACAUGAACAAAAUGCCAGAUGUUGCUAUGACUCUUGC



Trigger
AGUUGUUGC





6
Reverse
GCAACAACUGCAAGAGUCAUAGCAACAUCUGGCAUUUUGUUCAU



Complement
GUUGACGUC





7
24mer EPSPS
AUGCCAGAUGUUGCUAUGACUCUU



Trigger





8
Reverse
AAGAGUCAUAGCAACAUCUGGCAU



Complement









A number of plant species contain an EPSPS gene. For example, a gene encoding an EPSPS polynucleotide molecule occurs naturally in the genome of Amaranthus palmeri, Amaranthus rudis, Amaranthus albus, Amaranthus chlorostachys, Amaranthus graecizans, Amaranthus hybridus, Amaranthus lividus, Amaranthus spinosus, Amaranthus thunbergii, Amaranthus viridis, Lolium multiflorum, Lolium rigidium, Ambrosia artemisiifolia, Ambrosia trifida, Euphorbia heterophylla, Kochia scoparia, Abutilon theophrasti, Sorghum halepense, Chenopodium album, Commelina diffusa, Convulvulus arvensis, Conyza candensis, Digitaria sanguinalis, and Xanthium strumarium. The nucleotide sequences of SEQ ID NO 3 and SEQ ID NO 5 were compared to the EPSPS gene sequences of various plant species and target sequences having at least 85% identity or complementarity to SEQ ID NOs 3-6 were identified. EPSPS target sequences identified as having at least 85% identity or complementarity to SEQ ID NOs 3-6 are shown in Table 2 (mismatches are underlined). Bioactive trigger polynucleotides comprising a nucleotide sequence having at least 85% identity or complementarity to SEQ ID NOs: 9-35 are contemplated for down regulating EPSPS expression and controlling herbicide resistant weeds.









TABLE 2







EPSPS target nucleotide sequences SEQ ID NOs: 9-35











SEQ






ID

Corresponding


NO:
Species
to:
Sequence
Length














9

Amaranthus

SEQ ID NO: 3
GAGCTCTTGGTTTAAAAGTGGAGGATGAT
49




graecizans


AATACAGCCAAAAGGGCAGT





10

Amaranthus

SEQ ID NO: 3
GAACTCTTGGTTTAAAAGTGGAGGATGAT
50




hybridus


AATACAGCCAAAAGGGCAGTC





11

Amaranthus

SEQ ID NO: 3
GAACTCTTGGTTTAAAAGTGGAGGATGAT
50




palmeri


AGTACAGCCAAAAGGGCAGTC





12

Amaranthus

SEQ ID NO: 3
GAACTCTTGGTTTAAAAGTGGAGGATGAT
50




rudis


AATACAGACAAAAGGGCAGTC





13

Amaranthus

SEQ ID NO: 3
GAACTCTTGGTTTAAAAGTGGAGGATGAT
50




viridis


AATACAGCCAAAAGGGCAGTC





14

Abutilon

SEQ ID NO: 5
GATGTCAACATGAACAAAATGCCAGATGT
53




theophrasti


TGCCATGACTCTCGCTGTTGTTGC





15

Amaranthus

SEQ ID NO: 5
GACGTCAACATGAACAAAATGCCAGATGT
53




graecizans


TGCTATGACTCTTGCAGTTGTTGC





16

Amaranthus

SEQ ID NO: 5
GACGTCAACATGAACAAAATGCCAGATGT
53




hybridus


TGCTATGACTCTTGCAGTAGTTGC





17

Amaranthus

SEQ ID NO: 5
GACGTCAACATGAACAAAATGCCAGATGT
53




lividus


TGCTATGACTCTTGCAGTAGTTGC





18

Amaranthus

SEQ ID NO: 5
GACGTCAACATGAACAAAATGCCAGATGT
53




palmeri


TGCTATGACTCTTGCAGTTGTTGC





19

Amaranthus

SEQ ID NO: 5
GACGTCAACATGAATAAAATGCCAGATGT
53




rudis


TGCTATGACTCTTGCAGTTGTTGC





20

Amaranthus

SEQ ID NO: 5
GACGTCAACATGAACAAAATGCCAGATGT
53




thunbergii


TGCTATGACTCTTGCAGTAGTTGC





21

Amaranthus

SEQ ID NO: 5
GACGTCAACATGAACAAAATGCCAGATGT
53




viridis


TGCTATGACTCTTGCAGTAGTTGC





22

Ambrosia

SEQ ID NO: 5
GATGTTAACATGAACAAAATGCCAGATGT
53




trifida


TGCCATGACGCTTGCAGTCGTTGC





23

Chenopodium

SEQ ID NO: 5
GATGTCAACATGAACAAAATGCCAGATGT
53




album



CGCTATGACTCTTGCTGTTGTTGC






24

Convolvulus

SEQ ID NO: 5
GATGTCAACATGAATAAAATGCCAGATGT
53




arvensis



CGCCATGACTCTTGCTGTAGTTGC






25

Conyza

SEQ ID NO: 5
GATGTGAACATGAACAAGATGCCTGATGT
53




canadensis


TGCCATGACTCTTGCTGTGGTCGC





26

Digitaria

SEQ ID NO: 5
GATGTTAACATGAACAAAATGCCCGATGT
53




sanguinalis


TGCCATGACTCTTGCCGTGGTTGC





27

Digitaria

SEQ ID NO: 5
GACGTCAACATGAACAAAATGCCTGATGT
53




sanguinalis



CGCAATGACTCTTGCTGTGGTTGC






28

Echinochloa

SEQ ID NO: 5
GATGTCAACATGAACAAAATGCCTGATGT
53




colona


TGCCATGACTCTTGCTGTGGTCGC





29

Echinochloa

SEQ ID NO: 5
GATGTCAACATGAACAAAATGCCTGATGT
53




crus-galli


TGCCATGACTCTTGCTGTGGTCGC





30

Euphorbia

SEQ ID NO: 5
GATGTGAACATGAACAAAATGCCAGATGT
53




heterophylla



CGCTATGACATTGGCTGTGGTTGC






31

Ipomoea

SEQ ID NO: 5
GATGTCAACATGAACAAAATGCCAGATGT
53




hederacea


TGCCATGACTCTTGCTGTAGTTGC





32

Lolium

SEQ ID NO: 5
GATGTCAACATGAACAAAATGCCTGATGT
53




multiflorum


TGCCATGACTCTTGCCGTTGTTGC





33

Senna

SEQ ID NO: 5
GATGTCAACATGAACAAGATGCCAGATGT
53




obtusifolia


TGCCATGACTCTTGCTGTAGTTGC





34

Sorghum

SEQ ID NO: 5
GATGTTAACATGAACAAAATGCCTGATGT
53




halepense


TGCCATGACTCTTGCTGTGGTTGC





35

Xanthium

SEQ ID NO: 5
GATGTTAACATGAACAAAATGCCAGATGT
53




strumarium


TGCCATGACGCTTGCAGTCGTTGC









Example 2. Bioactive EPSPS Trigger Molecules Increase Susceptibility of Glyphosate-Resistant Palmer amaranth to Glyphosate

The efficacies of mid-sized bioactive polynucleotide trigger molecules comprising SEQ ID NOs: 3 and 4 or SEQ ID NOs: 5 and 6 were assessed in glyphosate-resistant Palmer amaranth in relation to a 24-mer trigger comprising SEQ ID NOs: 7 and 8, which was known to sensitize glyphosate-resistant Palmer amaranth to glyphosate. Double stranded RNA (dsRNA) triggers comprising polynucleotide sequences of SEQ ID NOs: 3 and 4, SEQ ID NOs: 5 and 6, and SEQ ID NOs: 7 and 8 were produced and the triggers were formulated with 0.5% SILWET® L-77, 2% AMS, and 20 mM phosphate buffer to the desired concentration. The trigger formulations were then topically applied to the leaves of glyphosate-resistant Amaranthus palmeri plants (“R-22”). Control plants were either untreated or treated with the 0.5% SILWET® L-77, 2% AMS, and 20 mM phosphate buffer solution. One day after treatment, WEATHERMAX® brand glyphosate herbicide (RU Wmax, Monsanto, St Louis, Mo.) was applied to the plants at 1.5 lb/ac. 11 days after treatment (DAT) with EPSPS trigger polynucleotides the percent growth reduction of the dsRNA treated plants was assessed relative to untreated control plants by visual score. At 14 DAT the fresh weight of the dsRNA treated and control plants were determined. Four replications were performed per treatment. As shown in Table 3, the mid-sized polynucleotide trigger molecules corresponding to SEQ ID NOs: 3 and 4 or SEQ ID NOs: 5 and 6, showed similar activity to the trigger sequence corresponding to SEQ ID NOs: 7 and 8 in sensitizing glyphosate-resistant Amaranthus palmeri plants to glyphosate. See also FIG. 1.









TABLE 3







Activity of EPSPS trigger polynucleotides in


glyphosate-resistant Amaranthus palmeri










Treatment
Concentration
visual 11-DAT
Fresh weight 14-DAT












SEQ ID NO
(nmole)
Average
Stdev
Average
Stdev















formulation

30.0
11.5
27.7
13.1


control













SEQ ID NO
2
nmole
47.5
5.0
19.0
7.7


7/8


SEQ ID NO
4
nmole
88.8
12.5
95.3
8.6


7/8


SEQ ID NO
8
nmole
90.0
7.1
91.8
5.4


7/8


SEQ ID NO
16
nmole
85.8
11.8
93.7
6.6


7/8


SEQ ID NO
2
nmole
48.8
17.5
18.2
10.9


5/6


SEQ ID NO
4
nmole
41.3
4.8
94.0
5.6


5/6


SEQ ID NO
8
nmole
93.8
2.5
96.2
2.8


5/6


SEQ ID NO
16
nmole
81.3
13.1
90.7
9.5


5/6


SEQ ID NO
2
nmole
46.3
18.0
24.0
3.7


3/4


SEQ ID NO
4
nmole
28.8
10.3
94.7
5.4


3/4


SEQ ID NO
8
nmole
88.3
10.4
88.4
9.5


3/4


SEQ ID NO
16
nmole
90.0
13.5
97.0
2.7


3/4









Example 3. Bioactive EPSPS Trigger Molecules Increase Susceptibility of Glyphosate-Resistant Waterhemp to Glyphosate

The efficacies of mid-sized polynucleotide trigger molecules comprising SEQ ID NOs: 3 and 4 or SEQ ID NOs: 5 and 6, were assessed in glyphosate-resistant Waterhemp (Amaranthus rudis) in relation to a 24-mer trigger comprising SEQ ID NOs: 7 and 8. dsRNA triggers comprising polynucleotide sequences of SEQ ID NOs: 3 and 4, SEQ ID NOs: 5 and 6, and SEQ ID NOs: 7 and 8 were produced and the triggers were each formulated with 0.5% SILWET® L-77, 2% AMS, and 20 mM phosphate buffer to a concentration of 8 nmol. The trigger formulations were then topically applied to the leaves of glyphosate-resistant Waterhemp. Control plants were either untreated or treated with a solution of 0.5% SILWET® L-77, 2% AMS, and 20 mM phosphate buffer. One day after treatment with the trigger formulation, WEATHERMAX® brand glyphosate herbicide was applied to the plants at 1.5 lb/ac. Four replications were performed per treatment. The fresh weight of the plants was determined 14 DAT with EPSPS trigger polynucleotides and the fresh weight % compared to control plants (treated with WEATHERMAX® brand glyphosate herbicide alone) was calculated. See Table 4. As shown in Table 4, the trigger polynucleotides comprising SEQ ID NO 3/4 or SEQ ID NO 5/6 showed similar activity to trigger polynucleotides comprising SEQ ID NO 7/8 in sensitizing glyphosate-resistant Waterhemp plants to glyphosate.









TABLE 4







Activity of EPSPS trigger polynucleotides


in glyphosate-resistant waterhemp











Treatment and

% Control Fresh



SEQ ID NO
Concentration
wt. average







Buffer

35



SEQ ID NO
8 nmol
85



7/8



SEQ ID NO
8 nmol
78



3/4



SEQ ID NO
8 nmol
83



5/6










Example 4. dsRNA Trigger Molecules Comprising SEQ ID NO 3/4 and SEQ ID NO 5/6 Reduce EPSPS mRNA in Palmer Protoplasts

The activities of mid-sized bioactive polynucleotide trigger molecules corresponding to SEQ ID NOs: 3 and 4 or SEQ ID NOs: 5 and 6 were assessed in Amaranthus palmeri protoplasts. A 6 ug dose of each dsRNA trigger (SEQ ID NO 3/4 or SEQ ID NO 5/6) was added to Amaranthus palmeri protoplasts. As shown in FIG. 2, the dsRNA triggers comprising SEQ ID NOs: 3 and 4 or SEQ ID NOs: 5 and 6 reduced EPSPS mRNA levels by 69% and 84%, respectively.


Example 5. Bioactive EPSPS Trigger Molecules Increase Susceptibility of Glyphosate-Resistant Waterhemp to Glyphosate

The efficacies of mid-sized bioactive polynucleotide trigger molecules


comprising SEQ ID NOs 3 and 4 or SEQ ID NOs 5 and 6 were assessed in glyphosate-resistant Waterhemp (WH13) in relation to a 24-mer trigger comprising SEQ ID NOs 7 and 8, which was known to sensitize glyphosate-resistant Waterhemp to glyphosate. Double stranded RNA (dsRNA) triggers comprising polynucleotide sequences of SEQ ID NOs: 3 and 4, SEQ ID NOs: 5 and 6, and SEQ ID NOs: 7 and 8 were produced and the bioactive trigger polynucleotides were formulated with 0.5% SILWET® L-77, 2% AMS, and 20 mM phosphate buffer to a concentration of 2 nmol, 4 nmol, 8 nmol or 16 nmol. The trigger formulations were then topically applied to the leaves of glyphosate-resistant Waterhemp plants (“WH13”). Control plants were either untreated or treated with the 0.5% SILWET® L-77, 2% AMS, and 20 mM phosphate buffer solution. One day after treatment, WEATHERMAX® brand glyphosate herbicide (RU Wmax, Monsanto, St Louis, Mo.) was applied to the plants at 1.5 lb/ac. Four replications were performed per treatment. FIG. 3 shows the plants at 14 days after treatment. As shown in FIG. 3, the mid-sized bioactive trigger polynucleotide molecules comprising SEQ ID NOs: 5 and 6 or SEQ ID NOs: 3 and 4, sensitize glyphosate-resistant Waterhemp plants to glyphosate.


Example 6. A Method to Control Weeds in a Field

A composition comprising at least one bioactive trigger polynucleotide comprising a nucleotide sequence that is essentially identical and/or essentially complementary to SEQ ID NOs: 3-35 or a fragment thereof and a transfer agent that mobilizes the bioactive trigger polynucleotide into a plant cell is applied to a field of growing plants at an effective concentration. For example, an effective concentration of a bioactive trigger polynucleotide can have a use rate of about 1 to 30 grams or more per acre depending on the size of the bioactive trigger polynucleotide and the number of bioactive trigger polynucleotides in the composition. The bioactive trigger polynucleotide of the composition may be a dsRNA, ssDNA or dsDNA or a combination thereof. An effective concentration of bioactive trigger polynucleotides modulate the expression of an EPSPS gene in one or more target weed plant species to promote sensitivity of the target weed plant species to glyphosate. A glyphosate-containing herbicide is applied to control weeds in the field.


The composition optionally comprises a bioactive trigger polynucleotide that modulates the expression of an essential gene and optionally a herbicide that has a different mode of action relative to glyphosate. The composition may include one or more additional herbicides as needed to provide effective multi-species weed control. A composition comprising 1 or 2 or 3 or 4 or more of bioactive trigger polynucleotide that are essentially identical or essentially complementary to SEQ ID NOs: 3-35 or a fragment thereof would enable broad activity of the composition against the multiple weed species that occur in a field environment.


Example 7. Tiling of the EPSPS cDNA for dsRNA Trigger Testing in GR Palmer

The EPSPS cDNA of SEQ ID NO: 1 was tiled across the entire length of the cDNA to identify target sequences for bioactive trigger polynucleotides covering as shown in Table 5. The target nucleotide sequence were chosen to be approximately 47-62 bp in length. Bioactive trigger polynucleotides comprising a nucleotide sequence having at least 85% identity or complementarity to SEQ ID NOs: 36-66 were tested for the ability to sensitize glyphosate-resistant Waterhemp to glyphosate.









