METHODS AND KITS FOR ISOLATION AND ANALYSIS OF A CHROMATIN REGION

Abstract

The present invention encompasses methods of identifying proteins and protein modifications of proteins specifically associated with a chromatin.

Description

FIELD OF THE INVENTION

The invention describes methods of identifying proteins and post-translational modification of proteins specifically associated with a chromatin region.

REFERENCE TO SEQUENCE LISTING

A paper copy of the sequence listing and a computer readable form of the same sequence listing are appended below and herein incorporated by reference. The information recorded in computer readable form is identical to the written sequence listing, according to 37 C.F.R. 1.821(f).

BACKGROUND OF THE INVENTION

It has long been appreciated that chromatin-associated proteins and epigenetic factors play central roles in gene regulation. Mis-regulation of chromatin structure and post-translational modification of histones (PTMs) is linked to cancer and other epigenetic diseases. The field of epigenomics has been transformed by chromatin immunoprecipitation approaches that provide for the localization of a defined protein or post-translationally modified protein to specific chromosomal sites. However, the hierarchy of chromatin-templated events orchestrating the formation and inheritance of different epigenetic states remains poorly understood at a molecular level; there are no current methodologies that allow for determination of all proteins present at a defined, small region of chromatin. Chromatin immunoprecipitation (ChIP) assays have allowed better understanding of genome-wide distribution of proteins and histone modifications within a genome at the nucleosome level. However, ChIP assays are largely confined to examining singular histone PTMs or proteins rather than simultaneous profiling of multiple targets, the inability to determine the co-occupancy of particular histone PTMs, and that ChIP is reliant on the previous identification of the molecular target. Other chromatin immunoprecipitation methodologies do not provide a mechanism for determining the specificity of protein interactions, or do not enrich for a small integrated genomic locus and cannot detect protein contamination in purified material. Therefore, there is a need for methods that allow for determination of all proteins and protein posttranslational modifications specifically associated at a defined, small region of chromatin.

SUMMARY OF THE INVENTION

In an aspect, the present invention encompasses a method of identifying proteins, including proteins comprising posttranslational modifications, specifically associated with a target chromatin in a cell. The method comprises: (a) providing a first cell sample comprising nucleic acid binding proteins and the target chromatin and a tag, wherein the target chromatin is tagged by contacting the target chromatin with a tag capable of specifically recognizing and binding one or more portions of the target chromatin and wherein the tag comprises an affinity handle, and a second cell sample comprising nucleic acid binding proteins and the target chromatin, wherein the target chromatin is not tagged by contacting the target chromatin with a non-functional tag that is not capable of specifically recognizing and binding one or more portions of the target chromatin and wherein the non-functional tag comprises an affinity handle; (b) isolating the affinity handle from each cell sample in (a) wherein affinity handle isolated from the first cell sample consists of affinity handle bound to tagged target chromatin bound to specifically associated nucleic acid binding proteins and affinity handle bound to non-specifically associated nucleic acid binding proteins and affinity handle isolated from the second cell sample consists of affinity handle bound to non-specifically associated nucleic acid binding proteins, wherein isolating the affinity handle enriches for the tagged target chromatin; (c) identifying bound proteins from (b); and (d) determining the amount of each bound protein in each cell sample from (b), wherein bound proteins that are enriched in the first cell sample as compared to the second cell sample are specifically associated with the tagged chromatin in the first cell sample.

BRIEF DESCRIPTION OF THE FIGURES

The application file contains at least one drawing executed in color. Copies of this patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

FIG. 1A and FIG. 1B depict the chromatin affinity purification with mass spectrometry method. (FIG. 1A) The chromatin affinity purification with mass spectrometry (ChAP-MS) approach provides for the specific enrichment of a given chromosome section and identification of specifically associated proteins and post-translational modifications. A LexA DNA affinity handle was engineered just upstream of the GAL1 start codon in S. cerevisiae. Strains containing the LexA DNA binding site and a plasmid expressing LexA-PrA protein affinity handle were cultured in glucose or galactose to provide transcriptional repression or activation, respectively, and subjected to in vivo chemical crosslinking to trap protein interactions. Following shearing of the chromatin to ˜1,000 bp, LexA-PrA was affinity purified on IgG-coated Dynabeads and coenriched proteins/post-translational modifications were identified by high-resolution mass spectrometry. (FIG. 1B) To control for nonspecifically enriched proteins, a strain lacking the LexA DNA binding site, but containing the LexA-PrA plasmid, was cultured isotopically heavy (¹³C₆ ¹⁵N₂-lysine) in glucose or galactose and mixed equally with the corresponding isotopically light culture containing the LexA DNA binding site prior to cell lysis. Following affinity purification (AP) and mass spectrometric analysis, nonspecifically enriched proteins were identified as a 1:1 ratio of light to heavy lysine-containing peptides, while proteins specifically enriched with the chromosome section were identified with a higher level of isotopically light lysine-containing peptides.

FIG. 2A and FIG. 2B depict a plot, a Western blot image and a plot showing DNA affinity handle for purification of a specific chromosome section. (FIG. 2A) S. cerevisiae strain LEXA::GAL1 pLexA-PrA was created by insertion of a LEXA DNA binding site upstream of the GAL1 start codon via homologous recombination. The pLexA-PrA plasmid was introduced into this strain and the constitutive expression of the LexA-PrA fusion protein was confirmed by western blotting for PrA. (FIG. 2B) Introduction of the LEXA DNA binding site does not impede GAL1 transcription. cDNA from wild-type or LEXA::GAL1 pLexA-PrA strains grown in glucose or galactose was used as a template for real time PCR analysis of GAL1 versus ACT1 gene transcription. Error bars are the SE of triplicate analyses.

FIG. 3A, FIG. 3B and FIG. 3C depict plots and a diagram showing efficiency of GAL1 chromatin purification. (FIG. 3A) The effect of buffer stringency on purification of LexA-PrA with associated chromatin was evaluated with ChIP. Strain LEXA::GAL1 pLexA-PrA was subjected to ChIP using the following buffer with the reagents indicated on the graph: 20 mM HEPES (pH 7.4), 0.1% Tween 20, and 2 mM MgCl₂. Enrichment of GAL1 DNA relative to ACT1 DNA was monitored by real-time PCR. (FIG. 3B) ChIP was used to measure the specificity of enrichment of LexA-PrA bound chromatin. Enrichment was monitored by real-time PCR with primer sets at the indicated chromosomal locations. (FIG. 3C) GAL1 chromatin is enriched in both glucose and galactose growth conditions. The relative efficiency of GAL1 enrichment was monitored by real-time PCR with primers targeted to the “0” position in panel (FIG. 3B) and to ACT1. The SE is indicated.