TABLE 5







EPSPS target nucleotide sequences SEQ ID NO 36-66









SEQ ID




NO
Size
Sense





36
49
GCTCAAGCTACTACCATCAACAATGGTGTCCATACTGGTCAATTGCACC





37
60
GCACCATACTTTACCCAAAACCCAGTTACCCAAATCTTCAAAAACTCTTAATTTTGGATC





38
60
GATCAAACTTGAGAATTTCTCCAAAGTTCATGTCTTTAACCAATAAAAGAGTTGGTGGGC





39
48
GCAATCATCAATTGTTCCCAAGATTCAAGCTTCTGTTGCTGCTGCAGC





40
54
GCTGAGAAACCTTCATCTGTCCCAGAAATTGTGTTACAACCCATCAAAGAGATC





41
52
GATCTCTGGTACTGTTCAATTGCCTGGGTCAAAGTCTTTATCCAATCGAATC





42
54
GAATCCTTCTTTTAGCTGCTTTGTCTGAGGGCACAACAGTGGTCGACAACTTGC





43
47
GCTGTATAGTGATGATATTCTTTATATGTTGGACGCTCTCAGAACTC





44
61
GCAGTCGTAGAGGGTTGTGGTGGTCTGTTTCCTGTTGGTAAAGATGGAAAGGAAGAGATTC





45
48
GATTCAACTTTTCCTTGGTAATGCAGGAACAGCGATGCGCCCATTGAC





46
56
GACAGCTGCGGTTGCCGTTGCTGGAGGAAATTCAAGTTATGTGCTTGATGGAGTAC





47
52
GTACCAAGAATGAGGGAGCGCCCCATTGGGGATCTGGTAGCAGGTCTAAAGC





48
53
GCAACTTGGTTCAGATGTAGATTGTTTTCTTGGCACAAATTGCCCTCCTGTTC





49
56
GTTCGGGTCAATGCTAAAGGAGGCCTTCCAGGGGGCAAGGTCAAGCTCTCTGGATC





50
54
GATCGGTTAGTAGCCAATATTTAACTGCACTTCTCATGGCTACTCCTTTGGGTC





51
48
GTCTTGGAGACGTGGAGATTGAGATAGTTGATAAATTGATTTCTGTAC





52
58
GTACCGTATGTTGAAATGACAATAAAGTTGATGGAACGCTTTGGAGTATCCGTAGAAC





53
51
GAACATAGTGATAGTTGGGACAGGTTCTACATTCGAGGTGGTCAGAAATAC





54
55
GTCAGAAATACAAATCTCCTGGAAAGGCATATGTTGAGGGTGATGCTTCAAGTGC





55
51
GCTAGCTACTTCCTAGCCGGAGCCGCCGTCACTGGTGGGACTGTCACTGTC





56
55
GTCAAGGGTTGTGGAACAAGCAGTTTACAGGGTGATGTAAAATTTGCCGAAGTTC





57
56
GTTCTTGAGAAGATGGGTTGCAAGGTCACCTGGACAGAGAATAGTGTAACTGTTAC





58
54
GTTACTGGACCACCCAGGGATTCATCTGGAAAGAAACATCTGCGTGCTATCGAC





59
62
GCCTTGTATGCAGATGGGCCCACCGCCATCAGAGATGTGGCTAGCTGGAGAGTGAAGGAAAC





60
50
GAAACCGAACGGATGATTGCCATTTGCACAGAACTGAGAAAGCTTGGGGC





61
52
GCAACAGTTGAGGAAGGATCTGATTACTGTGTGATCACTCCGCCTGAAAAGC





62
51
GCTAAACCCCACCGCCATTGAAACTTATGACGATCACCGAATGGCCATGGC





63
57
GCATTCTCTCTTGCTGCCTGTGCAGATGTTCCCGTCACTATCCTTGATCCGGGATGC





64
54
GCACCCGTAAAACCTTCCCGGACTACTTTGATGTTTTAGAAAAGTTCGCCAAGC





65
50
GAACTCTTGGTTTAAAAGTGGAGGATGATAGTACAGCCAAAAGGGCAGTC





66
53
GACGTCAACATGAACAAAATGCCAGATGTTGCTATGACTCTTGCAGTTGTTGC









Double stranded RNA (dsRNA) triggers comprising polynucleotide sequences corresponding to SEQ ID NOs: 36-62 were produced and the bioactive trigger polynucleotides were formulated with 0.5% SILWET® L-77, 2% AMS, and 20 mM phosphate buffer to a final concentration of 8 nmol. The trigger formulations were then topically applied to the leaves of glyphosate-resistant Waterhemp plants (“WH13”). Control plants were either untreated or treated with the formulation 0.5% SILWET® L-77, 2% AMS, and 20 mM phosphate “buffer” solution. Additionally dsRNA comprising SEQ ID NOs: 7 and 8 (24-mer EPSPS trigger) was applied as a control. One day after treatment, WEATHERMAX® brand glyphosate herbicide (RU Wmax, Monsanto, St Louis, Mo.) was applied to the plants at 1.5 lb/ac.


Three replications were performed per treatment. FIG. 4 shows the fresh weight (g) of the plants at 14 days after treatment. As shown in FIG. 4, several mid-sized bioactive trigger polynucleotide molecules sensitize glyphosate-resistant Waterhemp plants to glyphosate, in particular, in addition to bioactive trigger polynucleotides comprising SEQ ID NOs: 3 and 4 or SEQ ID NOs: 5 and 6, it was observed that bioactive trigger polynucleotides corresponding to SEQ ID NOs: 36, 42, 43, 44, 57, 58 and 59 had good efficacy.

Claims
  • 1. A method of controlling growth, development or reproductive ability of a plant, comprising: topically treating the plant with a composition comprising a double-stranded RNA (dsRNA) polynucleotide and a transfer agent, wherein the dsRNA polynucleotide comprises (a) a strand consisting of SEQ ID NO: 3 or 5; and (b) a strand comprising the reverse complement of (a), whereby the growth, development or reproductive ability of the plant is reduced, relative to a plant not treated with the composition.
  • 2. The method of claim 1, wherein the transfer agent is selected from the group consisting of an organosilicone surfactant, a cationic lipid reagent, and a plant hormone.
  • 3. The method of claim 2, wherein the cationic lipid reagent is N41-(2,3-Dioleoyloxy)propyll-N,N,N-trimethylammonium methyl-sulfate (DOTAP), or wherein the plant hormone is brassinosteroid.
  • 4. The method of claim 1, wherein the plant is selected from the group consisting of Amaranthus palmeri, Amaranthus rudis, Amaranthus albus, Amaranthus chlorostachys, Amaranthus graecizans, Amaranthus hybridus, Amaranthus lividus, Amaranthus spinosus, Amaranthus thunbergii, Amaranthus viridis, Lolium multiflorum, Lolium rigidum, Ambrosia artemisiifolia, Ambrosia trifida, Euphorbia heterophylla, Kochia scoparia, Abutilon theophrasti, Sorghum halepense, Chenopodium album, Commelina diffusa, Convolvulus arvensis, Conyza canadensis, Digitaria sanguinalis, and Xanthium strumarium.
  • 5. The method of claim 1, wherein the composition further comprises one or more of an EPSPS-inhibitor herbicide and two different dsRNA polynucleotides, one consisting of a strand of SEQ ID NO: 3 and its reverse complement, and the other consisting of a strand of SEQ ID NO: 5 and its reverse complement.
  • 6. The method of claim 5, wherein the composition further comprises a component selected from the group consisting of an auxin-like herbicide, 3,6-dichloro-o-anisic acid, 2,4-dichlorophenoxyacetic acid, and one or more herbicides different from the one or more of the EPSPS-inhibitor herbicide.
  • 7. A composition comprising: a dsRNA polynucleotide and a transfer agent, wherein the dsRNA polynucleotide comprises (a) a strand consisting of SEQ ID NO: 3 or 5; and (b) a strand comprising the reverse complement of (a).
  • 8. The composition of claim 7, wherein the transfer agent is selected from the group consisting of an organosilicone surfactant, a cationic lipid reagent, and brassinosteroid.
  • 9. The composition of claim 8, wherein the composition further comprises ammonium sulfate.
  • 10. The composition of claim 8, wherein the cationic lipid reagent is N41-(2,3-Dioleoyloxy)propyll-N,N,N-trimethylammonium methyl-sulfate (DOTAP).
  • 11. The composition of claim 7, further comprising an EPSPS-inhibitor herbicide.
  • 12. The composition of claim 11, wherein the EPSPS-inhibitor herbicide is glyphosate.
  • 13. The composition of claim 11, further comprising a non-EPSPS-inhibitor herbicide.
  • 14. The composition of claim 13, wherein the non-EPSPS-inhibitor herbicide is 3,6-dichloro-o-anisic acid or 2,4-dichlorophenoxyacetic acid.
  • 15. A method of sensitizing a weedy plant to an EPSPS-inhibitor herbicide comprising: treating the weedy plant with a dsRNA polynucleotide, wherein the dsRNA polynucleotide comprises (a) a strand consisting of SEQ ID NO: 3 or 5; and (b) a strand comprising the reverse complement of (a), whereby the weedy plant is more sensitive to the EPSPS-inhibitor herbicide relative to a weedy plant not treated with the dsRNA polynucleotide.
  • 16. The method of claim 15, wherein the EPSPS-inhibitor herbicide is glyphosate.
  • 17. The method of claim 15, wherein the weedy plant is resistant to glyphosate, 3,6-dichloro-o-anisic acid, sulfonylurea, or a combination thereof.
  • 18. The method of claim 15, wherein the weedy plant is selected from the group consisting of Amaranthus palmeri, Amaranthus rudis, Amaranthus albus, Amaranthus chlorostachys, Amaranthus graecizans, Amaranthus hybridus, Amaranthus lividus, Amaranthus spinosus, Amaranthus thunbergii, Amaranthus viridis, Lolium multiflorum, Lolium rigidum, Ambrosia artemisiifolia, Ambrosia trifida, Euphorbia heterophylla, Kochia scoparia, Abutilon theophrasti, Sorghum halepense, Chenopodium album, Commelina diffusa, Convolvulus arvensis, Conyza canadensis, Digitaria sanguinalis, and Xanthium strumarium.
CROSS-REFERENCE TO RELATED APPLICATIONS

This application is a U.S. National Stage Application of PCT/US2015/011408, filed on Jan. 14, 2015, which claims the benefit of U.S. Provisional Application No. 61/927,682, filed on Jan. 15, 2014, which is incorporated by reference in its entirety herein.