FIG. 4A, FIG. 4B, FIG. 4C and FIG. 4D depict an image of an SDS-PAGE gel and mass spectra showing ChAP-MS analysis of GAL1 chromatin. (FIG. 4A) Enrichment of GAL1 chromatin under transcriptionally repressive glucose and active galactose growth conditions. Strain LEXA::GAL1 pLexA-PrA was grown in either glucose or galactose and subjected to affinity purification of GAL1 chromatin via LexA-PrA as detailed in FIG. 1. Addition of an equivalent amount of isotopically heavy (¹³C₆ ¹⁵N₂-lysine) cells lacking the LexA DNA binding site provided for the identification of proteins specifically enriched with GAL1 chromatin. Proteins coenriching with LexA-PrA were resolved by SDS-PAGE and visualized by Coomassie-staining. Each gel lane was sliced into 2 mm sections. Gel slices were treated with trypsin and resulting peptides were analyzed by high-resolution mass spectrometry. (FIG. 4B, FIG. 4C, FIG. 4D) Representative high-resolution mass spectra from proteins and histone post-translational modifications identified from the purification of transcriptionally active GAL1 chromatin. (FIG. 4B) Spt16; (FIG. 4C) H3K14ac; (FIG. 4D) Rpl3 (ribosomal).

FIG. 5 depicts a plot showing proteins and histone post-translational modifications enriched with GAL1 chromatin. Proteins and histone post-translational modifications identified from the ChAP-MS analysis of GAL1 chromatin in the transcriptionally active galactose and repressive glucose growth conditions are listed in accordance to their percent isotopically light. Proteins or post-translational modifications were considered specifically enriched with GAL1 chromatin if the percent isotopically light was 2 SDs from the nonspecific baseline established by the average of contaminant ribosomal proteins. Other proteins shown to be specifically enriched, but not correlated to gene transcription, are averaged together and listed individually in Table 4 and Table 5. The number of proteins averaged is shown in parentheses. The SD is indicated.

FIG. 6 depicts a plot showing the validation of proteins and histone post-translational modifications on GAL1 chromatin. ChIP was targeted to Gal3-TAP, Spt16-TAP, Rpb2-TAP, H3K14ac, and H3K36me3 under transcriptionally active galactose and repressive glucose growth conditions. ChIP to general H3 was used as a nucleosome occupancy control for each histone post-translational modification ChIP. Enrichment of the 5′ end of GAL1 DNA relative to ACT1 DNA was monitored by real-time PCR. The SE is indicated.

FIG. 7A, FIG. 7B, FIG. 7C, FIG. 7D, FIG. 7E, FIG. 7F and FIG. 7G depict diagrams and graphs showing that TAL proteins can specifically enrich native chromatin sections. (FIG. 7A) Schematic overview of TAL-ChAP-MS technology. (FIG. 7B) A unique DNA sequence in the promoter region of GAL1 was used to design a specific binding TAL protein that contained a PrA affinity tag. (FIG. 7C) A pTAL-PrA plasmid was introduced into S. cerevisiae cells, and the constitutive expression of the TAL-PrA fusion protein was confirmed by western blotting for PrA. (FIG. 7D) Expression of TAL-PrA does not impede galactose-induced GAL1 transcription. cDNA from wild-type yeast and wild-type with a plasmid expressing PrA-tagged TAL (+pTAL-PrA) grown in glucose (Glu) or galactose (Gal) was used as a template for real time PCR analysis of GAL1 versus ACT1 gene transcription. Error bars are the standard deviation. (FIG. 7E, FIG. 7F, FIG. 7G) TAL-PrA specifically binds and enriches chromatin at the promoter of transcriptionally active GAL1. ChIP was performed to the PrA-tag in wild-type cells containing the TAL-PrA (+pTAL-PrA, light gray bars) and in wild-type control (dark gray bars). The efficiency of GAL1 enrichment relative to ACT1 was monitored by real-time PCR with primers targeted to the TAL binding site (‘0’) and to DNA sequences 2000 by up- and downstream (FIG. 7E). The standard deviation is indicated. (FIG. 7F) Under transcriptionally active conditions (galactose), TAL-PrA specifically enriched chromatin from the GAL1 promoter region relative to sequences 2 kb up- and downstream. (FIG. 7G) The TAL-PrA protein did not show enrichment of the GAL1 promoter chromatin under transcriptionally repressive glucose growth conditions.

FIG. 8A, FIG. 8B and FIG. 8C depict an image of an SDS-PAGE gel and graphs showing TAL-ChAP-MS analysis of GAL1 promoter chromatin from cells grown its galactose. (FIG. 8A) Proteins co-purifying with TAL-PrA targeted to the promoter region of GAL1 (+pTAL-PrA lane) and proteins non-specifically associating with the IgG-coated Dynabeads (wild-type lane) were resolved by SDS-PAGE/Coomassie-staining and identified by high-resolution mass spectrometry. (FIG. 8B) Proteins found by label-free proteomic analysis to be enriched by >2-fold with transcriptionally active GAL1 promoter chromatin are plotted in accordance to their ranked level of enrichment divided by the total number of enriched proteins (N). Highlighted are the top 10% of proteins (>15-fold enrichment) and histone PTMs enriched with GAL1 promoter chromatin. (FIG. 8C) ChIP was targeted to Spt16-TAP, Rpb2-TAP, Gal3-TAP and H3K14ac under transcriptionally active galactose (light gray bars) and repressive glucose (dark gray bars) growth conditions, ChIP to general H3 was used as a nucleosome occupancy control for H3K14ac ChIP. Enrichment adjacent to the TAL binding site in the promoter of GAL1 relative to ACT1 was monitored by real-time qPCR. The standard error is indicated.

FIG. 9 depicts an illustration of the CRISPR-ChAP-MS approach. PrA-tagged Cas9 bound to gRNA is targeted to a specific region of chromatin. Following chemical cross-linking, the chromatin is sheared to approximately 1 kb in size and subjected to affinity isolation with IgG-coated beads. Isolated chromatin containing PrA-tagged Cas9/gRNA is then analyzed with high resolution mass spectrometry to identify specifically associated proteins and histone posttranslational modifications.

FIG. 10A, FIG. 10B and FIG. 10C depict a Western blot and graphs showing a PrA-tagged Cas9/gRNA complex can specifically enrich a small chromatin section. (FIG. 10A) Using Western-blotting to the PrA-tag, similar expression of PrA-Cas9 was shown in both glucose and galactose-containing media. Western-blotting to histone H4 was used as a loading control. S. cerevisiae were transformed with either a plasmid expressing PrA-tagged Cas9 (pPrA-Cas9) and/or a plasmid expressing gRNA specific to a sequence in the promoter of GAL1 (pgRNA-GAL1). (FIG. 10B) Real-time reverse transcription PCR showed similar galactose-induced transcription of the GAL1 gene relative to ACT1 in cells expressing PrA-Cas9±gRNA-GAL1. Transcript levels of GAL1 are reported as a ratio of detection in galactose relative to glucose-containing media. (FIG. 10C) PrA-Cas9/gRNA complex specifically enriched GAL1 promoter chromatin under transcriptionally active conditions. Using ChIP to the PrA-tag on Cas9, enrichment at each indicated target relative to actin was measured in cells containing the PrA-Cas9/gRNA complex in comparison to those with only the PrA-Cas9. The genomic targets were: GAL1 for the genomic target of the gRNA-GAL1, 2000 base-pairs up- and downstream of the gRNA-GAL1 target, and four off-target (OT) sites for the PrA-Cas9/gRNA-GAL1 complex containing varying levels of sequence similarity to the gRNA-GAL1 target (±protospacer-activation motif (PAM motif)). Error bars are standard error from triplicate analyses. (*) indicates significant (p<0.05) enrichment from galactose growths relative to glucose.

FIG. 11A and FIG. 11B depict a SDS-PAGE gel and a graph showing CRISPR-ChAP-MS analysis of transcriptionally active promoter chromatin. (FIG. 11A) Chromatin was affinity purified on IgG-beads from cells grown in galactose-containing media that expressed PrA-Cas9 as a control and cells that expressed PrA-Cas9/gRNA targeted to the promoter region of GAL1. Co-enriched proteins were resolved by SDS-PAGE and identified with high resolution mass spectrometry. Label-free proteomics was used to determine whether a protein or histone PTM was specifically enriched with the promoter chromatin. (FIG. 11B) ChIP to PrA-tagged versions of the proteins or to the histone PTM (normalized for nucleosome occupancy) purified with the promoter chromatin was used to validate enrichment at the GAL1 promoter relative to ACT1. Cells were grown in either glucose or galactose-containing media.

DETAILED DESCRIPTION OF THE INVENTION

A method of isolating and identifying proteins associated with a target region of chromatin in a cell has been discovered. The method may also be used to identify post-translational modifications (PTMs) of proteins associated with a target chromatin in a cell. Advantageously, the method may be used to determine whether the association of the identified proteins with a chromatin in a cell is specific or non-specific. As used herein, “specifically associated” or “specific association” of a protein with a target chromatin refers to any protein in a cell that normally associates with a chromatin in a cell. In addition, and as illustrated in the examples, the method may be used to determine the role of proteins and post-translational modifications (PTMs) of proteins in chromatin function, including regulatory mechanisms of transcription, and the role of epigenomic factors in controlling chromatin function.

I. Method of ChAP-MS

In some aspects, the invention provides methods of isolating and identifying proteins specifically associated with a target chromatin. As described in Example 1 and FIG. 1, a method of the invention comprises isolating a target chromatin from a cell. As used herein, a “target chromatin” refers to a specific chromatin or a chromatin fragment that may be used in an application of the invention. According to the method, isolating the target chromatin isolates nucleic acid sequences and proteins, including proteins comprising posttranslational modifications, associated with the target chromatin. The proteins and posttranslational modifications of proteins associated with the target chromatin may then be identified, and a determination of which of the identified proteins and posttranslational modifications of proteins associated with a target chromatin isolated from a cell are specifically or non-specifically associated with the target chromatin is made.

To determine which of the identified proteins and posttranslational modifications of proteins associated with a target chromatin isolated from a cell are specifically or non-specifically associated with the target chromatin, a method of the invention provides two cell samples, or lysates derived from two cell samples, comprising the target chromatin, wherein proteins in one cell sample, but not both of the cell samples are metabolically labeled. Typically, the two cell samples are grown identically. In addition, the target chromatin in one of the cell samples or an extract from one of the cell samples is tagged. The two cell samples, or lysates derived from the cell samples of the invention are combined. The tagged target chromatin is isolated in the presence of the other cell sample or an extract from the other cell sample. Therefore, if a target chromatin of the invention is tagged in the unlabeled cell sample, proteins specifically associated with the tagged chromatin are unlabeled, and will be isolated in the presence of labeled proteins from the labeled cell sample. Alternatively, if a target chromatin of the invention is tagged in the labeled cell sample, the proteins associated with the tagged chromatin are labeled, and will be isolated in the presence of unlabeled proteins from the unlabeled cell sample.

As such, determining if a certain identified protein associated with the target chromatin is labeled, unlabeled, or a combination of labeled and unlabeled may determine if the protein was specifically associated with a target chromatin of the invention. If an identified protein comprises a mixture of labeled and unlabeled proteins, then that protein became associated with a target chromatin during the chromatin isolation procedure, and association of that protein with the target chromatin is not specific. If a target chromatin of the invention is isolated from the unlabeled cell sample, only unlabeled identified proteins associated with the target chromatin are specifically associated with the target chromatin. Alternatively, if a target chromatin of the invention is isolated from the labeled cell sample, only labeled identified proteins associated with the target chromatin are specifically associated with the target chromatin.

In some embodiments, a tagged target chromatin of the invention is isolated from an unlabeled cell sample, and unlabeled proteins associated with the target chromatin are specifically associated with the target chromatin. In other embodiments, a tagged target chromatin of the invention is isolated from a labeled cell sample, and labeled proteins associated with the target chromatin are specifically associated with the target chromatin.