PCT Information
Filing Document Filing Date Country Kind
PCT/US2015/011408 1/14/2015 WO 00
Publishing Document Publishing Date Country Kind
WO2015/108982 7/23/2015 WO A
US Referenced Citations (386)
Number Name Date Kind
3687808 Merigan et al. Aug 1972 A
3791932 Schuurs et al. Feb 1974 A
3839153 Schuurs et al. Oct 1974 A
3850578 McConnell Nov 1974 A
3850752 Schuurs et al. Nov 1974 A
3853987 Dreyer Dec 1974 A
3867517 Ling Feb 1975 A
3879262 Schuurs et al. Apr 1975 A
3901654 Gross Aug 1975 A
3935074 Rubenstein et al. Jan 1976 A
3984533 Uzgiris Oct 1976 A
3996345 Ullman et al. Dec 1976 A
4034074 Miles Jul 1977 A
4098876 Piasio et al. Jul 1978 A
4469863 Ts'o et al. Sep 1984 A
4476301 Imbach et al. Oct 1984 A
4535060 Comai Aug 1985 A
4581847 Hibberd et al. Apr 1986 A
4666828 Gusella May 1987 A
4683202 Mullis Jul 1987 A
4761373 Anderson et al. Aug 1988 A
4769061 Comai Sep 1988 A
4801531 Frossard Jan 1989 A
4810648 Stalker Mar 1989 A
4879219 Wands et al. Nov 1989 A
4940835 Shah et al. Jul 1990 A
4971908 Kishore et al. Nov 1990 A
5004863 Umbeck Apr 1991 A
5011771 Bellet et al. Apr 1991 A
5013659 Bedbrook et al. May 1991 A
5015580 Christou et al. May 1991 A
5023243 Tullis Jun 1991 A
5034506 Summerton et al. Jul 1991 A
5094945 Comai Mar 1992 A
5141870 Bedbrook et al. Aug 1992 A
5145783 Kishore et al. Sep 1992 A
5159135 Umbeck Oct 1992 A
5166315 Summerton et al. Nov 1992 A
5177196 Meyer, Jr. et al. Jan 1993 A
5185444 Summerton et al. Feb 1993 A
5188642 Shah et al. Feb 1993 A
5188897 Suhadolnik et al. Feb 1993 A
5192659 Simons Mar 1993 A
5214134 Weis et al. May 1993 A
5216141 Benner Jun 1993 A
5235033 Summerton et al. Aug 1993 A
5264423 Cohen et al. Nov 1993 A
5264562 Matteucci Nov 1993 A
5264564 Matteucci Nov 1993 A
5272057 Smulson et al. Dec 1993 A
5276019 Cohen et al. Jan 1994 A
5281521 Trojanowski et al. Jan 1994 A
5286634 Stadler et al. Feb 1994 A
5286717 Cohen et al. Feb 1994 A
5304732 Anderson et al. Apr 1994 A
5310667 Eichholtz et al. May 1994 A
5312910 Kishore et al. May 1994 A
5321131 Agrawal et al. Jun 1994 A
5331107 Anderson et al. Jul 1994 A
5339107 Henry et al. Aug 1994 A
5346107 Bouix et al. Sep 1994 A
5378824 Bedbrook et al. Jan 1995 A
5390667 Kumakura et al. Feb 1995 A
5392910 Bell et al. Feb 1995 A
5393175 Courville Feb 1995 A
5399676 Froehler Mar 1995 A
5405938 Summerton et al. Apr 1995 A
5405939 Suhadolnik et al. Apr 1995 A
5416011 Hinchee et al. May 1995 A
5453496 Caruthers et al. Sep 1995 A
5455233 Spielvogel et al. Oct 1995 A
5459127 Felgner et al. Oct 1995 A
5460667 Moriyuki et al. Oct 1995 A
5462910 Ito et al. Oct 1995 A
5463174 Moloney et al. Oct 1995 A
5463175 Barry et al. Oct 1995 A
5466677 Baxter et al. Nov 1995 A
5470967 Huie et al. Nov 1995 A
5476925 Letsinger et al. Dec 1995 A
5489520 Adams et al. Feb 1996 A
5489677 Sanghvi et al. Feb 1996 A
5491288 Chaubet et al. Feb 1996 A
5510471 Lebrun et al. Apr 1996 A
5518908 Corbin et al. May 1996 A
5519126 Hecht May 1996 A
5536821 Agrawal et al. Jul 1996 A
5538880 Lundquist et al. Jul 1996 A
5541306 Agrawal et al. Jul 1996 A
5541307 Cook et al. Jul 1996 A
5550111 Suhadolnik et al. Aug 1996 A
5550318 Adams et al. Aug 1996 A
5550398 Kocian et al. Aug 1996 A
5550468 Häberlein et al. Aug 1996 A
5558071 Ward et al. Sep 1996 A
5561225 Maddry et al. Oct 1996 A
5561236 Leemans et al. Oct 1996 A
5563253 Agrawal et al. Oct 1996 A
5569834 Hinchee et al. Oct 1996 A
5571799 Tkachuk et al. Nov 1996 A
5587361 Cook et al. Dec 1996 A
5591616 Hiei et al. Jan 1997 A
5593874 Brown et al. Jan 1997 A
5596086 Matteucci et al. Jan 1997 A
5597717 Guerineau et al. Jan 1997 A
5602240 De Mesmaeker et al. Feb 1997 A
5605011 Bedbrook et al. Feb 1997 A
5608046 Cook et al. Mar 1997 A
5610289 Cook et al. Mar 1997 A
5618704 Sanghvi et al. Apr 1997 A
5623070 Cook et al. Apr 1997 A
5625050 Beaton et al. Apr 1997 A
5627061 Barry et al. May 1997 A
5633360 Bischofberger et al. May 1997 A
5633435 Barry et al. May 1997 A
5633448 Lebrun et al. May 1997 A
5639024 Mueller et al. Jun 1997 A
5646024 Leemans et al. Jul 1997 A
5648477 Leemans et al. Jul 1997 A
5663312 Chaturvedula Sep 1997 A
5677437 Teng et al. Oct 1997 A
5677439 Weis et al. Oct 1997 A
5719046 Guerineau et al. Feb 1998 A
5721138 Lawn Feb 1998 A
5731180 Dietrich Mar 1998 A
5739180 Taylor-Smith Apr 1998 A
5746180 Jefferson et al. May 1998 A
5767361 Dietrich Jun 1998 A
5767373 Ward et al. Jun 1998 A
5780708 Lundquist et al. Jul 1998 A
5804425 Barry et al. Sep 1998 A
5824877 Hinchee et al. Oct 1998 A
5837848 Ely et al. Nov 1998 A
5859347 Brown et al. Jan 1999 A
5866775 Eichholtz et al. Feb 1999 A
5874265 Adams et al. Feb 1999 A
5879903 Strauch et al. Mar 1999 A
5914451 Martinell et al. Jun 1999 A
5919675 Adams et al. Jul 1999 A
5928937 Kakefuda et al. Jul 1999 A
5939602 Volrath et al. Aug 1999 A
5969213 Adams et al. Oct 1999 A
5981840 Zhao et al. Nov 1999 A
5985793 Sandbrink et al. Nov 1999 A
RE36449 Lebrun et al. Dec 1999 E
6040497 Spencer et al. Mar 2000 A
6056938 Unger et al. May 2000 A
6069115 Pallett et al. May 2000 A
6084089 Mine et al. Jul 2000 A
6084155 Volrath et al. Jul 2000 A
6118047 Anderson et al. Sep 2000 A
6121513 Zhang et al. Sep 2000 A
6130366 Herrera-Estrella et al. Oct 2000 A
6140078 Sanders et al. Oct 2000 A
6153812 Fry et al. Nov 2000 A
6160208 Lundquist et al. Dec 2000 A
6177616 Bartsch et al. Jan 2001 B1
6194636 McElroy et al. Feb 2001 B1
6225105 Sathasivan et al. May 2001 B1
6225114 Eichholtz et al. May 2001 B1
6232526 McElroy et al. May 2001 B1
6245968 Boudec et al. Jun 2001 B1
6248876 Barry et al. Jun 2001 B1
6252138 Karimi et al. Jun 2001 B1
RE37287 Lebrun et al. Jul 2001 E
6268549 Sailland et al. Jul 2001 B1
6271359 Norris et al. Aug 2001 B1
6282837 Ward et al. Sep 2001 B1
6288306 Ward et al. Sep 2001 B1
6288312 Christou et al. Sep 2001 B1
6294714 Matsunaga et al. Sep 2001 B1
6326193 Liu et al. Dec 2001 B1
6329571 Hiei Dec 2001 B1
6348185 Piwnica-Worms Feb 2002 B1
6365807 Christou et al. Apr 2002 B1
6384301 Martinell et al. May 2002 B1
6385902 Schipper et al. May 2002 B1
6399861 Anderson et al. Jun 2002 B1
6403865 Koziel et al. Jun 2002 B1
6414222 Gengenbach et al. Jul 2002 B1
6421956 Boukens et al. Jul 2002 B1
6426446 McElroy et al. Jul 2002 B1
6433252 Kriz et al. Aug 2002 B1
6437217 McElroy et al. Aug 2002 B1
6453609 Soll et al. Sep 2002 B1
6479291 Kumagai et al. Nov 2002 B2
6506559 Fire et al. Jan 2003 B1
6642435 Rafalski et al. Nov 2003 B1
6644341 Chemo et al. Nov 2003 B1
6645914 Woznica et al. Nov 2003 B1
6768044 Boudec et al. Jul 2004 B1
6992237 Habben et al. Jan 2006 B1
7022896 Weeks et al. Apr 2006 B1
7026528 Cheng et al. Apr 2006 B2
RE39247 Barry et al. Aug 2006 E
7105724 Weeks et al. Sep 2006 B2
7119256 Shimizu et al. Oct 2006 B2
7138564 Tian et al. Nov 2006 B2
7297541 Moshiri et al. Nov 2007 B2
7304209 Zink et al. Dec 2007 B2
7312379 Andrews et al. Dec 2007 B2
7323310 Peters et al. Jan 2008 B2
7371927 Yao et al. May 2008 B2
7392379 Le Pennec et al. Jun 2008 B2
7405347 Hammer et al. Jul 2008 B2
7406981 Hemo et al. Aug 2008 B2
7462379 Fukuda et al. Dec 2008 B2
7485777 Nakajima et al. Feb 2009 B2
7525013 Hildebrand et al. Apr 2009 B2
7550578 Budworth et al. Jun 2009 B2
7622301 Ren et al. Nov 2009 B2
7657299 Huizenga et al. Feb 2010 B2
7671254 Tranel et al. Mar 2010 B2
7714188 Castle et al. May 2010 B2
7738626 Weese et al. Jun 2010 B2
7807791 Sekar et al. Oct 2010 B2
7838263 Dam et al. Nov 2010 B2
7838733 Wright et al. Nov 2010 B2
7842856 Tranel et al. Nov 2010 B2
7884262 Clemente et al. Feb 2011 B2
7910805 Duck et al. Mar 2011 B2
7935869 Pallett et al. May 2011 B2
7943819 Baum et al. May 2011 B2
7973218 McCutchen et al. Jul 2011 B2
8090164 Bullitt et al. Jan 2012 B2
8143480 Axtell et al. Mar 2012 B2
8548778 Hart et al. Oct 2013 B1
8554490 Tang et al. Oct 2013 B2
9121022 Sammons Sep 2015 B2
9422557 Ader Aug 2016 B2
9445603 Baum et al. Sep 2016 B2
20010006797 Kumagai et al. Jul 2001 A1
20010042257 Connor-Ward et al. Nov 2001 A1
20020069430 Kiaska et al. Jun 2002 A1
20020114784 Li et al. Aug 2002 A1
20030150017 Mesa et al. Aug 2003 A1
20030154508 Stevens et al. Aug 2003 A1
20030167537 Jiang Sep 2003 A1
20040029275 Brown et al. Feb 2004 A1
20040053289 Allen et al. Mar 2004 A1
20040055041 Labate et al. Mar 2004 A1
20040072692 Hoffman et al. Apr 2004 A1
20040082475 Hoffman et al. Apr 2004 A1
20040123347 Hinchey et al. Jun 2004 A1
20040126845 Eenennaam et al. Jul 2004 A1
20040133944 Hake et al. Jul 2004 A1
20040147475 Li et al. Jul 2004 A1
20040177399 Hammer et al. Sep 2004 A1
20040216189 Houmard et al. Oct 2004 A1
20040244075 Cai et al. Dec 2004 A1
20040250310 Shukla et al. Dec 2004 A1
20050005319 della-Cioppa et al. Jan 2005 A1
20050044591 Yao et al. Feb 2005 A1
20050215435 Menges et al. Sep 2005 A1
20050246784 Plesch et al. Nov 2005 A1
20050250647 Hills et al. Nov 2005 A1
20060009358 Kibler et al. Jan 2006 A1
20060021087 Baum et al. Jan 2006 A1
20060040826 Eaton et al. Feb 2006 A1
20060111241 Gerwick, III et al. May 2006 A1
20060130172 Whaley et al. Jun 2006 A1
20060135758 Wu Jun 2006 A1
20060200878 Lutfiyya et al. Sep 2006 A1
20060223708 Hoffmann et al. Oct 2006 A1
20060223709 Helmke et al. Oct 2006 A1
20060247197 Van De Craen et al. Nov 2006 A1
20060272049 Waterhouse et al. Nov 2006 A1
20060276339 Windsor et al. Dec 2006 A1
20070011775 Allen et al. Jan 2007 A1
20070021360 Nyce et al. Jan 2007 A1
20070050863 Tranel et al. Mar 2007 A1
20070124836 Baum et al. May 2007 A1
20070199095 Allen et al. Aug 2007 A1
20070250947 Boukharov et al. Oct 2007 A1
20070259785 Heck et al. Nov 2007 A1
20070269815 Rivory et al. Nov 2007 A1
20070281900 Cui et al. Dec 2007 A1
20070300329 Allen et al. Dec 2007 A1
20080022423 Roberts et al. Jan 2008 A1
20080050342 Fire et al. Feb 2008 A1
20080092256 Kohn Apr 2008 A1
20080113351 Naito et al. May 2008 A1
20080155716 Sonnewald et al. Jun 2008 A1
20080214443 Baum et al. Sep 2008 A1
20090011934 Zawierucha et al. Jan 2009 A1
20090018016 Duck et al. Jan 2009 A1
20090036311 Witschel et al. Feb 2009 A1
20090054240 Witschel et al. Feb 2009 A1
20090075921 Ikegawa et al. Mar 2009 A1
20090098614 Zamore et al. Apr 2009 A1
20090118214 Paldi et al. May 2009 A1
20090137395 Chicoine et al. May 2009 A1
20090165153 Wang et al. Jun 2009 A1
20090165166 Feng et al. Jun 2009 A1
20090172838 Axtell et al. Jul 2009 A1
20090188005 Boukharov et al. Jul 2009 A1
20090205079 Kumar et al. Aug 2009 A1
20090215628 Witschel et al. Aug 2009 A1
20090285784 Raemaekers et al. Nov 2009 A1
20090293148 Ren et al. Nov 2009 A1
20090298787 Raemaekers et al. Dec 2009 A1
20090306189 Raemaekers et al. Dec 2009 A1
20090307803 Baum et al. Dec 2009 A1
20100005551 Roberts et al. Jan 2010 A1
20100048670 Biard et al. Feb 2010 A1
20100068172 Van De Craen Mar 2010 A1
20100071088 Sela et al. Mar 2010 A1
20100099561 Selby et al. Apr 2010 A1
20100100988 Tranel et al. Apr 2010 A1
20100152443 Hirai et al. Jun 2010 A1
20100154083 Ross et al. Jun 2010 A1
20100192237 Ren et al. Jul 2010 A1
20100247578 Salama Sep 2010 A1
20110015084 Christian et al. Jan 2011 A1
20110015284 Dees et al. Jan 2011 A1
20110028412 Cappello et al. Feb 2011 A1
20110035836 Eudes et al. Feb 2011 A1
20110041400 Trias Vila et al. Feb 2011 A1
20110053226 Rohayem Mar 2011 A1
20110098180 Michel et al. Apr 2011 A1
20110105327 Nelson May 2011 A1
20110105329 Song et al. May 2011 A1
20110112570 Mannava et al. May 2011 A1
20110126310 Feng et al. May 2011 A1
20110126311 Velcheva et al. May 2011 A1
20110152339 Brown et al. Jun 2011 A1
20110152346 Karleson et al. Jun 2011 A1
20110152353 Koizumi et al. Jun 2011 A1
20110160082 Woo et al. Jun 2011 A1
20110166022 Israels et al. Jul 2011 A1
20110166023 Nettleton-Hammond et al. Jul 2011 A1
20110171176 Baas et al. Jul 2011 A1
20110171287 Saarma et al. Jul 2011 A1
20110177949 Krapp et al. Jul 2011 A1
20110185444 Li et al. Jul 2011 A1
20110185445 Bogner et al. Jul 2011 A1
20110191897 Poree et al. Aug 2011 A1
20110201501 Song et al. Aug 2011 A1
20110296555 Ivashuta et al. Dec 2011 A1
20110296556 Sammons et al. Dec 2011 A1
20120036594 Cardoza et al. Feb 2012 A1
20120107355 Harris et al. May 2012 A1
20120108497 Paldi et al. May 2012 A1
20120137387 Baum et al. May 2012 A1
20120150048 Kang et al. Jun 2012 A1
20120156784 Adams, Jr. et al. Jun 2012 A1
20120157512 Ben-Chanoch et al. Jun 2012 A1
20120164205 Baum et al. Jun 2012 A1
20120185967 Sela et al. Jul 2012 A1
20120198586 Narva et al. Aug 2012 A1
20120230565 Steinberg et al. Sep 2012 A1
20120258646 Sela et al. Oct 2012 A1
20130003213 Kabelac et al. Jan 2013 A1
20130041004 Drager et al. Feb 2013 A1
20130047297 Sammons Feb 2013 A1
20130047298 Tang Feb 2013 A1
20130060133 Kassab et al. Mar 2013 A1
20130067618 Ader Mar 2013 A1
20130084243 Goetsch et al. Apr 2013 A1
20130096073 Sidelman Apr 2013 A1
20130097726 Ader Apr 2013 A1
20130212739 Giritch et al. Aug 2013 A1
20130226003 Edic et al. Aug 2013 A1
20130247247 Ader Sep 2013 A1
20130254940 Ader Sep 2013 A1
20130254941 Ader Sep 2013 A1
20130288895 Ader Oct 2013 A1
20130318657 Avniel et al. Nov 2013 A1
20130318658 Ader et al. Nov 2013 A1
20130324842 Mittal et al. Dec 2013 A1
20130326731 Ader Dec 2013 A1
20140018241 Sammons Jan 2014 A1
20140057789 Sammons Feb 2014 A1
20140109258 Van De Craen et al. Apr 2014 A1
20140215656 Crawford Jul 2014 A1
20140230090 Avniel et al. Aug 2014 A1
20140274712 Finnessy Sep 2014 A1
20140275208 Hu et al. Sep 2014 A1
20140283211 Crawford Sep 2014 A1
20140296503 Avniel et al. Oct 2014 A1
20150096079 Avniel et al. Apr 2015 A1
20150143580 Beattie et al. May 2015 A1
20150159156 Inberg et al. Jun 2015 A1
20150203867 Beattie et al. Jul 2015 A1
20150240258 Beattie et al. Aug 2015 A1
20160015035 Tao Jan 2016 A1
20160029644 Tao Feb 2016 A1
Foreign Referenced Citations (259)
Number Date Country
2008258254 Jul 2014 AU
101279950 Oct 2008 CN
101279951 Oct 2008 CN
101892247 Nov 2010 CN
101914540 Dec 2010 CN
102154364 Aug 2011 CN
102481311 May 2012 CN
102822350 Dec 2012 CN
102906263 Jan 2013 CN
288618 Apr 1991 DE
10000600 Jul 2001 DE
10116399 Oct 2002 DE
10256353 Jun 2003 DE
10256354 Jun 2003 DE
10256367 Jun 2003 DE
10204951 Aug 2003 DE
10234875 Feb 2004 DE
10234876 Feb 2004 DE
102004054666 May 2006 DE
102005014638 Oct 2006 DE
102005014906 Oct 2006 DE
102007012168 Sep 2008 DE
102010042866 May 2011 DE
0 804 600 Nov 1997 EP
1 157 991 Nov 2001 EP
1 238 586 Sep 2002 EP
1 416 049 May 2004 EP
1 496 123 Jan 2005 EP
1 889 902 Feb 2008 EP
2 147 919 Jan 2010 EP
2 160 098 Nov 2010 EP
2 530 159 Mar 2011 EP
2 305 813 Apr 2011 EP
2 545 182 Jan 2013 EP
2001253874 Sep 2001 JP
2002080454 Mar 2002 JP
2002138075 May 2002 JP
2002145707 May 2002 JP
2002220389 Aug 2002 JP
2003064059 Mar 2003 JP
2003096059 Apr 2003 JP
2004051628 Feb 2004 JP
2004107228 Apr 2004 JP
2005008583 Jan 2005 JP
2005239675 Sep 2005 JP
2005314407 Nov 2005 JP
2006232824 Sep 2006 JP
2006282552 Oct 2006 JP
2007153847 Jun 2007 JP
2007161701 Jun 2007 JP
2007182404 Jul 2007 JP
2008074840 Apr 2008 JP
2008074841 Apr 2008 JP
2008133207 Jun 2008 JP
2008133218 Jun 2008 JP
2008169121 Jul 2008 JP
2009-508481 Mar 2009 JP
2009067739 Apr 2009 JP
2009114128 May 2009 JP
2009126792 Jun 2009 JP
2009137851 Jun 2009 JP
WO 8911789 Dec 1989 WO
WO 9534659 Dec 1995 WO
WO 9534668 Dec 1995 WO
WO 96005721 Feb 1996 WO
WO 96033270 Oct 1996 WO
WO 96038567 Dec 1996 WO
WO 96040964 Dec 1996 WO
WO 9749816 Dec 1997 WO
WO 99024585 May 1999 WO
WO 9926467 Jun 1999 WO
WO 9927116 Jun 1999 WO
WO 9932619 Jul 1999 WO
WO 9961631 Dec 1999 WO
WO 9967367 Dec 1999 WO
WO 0032757 Jun 2000 WO
WO 00044914 Aug 2000 WO
WO 0107601 Feb 2001 WO
WO 2001007601 Feb 2001 WO
WO 2001085970 Nov 2001 WO
WO 0214472 Feb 2002 WO
WO 02066660 Aug 2002 WO
WO 03000679 Jan 2003 WO
WO 03006422 Jan 2003 WO
WO 2003004649 Jan 2003 WO
WO 03012052 Feb 2003 WO
WO 03013247 Feb 2003 WO
WO 03016308 Feb 2003 WO
WO 2003014357 Feb 2003 WO
WO 03020704 Mar 2003 WO
WO 03022051 Mar 2003 WO
WO 03022831 Mar 2003 WO
WO 03022843 Mar 2003 WO
WO 03029243 Apr 2003 WO
WO 03037085 May 2003 WO
WO 03037878 May 2003 WO
WO 03045878 Jun 2003 WO
WO 03050087 Jun 2003 WO
WO 03051823 Jun 2003 WO
WO 03051824 Jun 2003 WO
WO 03051846 Jun 2003 WO
WO 03064625 Aug 2003 WO
WO 03076409 Sep 2003 WO
WO 03077648 Sep 2003 WO
WO 03087067 Oct 2003 WO
WO 03090539 Nov 2003 WO
WO 03091217 Nov 2003 WO
WO 03093269 Nov 2003 WO
WO 03104206 Dec 2003 WO
WO 2004002947 Jan 2004 WO
WO 2004002981 Jan 2004 WO
WO 2004005485 Jan 2004 WO
WO 2004009761 Jan 2004 WO
WO 2004011429 Feb 2004 WO
WO 2004022771 Mar 2004 WO
WO 2004029060 Apr 2004 WO
WO 2004035545 Apr 2004 WO
WO 2004035563 Apr 2004 WO
WO 2004035564 Apr 2004 WO
WO 2004037787 May 2004 WO
WO 2004049806 Jun 2004 WO
WO 2004062351 Jul 2004 WO
WO 2004067518 Aug 2004 WO
WO 2004067527 Aug 2004 WO
WO 2004074443 Sep 2004 WO
WO 2004077950 Sep 2004 WO
WO 2005000824 Jan 2005 WO
WO 2005003362 Jan 2005 WO
WO 2005007627 Jan 2005 WO
WO 2005007860 Jan 2005 WO
WO 2005040152 May 2005 WO
WO 2005047233 May 2005 WO
WO 2005047281 May 2005 WO
WO 2005061443 Jul 2005 WO
WO 2005061464 Jul 2005 WO
WO 2005068434 Jul 2005 WO
WO 2005070889 Aug 2005 WO
WO 2005089551 Sep 2005 WO
WO 2005095335 Oct 2005 WO
WO 2005107437 Nov 2005 WO
WO 2005110068 Nov 2005 WO
WO 2006006569 Jan 2006 WO
WO 2006024820 Mar 2006 WO
WO 2006029828 Mar 2006 WO
WO 2006029829 Mar 2006 WO
WO 2006037945 Apr 2006 WO
WO 2006050803 May 2006 WO
WO 2006074400 Jul 2006 WO
WO 2006090792 Aug 2006 WO
WO 2006123088 Nov 2006 WO
WO 2006125687 Nov 2006 WO
WO 2006125688 Nov 2006 WO
WO 2006132270 Dec 2006 WO
WO 2006138638 Dec 2006 WO
WO 2007003294 Jan 2007 WO
WO 2007007316 Jan 2007 WO
WO 2007024783 Mar 2007 WO
WO 2007026834 Mar 2007 WO
WO 2007035650 Mar 2007 WO
WO 2007038788 Apr 2007 WO
WO 2007039454 Apr 2007 WO
WO 2007050715 May 2007 WO
WO 2007051462 May 2007 WO
WO 2007070389 Jun 2007 WO
WO 2007071900 Jun 2007 WO
WO 2007074405 Jul 2007 WO
WO 2007077201 Jul 2007 WO
WO 2007077247 Jul 2007 WO
WO 2007080126 Jul 2007 WO
WO 2007080127 Jul 2007 WO
WO 2007083193 Jul 2007 WO
WO 2007096576 Aug 2007 WO
WO 2007051462 Oct 2007 WO
WO 2007119434 Oct 2007 WO
WO 2007134984 Nov 2007 WO
WO 2008007100 Jan 2008 WO
WO 2008009908 Jan 2008 WO
WO 2008029084 Mar 2008 WO
WO 2008042231 Apr 2008 WO
WO 2008059948 May 2008 WO
WO 2008063203 May 2008 WO
WO 2008071918 Jun 2008 WO
WO 2008074991 Jun 2008 WO
WO 2008084073 Jul 2008 WO
WO 2008100426 Aug 2008 WO
WO 2008102908 AI Aug 2008 WO
WO 2008148223 Dec 2008 WO
WO 2008152072 Dec 2008 WO
WO 2008152073 Dec 2008 WO
WO 2009000757 Dec 2008 WO
WO 2009005297 Jan 2009 WO
WO 2009029690 Mar 2009 WO
WO 2009035150 Mar 2009 WO
WO 2009037329 Mar 2009 WO
WO 2009046384 Apr 2009 WO
WO 2009063180 May 2009 WO
WO 2009068170 Jun 2009 WO
WO 2009068171 Jun 2009 WO
WO 2009086041 Jul 2009 WO
WO 2009090401 Jul 2009 WO
WO 2009090402 Jul 2009 WO
WO 2009115788 Sep 2009 WO
WO 2009116558 Sep 2009 WO
WO 2009125401 Oct 2009 WO
WO 2009144079 Dec 2009 WO
WO 2009152995 Dec 2009 WO
WO 2009158258 Dec 2009 WO
WO 2010012649 Feb 2010 WO
WO 2010026989 Mar 2010 WO
WO 2010034153 Apr 2010 WO
WO 2010049270 May 2010 WO
WO 2010049369 May 2010 WO
WO 2010049405 May 2010 WO
WO 2010049414 May 2010 WO
WO 2010056519 May 2010 WO
WO 2010063422 Jun 2010 WO
WO 2010069802 Jun 2010 WO
WO 2010078906 Jul 2010 WO
WO 2010078912 Jul 2010 WO
WO 2010093788 Aug 2010 WO
WO 2010104217 Sep 2010 WO
WO 2010108611 Sep 2010 WO
WO 2010112826 Oct 2010 WO
WO 2010116122 Oct 2010 WO
WO 2010119906 Oct 2010 WO
WO 2010130970 Nov 2010 WO
WO 2011001434 Jan 2011 WO
WO 2011003776 Jan 2011 WO
WO 2011035874 Mar 2011 WO
WO 2011045796 Apr 2011 WO
WO 2011065451 Jun 2011 WO
WO 2011067745 Jun 2011 WO
WO 2011075188 Jun 2011 WO
WO 2011080674 Jul 2011 WO
WO 2011112570 Sep 2011 WO
WO 2011132127 Oct 2011 WO
WO 2012001626 Jan 2012 WO
WO 2012056401 May 2012 WO
WO 2012092580 Jul 2012 WO
WO 2012164100 Dec 2012 WO
WO 2013010691 Jan 2013 WO
WO 2013025670 Feb 2013 WO
WO 2013039990 Mar 2013 WO
WO 2013040005 Mar 2013 WO
WO 2013040021 Mar 2013 WO
WO 2013040033 Mar 2013 WO
WO 2013040049 Mar 2013 WO
WO 2013040057 Mar 2013 WO
WO 2013040116 Mar 2013 WO
WO 2013040117 Mar 2013 WO
WO 2013153553 Oct 2013 WO
WO 2013175480 Nov 2013 WO
WO 2014022739 Feb 2014 WO
WO 2014106837 Jul 2014 WO
WO 2014106838 Jul 2014 WO
WO 2014151255 Sep 2014 WO
WO 2014164761 Oct 2014 WO
WO 2014164797 Oct 2014 WO
WO 2015010026 Jan 2015 WO
Non-Patent Literature Citations (598)
Entry
GenBank Accession No. FJ861242.1, Amaranthus palmeri 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) mRNA, Feb. 3, 2010 (Year: 2010).
5′-leader responsible for enhancing translation, Nucleic Acids Res., 20(17):4631-4638 (1992).
Agricultural Chemical Usage 2006 Vegetables Summary, Agricultural Statistics Board, NASS, USDA, pp. 1-372 (2007).
Agrios, Plant Pathology (Second Edition), 2:466-470 (1978).
Alarcón-Reverte et al., “Resistance to ACCase-inhibiting herbicides in the weed Lolium multiflorum,” Comm. Appl. Biol. Sci., 73(4):899-902 (2008).
Al-Kaff et al,, “Plants rendered herbicide-susceptible by cauliflower mosaic virus—elicited suppression of a 35S promoter-regulated transgene,” Nature Biotechnology, 18:995-999 (2000).
Amarzguioui et al., “An algorithm for selection of functional siRNA sequences,” Biochemical and Biophysical Research Communications, 316:1050-1058 (2004).
Ambrus et al., “The Diverse Roles of RNA Helicases in RNAi,” Cell Cycle, 8(21):3500-3505 (2009).
An et al., “Transient RNAi Induction against Endogenous Genes in Arabidopsis Protoplasts Using in Vitro-Prepared Double-Stranded RNA,” Biosci Biotechnol Biochem, 69(2):415-418 (2005).
Andersen et al., “Delivery of siRNA from lyophilized polymeric surfaces,” Biomaterials, 29:506-512 (2008).
Andersson et al., “A novel selection system for potato transformation using a mutated AHAS gene,” Plant Cell Reports, 22(4):261-267 (2003).
Anonymous, “Resistant Weeds Spur Research Into New Technologies,” Grains Research & Development Corporation, 2013.
Anonymous, “A handbook for high-level expression and purification of 6xHis-tagged proteins,” The QiaExpressionist, (2003).
Anonymous, “Agronomy Facts 37: Adjuvants for enhancing herbicide performance,” n.p., 1-8, (Jan. 26, 2000), Web, (Jan. 21, 2014).
Anonymous, “Devgen, The mini-Monsanto,” KBC Securities (2006).
Anonymous, “Do Monsanto have the next big thing?,” Austalian Herbicide Resistance Initiative (AHRI), (Apr. 23, 2014) Web. (Jan. 19, 2015).
Aoki et al., “In Vivo Transfer Efficiency of Antisense Oligonucleotides into the Myocardium Using HVJ-Liposome Method,” Biochem Biophys Res Commun, 231:540-545 (1997).
Arpaia et al., “Production of transgenic eggplant (Solanum melongena L.) resistant to Colorado Potato Beetle (Leptinotarsa decemlineata Say),” (1997) Theor. Appl. Genet., 95:329-334 (1997).
Artymovich, “Using RNA interference to increase crop yield and decrease pest damage,” MMG 445 Basic Biotech., 5(1):7-12 (2009).
Ascencio-Ibanez et al., “DNA abrasion onto plants is an effective method for geminivirus infection and virus-induced gene silencing,” Journal of Virological Methods, 142:198-203 (2007).
Axtell et al., “A Two-Hit Trigger for siRNA Biogenesis in Plants,” Cell, 127:565-577 (2006).
Bachman et al., “Characterization of the spectrum of insecticidal activity of a double-stranded RNA with targeted activity against Western Corn Rootworm (Diabrotica virgifera virgifera LeConte),” Transgenic Res., pp. 1-16 (2013).
Baerson et al., “Glyphosate-Resistant Goosegrass. Identification of a Mutation in the Target Enzyme 5-Enolpyruvylshikimate-3-Phosphate Synthase,” Plant Physiol., 129(3):1265-1275 (2002).
Bai et al., “Naturally Occurring Broad-Spectrum Powdery Mildew Resistance in a Central American Tomato Accession Is Caused by Loss of Mlo Function,” MPMI, 21(1):30-39 (2008).
Balibrea et al., “Extracellular Invertase is an Essential Component of Cytokinin-Mediated Delay of Senescence,” The Plant Cell, 16(5):1276-1287 (2004).
Bannerjee et al., “Efficient production of transgenic potato (S. tuberosum L. ssp. andigena) plants via Agrobacterium tumefaciens-mediated transformation,” Plant Sci., 170:732 738 (2006).
Bart et al., “A novel system for gene silencing using siRNAs in rice leaf and stem-derived protoplasts,” Plant Methods, 2(13):1-9 (2006).
Basu et al., “Weed genomics: new tools to understand weed biology,” TRENDS in Plant Science, 9(8):391-398 (2004).
Baulcombe, “RNA silencing and heritable epigenetic effects in tomato and Arabidopsis,” Abstract 13th Annual Fall Symposium, Plant Genomes to Phenomes, Donald Danforth Plant Science Center, 28-30 (2011).
Bayer et al., “Programmable ligand-controlled riboregulators of eukaryotic gene expression,” Nature Biotechnol., 23(3):337-343 (2005).
Beal, et al., “Second Structural Motif for Recognition of DNA by Oligonucleotide-Directed Triple-Helix Formation,” Science, 251:1360-1363 (1992).
Becker et al., “Fertile transgenic wheat from microprojectile bombardment of scutellar tissue,” The Plant Journal, 5(2):299-307 (1994).
Bedell et al., “Sorghum Genome Sequencing by Methylation Filtration,” Plos Biology, 3(1):E13/104-115 (2005).
Bhargava et al., “Long double-stranded RNA-mediated RNA interference as a tool to achieve site-specific silencing of hypothalamic neuropeptides,” Brain Research Protocols, 13:115-125 (2004).
Boletta et al., “High Efficient Non-Viral Gene Delivery to the Rat Kidney by Novel Polycationic Vectors,” J. Am Soc. Nephrol., 7:1728 (1996).
Bolognesi et al., “Characterizing the Mechanism of Action of Double-Stranded RNA Activity against Western Corn Rootworm(Diabrotica virgifera virgifera LeConte),” PLoS ONE 7(10):e47534 (2012).
Bolter et al., “A chloroplastic inner envelope membrane protease is essential for plant development,” FEBS Letters, 580:789-794 (2006).
Bourgeois et al., “Field and producer survey of ACCase resistant wild oat in Manitoba,” Canadian Journal of Plant Science, 709-715 (1997).
Breaker et al., “A DNA enzyme with Mg2+-dependent RNA phosphoesterase activity,” Chemistry and Biology, 2:655-660 (1995).
Brodersen et al., “The diversity of RNA silencing pathways in plants,” Trends in Genetics, 22(5):268-280 (2006).
Brugière et al., “Glutamine Synthetase in the Phloem Plays a Major Role in Controlling Proline Production,” The Plant Cell, 11:1995-2011 (1999).
Burgos et al., “Review: Confirmation of Resistance to Herbicides and Evaluation of Resistance Levels,” Weed Science, 61(1):4-20 (2013).
Busch et al., “RNAi for discovery of novel crop protection products,” Pflanzenschutz-Nachrichten Bayer, 58(1):34-50 (2005)
Busi et al., “Gene flow increases the initial frequency of herbicide resistance alleles in unselectedpopulations,” Agriculture, Ecosystems and Environments, Elsevier, Amsterdam, NL, 142(3):403-409 (2011).
Butler et al., “Priming and re-drying improve the survival of mature seeds of Digitalis purpurea during storage,” Annals of Botany, 103:1261-1270 (2009).
Bytebier et al., “T-DNA organization in tumor cultures and transgenic plants of the monocotyledon Asparagus officinalis,” Proc. Natl. Acad. Sci. U.S.A., 84:5345-5349 (1987).
Campbell et al., “Gene-knockdown in the honey bee mite Varroa destructor by a non-invasive approach: studies on a glutathione S-transferase,” Parasites & Vectors, 3(1):73, pp. 1-10 (2010).
Chabannes et al., “In situ analysis of lignins in transgenic tobacco reveals a differential impact of individual transformations on the spatial patterns of lignin deposition at the cellular and subcellular levels,” The Plant Journal, 28(3):271-282 (2001).
Chabbouh et al., “Cucumber mosaic virus in artichoke,” FAO Plant Protection Bulletin, 38:52-53 (1990).
Chakravarty et al., “Genetic Transformation in Potato: Approaches and Strategies,” Amer J Potato Res, 84:301 311 (2007).
Chang et al., “Cellular Internalization of Fluorescent Proteins via Arginine-rich Intracellular Delivery Peptide in Plant Cells,” Plant Cell Physiol., 46(3):482-488 (2005).
Chee et al., “Transformation of Soybean (Glycine max) by Infecting Germinating Seeds with Agrobacterium tumefaciens,” Plant Physiol., 91:1212-1218 (1989).
Chen et al., “Exploring MicroRNA-Like Small RNAs in the Filamentous Fungus Fusarium oxysporum,” PLOS One, 9(8):e104956:1-10 (2014).
Chen et al., “In Vivo Analysis of the Role of atTic20 in Protein Import into Chloroplasts,” The Plant Cell, 14:641-654 (2002).
Chen et al., “Transfection and Expression of Plasmid DNA in Plant Cells by an Arginine-Rich Intracellular Delivery Peptide without Protoplast Preparation,” FEBS Letters 581, pp. 1891-1897 (2007).
Cheng et al., “Production of fertile transgenic peanut (Arachis hypogaea L.) plants using Agrobacterium tumefaciens,” Plant Cell Reports, 15:653-657 (1996).
Chi et al., “The Function of RH22, a Dead RNA Helicase, in the Biogenesis of the 50S Ribosomal Subunits of Arabidopsis Chloroplasts,” Plant Physiology, 158:693-707 (2012).
Chupp et al., “Chapter 8: White Rust,” Vegetable Diseases and Their Control, The Ronald Press Company, New York, pp. 267-269 (1960).
Clough et al., “Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana,” The Plant Journal, 16(6):735-743 (1998).
CN101914540 Patent Diclosure, “Introduction of RNA into plant by interference,” (2010).
Colbourne et al., “The Ecoresponsive Genome of Daphnia pulex,” Science, 331(6017):555-561 (2011).
Colliver et al., “Differential modification of flavonoid and isoflavonoid biosynthesis with an antisense chalcone synthase construct in transgenic Lotus corniculatus,” Plant Molecular Biology, 35:509-522 (1997).
Communication pursuant to Article 94(3) EPC dated Jan. 14, 2016, in European Patent Application No. 12 832 415.9.
Communication pursuant to Article 94(3) EPC dated Jun. 26, 2015, in European Patent Application No. 11 753 916.3.
Communication pursuant to Article 94(3) EPC dated Mar. 18, 2016, in European Patent Application No. 12 832 160.1.
Communication pursuant to Article 94(3) EPC dated Mar. 24, 2016, in European Patent Application No. 12 831 684.1.
Communication pursuant to Article 94(3) EPC dated Mar. 4, 2016, in European Patent Application No. 12 830 932.5.
Communication pursuant to Article 94(3) EPC dated Mar. 9, 2016, in European Patent Application No. 12 831 166.9.
Communication pursuant to Article 94(3) EPC dated Oct. 23, 2015, in European Patent Application No. 12 831 945.6.
Concise Descriptions of Relevance filed by a third party on Nov. 29, 2012, in U.S. Appl. No. 13/042,856.
Constan et al., “An outer envelope membrane component of the plastid protein import apparatus plays an essential role in Arabidopsis,” The Plant Journal, 38:93-106 (2004).
Cooney et al., “Site-Specific Oligonucleotide Binding Represses Transcription of the Human c-myc Gene in Vitro,” Science ,241:456-459 (1988).
COST Action FA0806 progress report “Plant virus control employing RNA-based vaccines: A novel non-transgenic strategy” (2010).
Coticchia et al., “Calmodulin modulates Akt activity in human breast cancer cell lines,” Breast Cancer Res. Treat, 115:545-560 (2009).
Dalakouras et al., “Induction of Silencing in Plants by High-Pressure Spraying of In vitro-Synthesized Small RNAs,” Frontiers in Plant Science, 7(1327):1-5 (2016).
Dalmay et al., “An RNA-Depenedent RNA Polymerase Gene in Arabidopsis is Required for Posttranscriptional Gene Silencing Mediated by a Transgene but Not by a Virus,” Cell, 101:543-553 (2000).
Davidson et al., “Engineering regulatory RNAs,” TRENDS in Biotechnology, 23(3):109-112 (2005).
Dawson et al., “cDNA cloning of the complete genome of tobacco mosaic virus and production of infectious transcripts,” Proc. Natl. Acad. Sci. USA, 83:1832-1836 (1986).
De Block, et al. “Engineering herbicide resistance in plants by expression of a detoxifying enzyme,” EMBO J. 6(9):2513-2519 (1987).
De Framond, “MINI-Ti: A New Vector Strategy for Plant Genetic Engineering,” Nature Biotechnology, 1:262-269 (1983).
Della-Cioppa et al., “Import of a precursor protein into chloroplasts is inhibited by the herbicide glyphosate,” The EMBO Journal, 7(5):1299-1305 (1988).
Desai et al., “Reduction in deformed wing virus infection in larval and adult honey bees (Apis mellifera L.) by double-stranded RNA ingestion,” Insect Molecular Biology, 21(4):446-455 (2012).
Di Stilio et al., “Virus-Induced Gene Silencing as a Tool for Comparative Functional Studies in Thalictrum,” PLoS One, 5(8):e12064 (2010).
Diallo et al., “Long Endogenous dsRNAs Can Induce Complete Gene Silencing in Mammalian Cells and Primary Cultures,” Oligonucleotides, 13:381-392 (2003).
Dietemann et al., “Varroa destructor: research avenues towards sustainable control,” Journal of Apicultural Research, 51(1):125-132 (2012).