(a) Cells

A target nucleic acid sequence may be isolated from any cell comprising the target nucleic acid sequence of the invention. A cell may be an archaebacterium, a eubacterium, or a eukaryotic cell. For instance, a cell of the invention may be a methanogen, a halophile or a thermoacidophile archaeabacterium, a gram positive, a gram negative, a cyanobacterium, a spirochaete, or a firmicute bacterium, a fungal cell, a moss cell, a plant cell, an animal cell, or a protist cell.

In some embodiments, a cell of the invention is a cell from an animal. A cell from an animal cell may be a cell from an embryo, a juvenile, or an adult. Suitable animals include vertebrates such as mammals, birds, reptiles, amphibians, and fish. Examples of suitable mammals include without limit rodents, companion animals, livestock, and primates. Non-limiting examples of rodents include mice, rats, hamsters, gerbils, and guinea pigs. Suitable companion animals include but are not limited to cats, dogs, rabbits, hedgehogs, and ferrets. Non-limiting examples of livestock include horses, goats, sheep, swine, cattle, llamas, and alpacas. Suitable primates include but are not limited to humans, capuchin monkeys, chimpanzees, lemurs, macaques, marmosets, tamarins, spider monkeys, squirrel monkeys, and vervet monkeys. Non-limiting examples of birds include chickens, turkeys, ducks, and geese. In some embodiments, a cell is a cell from a human.

In some embodiments, a cell may be from a model organism commonly used in laboratory research. For instance, a cell of the invention may be an E. coli, a Bacillus subtilis, a Caulobacter crescentus, a Mycoplasma genitalium, an Aliivibrio fischeri, a Synechocystis, or a Pseudomonas fluorescens bacterial cell; a Chlamydomonas reinhardtii, a Dictyostelium discoideum, a Tetrahymena thermophila, an Emiliania huxleyi, or a Thalassiosira pseudonana protist cell; an Ashbya gossypii, an Aspergillus nidulans, a Coprinus cinereus, a Cunninghamella elegans, a Neurospora crassa, a Saccharomyces cerevisiae, a Schizophyllum commune, a Schizosaccharomyces pombe, or an Ustilago maydis fungal cell; an Arabidopsis thaliana, a Selaginella moellendorffii, a Brachypodium distachyon, a Lotus japonicus, a Lemna gibba, a Zea mays, a Medicago truncatula, a Mimulus, a tobacco, a rice, a Populus, or a Nicotiana benthamiana plant cell; a Physcomitrella patens moss; an Amphimedon queenslandica sponge, an Arbacia punctulata sea urchin, an Aplysia sea slug, a Branchiostoma floridae deuterostome, a Caenorhabditis elegans nematode, a Ciona intestinalis sea squirt, a Daphnia spp. crustacean, a Drosophila fruit fly, a Euprymna scolopes squid, a Hydra Cnidarian, a Loligo pealei squid, a Macrostomum lignano flatworm, a Mnemiopsis leidyicomb jelly, a Nematostella vectensis sea anemone, an Oikopleura dioica free-swimming tunicate, an Oscarella carmela sponge, a Parhyale hawaiensis crustacean, a Platynereis dumerilii marine polychaetous annelid, a Pristionchus pacificus roundworm, a Schmidtea mediterranea freshwater planarian, a Stomatogastric ganglion of various arthropod species, a Strongylocentrotus purpuratus sea urchin, a Symsagittifera roscoffensis flatworm, a Tribolium castaneum beetle, a Trichoplax adhaerens Placozoa, a Tubifex tubifex oligochaeta, a laboratory mouse, a Guinea pig, a Chicken, a Cat, a Dog, a Hamster, a Lamprey, a Medaka fish, a Rat, a Rhesus macaque, a Cotton rat, a Zebra finch, a Takifugu pufferfish, an African clawed frog, or a Zebrafish. In exemplary embodiments, a cell is a Saccharomyces cerevisiae yeast cell. In particularly exemplary embodiments, a cell is a Saccharomyces cerevisiae W303a yeast cell.

A cell of the invention may be derived from a tissue or from a cell line grown in tissue culture. A cell line may be adherent or non-adherent, or a cell line may be grown under conditions that encourage adherent, non-adherent or organotypic growth using standard techniques known to individuals skilled in the art. Cell lines and methods of culturing cell lines are known in the art. Non-limiting examples of cell lines commonly cultured in a laboratory may include HeLa, a cell line from the National Cancer Institute's 60 cancer cell lines, DU145 (prostate cancer), Lncap (prostate cancer), MCF-7 (breast cancer), MDA-MB-438 (breast cancer), PC3 (prostate cancer), T47D (breast cancer), THP-1 (acute myeloid leukemia), U87 (glioblastoma), SHSY5Y Human neuroblastoma cells, Saos-2 cells (bone cancer), Vero, GH3 (pituitary tumor), PC12 (pheochromocytoma), MC3T3 (embryonic calvarium), Tobacco BY-2 cells, Zebrafish ZF4 and AB9 cells, Madin-Darby canine kidney (MDCK), or Xenopus A6 kidney epithelial cells.

A cell of the invention may be derived from a biological sample. As used herein, the term “biological sample” refers to a sample obtained from a subject. Any biological sample containing a cell is suitable. Numerous types of biological samples are known in the art. Suitable biological sample may include, but are not limited to, tissue samples or bodily fluids. In some embodiments, the biological sample is a tissue sample such as a tissue biopsy. The tissue biopsy may be a biopsy of a known or suspected tumor. The biopsied tissue may be fixed, embedded in paraffin or plastic, and sectioned, or the biopsied tissue may be frozen and cryosectioned. Alternatively, the biopsied tissue may be processed into individual cells or an explant, or processed into a homogenate, a cell extract, a membranous fraction, or a protein extract. The sample may also be primary and/or transformed cell cultures derived from tissue from the subject. In other embodiments, the sample may be a bodily fluid. Non-limiting examples of suitable bodily fluids include blood, plasma, serum, and urine. The fluid may be used “as is”, the cellular components may be isolated from the fluid, or a protein fraction may be isolated from the fluid using standard techniques.