Du et al., “A systematic analysis of the silencing effects of an active siRNA at all single-nucleotide mismatched target sites,” Nucleic Acids Research, 33(5):1671-1677 (2005).
Dunoyer et al., “Small RNA Duplexes Function as Mobile Silencing Signals Between Plant Cells,” Science, 328:912-916 (2010).
Eamens et al., “RNA Silencing in Plants: Yesterday, Today, and Tomorrow,” Plant Physiology, 147(2):456-468 (2008).
Ellington et al., “In vitro selection of RNA molecules that bind specific ligands,” Nature, 346:818-822 (1990).
Emery et al., “Radial Patterning of Arabidopsis Shoots by Class III HD-ZIP and KANADI Genes,” Current Biology, 13:1768-1774 (2003).
Eudes et al., “Cell-penetrating peptides,” Plant Signaling & Behavior, 3(8):549-5550 (2008).
European Cooperation in the field of Scientific and Technical Research—Memorandum of Understanding for COST Action FA0806 (2008).
European Search Report dated Sep. 7, 2017, in European Patent Application No. 17152830.0.
Extended European Search Report dated Feb. 2, 2015, in European Patent Application No. 12 830 932.5.
Extended European Search Report dated Feb. 27, 2015, in European Patent Application No. 12 832 160.1.
Extended European Search Report dated Feb. 3, 2015, in European Patent Application No. 12 831 945.6.
Extended European Search Report dated Jan. 20, 2016, in European Patent Application No. 13 794 339.5.
Extended European Search Report dated Jan. 21, 2015, in European Patent Application No. 12 832 415.9.
Extended European Search Report dated Jan. 29, 2015, in European Patent Application No. 12 831 567.8.
Extended European Search Report dated Jun. 29, 2015, in European Patent Application No. 12 831 494.5.
Extended European Search Report dated Mar. 17, 2015, in European Patent Application No. 12 831 684.1.
Extended European Search Report dated Mar. 3, 2015, in European Patent Application No. 12 831 166.9.
Extended European Search Report dated Nov. 7, 2017, in European Patent Application No. 15811092.4.
Extended European Search Report dated Nov. 8, 2017, in European Patent Application No. 15737282.2.
Extended European Search Report dated Oct. 8, 2013, in European Patent Application No. 11753916.3.
Extended European Search Report dated Sep. 29, 2016, in European Patent Application No. 14778840.0.
Farooq et al., “Rice seed priming,” IRPN, 30(2):45-48 (2005).
Fassler, BLAST Glossary, National Center for Biotechnology Information (2011).
Fernandez et al., “Uptake of Hydrophilic Solutes Through Plant Leaves: Current State of Knowledge and Perspectives of Foliar Fertilization,” Critical Reviews in Plant Sciences, 28:36-38 (2009).
Feuillet et al., “Crop genome sequencing: lessons and rationales,” Trends Plant Sci., 16:77-88 (2011).
Final Office Action dated Apr. 7, 2016, in U.S. Appl. No. 13/619,980.
Final Office Action dated Dec. 17, 2015, in U.S. Appl. No. 14/335,135.
Final Office Action dated Feb. 17, 2016, in U.S. Appl. No. 13/612,929.
Final Office Action dated Feb. 4, 2016, in U.S. Appl. No. 13/612,936.
Final Office Action dated Jun. 30, 2016, in U.S. Appl. No. 13/901,326.
Final Office Action dated Mar. 2, 2016, in U.S. Appl. No. 13/612,995.
Final Office Action dated Mar. 21, 2016, in U.S. Appl. No. 13/612,925.
Final Office Action dated May 26, 2016, in U.S. Appl. No. 14/532,596.
Final Office Action dated Nov. 10, 2015, in U.S. Appl. No. 13/612,985.
Final Office Action dated Nov. 10, 2016, in U.S. Appl. No. 13/583,302.
Final Office Action dated Nov. 19, 2015, in U.S. Appl. No. 13/612,941.
Final Office Action dated Nov. 30, 2015, in U.S. Appl. No. 13/612,948.
Final Office Action dated Nov. 7, 2013, in U.S. Appl. No. 13/042,856.
Final Office Action dated Oct. 20, 2016, in U.S. Appl. No. 14/480,199.
Final Office Action dated Oct. 22, 2015, in U.S. Appl. No. 14/608,951.
Final Office Action dated Sep. 9, 2016, in U.S. Appl. No. 13/612,954.
Final Office Action dated Sep. 9, 2016, in U.S. Appl. No. 14/603,347.
Final Office Action dated Sep. 9, 2016, in U.S. Appl. No. 14/608,951.
Fire et al., “Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans,” Nature, 391:806-811 (1998).
First Examination Report dated Apr. 23, 2013, in New Zealand Patent Application No. 601784.
First Examination Report dated Jul. 28, 2014, in New Zealand Patent Application No. 627060.
First Office Action dated Aug. 31, 2015, in Chinese Patent Application No. 201280053985.3.
First Office Action dated Feb. 2, 2016, in Chinese Patent Application No. 201380039346.6.
First Office Action dated Jul. 7, 2015, in Chinese Patent Application No. 201280054820.8.
First Office Action dated Mar. 12, 2015, in Chinese Patent Application No. 201280053984.9.
First Office Action dated Mar. 2, 2015, in Chinese Patent Application No. 201280054819.5.
First Office Action dated May 27, 2015, in Chinese Patent Application No. 201280054179.8.
First Office Action dated Sep. 9, 2015, in Chinese Patent Application No. 201280055409.2.
Fraley et al., “Liposome-mediated delivery of tobacco mosaic virus RNA into tobacco protoplasts: A sensitive assay for monitoring liposome-protoplast interactions,” Proc Natl Acad Sci U S A., 79(6):1859-1863 (1982).
Friedberg, “Automated protein function prediction—the genomic challenge,” Briefings in Bioinformatics, 7(3):225-242 (2006).
Fukuhara et al., “Enigmatic Double-Stranded RNA in Japonica Rice,” Plant Molecular Biology, 21:1121-1130 (1993).
Fukuhara et al., “The Unusual Structure of a Novel RNA Replicon in Rice,” The Journal of Biological Chemistry, 270(30):18147-18149 (1995).
Fukuhara et al., “The wide distribution of endornaviruses, large double-stranded RNA replicons with plasmid-like properties,” Archives of Virology, 151:995-1002 (2006).
Fukunaga et al., “dsRNA with 5′ overhangs v contributes to endogenous and antiviral RNA silencing pathways in plants,” The EMBO Journal, 28(5):545-555 (2009).
Funke et al., “Molecular basis for herbicide resistance in Roundup Ready crops,” PNAS, 103:13010-13015 (2006).
Further Examination Report dated May 16, 2014, in New Zealand Patent Application No. 601784.
Gaines et al., “Gene amplification confers glyphosate resistance in Amaranthus palmeri,” Proc. Natl. Acad. Sci. USA, 107(3):1029-1034 (2010).
Gallie et al., Identification of the motifs within the tobacco mosaic virus.
Gan et al., “Bacterially expressed dsRNA protects maize against SCMV infection,” Plant Cell Rep, 29(11):1261-1268 (2010).
Gan et al., “Inhibition of Leaf Senescence by Autoregulated Production of Cytokinin,” Science, 270:1986-1988 (1995).
Gao et al., “Down-regulation of acetolactate synthase compromises 01-1-mediated resistance to powdery mildew in tomato,” BMC Plant Biology, 14 (2014).
Gao et al., “Nonviral Methods for siRNA Delivery,” Molecular Pharmaceutics, 6(3):651-658 (2008).
Garbian et al., “Bidirectional Transfer of RNAi between Honey Bee and Varroa destructor: Varroa Gene Silencing Reduces Varroa Population,” 8(12):1-9:e1003035 (2012).
Gaskin et al., “Novel organosillicone adjuvants to reduce agrochemical spray volumes on row crops,” New Zealand Plant Protection, 53:350-354 (2000).
Ge et al., “Rapid vacuolar sequestration: the horseweed glyphosate resistance mechanism,” Pest Management Sci., 66:345-348 (2010).
GenBank Accession No. AY545657.1 (2004).
GenBank Accession No. CB377464, “CmaE1_37_J02_T3 Cowpea weevil larvae Lambda Zap Express Library Callosobruchus maculatus cDNA, mRNA sequence,” (2007).
GenBank Accession No. DY640489, “PU2_p1ate27_F03 PU2 Prunus persica cDNA similar to expressed mRNA inferred from Prunus persica hypothetical domain/motif cont aining IPR011005:Dihydropteroate synthase-like, MRNA sequence” (2006).
GenBank Accession No. EF143582 (2007).
GenBank Accession No. EU024568, “Amaranthus hypochondriacus acetolactate synthase (ALS) gene” (2007).
GenBank Accession No. EW765249, “ST020010B10C12 Normalized and subtracted western corn rootworm female head cDNA library Diabrotica virgifera virgifera cDNA clone STO20010BI0C12 5-, mRNA sequence,” (2007).
GenBank Accession No. EW771198, “ST020010B10C12 Normalized and subtracted western corn rootworm female head cDNA library Diabrotica virgifera virgifera cDNA clone STO20010B10C12 5-, mRNA sequence,” (2007).
GenBank Accession No. FE348695, “CBIB7954.fwd CBIB_Daphnia_pulex_Chosen_One_Library_2 Daphnia pulex cDNA clone CBIB7954 5′, mRNA sequence” (2011).
GenBank Accession No. FJ972198, “Solanum lycopersicum cultivar Ailsa Craig dihydropterin pyrophosphokinase-dihydropteroate synthase (HPPK-DHPS) gene, complete cds” (2010).
GenBank Accession No. GI:186478573 (2014).
GenBank Accession No. GU120406, “Chrysomela tremulae ribosomal protein L7 (RpL7) mRNA, complete cds” (2009).
GenBank Accession No. HD315444, “Sequence 192160 from Patent EP2213738” (2010).
GenBank Accession No. Q4GXM3_BIPLU, “Ribosomal protein L7e” (2006).
GenBank Accession No. U87257.1, “Daucus carota 4-hydroxyphenylpyruvate dioxygenase mRNA, complete cds” (1997).
GenBank Accession No. XM_014456745.1, Predicted: Myotis lucifugus ribonucleoprotein, PTB-binding 2 (RAVER2), transcript variant X3, mRNA,: (2015).
GenBank Accession No. Y08611.1, “P.sativum mRNA for dihydropterin pyrophosphokinase/dihydropteroate synthase.” (2006).
GenEmbl Accession No. FJ861243 (2010).
Gong et al., “Silencing of Rieske iron-sulfur protein using chemically synthesised siRNA as a potential biopesticide against Plutella xylostella,” Pest Manag Sci, 67:514-520 (2011).
Gossamer Threads, Compendium of Herbicide Adjuvants: Organo-Silicone Surfactant, p. 1-4 (1998).
Gressel et al., “A strategy to provide long-term control of weedy rice while mitigating herbicide resistance transgene flow, and its potential use for other crops with related weeds,” Pest Manag Sci, 65(7):723-731 (2009).
Gudkov, “Minireview: The L7/L12 ribosomal domain of the ribosome: structural and functional studies,” FEBS Letters, 407:253-256 (1997).
Gutensohn et al., “Functional analysis of the two Arabidopsis homologues of Toc34, a component of the chloroplast protein import apparatus,” The Plant Journal, 23(6):771-783 (2000).
Hagio, “Chapter 25: Direct Gene Transfer into Plant Mature Seeds via Electroporation After Vacuum Treatment,” Electroporation and Sonoporation in Developmental Biology, p. 285-293 (2009).
Haigh, “The Priming of Seeds: Investigation into a method of priming large quantities of seeds using salt solutions,” Thesis submitted to Macquarie University (1983).
Hajirezaei et al., “Impact of elevated cytosolic and apoplastic invertase activity on carbon metabolism during potato tuber development,” Journal of Experimental Botany, 51:439-445 (2000).
Hamilton et al “Guidelines for the Identification and Characterization of Plant Viruses,” J. gen. Virol., 54:223-241 (1981).
Hamilton et al., “Two classes of short interfering RNA in RNA silencing,” EMBO J., 21(17):4671-4679 (2002).
Han et al., “Molecular Basis for the Recognition of Primary microRNAs by the Drosha-DGCR8 Complex,” Cell, 125(5):887-901 (2006).
Hannon, “RNA interference,” Nature,481:244-251 (2002).
Hardegree, “Drying and storage effects on germination of primed grass seeds,” Journal of Range Management, 47(3):196-199 (1994).
Harrison et al., “Does Lowering Glutamine Synthetase Activity in Nodules Modigy Nitrogen Metabolism and Growth of Lotus japonicus?,” Plant Physiology, 133:253-262 (2003).
Heffer et al., “Rapid isolation of gene homologs across taxa: Efficient identification and isolation of gene orthologs from non-model organism genomes, a technical report,” EvoDevo Journal, 2(7):1-5 (2011).
Herman et al., “A three-component dicamba O-demethylase from Pseudomonas maltophilia, strain DI-6: gene isolation, characterization, and heterologous expression,” J. Biol. Chem., 280: 24759-24767 (2005).
Hess, “Surfactants and Additives,” 1999 Proceedings of the California Weed Science Society, 51:156-172 (1999).
Hewezi et al., “Local infiltration of high- and low-molecular-weight RNA from silenced sunflower (Helianthus annuus L.) plants triggers post-transcriptional gene silencing in non-silenced plants,” Plant Biotechnology Journal, 3:81-89 (2005).
Hidayat et al., “Enhanced Metabolism of Fluazifop Acid in a Biotype of Digitaria sanguinalis Resistant to the Herbicide Fluazifop-P-Butyl,” Pesticide Biochem. Physiol., 57:137-146 (1997).
Himber et al., “Transitivity-dependant and -independent cell-to-cell movement of RNA silencing,” The EMBO Journal, 22(17):4523-4533 (2003).
Hirschberg et al., “Molecular Basis of Herbicide Resistance in Amaranthus hybridus,” Science, 222:1346-1349 (1983).
Hoekema et al., “A binary plant vector strategy based on separation of vir- and T-region of the Agrobacterium tumefaciens Ti-plasmid,” Nature, 303:179-180 (1983).
Hofgen et al., “Repression of Acetolactate Synthase Activity through Antisense Inhibition: Molecular and Biochemical Analysis of Transgenic Potato (Solanum tuberosum L. cv Desiree) Plants,” Plant Physiol., 107(2):469-477 (1995).
Holtra et al., “Assessment of the Physiological Condition of Salvinia natans L. Exposed to Copper(II) Ions,” Environ. Protect. Eng., 41:147-158 (2015).
Hsieh et al., “A library of siRNA duplexes targeting the phosphoinositide 3-kinase pathway: determinants of gene silencing for use in cell-based screens,” Nucleic Acids Res., 32(3):893-901 (2004).
Huang et al., “In Vivo Analyses of the Roles of Essential Omp85-Related Proteins in the Chloroplast Outer Envelope Membrane,” Plant Physiol., 157:147-159 (2011).
Huesken et al., “Design of a genome-wide siRNA library using an artificial neural network,” Nature Biotechnology, 23(8): 995-1001 (2005).
Hunter et al., “RNA Interference Strategy to suppress Psyllids & Leafhoppers,” International Plant and Animal Genome XIX, 15-19 (2011).
Ichihara et al., “Thermodynamic instability of siRNA duplex is a prerequisite for dependable prediction of siRNA activities,” Nucleic Acids Res., 35(18):e123 (2007).
International Preliminary Report on Patentability (Chapter II) dated Jul. 24, 2015, in International Application No. PCT/US2014/047204.
International Preliminary Report on Patentability dated Sep. 11, 2012, in International Application No. PCT/US2011/027528.
International Preliminary Report on Patentability dated Sep. 11, 2014, in International Application No. PCT/IL2013/050447.
International Rice Genome Sequencing Project, The map-based sequence of the rice genome, Nature, 436(11):793-800 (2005).
International Search Report and the Written Opinion dated Feb. 25, 2013, in International Application No. PCT/US2012/054883.
International Search Report and the Written Opinion dated Feb. 27, 2013, in International Application No. PCT/US2012/054814.
International Search Report and the Written Opinion dated Feb. 27, 2013, in International Application No. PCT/US2012/054842.
International Search Report and the Written Opinion dated Feb. 27, 2013, in International Application No. PCT/US2012/054862.
International Search Report and the Written Opinion dated Feb. 27, 2013, in International Application No. PCT/US2012/054894.
International Search Report and the Written Opinion dated Feb. 27, 2013, in International Application No. PCT/US2012/054974.
International Search Report and the Written Opinion dated Feb. 27, 2013, in International Application No. PCT/US2012/054980.
International Search Report and Written Opinion dated Jul. 8, 2015, in International Application No. PCT/US2015/011408.
International Search Report and the Written Opinion dated Jul. 15, 2014, in International Application No. PCT/US2014/025305.
International Search Report and the Written Opinion dated Jul. 22, 2014, in International Application No. PCT/IL2013/051083.
International Search Report and the Written Opinion dated Jul. 22, 2014, in International Application No. PCT/IL2013/051085.
International Search Report and the Written Opinion dated Jul. 24, 2014, in International Application No. PCT/US2014/026036.
International Search Report and the Written Opinion dated May 10, 2011, in International Application No. PCT/US2011/027528.
International Search Report and the Written Opinion dated Oct. 1, 2013, in International Application No. PCT/IL2013/050447.
International Search Report and Written Opinion dated Aug. 25, 2014, in International Application No. PCT/US2014/023503.