Suitable subjects include, but are not limited to, a human, a livestock animal, a companion animal, a lab animal, and a zoological animal. In one embodiment, the subject may be a rodent, e.g. a mouse, a rat, a guinea pig, etc. In another embodiment, the subject may be a livestock animal. Non-limiting examples of suitable livestock animals may include pigs, cows, horses, goats, sheep, llamas and alpacas. In yet another embodiment, the subject may be a companion animal. Non-limiting examples of companion animals may include pets such as dogs, cats, rabbits, and birds. In yet another embodiment, the subject may be a zoological animal. As used herein, a “zoological animal” refers to an animal that may be found in a zoo. Such animals may include non-human primates, large cats, wolves, and bears. In preferred embodiments, the animal is a laboratory animal. Non-limiting examples of a laboratory animal may include rodents, canines, felines, and non-human primates. In a preferred embodiment, the subject is human.

As will be appreciated by a skilled artisan, the method of collecting a biological sample can and will vary depending upon the nature of the biological sample and the type of analysis to be performed. Any of a variety of methods generally known in the art may be utilized to collect a biological sample. Generally speaking, the method preferably maintains the integrity of the sample such that chromatin can be accurately detected and measured according to the invention.

As described in Section (I) above, two cell samples, or lysates derived from two cell samples are combined, and a tagged target chromatin of the invention is isolated from the combined cells or combined cell lysates. Typically, cells in two cell samples of the invention are from the same type of cells or they may be derived from the same type of cells. For instance, cells may comprise a heterologous nucleic acid in a target chromatin, and may also comprise a heterologous protein expressed in a cell of the invention. The heterologous nucleic acid in a target chromatin may be used for tagging a chromatin of the invention, and the heterologous protein expressed in a cell may be used for tagging a target chromatin as described in Section I(d). In some embodiments, cells in two cell samples of the invention are from the same type of cells. In other embodiments, cells in the first cell sample are derived from the same cell type as cells in the second cell sample.

Two cell samples of the invention may be from the same genus, species, variety or strain of cells. In preferred embodiments, two cell samples of the invention are Saccharomyces cerevisiae yeast cells or derivatives of Saccharomyces cerevisiae yeast cells. In exemplary embodiments, two cell samples of the invention are Saccharomyces cerevisiae W303a yeast cells or derivatives of Saccharomyces cerevisiae W303a yeast cells. In exemplary embodiments, two cell samples of the invention are derivatives of Saccharomyces cerevisiae W303a yeast cells comprising the lexA binding site upstream of the GAL1 transcription start site, wherein protein A is expressed in one of the cell samples of derived Saccharomyces cerevisiae W303a yeast cells.

According to the invention, a metabolically labeled cell sample and an unlabeled cell sample are combined to generate a combined cell sample, or lysates derived from the two cell samples are combined to generate a combined cell lysate. Cell samples may be combined in a weight to weight (w/w) ratio of about 1:100 to about 100:1, about 1:50 to about 50:1, about 1:25 to about 25:1, preferably about 1:10 to about 10:1, and more preferably about 1:5 to about 5:1. In preferred embodiments, cell samples are combined in a w/w ratio of about 1:5 to about 5:1, about 1:2 to about 2:1, about 1:1.5 to about 1.5:1, or about 1:1. In exemplary embodiments, cell samples are combined in a w/w ratio of about 1:1. If cell lysates derived from two cell samples of the invention are combined, lysates derived from cell ratios described herein are combined. Individuals of ordinary skill in the art will recognize that ratios of cell samples or lysates derived from cell samples described herein may be subject to statistical confidence limits of actual cell weight. For instance, the ratio may be based on 85, 90, 95% or more confidence limits on cell weight.

The number of cells in a cell sample can and will vary depending on the type of cells, the abundance of a target chromatin in a cell, and the method of protein identification used, among other variables. For instance, if a cell of the invention is Saccharomyces cerevisiae, about 5×10¹⁰ to about 5×10¹², more preferably, about 1×10¹¹ to about 1×10¹² cells may be used in a cell sample. In some embodiments, about about 1×10¹¹ to about 1×10¹² Saccharomyces cerevisiae cells are used in a cell sample.

Two cell samples of the invention are typically grown identically. Identically grown cell samples minimizes potential structural or functional differences at a target chromatin present in both cell samples. As used herein, “grown identically” refers to cultured cell samples grown using similar culture condition, or cells from a tissue harvested using identical harvesting techniques. As described below, the two cell samples of the invention are grown identically in a manner that allows the metabolic labeling of proteins in one of the cell samples. For instance, the two cell samples of the invention are grown identically, except that one of the cell samples may be grown in the presence of a labeled amino acid as described in the examples, to generate a cell sample with metabolically labeled proteins.

Proteins in a cell sample are metabolically labeled. Methods of metabolically labeling proteins in a cell are known in the art and may comprise culturing a cell in the presence of at least one labeled analogue of a biomolecule that is metabolized by a cell of the invention. When the labeled analog of a biomolecule is supplied to cells in culture instead of the unlabeled biomolecule, the labeled biomolecule is incorporated into all newly synthesized proteins. After a number of cell divisions, each instance of this particular labeled biomolecule will be replaced by its labeled analog. Since there is hardly any chemical difference between the labeled biomolecule and the unlabeled biomolecule, the cells behave exactly like the control cell population grown in the presence of unlabeled biomolecule. As such, up to 100% of the particular biomolecule in a cell may be labeled. In some embodiments, up to 10, 20, 30, 40, 50, 60, 70, 80, 90 or up to 100% of the particular biomolecule in a cell is labeled. In preferred embodiments, up to 50, 60, 70, 80, 90 or up to 100%, and more preferably up to 90 or up to 100% of the particular biomolecule in a cell is labeled. In preferred embodiments, up to 100% of the particular biomolecule in a cell is labeled.

A cell may be labeled by culturing a cell in the presence of one or more than one labeled biomolecule. For instance, a cell may be cultured in the presence of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more labeled biomolecules. In some embodiments, a cell may be cultured in the presence of 1, 2, 3, 4, or 5 labeled biomolecules. In other embodiments, a cell may be cultured in the presence of 5, 6, 7, 8, 9, or 10 labeled biomolecules. In preferred embodiments, a cell may be cultured in the presence of 1 or 2 labeled biomolecules.

Non-limiting examples of a biomolecule that may be labeled and is metabolized by a cell of the invention may include an amino acid, a nucleic acid, a carbohydrate or a labeled molecule that may be incorporated into an amino acid, a nucleic acid, or a carbohydrate. Non-limiting examples of a labeled molecule that may be incorporated into an amino acid, a nucleic acid, a carbohydrate may include labeled ammonium sulfate, and labeled ammonium chloride. A labeled biomolecule may be a component of a cell culture medium such as a food source, e.g., glucose, sera or cell extracts. In some embodiments, a labeled biomolecule that is metabolized by a cell of the invention is a labeled nucleic acid. In other embodiments, a labeled biomolecule that is metabolized by a cell of the invention is a labeled carbohydrate such as [¹³C]glucose.

In preferred embodiments, a biomolecule that is metabolized by a cell of the invention is a labeled amino acid. In general, a labeled amino acid of the invention may be a labeled L-amino acid, a labeled D-amino acid or a mixture thereof. In preferred embodiments, a labeled amino acids is a labeled L-amino acids. A labeled amino acid may be a free amino acid or an amino acid salt. A labeled amino acid may also be in the form of intact protein or peptide, provided that the protein or peptide comprises a labeled amino acid of the invention. In some preferred embodiments, a labeled amino acid that may be used for metabolically labeling a cell of the invention may be a labeled L-Lysine, L-Arginine, L-Methionine, L-Tyrosine, or combinations thereof.

A labeled biomolecule may be labeled using a heavy isotope of one or more atoms of the biomolecule. Non limiting examples of a heavy isotope of one or more atoms of a biomolecule may include heavy hydrogen, carbon, nitrogen, phosphorous, oxygen, or sulfur. A labeled biomolecule may be about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 18, 19 or 20 Da or more heavier than an unlabeled biomolecule. In some embodiments, a labeled biomolecule is about 1, 2, 3, 4, or 5 Da heavier than an unlabeled biomolecule. In other embodiments, a labeled biomolecule is about 5, 6, 7, 8, 9, or 10 Da heavier than an unlabeled biomolecule. In yet other embodiments, a labeled biomolecule is about 10, 11, 12, 13, 14, or 15 Da heavier than an unlabeled biomolecule. In additional embodiments, a labeled biomolecule is about 15, 16, 17 18, 19 or 20 Da heavier than an unlabeled biomolecule. In preferred embodiments, a labeled biomolecule is about 4, 5, 6, 7, 8, 9, or 10 Da heavier than an unlabeled biomolecule.

In preferred embodiments, a labeled biomolecule is a labeled amino acid that may be used for metabolically labeling a cell of the invention may be a heavy analog of L-Lysine, L-Arginine, L-Methionine, L-Tyrosine, or combinations thereof. Non limiting examples of heavy analogs of L-Lysine, L-Arginine, L-Methionine, L-Tyrosine may include, [¹³C₆]-L-Lysine, [¹³C₆, ¹⁵N₂]-L-Lysine, [¹³C₆, ¹⁵N₂, D9]-L-Lysine, [¹⁵N₂, D9]-L-Lysine, [4,4,5,5-D4]-L-Lysine, [¹⁵N₂]-L-Lysine, [¹³C₆, ¹⁵N₂]-L-Lysine, [¹³C₆]-L-Arginine, [U-¹³C₆, ¹⁵N₄]-L-Arginine, [U-¹³C₆, ¹⁵N₄, D7]-L-Arginine, [¹⁵N₄, D7]-L-Arginine, [¹⁵N₄]-L-Arginine, [¹³C₆, ¹⁵N₄]-L-Arginine, [1-13C, methyl-D3]-L-Methionine, [¹³C₉; 9 Da]-L-Tyrosine, [¹⁵N]-L-Tyrosine, and [¹³C₉, ¹⁵N]-L-Tyrosine. In an exemplary embodiment, a labeled amino acid used to metabolically label a cell of the invention is [¹³C6, ¹⁵N4]-L-Arginine.

(b) Chromatin

A method of the invention comprises identification of a protein and post-translational modification of a protein associated with a target chromatin. Generally, chromatin refers to the combination of nucleic acids and proteins in the nucleus of a eukaryotic cell. However, it is contemplated that the term “chromatin” may also refer to the combination of any nucleic acid sequence and proteins associated with the nucleic acid sequence in any cell.

A chromatin of the invention may comprise single stranded nucleic acid, double stranded nucleic acid, or a combination thereof. In some embodiments, a chromatin comprises single stranded nucleic acid. In other embodiments, a chromatin comprises a combination of single stranded and double stranded nucleic acids. In yet other embodiments, a chromatin comprises double stranded nucleic acid.

A chromatin of the invention may comprise a ribonucleic acid (RNA), a deoxyribonucleic acid (DNA), or a combination of RNA and DNA. In some embodiments, a chromatin of the invention comprises a combination of a RNA sequence and proteins associated with the RNA sequence in a cell. Non-limiting examples of RNA sequences may include mRNA, and non-coding RNA such as tRNA, rRNA, snoRNAs, microRNAs, siRNAs, piRNAs and the long noncoding RNA (IncRNA). In preferred embodiments, a chromatin of the invention comprises a combination of a DNA sequence and proteins associated with the DNA sequence in a cell. In other preferred embodiments, a chromatin of the invention comprises a combination of RNA and DNA sequences, and proteins associated with the RNA and DNA sequence in a cell. Non limiting examples of chromatin that may comprise a combination of RNA and DNA may include genomic DNA undergoing transcription, or genomic DNA comprising non-coding RNA such as IncRNA.

A chromatin of the invention may be genomic chromatin such as, chromatin from a chromosome of a cell, or chromatin from an organelle in the cell. Alternatively, a chromatin may be chromatin from an extrachromosomal nucleic acid sequence. In some embodiments, a chromatin of the invention is chromatin from an organelle in the cell. Non-limiting examples of a chromatin from an organelle may include mitochondrial nucleic acid sequence in plant and animal cells, and a chloroplast nucleic acid sequence in plant cells. In some embodiments, a nucleic acid sequence of the invention is a mitochondrial nucleic acid sequence. In other embodiments, a nucleic acid sequence of the invention is a chloroplast nucleic acid sequence.

In some embodiments, a chromatin of the invention is chromatin from an extrachromosomal nucleic acid sequence. The term “extrachromosomal,” as used herein, refers to any nucleic acid sequence not contained within the cell's genomic nucleic acid sequence. An extrachromosomal nucleic acid sequence may comprise some sequences that are identical or similar to genomic sequences in the cell, however, an extrachromosomal nucleic acid sequence as used herein does not integrate with genomic sequences of the cell. Non-limiting examples of an extrachromosomal nucleic acid sequence may include a plasmid, a virus, a cosmid, a phasmid, and a plasmid.