International Search Report and Written Opinion dated Aug. 27, 2014, in International Application No. PCT/US2014/023409.
International Search Report and Written Opinion dated Feb. 23, 2015, in International Application No. PCT/US2014/063832.
International Search Report and Written Opinion dated Mar. 26, 2015, in International Application No. PCT/US2014/069353.
International Search Report and Written Opinion dated May 26, 2016, in International Application No. PCT/US2016/014344.
International Search Report and Written Opinion dated Nov. 24, 2015, in International Application No. PCT/US2015/037522.
International Search Report and Written Opinion dated Nov. 27, 2015, in International Application No. PCT/US2015/037015.
International Search Report dated Mar. 12, 2013, in International Application No. PCT/US2012/054789.
Invitation to Pay Additional Fees dated May 6, 2014, in International Application No. PCT/IL2013/051083.
Invitation to Pay Additional Fees dated May 6, 2014, in International Application No. PCT/IL2013/051085.
Invitation to Pay Additional Fees dated Nov. 25, 2014, in International Application No. PCT/US2014/047204.
Invitation to Pay Additional Fees dated Sep. 8, 2015, in International Application No. PCT/US2015/037015.
Invitation to Pay Additional Fees dated Sep. 9, 2015, in International Application No. PCT/US2015/037522.
Isaacs et al., “Engineered riboregulators enable post-transcriptional control of gene expression,” Nature Biotechnology, 22(7):841-847 (2004).
Ivanova et al., “Members of the Toc159 Import Receptor Family Represent Distinct Pathways for Protein Targeting to Plastids,” Molecular Biology of the Cell, 15:3379-3392 (2004).
Jacque et al., “Modulation of HIV-1 replication by RNA interference,” Nature, 418, 435-438 (2002).
Jang et al., “Resistance to herbicides caused by single amino acid mutations in acetyl-CoA carboxylase in resistant populations of grassy weeds,” New Phytologist, 197(4):1110-1116 (2013).
Ji et al., “Regulation of small RNA stability: methylation and beyond,” Cell Research, 22:624-636 (2012).
Jin et al., “Posttranslational Elevation of Cell Wall Invertase Activity by Silencing its Inhibitor in Tomato Delays Leaf Senescence and Increases Seed Weight and Fruit Hexose Level,” The Plant Cell, 21:2072-2089 (2009).
Jofre-Garfias et al., “Agrobacterium-mediated transformation of Amaranthus hypochondriacus: light- and tissue-specific expression of a pea chlorophyll a/b-binding protein promoter,” Plant Cell Reports, 16:847-852 (1997).
Jones-Rhoades et al., “MicroRNAs and Their Regulatory Roles in Plants,” Annu. Rev. Plant Biol., 57:19-53 (2006).
Josse et al., “A DELLA in Disguise: SPATULA Restrains the Growth of the Developing Arabidopsis Seedling,” Plant Cell, 23:1337-1351 (2011).
Kaloumenos et al., “Identification of a Johnsongrass (Sorghum halepense) Biotype Resistant to ACCase-Inhibiting Herbicides in Northern Greece,” Weed Technol, 23:470-476 (2009).
Kam et al., “Nanotube Molecular Transporters: Internalization of Carbon Nanotube—Protein Conjugates into Mammalian Cells,” J. Am. Chem. Soc., 126(22):6850-6851 (2004).
Kambiranda et al., “Relationship Between Acid Invertase Activity and Sugar Content in Grape Species,” Journal of Food Biochemistry, 35:1646-1652 (2011).
Katoh et al., “Specific residues at every third position of siRNA shape its efficient RNAi activity,” Nucleic Acids Res., 35(4): e27 (2007).
Kertbundit et al., “In vivo random β-glucuronidase gene fusions in Arabidopsis thaliana,” Proc. Natl. Acad. Sci. U S A., 88:5212-5216 (1991).
Khachigian, “DNAzymes: Cutting a path to a new class of therapeutics,” Curr Opin Mol Ther 4(2):119-121 (2002).
Khan et al., “Matriconditioning of Vegetable Seeds to Improve Stand Establishment in Early Field Plantings,” J. Amer. Soc. Hort. Sci., 117(1):41-47 (1992).
Khodakovskaya et al., “Carbon Nanotubes Are Able to Penetrate Plant Seed Coat and Dramatically Affect Seed Germination and Plant Growth,” ACS Nano, 3(10):3221-3227 (2009).
Kikkert et al., “Stable Transformation of Plant Cells by Particle Bombardment/Biolistics,” Methods in Molecular Biology, 286:61-78 (2005).
Kim et al., “Optimization of Conditions for Transient Agrobacterium-Mediated Gene Expression Assays in Arabidopsis,” Plant Cell Reports, 28:1159-1167 (2009).
Kim et al., “Synthetic dsRNA Dicer substrates enhance RNAi potency and efficacy,” Nature Biotechnology, 23(2):222-226 (2005).
Kirkwood, “Herbicides and Plants,” Botanical Journal of Scotland, 46(3):447-462 (1993).
Kirkwood, “Use and Mode of Action of Adjuvants for Herbicides: A Review of some Current Work,” Pestic Sci., 38:93-102 (1993).
Klahre et al., “High molecular weight RNAs and small interfering RNAs induce systemic posttranscriptional gene silencing in plants,” Proc. Natl. Acad. Sci. USA, PNAS, 99(18):11981-11986 (2002).
Knudsen, “Promoter2.0: for the recognition of Poll promoter sequences,” Bioniformatics, 15(5):356-361 (1999).
Kronenwett et al., “Oligodeoxyribonucleotide Uptake in Primary Human Hematopoietic Cells Is Enhanced by Cationic Lipids and Depends on the Hematopoietic Cell Subset,” Blood, 91(3):852-862 (1998).
Kumar et al., Sequencing, De Novo Assembly and Annotation of the.
Kusaba et al., “Low glutelin content1: A Dominant Mutation That Suppresses the Glutelin Multigene Family via RNA Silencing ni Rice,” The Plant Cell, 15(6):1455-1467 (2003).
Kusaba, “RNA interference in crop plants,” Curr Opin Biotechnol, 15(2):139-143 (2004).
Lavigne et al., “Enhanced antisense inhibition of human immunodeficiency virus type 1 in cell cultures by DLS delivery system,” Biochem Biophys Res Commun, 237:566-571 (1997).
Lee et al., “Aptamer Database,” Nucleic Acids Research, 32:D95-D100 (2004).
Lein et al., “Target-based discovery of novel herbicides,” Current Opinion in Plant Biology, 7:219-225 (2004).
Leopold et al., “Chapter 4: Moisture as a Regulator of Physiological Reaction in Seeds,” Seed Moisture, CSSA Special Publication No. 14, pp. 51-69 (1989).
Lermontova et al., “Reduced activity of plastid protoporphyrinogen oxidase causes attenuated photodynamic damage during high-light compared to low-light exposure,” The Plant Journal, 48(4):499-510 (2006).
Lesnik et al., “Prediction of rho-independent transcriptional terminators in Escherichia coli,” Nucleic Acids Research, 29(17):3583-3594 (2001).
Li et al., “A Simplified Seed Transformation Method for Obtaining Transgenic Brassica napus Plants,” Agricultural Sciences in China, 8(6):658-663 (2009).
Li et al., “Establishment of a highly efficient transformation system for pepper (Capsicum annuum L.),” Plant Cell Reports, 21:785-788 (2003).
Li et al., “The FAST technique: a simplified Agrobacterium-based transformation method for transient gene expression analysis in seedlings of Arabidopsis and other plant species,” Plant Methods, 5(6):1-15 (2009).
Liu et al, “The Helicase and RNaseIIIa Domains of Arabidopsis Dicer-Like1 Modulate Catalytic Parameters during MicroRNA Biogenesis,” Plant Physiology, 159:748-758 (2012).
Liu et al., “Carbon Nanotubes as Molecular Transporters for Walled Plant Cells,” Nano Letters, 9(3):1007-1010 (2009).
Liu et al., “Comparative study on the interaction of DNA with three different kinds of surfactants and the formation of multilayer films,” Bioelectrochemistry, 70:301-307 (2007).
Liu et al., “DNAzyme-mediated recovery of small recombinant RNAs from a 5S rRNA-derived chimera expressed in Escherichia coli,” BMC Biotechnology, 10:85 (2010).
Liu et al., “Identification and Application of a Rice Senescence-Associated Promoter,” Plant Physiology, 153:1239-1249 (2010).
Liu, “Influence of Sugars on the Foliar Uptake of Bentazone and Glyphosate,” New Zealand Plant Protection, 55:159-162 (2002).
Llave et al., “Endogenous and Silencing-Associated Small RNAs in Plants,” The Plant Cell, 14:1605-1619 (2002).
Lu et al., “Oligo Walk: an online siRNA design tool utilizing hybridization thermodynamics,” Nucleic Acids Research, 36:W104-W108 (2008).
Lu et al., “RNA silencing in plants by the expression of siRNA duplexes,” Nucleic Acids Res., 32(21):e171 (2004).
Luft, “Making sense out of antisense oligodeoxynucleotide delivery: getting there is half the fun,” J Mol Med, 76:75-76 (1998).
Luque et al., “Water Permeability of Isolated Cuticular Membranes: A Structural Analysis,” Archives of Biochemistry and Biophysics, 317(2):417-422 (1995).
Maas et al., “Mechanism and optimized conditions for PEG mediated DNA transfection into plant protoplasts,” Plant Cell Reports, 8:148-149 (1989).
MacKenzie et al., “Transgenic Nicotiana debneyii expressing viral coat protein are resistant to potato virus S infection,” Journal of General Virology, 71:2167-2170 (1990).
Maher III et al., “Inhibition of DNA binding proteins by oligonucleotide-directed triple helix formation,” Science, 245(4919):725-730 (1989).
Makkouk et al., “Virus Diseases of Peas, Beans, and Faba Bean in the Mediterranean region,” Adv Virus Res, 84:367-402 (2012).
Mandal et al., “Adenine riboswitches and gene activation by disruption of a transcription terminator,” Nature Struct. Mol. Biol., 11(1):29-35 (2004).
Mandal et al., “Gene Regulation by Riboswitches,” Nature Reviews | Molecular Cell Biology, 5:451-463 (2004).
Manoharan, “Oligonucleotide Conjugates as Potential Antisense Drugs with Improved Uptake, Biodistribution, Targeted Delivery, and Mechanism of Action,” Antisense & Nucleic Acid Drug Development, 12:103-128 (2002).
Maori et al., “IAPV, a bee-affecting virus associated with Colony Collapse Disorder can be silenced by dsRNA ingestion,” Insect Molecular Biology, 18(1):55-60 (2009).
Masoud et al., “Constitutive expression of an inducible β-1,3-glucanase in alfalfa reduces disease severity caused by the oomycete pathogen Phytophthora megasperma f. sp medicaginis, but does not reduce disease severity of chitincontaining fungi,” Transge.
Matveeva et al., “Prediction of antisense oligonucleotide efficacy by in vitro methods,” Nature Biotechnology, 16:1374-1375 (1998).
McGinnis, “RNAi for functional genomics in plants,” Brief Funct Genomics, 9(2):111-7 (2010).
Meinke, et al., “Identifying essential genes in Arabidopsis thaliana,” Trends Plant Sci., 13(9):483-491 (2008).
Meins et al., “RNA Silencing Systems and Their Relevance to Plant Development,” Annu. Rev. Cell Dev. Biol., 21:297-318 (2005).
Melnyk et al., “Intercellular and systemic movement of RNA silencing signals,” The EMBO Journal, 30:3553-3563 (2011).
Migge et al., “Greenhouse-grown conditionally lethal tobacco plants obtained by expression of plastidic glutamine synthetase antisense RNA may contribute to biological safety,” Plant Science 153:107-112 (2000).
Misawa et al., “Expression of an Erwinia phytoene desaturase gene not only confers multiple resistance to herbicides interfering with carotenoid biosynthesis but also alters xanthophyll metabolism in transgenic plants,” The Plant Journal, 6(4):481-489 (19.
Misawa et al., “Functional expression of the Erwinia uredovora carotenoid biosynthesis gene crtl in transgenic plants showing an increase of β-carotene biosynthesis activity and resistance to the bleaching herbicide norflurazon,” The Plant Journal, 4(5):8.
Miura et al., “The Balance between Protein Synthesis and Degradation in Chloroplasts Determines Leaf Variegation in Arabidopsis yellow variegated Mutants,” The Plant Cell, 19:1313-1328 (2007).
Molina et al., “Inhibition of protoporphyrinogen oxidase expression in Arabidopsis causes a lesion-mimic phenotype that induces systemic acquired resistance,” The Plant Journal, 17(6):667-678 (1999).
Molnar et al., “Plant Virus-Derived Small Interfering RNAs Originate redominantly from Highly Structured Single-Stranded Viral RNAs,” Journal of Virology, 79(12):7812-7818 (2005).
Molnar et al., “Small Silencing RNAs in Plants Are Mobile and Direct Epigenetic Modification in Recipient Cells,” Science, 328:872-875 (2010).
Mora et al., “How Many Species Are There on Earth and in the Ocean?,” PLOS Biol., 9(8):e100127, p. 1-8 (2011).
Moriyama et al., “Double-stranded RNA in rice: a novel RNA replicon in plants,” Molecular & General Genetics, 248(3):364-369 (1995).
Moriyama et al., “Stringently and developmentally regulated levels of a cytoplasmic double-stranded RNA and its high-efficiency transmission via egg and pollen in rice,” Plant Molecular Biology, 31:713-719 (1996).
Morrissey et al., “Potent and persistent in vivo anti-HBV activity of chemically modified siRNAs,” Nat Biotechnol. 23(8):1002-1007 (2005).
Moser et al., “Sequence—Specific Cleavage of Double Helical DNA by Triple Helix Formation,” Science, 238:645-646 (1987).
Mount et al., “Gene and Metabolite Regulatory Network Analysis of Early Developing Fruit Tissues Highlights New Candidate Genes for the Control of Tomato Fruit Composition and Development,” Plant Physiology, 149:1505-1528 (2009).
Non-Final Office Action dated Apr. 11, 2013, in U.S. Appl. No. 13/042,856.
Non-Final Office Action dated Apr. 29, 2016, in U.S. Appl. No. 13/583,302.
Non-Final Office Action dated Aug. 10, 2016, in U.S. Appl. No. 13/612,995.
Non-Final Office Action dated Aug. 12, 2015, in U.S. Appl. No. 13/612,936.
Non-Final Office Action dated Aug. 13, 2015, in U.S. Appl. No. 13/612,929.
Non-Final Office Action dated Aug. 19, 2016, in U.S. Appl. No. 13/612,925.
Non-Final Office Action dated Aug. 19, 2016, in U.S. Appl. No. 13/612,929.
Non-Final Office Action dated Aug. 3, 2016, in U.S. Appl. No. 14/015,715.
Non-Final Office Action dated Aug. 5, 2016, in U.S. Appl. No. 14/015,785.
Non-Final Office Action dated Aug. 8, 2016, in U.S. Appl. No. 13/612,936.
Non-Final Office Action dated Dec. 17, 2015, in U.S. Appl. No. 14/532,596.
Non-Final Office Action dated Feb. 10, 2016, in U.S. Appl. No. 13/901,326.
Non-Final Office Action dated Feb. 23, 2016, in U.S. Appl. No. 14/603,347.
Non-Final Office Action dated Feb. 23, 2016, in U.S. Appl. No. 14/608,951.
Non-Final Office Action dated Jul. 23, 2015, in U.S. Appl. No, 14/335,135.
Non-Final Office Action dated Jul. 30, 2014, in U.S. Appl. No. 13/042,856.
Non-Final Office Action dated Jun. 5, 2015, in U.S. Appl. No. 13/612,948.
Non-Final Office Action dated Jun. 8, 2015, in U.S. Appl. No. 13/612,941.
Non-Final Office Action dated Mar. 1, 2016, in U.S. Appl. No. 13/612,954.
Non-Final Office Action dated Mar. 30, 2015, in U.S. Appl. No. 13/583,302.
Non-Final Office Action dated May 15, 2015, in U.S. Appl. No. 14/608,951.
Non-Final Office Action dated May 22, 2015, in U.S. Appl. No. 13/612,985.
Non-Final Office Action dated Nov. 9, 2016, in U.S. Appl. No. 14/901,003.
Non-Final Office Action dated Oct. 3, 2016, in U.S. Appl. No. 14/403,491.
Non-Final Office Action dated Sep. 1, 2015, in U.S. Appl. No. 13/612,954.
Non-Final Office Action dated Sep. 11, 2015, in U.S. Appl. No. 13/612,925.
Non-Final Office Action dated Sep. 4, 2015, in U.S. Appl. No. 13/612,995.
Non-Final Office Action dated Sep. 6, 2016, in U.S. Appl. No. 14/335,135.
Nookaraju et al., “Molecular approaches for enhancing sweetness in fruits and vegetables,” Scientia Horticulture, 127:1-15 (2010).
Nord-Larsen et al., “Cloning, characterization and expression analysis of tonoplast intrinsic proteins and glutamine synthetase in ryegrass (Lolium perenne L.),” Plant Cell Reports, 28(10):1549-1562 (2009).
Notice of Allowance dated Apr. 11, 2016, in U.S. Appl. No. 13/612,985.
Notice of Allowance dated Apr. 19, 2016, in U.S. Appl. No. 13/612,941.
Notice of Allowance dated Apr. 20, 2016, in U.S. Appl. No. 13/612,948.
Notice of Allowance dated Feb. 23, 2015, in U.S. Appl. No. 13/042,856.
Notice of Allowance dated Jun. 2, 2015, in U.S. Appl. No. 13/042,856.
Notice of Allowance dated Oct. 5, 2015, in U.S. Appl. No. 13/583,302.
Nowak et al., “A new and efficient method for inhibition of RNA viruses by DNA interference,” The FEBS Journal, 276:4372-4380 (2009).
Office Action dated Apr. 13, 2016, in Chinese Patent Application No. 201280053985.3.
Office Action dated Aug. 1, 2017, in European Patent Application No. 12 830 932.5.
Office Action dated Aug. 14, 2017, in Israeli Patent Application No. 235878.
Office Action dated Aug. 22, 2017, in Korean Patent Application No. 10-2012-7023415.
Office Action dated Aug. 25, 2016, in Eurasian Patent Application No. 201201264.