In some preferred embodiments, a chromatin of the invention is genomic chromatin. In exemplary embodiments, a chromatin of the invention is genomic chromatin of a eukaryotic cell. A eukaryotic cell of the invention may be as described in Section I(a) above.

Primary functions of genomic chromatin of a eukaryotic cell may be DNA packaging into a smaller volume to fit in the cell, strengthening of the DNA to allow mitosis, prevent DNA damage, and to control gene expression and DNA replication. As described above, genomic chromatin of a eukaryotic cell may comprise DNA sequences and a plurality of DNA-binding proteins as well as certain RNA sequences, assembled into higher order structural or functional regions. As used herein, a “structural or functional feature of a chromatin”, refers to a chromatin feature characterized by, or encoding, a function such as a regulatory function of a promoter, terminator, translation initiation, enhancer, etc., or a structural feature such as heterochromatin, euchromatin, a nucleosome, a telomere, or a centromere. A physical feature of a nucleic acid sequence may comprise a functional role and vice versa. As described below, a chromatin of the invention may be a chromatin fragment, and as such may comprise a fragment of a physical or functional feature of a chromatin, or no physical or functional features or known physical or functional features.

The primary protein components of genomic eukaryotic chromatin are histones that compact the DNA into a nucleosome. The nucleosome comprises an octet of histone proteins around which is wound a stretch of double stranded DNA sequence of about 150 to about 250 bp in length. Histones H2A, H2B, H3 and H4 are part of the nucleosome while histone H1 may act to link adjacent nucleosomes together into a higher order structure. Histones are subject to post translational which may affect their function in regulating chromatin function. Such modifications may include methylation, citrullination, acetylation, phosphorylation, SUMOylation, ubiquitination, and ADP-ribosylation.

Many further polypeptides and protein complexes interact with the nucleosome and the histones to regulate chromatin function. A “polypeptide complex” as used herein, is intended to describe proteins and polypeptides that assemble together to form a unitary association of factors. The members of a polypeptide complex may interact with each other via non-covalent or covalent bonds. Typically members of a polypeptide complex will cooperate to enable binding either to a nucleic acid sequence or to polypeptides and proteins already associated with or bound to a nucleic acid sequence in chromatin. Chromatin associated polypeptide complexes may comprise a plurality of proteins and/or polypeptides which each serve to interact with other polypeptides that may be permanently associated with the complex or which may associate transiently, dependent upon cellular conditions and position within the cell cycle. Hence, particular polypeptide complexes may vary in their constituent members at different stages of development, in response to varying physiological conditions or as a factor of the cell cycle. By way of example, in animals, polypeptide complexes with known chromatin remodelling activities include Polycomb group gene silencing complexes as well as Trithorax group gene activating complexes.

Additionally, a protein associated with a chromatin of the invention may be a protein normally expressed in a cell, or may be an exogenous heterologous protein expressed in a cell. In some embodiments, a protein associated with a chromatin of the invention is a protein normally expressed in a cell. In other embodiments, a protein associated with a chromatin of the invention is a protein not normally expressed in a cell.

A chromatin of the invention may be an intact and complete chromatin from the cell, or may be a fragment of a chromatin in a cell. In some embodiments, a chromatin of the invention is an intact chromatin isolated from a cell. For instance, a chromatin of the invention may be a plasmid, a cosmid, or a phage chromatin or a complete organellar chromatin. In preferred embodiments, a chromatin of the invention is a fragment of a chromatin from a cell. In exemplary embodiments, a chromatin of the invention is a fragment of a genomic chromatin from a cell.

When a chromatin of the invention is a fragment of a chromatin in a cell, any method of fragmenting a chromatin known in the art may be used. Such methods may include physical methods of fragmenting a chromatin, or enzymatic digestion of a nucleic acid sequence of a chromatin. In some embodiments, a fragment of a chromatin may be generated using enzymatic digestion of a nucleic acid sequence in chromatin. Non-limiting examples of enzymatic digestion may include random or sequence specific enzymatic digestion using restriction enzymes, nucleases, combinations of restriction enzymes and nucleases, or combinations of nicking and other nucleases such as NEBNext™ fragmentase, which comprises a nicking enzyme that randomly generates nicks in double stranded DNA and another enzyme that cuts the strand opposite to the generated nicks.

In other embodiments, a fragment of a chromatin may be generated using a physical method of fragmenting a chromatin. Non-limiting examples of physical fragmenting methods that may be used to fragment a chromatin of the invention may include nebulization, sonication, and hydrodynamic shearing. In some embodiments, a fragment of a chromatin may be generated using nebulization. In other embodiments, a fragment of a chromatin may be generated using hydrodynamic shearing. In preferred embodiments, a fragment of a chromatin may be generated using sonication. During sonication, a sample comprising chromatin is subjected to ultrasonic waves, whose vibrations produce gaseous cavitations in the liquid that shear or break high molecular weight molecules such as chromatin through resonance vibration. Sonication methods that may be used to generate a chromatin of the invention are known in the art