Office Action dated Aug. 28, 2013, in Chinese Patent Application No. 201180012795.2.
Office Action dated Aug. 3, 2017, in Chinese Patent Application No. 201480014392.5 (with English translation).
Office Action dated Aug. 3, 2017, in European Patent Application No. 12 831 684.1.
Office Action dated Aug. 8, 2017, in Chilean Patent Application No. 201501874.
Office Action dated Dec. 13, 2016, in Ukrainian Patent Application No. a 2014 03843.
Office Action dated Dec. 14, 2016, in Ukrainian Patent Application No. a 2014 03850.
Office Action dated Dec. 15, 2016, in Ukrainian Patent Application No. a 2014 03845.
Office Action dated Dec. 15, 2016, in Ukrainian Patent Application No. a 2014 03849.
Office Action dated Dec. 15, 2016, in Ukrainian Patent Application No. a 2014 03852.
Office Action dated Dec. 27, 2016, in Ukrainian Patent Application No. a 2012 11548.
Office Action dated Dec. 5, 2017, in Japanese Patent Application No. 2016-502033.
Office Action dated Feb. 17, 2014, in Mexican Patent Application No. MX/a/2012/010479.
Office Action dated Feb. 24, 2014, in Eurasian Patent Application No. 201201264.
Office Action dated Jul. 11, 2017, in Mexican Patent Application No. MX/a/2015/013118 (with English translation).
Office Action dated Jul. 18, 2016, in Indonesian Patent Application No. W00201203610.
Office Action dated Jul. 23, 2015, in Ukrainian Patent Application No. 201211548.
Office Action dated Jul. 3, 2017, in Mexican Patent Application No. MX/a/2015/012632 (with English translation).
Office Action dated Jul. 6, 2017, in Mexican Patent Application No. MX/a/2015/013103 (with English translation).
Office Action dated Jun. 20, 2016, in Chinese Patent Application No. 201280054819.5.
Office Action dated Jun. 24, 2016, in Chinese Patent Application No. 201280053984.9.
Office Action dated Mar. 16, 2017, in Chinese Patent Application No. 201280054819.5.
Office Action dated May 3, 2016, in Chilean Patent Application No. 201601057.
Office Action dated Nov. 15, 2016, in Mexican Patent Application No. MX/a/2014/003068 (with English translation).
Office Action dated Sep. 5, 2016, in Ukrainian Patent Application No. a 2014 03846.
Office Action dated Sep. 6, 2017, in Chinese Patent Application No. 2014800154012 (with English translation).
Office Action dated Nov. 3, 2014, in Chinese Patent Application No. 201180012795.2.
Office Action dated Jan. 6, 2015, in Japanese Patent Application No. 2012-557165.
Office Action dated Nov. 19, 2014, in Eurasian Patent Application No. 201201264/28.
Office Action dated Oct. 5, 2015, in Eurasian Patent Application No. 201201264/28.
Ongvarrasopone et al., “A Simple and Cost Effective Method to Generate dsRNA for RNAi Studies in Invertebrates,” Science Asia, 33:35-39 (2007).
Orbović et al., “Foliar-Applied Surfactants and Urea Temporarily Reduce Carbon Assimilation of Grapefruit Leaves,” J. Amer. Soc. Hort. Sci., 126(4):486-490 (2001).
Ouellet et al., “Members of the Acetohydroxyacid Synthase Muligene Family of Brassica napus Have Divergent Patterns of Expression,” The Plant Journal, Blackwell Scientific Publications, Oxford, GB, 2(3):321-330 (1992).
Paddison et al., Stable suppression of gene expression by RNAi in.
Palauqui et al., “Activation of systemic acquired silencing by localised introduction of DNA,” Current Biology, 9:59-66 (1999).
Parera et al., “Dehydration Rate after Solid Matrix Priming Alters Seed Performance of Shrunken-2 Corn,” J. Amer. Soc. Hort. Sci., 119(3):629-635 (1994).
Partial European Search Report dated Dec. 6, 2017, in European Patent Application No. 17181861.0.
Partial Supplementary European Search Report dated Mar. 2, 2015, in European Patent Application No. 12 831 494.5.
Patent Examination Report No. 1 dated Feb. 8, 2016, in Australian Patent Application No. 2014262189.
Patent Examination Report No. 1 dated Jun. 17, 2016, in Australian Patent Application No. 2012308659.
Patent Examination Report No. 1 dated Jun. 17, 2016, in Australian Patent Application No. 2012308660.
Patent Examination Report No. 1 dated Jun. 8, 2017, in Australian Patent Application No. 2012308686.
Patent Examination Report No. 1 dated Nov. 11, 2013, in Australian Patent Application No. 2011224570.
Paungfoo-Lonhienne et al., “DNA is Taken up by Root Hairs and Pollen, and Stimulates Root and Pollen Tube Growth,” Plant Physiology, 153:799-805 (2010).
Paungfoo-Lonhienne et al., “DNA uptake by Arabidopsis induces changes in the expression of CLE peptides which control root morphology,” Plant Signaling & Behavior, 5(9):1112-1114 (2010).
Pei et al., “On the art of identifying effective and specific siRNAs,” Nature Methods, 3(9):670-676 (2006).
Peretz et al., “A Universal Expression/Silencing Vector in Plants,” Plant Physiology, 145:1251-1263 (2007).
Pornprom et al., “Glutamine synthetase mutation conferring target-site-based resistance to glufosinate in soybean cell selections,” Pest Manag Sci, 2009; 65(2):216-222 (2009).
Powles et al., “Evolution in Action: Plants Resistant to Herbicides,” Annual Review of Plant Biology, 61(1):317-347 (2010).
Pratt et al., “Amaranthus rudis and A. tuberculatus, One Species or Two?,” Journal of the Torrey Botanical Society, 128(3):282-296 (2001).
Preston et al., “Multiple effects of a naturally occurring proline to threonine substitution within acetolactate synthase in two herbicide-resistant populations of Lactuca serriola,” Pesticide Biochem. Physiol., 84(3):227-235 (2006).
Promoter Prediction for SEQ ID No. 1702 from 13/612929/MK/, Promoter 2.0 Prediction Results, pp. 1-4 (2016).
Promoter Prediction for SEQ ID No. 4 from 13/612995/MK/, Promoter 2.0 Prediction Results, pp. 1-3 (2016).
Promoter Prediction for SEQ ID No. 7 from 13/612936/MK/, Promoter 2.0 Prediction Results, pp. 1-2 (2016).
Promoter Prediction for SEQ ID No. 8 from 13/612,925/MK/, Promoter 2.0 Prediction Results, pp. 1-6 (2016).
Qichuan et al., Seed Science, China Agriculture Press, pp. 101-103, Table 2-37.
Qiwei,“Advance in DNA interference,” Progress in Veterinary Medicine, 30(1):71-75 (2009).
Rajur et al., “Covalent Protein—Oligonucleotide Conjugates for Efficient Delivery of Antisense Molecules,” Bioconjug Chem., 8:935-940 (1997).
Rakoczy-Trojanowska, “Alternative Methods of Plant Transformation—a short review,” Cellular & Molecular Biology Letters, 7:849-858 (2002).
Reddy et al “Organosilicone Adjuvants Increased the Efficacy of Glyphosate for Control of Weeds in Citrus (Citrus spp.)” HortScience 27(9):1003-1005 (1992).
Reddy et al., “Aminomethylphosphonic Acid Accumulation in Plant Species Treated with Glyphosate,” J. Agric. Food Chem., 56(6):2125-2130 (2008).
Regalado, “The Next Great GMO Debate,” MIT Technology Review,pp. 1-19 (2015) <https://www.technologyreview.com/s/540136/the-next-great-gmo-debate/>.
Reither et al., “Specificity of DNA triple helix formation analyzed by a FRET assay,” BMC Biochemistry, 3:27 (2002).
Restriction Requirement dated Apr. 21, 2015, in U.S. Appl. No. 13/612,954.
Restriction Requirement dated Feb. 12, 2015, in U.S. Appl. No. 13/612,985.
Restriction Requirement dated Jul. 15, 2016, in U.S. Appl. No. 14/143,748.
Restriction Requirement dated Jul. 18, 2016, in U.S. Appl. No. 14/143,836.
Restriction Requirement dated Mar. 12, 2015, in U.S. Appl. No. 13/612,948.
Restriction Requirement dated Mar. 4, 2015, in U.S. Appl. No. 13/612,941.
Restriction Requirement dated May 4, 2015, in U.S. Appl. No. 13/612,929.
Restriction Requirement dated May 5, 2015, in U.S. Appl. No. 13/612,936.
Restriction Requirement dated May 7, 2015, in U.S. Appl. No. 13/612,925.
Restriction Requirement dated May 7, 2015, in U.S. Appl. No. 13/612,995.
Restriction Requirement dated Oct. 13, 2016, in U.S. Appl. No. 14/206,707.
Restriction Requirement dated Oct. 2, 2012, in U.S. Appl. No. 13/042,856.
Restriction Requirement dated Oct. 21, 2014, in U.S. Appl. No. 13/583,302.
Restriction Requirement dated Oct. 28, 2015, in U.S. Appl. No. 14/603,347.
Restriction Requirement dated Sep. 2, 2015, in U.S. Appl. No. 14/532,596.
Rey et al., “Diversity of Dicotyledenous-Infecting Geminiviruses and Their Associated DNA Molecules in Southern Africa, Including the South-West Indian Ocean Islands,” Viruses, 4:1753-1791 (2012).
Reynolds et al., “Rational siRNA design for RNA interference,” Nature Biotechnology, 22:326-330 (2004).
Richardson et al., “Targeting and assembly of components of the TOC protein import complex at the chloroplast outer envelope membrane,” Frontiers in Plant Science, 5:1-14 (2014).
Riggins et al., “Characterization of de novo transcriptome for waterhemp (Amaranthus tuberculatus) using GS-FLX 454 pyrosequencing and its application for studies of herbicide target-site genes,” Pest Manag. Sci., 66:1042-1052 (2010).
Roberts, “Fast-track applications: The potential for direct delivery of proteins and nucleic acids to plant cells for the discovery of gene function,” Plant Methods, 1(12):1-3 (2005).
Robson et al., “Leaf senescence is delayed in maize expressing the Agrobacterium IPT gene under the control of a novel maize senescence-enhanced promoter,” Plant Biotechnology Journal, 2:101-112 (2004).
Roitsch et al., “Extracellular invertase: key metabolic enzyme and PR protein,” Journal of Experimental Botany, 54(382):513-524 (2003).
Roitsch et al., “Function and regulation of plant invertases: sweet sensations,” Trades in Plant Science, 9(12):606-613 (2004).
Rose et al., “Functional polarity is introduced by Dicer processing of short substrate RNAs,” Nucleic Acids Research, 33(13):4140-4156 (2005).
Rothnie et al., Pararetroviruses and Retroviruses: A Comparative Review of Viral Structure and Gene Expression Strategies, Advances in Virus Research, 44:1-67 (1994).
Ruan et al., “Suppression of Sucrose Synthase Gene Expression Represses Cotton Fiber Cell Initiation, Elongation, and Seed Development,” The Plant Cell, 15:952-964 (2003).
Ryabov et al., “Cell-to-Cell, but Not Long-Distance, Spread of RNA Silencing That is Induced in Individual Epidermal Cells,” Journal of Virology, 78(6):3149-3154 (2004).
Ryan, “Human endogenous retroviruses in health and disease: a symbiotic perspective,” Journal of the Royal Society of Medicine, 97:560-565 (2004).
Salanenka et al., “Seedcoat Permeability: Uptake and Post-germination Transport of Applied Model Tracer Compounds,” HortScience, 46(4):622-626 (2011).
Santoro et al., “A general purpose RNA-cleaving DNA enzyme,” Proc. Natl. Acad. Sci. USA, 94:4262-4266 (1997).
Sathasivan et al., “Nucleotide sequence of a mutant acetolactate synthase gene from an imidazolinone-resistant Arabidopsis thaliana var. Columbia,” Nucleic Acids Research, 18(8):2188-2193 (1990).
Schönherr, “Water Permeability of Isolated Cuticular Membranes: The Effect of pH and Cations on Diffusion, Hydrodynamic Permeability and Size of Polar Pores in the Cutin Matrix,” Planta, 128:113-126 (1976).
Schwab et al., “RNA silencing amplification in plants: Size matters,” PNAS, 107(34):14945-14946 (2010).
Schweizer et al., “Double-stranded RNA interferes with gene function at the single-cell level in cereals,” The Plant Journal, 24(6):895-903 (2000).
Schwember et al., “Drying Rates following Priming Affect Temperature Sensitivity of Germination and Longevity of Lettuce Seeds,” HortScience, 40(3):778-781 (2005).
Scott et al., Botanical Insecticides for Controlling Agricultural Pests: Piperamides and the Colorado Potato Beetle Leptinotarsa decemlineata Say (Coleoptera: Chrysomelidae), Archives of Insect Biochemistry and Physiology, 54:212-225 (2003).
Search Report dated Jul. 24, 2017, in Chinese Patent Application No. 201480014392.5 (with English translation).
Search Report dated Oct. 20, 2017, in Chinese Patent Application No. 201380039346.6.
Second Chinese Office Action dated Jun. 10, 2014, in Chinese Patent Application No. 201180012795.2.
Second Office Action dated Feb. 25, 2016, in Chinese Patent Application No. 201280054179.8.
Second Office Action dated Mar. 4, 2016, in Chinese Patent Application No. 201280054820.8.
Seidman et al., “The potential for gene repair via triple helix formation,” J Clin Invest., 112(4):487-494 (2003).
Selvarani et al., “Evaluation of seed priming methods to improve seed vigour of onion (Allium cepa cv. Aggregatum) and carrot (Daucus carota),” Journal of Agricultural Technology, 7(3):857-867 (2011).
Senthil-Kumar et al., “A systematic study to determine the extent of gene silencing in Nicotiana benthamiana and other Solanaceae species when heterologous gene sequences are used for virus-induced gene silencing,” New Phytologist, 176:782-791 (2007).
Sharma et al., “A simple and efficient Agrobacterium-mediated procedure for transformation of tomato,” J. Biosci., 34(3):423 433 (2009).
Shintani et al., “Antisense Expression and Overexpression of Biotin Carboxylase in Tobacco Leaves,” Plant Physiol., 114:881-886 (1997).
Showalter, “Structure and Function of Plant Cell Wall Proteins,” The Plant Cell, 5:9-23 (1993).
Sijen et al., “On the Role of RNA Amplification in dsRNA-Triggered Gene Silencing,” Cell, 107:465-476 (2001).
Silwet L-77 Spray Adjuvant for agricultural applications, product description from Momentive Performance Materials, Inc. (2003).
Singh et al., “Absorption and translocation of glyphosate with conventional and organosilicone adjuvants,” Weed Biology and Management, 8:104-111 (2008).
Small, “RNAi for revealing and engineering plant gene functions,” Current Opinion in Biotechnology, 18:148-153 (2007).
Snead et al., “Molecular basis for improved gene silencing by Dicer substrate interfering RNA compared with other siRNA variants,” Nucleic Acids Research, 41(12):6209-6221 (2013).
Song et al., “Herbicide,” New Heterocyclic Pesticide, Chemical Industry Press, 354-356 (2011).
Statement of Grounds and Particulars dated Sep. 1, 2017, in Australian Patent No. 2014262189.
Steeves et al., “Transgenic soybeans expressing siRNAs specific to a major sperm protein gene suppress Heterodera glycines reproduction,” Funct. Plant Biol., 33:991-999 (2006).
Stevens et al., “New Formulation Technology—SILWET® Organosilicone Surfactants Have Physical and Physiological Properties Which Enhance the Performance of Sprays,” Proceedings of the 9th Australian Weeds Conference, pp. 327-331 (1990).
Stevens, “Formulation of Sprays to Improve the Efficacy of Foliar Fertilisers,” New Zealand Journal of Forestry Science, 24(1):27-34 (1994).
Stevens, “Organosilicone Surfactants as Adjuvants for Agrochemicals,” New Zealand Journal of Forestry Science, 24:27-34 (1994).
Stock et al., “Possible Mechanisms for Surfactant-Induced Foliar Uptake of Agrochemicals,” Pestic. Sci., 38:165-177 (1993).
Strat et al., “Specific and nontoxic silencing in mammalian cells with expressed long dsRNAs,” Nucleic Acids Research, 34(13):3803-3810 (2006).
Street, “Why is DNA (and not RNA) a stable storage form for genetic information?,” Biochemistry Revisited, pp. 1-4 (2008).
Sudarsan et al., “Metabolite-binding RNA domains are present in the genes of eukaryotes,” RNA, 9:644-647 (2003).
Summons to Attend Oral Proceedings Pursuant to Rule 115(1) EPC, dated Aug. 7, 2017, in European Patent Application No. 12832160.1.
Sun et al., “A Highly efficient Transformation Protocol for Micro-Tom, a Model Cultivar for Tomato Functional Genomics,” Plant Cell Physiol., 47(3):426-431 (2006).
Sun et al., “Antisense oligodeoxynucleotide inhibition as a potent strategy in plant biology: identification of SUSIBA2 as a transcriptional activator in plant sugar signalling,” The Plant Journal, 44:128-138 (2005).
Sun et al., “Sweet delivery—sugar translocators as ports of entry for antisense oligodeoxynucleotides in plant cells,” The Plant Journal, 52:1192-1198 (2007).
Sutton et al., “Activity of mesotrione on resistant weeds in maize,” Pest Manag. Sci., 58:981-984 (2002).
Takasaki et al., “An Effective Method for Selecting siRNA Target Sequences in Mammalian Cells,” Cell Cycle, 3:790-795 (2004).
Tang et al., “Efficient delivery of small interfering RNA to plant cells by a nanosecond pulsed laser-induced stress wave for posttranscriptional gene silencing,” Plant Science, 171:375-381 (2006).
Tank Mixing Chemicals Applied to Peanut Crops: Are the Chemicals Compatible?, College of Agriculture & Life Sciences, NC State University, AGW-653, pp. 1-11 (2004).
Taylor, “Seed Storage, Germination and Quality,” The Physiology of Vegetable Crops, pp. 1-36 (1997).
Temple et al., “Can glutamine synthetase activity levels be modulated in transgenic plants by the use of recombinant DNA technology?” Transgenic Plants and Plant Biochemistry, 22(4):915-920 (1994).
Temple et al., “Down-regulation of specific members of the glutamine synthetase gene family in Alfalfa by antisense RNA technology,” Plant Molecular Biology, 37:535-547 (1998).
Templeton et al., “Improved DNA: liposome complexes for increased systemic delivery and gene expression,” Nature Biotechnology, 15:647-652 (1997).
Tenllado et al., “Crude extracts of bacterially expressed dsRNA can be used to protect plants against virus infection,” BMC Biotechnology, 3(3):1-11 (2003).
Tenllado et al, “Double-Stranded RNA-Mediated Interference with Plant Virus Infection,” Journal of Virology, 75(24):12288-12297 (2001).
Tenllado et al., “RNA interference as a new biotechnological tool for the control of virus diseases in plants,” Virus Research, 102:85-96 (2004).
Tepfer, “Risk assessment of virus resistant transgenic plants,” Annual Review of Phytopathology, 40:467-491 (2002).
The Seed Biology Place, Website Gerhard Leubner Lab Royal Holloway, University of London, <http://www.seedbiology.de/seedtechnology.asp.
Third Party Submission filed on Nov. 29, 2012 in U.S. Appl. No. 13/042,856.
Thomas et al., “Size constraints for targeting post-transcriptional gene silencing and for RNA-directed methylation in Nicotiana benthamiana using a potato virus X vector,” The Plant Journal, 25(4):417-425 (2001).
Thompson, et al., “CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice,” Nucl. Acids Res., 22(22):4673-4680 (1994).
Timmons et al., “Specific interference by ingested dsRNA,” Nature, 395:854 (1998).
Tomari et al., “Perspective: machines for RNAi,” Genes & Dev., 19:517-529 (2005).
Tomlinson et al., “Evidence that the hexose-to-sucrose ratio does not control the switch to storage product accumulation in oilseeds: analysis of tobacco seed development and effects of overexpressing apoplastic invertase,” Journal of Experimental Botany.
Töpfer et al., “Uptake and Transient Expression of Chimeric Genes in Seed-Derived Embryos,” Plant Cell, 1:133-139 (1989).
Toriyama et al., Transgenic Rice Plants After Direct Gene Transfer Into.
Tran et al., “Control of specific gene expression in mammalian cells by co-expression of long complementary RNAs,” FEBS Lett.;573(1-3):127-134 (2004).
Tranel et al., “Resistance of weeds to ALS-inhibiting herbicides: what have we learned?,” Weed Science, 50:700-712 (2002).
Trucco et al., “Amaranthus hybridus can be pollinated frequently by A. tuberculatus under filed conditions,” Heredity, 94:64-70 (2005).
Tsugawa et al., “Efficient transformation of rice protoplasts mediated by a synthetic polycationic amino polymer,” Theor Appl Genet, 97:1019-1026 (1998).
Turina et al., “Tospoviruses in the Mediterranean Area,” Advances in Virus Research, 84:403-437 (2012).
Tuschl, “Expanding small RNA interference,” Nature Biotechnol., 20: 446-448 (2002).
Tuschl, “RNA Interference and Small Interfering RNAs,” ChemBiochem. 2(4):239-245 (2001).
Ui-Tei et al., “Guidelines for the selection of highly effective siRNA sequences for mammalian and chick RNA interference,” Nucleic Acids Res., 32(3): 936-948 (2004).
Unnamalai et al., “Cationic oligopeptide-mediated delivery of dsRNA for post-transcriptional gene silencing in plant cells,” FEBS Letters, 566:307-310 (2004).
Unniraman et al., “Alternate Paradigm for Intrinsic Transcription Termination in Eubacteria,” The Journal of Biological Chemistry, 276(45)(9):41850-41855 (2001).
Unniraman et al., “Conserved Economics of Transcription Termination in Eubacteria,” Nucleic Acids Research, 30(3):675-684 (2002).
Urayama et al., “Knock-down of OsDCL2 in Rice Negatively Affects Maintenance of the Endogenous dsRNA Virus, Oryza sativa Endornavirus,” Plant and Cell Physiology, 51(1):58-67 (2010).
Van de Wetering et al., “Specific inhibition of gene expression using a stably integrated, inducible small-interfering-RNA vector,” EMBO Rep., 4(6):609-615 (2003).
Vasil et al., “Herbicide Resistant Fertile Transgenic Wheat Plants Obtained by Microprojectile Bombardment of Regenerable Embryogenic Callus,” Bio/Technology,10:667-674 (1992).
Vaucheret, “Post-transcriptional small RNA pathways in plants: mechanisms and regulations,” Genes Dev., 20:759-771 (2006).
Vencill et al., “Resistance of Weeds to Herbicides,” Herbicides and Environment, 29:585-594 (2011).
Verma et al., “Modified oligonucleotides: synthesis and strategy for users,” Annu. Rev. Biochem., 67:99-134 (1998).
Vermeulen et al., “The contributions of dsRNA structure to Dicer specificity and efficiency,” RNA, 11(5):674-682 (2005).
Vert et al., “An accurate and interpretable model for siRNA efficacy prediction,” BMC Bioinformatics, 7:520 (2006).
Voinnet et al., “Systemic Spread of Sequence-Specific Transgene RNA Degradation in Plants Is Initiated by Localized Introduction of Ectopic Promoterless DNA,” Cell, 95:177-187 (1998).
Voinnet, “Origin, Biogenesis, and Activity of Plant MicroRNAs,” Cell, 136:669-687 (2009).
Wakelin et al., “A target-site mutation is present in a glyphosate-resistant Lolium rigidum population,” Weed Res. (Oxford), 46(5):432-440 (2006).
Walton et al., “Prediction of antisense oligonucleotide binding affinity to a structured RNA target,” Biotechnol Bioeng 65(1):1-9 (1999).
Wan et al., “Generation of Large Numbers of Independently Transformed Fertile Barley Plants,” Plant Physiol., 104:37-48 (1994).
Wang et al., “Foliar uptake of pesticides-Present status and future challenge,” ScienceDirect, 87:1-8 (2007).
Wardell, “Floral Induction of Vegetative Plants Supplied a Purified Fraction of Deoxyribonucleic Acid from Stems of Flowering Plants,” Plant Physiol, 60:885-891 (1977).
Wardell,“Floral Activity in Solutions of Deoxyribonucleic Acid Extracted from Tobacco Stems,” Plant Physiol, 57:855-861 (1976).
Waterhouse et al., “Virus resistance and gene silencing in plants can be induced by simultaneous expression of sense and antisense RNA,” Proc Natl Acad Sci USA, 95 13959-13964 (1998).
Welch et al., “Expression of ribozymes in gene transfer systems to modulate target RNA levels,” Curr Opin Biotechnol. 9(5):486-496 (1998).
Widholm et al., “Glyphosate selection of gene amplification in suspension cultures of 3 plant species,” Phyisologia Plantarum, 112:540-545 (2001).
Wiesman et al., “Novel cationic vesicle platform derived from vernonia oil for efficient delivery of DNA through plant cuticle membranes,” Journal of Biotechnology, 130:85-94 (2007).
Wild Carrot, Noxious Weed Control Board (NWCB) of Washington State (2010) <www.nwcb.wa.gov/detail.asp?weed=46>.
Wilson, et al., “Transcription termination at intrinsic terminators: The role of the RNA hairpin,” Proc. Natl. Acad. Sci. USA, 92:8793-8797 (1995).
Winkler et al., “Thiamine derivatives bind messenger RNAs directly to regulate bacterial gene expression,” Nature, 419:952-956 (2002).
Wool et al., “Structure and evolution of mammalian ribosomal proteins,” Biochem. Cell Biol., 73:933-947 (1995).
Written Opinion dated Apr. 7, 2016, in Singapore Patent Application No. 201206152-9.
Written Opinion dated Mar. 6, 2017, in Singaporean Patent Application No. 2012061529.
Written Opinion dated May 8, 2014, in International Application No. PCT/IL2013/050447.
Written Opinion dated Sep. 1, 2014, in Singapore Patent Application No. 201206152-9.
Xu et al., “Characterization and Functional Analysis of the Calmodulin-Binding Domain of Rac1 GTPase,” PLoS One, 7(8):e42975 (2012).
Yin et al., “Production of double-stranded RNA for interference with TMV infection utilizing a bacterial prokaryotic expression system,” Appl. Microbiol. Biotechnol., 84(2):323-333 (2009).
YouTube video by General Electric Company “Silwet Surfactants,” screen shot taken on Jan. 11, 2012 of video of www.youtube.com/watch?v=WBw7nXMqHk8 (uploaded Jul. 13, 2009).
Zagnitko, “Lolium regidum clone LS1 acetyl-CoA carboxylase mRNA, partial cds; nuclear gene for plastid product,” GenBank: AF359516.1, 2 pages (2001).
Zagnitko, et al., “An isoleucine/leucine residue in the carboxyltransferase domain of acetyl-CoA carboxylase is critical for interaction with aryloxyphenoxypropionate and cyclohexanedione inhibitors,” PNAS, 98(12):6617-6622 (2001).
Zaimin et al., Botany, Northwest A&F University Press, p. 89.
Zhang et al., “Development and Validation of Endogenous Reference Genes for Expression Profiling of Medaka (Oryzias latipes) Exposed to Endocrine Disrupting Chemicals by Quantitative Real-Time RT-PCR,” Toxicological Sciences, 95(2):356-368 (2007).
Zhang et al., “A novel rice gene, NRR responds to macronutrient deficiency and regulates root growth,” Mol Plant, 5(1):63-72 (2012).
Zhang et al., “Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method,” Nature Protocols, 1(2):1-6 (2006).
Zhang et al., “Cationic lipids and polymers mediated vectors for delivery of siRNA,” Journal of Controlled Release, 123:1-10 (2007).
Zhang et al., “DEG: a database of essential genes,” Nucleic Acids Res., 32:D271-D272 (2004).
Zhang et al., “Transgenic rice plants produced by electroporation-mediated plasmid uptake into protoplasts,” The Plant Cell Rep., 7:379-384 (1988).
Zhang, “Artificial trans-acting small interfering RNA: a tool for plant biology study and crop improvements,” Planta, 239:1139-1146 (2014).
Zhang, Chapter 10: New Characteristics of Pesticide Research & Development, p. 209 (2010).
Zhao et al., “Phyllotreta striolata (Coleoptera: Chrysomelidae):Arginine kinase cloning and RNAi-based pest control,” European Journal of Entomology, 105(5):815-822 (2008).
Zhong et al., “A forward genetic screen to explore chloroplast protein import in vivo identifies Moco sulfurase, pivotal for ABA and IAA biosynthesis and purine turnover,” The Plant Journal, 63:44-59 (2010).
Zhu et al., “Ingested RNA interference for managing the populations of the Colorado potato beetle, Leptinotarsa decemlineata,” Pest Manag Sci, 67:175-182 (2010).
Bauer et al., “The major protein import receptor of plastids is essential for chloroplast biogenesis,” Nature, 403:203-207 (2000).
Baum et al., “Progress Towards RNAi-Mediated Insect Pest Management,” Advances in insect Physiology, 47:249-295 (2014).
Chang et al., “Dual-target gene silencing by using long, synthetic siRNA duplexes without triggering antiviral responses,” Molecules and Cells, 27(6)″ 689-695 (2009).
Cheng et al., “Transient Expression of Minimum Linear Gene Cassettes in Onion Epidermal Cells Via Direct Transformation,” Appl Biochem Biotechnol, 159:739-749 (2009).
Christiaens et al., “The challenge of RNAi-mediated control of hemipterans,” Current Opinion in Insect Science, 6:15-21 (2014).
Communication Pursuant to Article 94(3) EPC dated Sep. 5, 2018, in European Patent Application No. 17152830.0.
Database EMBL XP-002781749(BG442539) dated Mar. 20, 2001.
Egli et al., “A Maize Acetyl-Coenzyme A Carboxylase cDNA Sequence,” Plant Physiol., 108: 1299-1300 (1995).
European Search. Report dated Jun. 29, 2018, in European Patent Application No. 18157745.3.
Examination Report dated Mar. 1, 2018, in Australian Patent Application No. 2013264742.
Extended European Search Report dated Sep. 28, 2018, in European Patent Application No, 16740770.9.
Extended European Search Report dated Apr. 13, 2018, in European Patent Application No, 15812530.0.
Extended European Search Report dated Mar. 15, 2018, in European Patent Application No. 17181861.0.
Gallie et al., “Identification of the motifs within the tobacco mosaic virus 5′-leader responsible for enhancing translation,” Nucleic Acids Res., 20(17):4631-4638 (1992).
Gan et al., “Bacterially expressed dsRNA protects maize against SCMV nfection,” Plant Cell Rep, 11:1261-1268 (2010).
Gasser et al., “Structure, Expression, and Evolution of the 5-Enolpyruvylshikimate-3-phosphate Synthase Genes of Petunia and Tomato,” J. Biol. Chem., 263: 4280-4287 (1988).
Gomez-Zurita et al., “Recalibrated Tree of Leaf Beetles (Chrysomelidae) Indicates Independent Diversification of Angiosperms and Their Insect Herbivores,” PLoS One, 4(e360):1-8 (2007).
Hoermann et al., “Tic32, as Essential Component in Chloroplast Biogenesis,” The Journal of Biological Chemistry, 279(33):34756-34762 (2004).
Hu et al., “High efficiency transport of quantum dots into plant roots with the aid of silwet L-77,” Plant Physiology and Biochemistry, 48:703-709 (2010).
Inaba et al., “Arabillopsis Tic110 Is Essential for the Assembly and Function of Protein Import Machinery of Plastids,” The Plant Cell, 17:1482-1496 (2005).
Jarvis et al, “An Arabidopsis mutant defective in the plastid general protein import apparatus,” Science, 282:100-103 (1998).
Kovacheva et al., “Further in viva studies on the role of the molecular chaperone, Hsp93, in plastid protein import,” The Plant Journal, 50:364-379 (2007).
Kovacheva et al., “In vivo studies on the roles of Tic100, Tic40 and Hsp93 during chloroplast protein import,” The Plant Journal, 41:412-428 (2005).
Li et at., “Long dsRNA but not siRNA initiates RNAi in western corn rootwmor larvae and adults,” Journal of Applied Entomology, 139(6):432-445 (2015).
Liu, “Calmodulin and Cell Cycle,” Foreign Medical Sciences Section of Pathophysiology and Clinical Medicine, 18(4):322-324 (1998).
Liu, “The Transformation of Nucleic Acid Degradants in Plants,” China Organic Fertilizers, Agriculture Press, ISBN: 7-1091634 (with English translation) (1991).
Non-Final Office Action dated Mar. 21, 2018, in U.S. Appl. No. 13/619,980.
Office Action dated Aug. 9, 2018, in Canadian Patent Application No, 2,848,371.
Office Action dated Feb. 21, 2018, in Mexican Patent Application No, MX/a/2015/012632 (with English translation).
Office Action dated Jul. 30, 2018, in Canadian Patent Application No. 2,848,576.
Office Action dated Mar. 8, 2018 (with English translation), in Chilean Patent Application No. 201403192.
Paddison et al., “Stable suppression of gene expression by RNAi in mammalian cells,” Proc. Natl Acad. Sci. USA, 99(3):1443-1448 (2002).
Partial Supplementary European Search Report dated Jan. 11, 2018, in European Patent Application No. 15812530.0.
Qichuan et al., Seed Science, China Agriculture Press, pp. 101-103, Tables 2-37 (2001).
Reverdatto et al., “A Multisubunit Acetyl Coenzyme A Carboxylase from Soybean,” Plant Physiol., 119: 961-978 (1999).
Stevens, “Organosilicone Surfactants as Adjuvants for Agrochemicals,” Journal of Pesticide Science, 38:103-122 (1993).
Stevens, “Formulation of Sprays to Improve the Efficacy of Foliar Fertilisers,” New Zealand Forest Research Institute, pp. 27-34 (1994).
Sun, “Characterization of Organosilicone Surfactants and Their Effects on Sulfonylurea Herbicide Activity,” Thesis Submitted to the Faculty of the Virginia Polytechnic Institute and Stale University dated Apr. 5. 1996.
Teng et al., “Tic21 Is an Essential Translocon Component for Protein Translocation across the Chloroplast Inner Envelope Membrane,” The Plant Cell, 18:2247-2257 (2006).
Ulrich et al., “Large scale RNAi screen in Tribolium reveals novel target genes for pest control and the proteasome as prime target,” BMC genomics, 16(1):671 (2015).
Wang et al., “Principle and technology of genetic engineering in plants,” in Plant genetic engineering principles and techniques, Beijing: Science Press, pp. 313-315 (1998).
Zaimin et al., Chapter III Seeds and Seedlings, Botany, Northwest A&F University Press, pp. 87-92 (2009).
Zhong et al., “A pea antisense gene for the chloroplast stromal processing peptidase yields seedling lethals in Arabidopsis: survivors show defective GFP import in vivo,” The Plant Journal, 34:802-812 (2003).
Zotti et al., “RNAi technology for insect management and protection of beneficial insects from diseases: lessons, challenges and risk assessments,” Neotropical Entomology, 44(3):197-213 (2015).
Related Publications (1)
Number Date Country
20160330967 A1 Nov 2016 US
Provisional Applications (1)
Number Date Country
61927682 Jan 2014 US