A fragment of a chromatin of the invention may comprise a nucleic acid sequence fragment and may be about 10, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850, 1900, 1950, 2000, 2050, 2100, 2150, 2200, 2250, 2300, 2350, 2400, 2450, 2500, 2550, 2600, 2650, 2700, 2750, 2800, 2850, 2900, 2950, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or about 10000 bases long or more. In some embodiments, a chromatin of the invention may comprise a nucleic acid sequence fragment of about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, or about 500 bases long. In other embodiments, a chromatin of the invention may comprise a nucleic acid sequence fragment of about 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, or about 1000 bases long. In yet other embodiments, a chromatin of the invention may comprise a nucleic acid sequence fragment of about 1000, 1010, 1020, 1030, 1040, 1050, 1060, 1070, 1080, 1090, 1100, 1110, 1120, 1130, 1140, 1150, 1160, 1170, 1180, 1190, 1200, 1210, 1220, 1230, 1240, 1250, 1260, 1270, 1280, 1290, 1300, 1310, 1320, 1330, 1340, 1350, 1360, 1370, 1380, 1390, 1400, 1410, 1420, 1430, 1440, 1450, 1460, 1470, 1480, 1490, or about 1500 bases long. In other embodiments, a chromatin of the invention may comprise a nucleic acid sequence fragment of about 1500, 1510, 1520, 1530, 1540, 1550, 1560, 1570, 1580, 1590, 1600, 1610, 1620, 1630, 1640, 1650, 1660, 1670, 1680, 1690, 1700, 1710, 1720, 1730, 1740, 1750, 1760, 1770, 1780, 1790, 1800, 1810, 1820, 1830, 1840, 1850, 1860, 1870, 1880, 1890, 1900, 1910, 1920, 1930, 1940, 1950, 1960, 1970, 1980, 1990, or about 2000 bases long. In additional embodiments, a chromatin of the invention may comprise a nucleic acid sequence fragment of about 2000, 2100, 2150, 2200, 2250, 2300, 2350, 2400, 2450, or about 2500 bases long. In other embodiments, a chromatin of the invention may comprise a nucleic acid sequence fragment of about 2000, 2050, 2100, 2150, 2200, 2250, 2300, 2350, 2400, 2450, or about 2500 bases long. In still other embodiments, a chromatin of the invention may comprise a nucleic acid sequence fragment of about 2500, 2550, 2600, 2650, 2700, 2750, 2800, 2850, 2900, 2950, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or about 10000 bases long or more.

In some preferred embodiments, a chromatin fragment of the invention may comprise a nucleic acid sequence fragment of about 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, 1000, 1010, 1020, 1030, 1040, 1050, 1060, 1070, 1080, 1090, 1100, 1110, 1120, 1130, 1140, 1150, 1160, 1170, 1180, 1190, 1200, 1210, 1220, 1230, 1240, or about 1250 bases long. In a preferred embodiment, a chromatin of the invention may comprise a nucleic acid sequence fragment of about 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, or about 850 bases long. In another preferred embodiment, a chromatin of the invention may comprise a nucleic acid sequence fragment of about 950, 960, 970, 980, 990, 1000, 1010, 1020, 1030, 1040, or about 1050 bases long.

In other preferred embodiments, a chromatin fragment of the invention may comprise a nucleic acid sequence fragment of about 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, 1000, 1010, 1020, 1030, 1040, 1050, 1060, 1070, 1080, 1090, 1100, 1110, 1120, 1130, 1140, 1150, 1160, 1170, 1180, 1190, 1200, 1210, 1220, 1230, 1240, 1250, 1260, 1270, 1280, 1290, 1300, 1310, 1320, 1330, 1340, 1350, 1360, 1370, 1380, 1390, 1400, 1410, 1420, 1430, 1440, 1450, 1460, 1470, 1480, 1490, or about 1500 bases long. In a preferred embodiment, a chromatin of the invention may comprise a nucleic acid sequence fragment of about 950, 960, 970, 980, 990, 1000, 1010, 1020, 1030, 1040, or about 1050 bases long. In another preferred embodiment, a chromatin of the invention may comprise a nucleic acid sequence fragment of about 1200, 1210, 1220, 1230, 1240, 1250, 1260, 1270, 1280, 1290, or about 1300 bases long.

As described in this section above, a chromatin of the invention may comprise one or more nucleosomes. As such, a chromatin fragment of the invention may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or about 20 nucleosomes. In some embodiments, a chromatin fragment of the invention may comprise about 1, 2, 3, 4, or about 5 nucleosomes. In other embodiments, a chromatin fragment of the invention may comprise about 5, 6, 7, 8, 9, or about 10 nucleosomes. In yet other embodiments, a chromatin fragment of the invention may comprise about 10, 11, 12, 13, 14, or about 15 nucleosomes. In other embodiments, a chromatin fragment of the invention may comprise about 15, 16, 17, 18, 19, or about 20 nucleosomes. In preferred embodiments, a chromatin fragment of the invention may comprise about 4 nucleosomes. In other preferred embodiments, a chromatin fragment of the invention may comprise about 5 nucleosomes.

A target chromatin fragment of the invention may comprise a structural or a functional feature of chromatin as described above, a fragment of a physical or functional feature, or no physical or functional features or known physical or functional features. In some embodiments, a target chromatin fragment of the invention comprises a structural feature of chromatin. In other embodiments, a target chromatin fragment of the invention comprises no physical or functional features or known physical or functional features. In yet other embodiments, a target chromatin fragment of the invention comprises a functional feature of chromatin. In exemplary embodiments, a functional feature of chromatin is a promoter. In particularly exemplary embodiments, a functional feature of chromatin is a GAL1 promoter of Saccharomyces cerevisiae.

(c) Preparation of Cell Lysate

A target chromatin is isolated from a combined cell lysate. A combined cell lysate comprises a lysate of two combined cell samples, or a combination of two cell lysates derived from two cell samples, wherein a target chromatin is tagged in one of the cell samples. Irrespective of whether one cell sample or a combined cell sample is lysed, a skilled practitioner of the art will appreciate that structural and functional features of a target chromatin must be preserved during cell lysis and isolation of the target chromatin. The association of proteins with a target chromatin may be preserved during cell lysis and isolation of the target chromatin using methods known in the art for preserving a complex of proteins with a nucleic acid sequence. For instance, lysing of a cell and isolation of a target chromatin may be performed under refrigeration or using cryogenic methods and buffer conditions capable of preserving association of proteins and nucleic acid sequences. In addition, a complex of proteins with a nucleic acid may be preserved by crosslinking protein and nucleic acid complexes in a cell prior to lysing and isolating a chromatin. Crosslinking protein and nucleic acid complexes in a cell may also capture, or preserve, transient protein-protein and protein-nucleic acid interactions.

In some embodiments, a complex of proteins with a nucleic acid may be preserved by crosslinking protein and nucleic acid complexes in a chromatin prior to lysing a cell and isolating the chromatin. Crosslinking is the process of joining two or more molecules such as two proteins or a protein and a nucleic acid molecule, by a covalent bond. Molecules may be crosslinked by irradiation with ultraviolet light, or by using chemical crosslinking reagents. Chemical crosslinking reagents capable of crosslinking proteins and nucleic acids are known in the art and may include crosslinking reagents that target amines, sulfhydryls, carboxyls, carbonyls or hydroxyls; omobifunctional or heterobifunctional crosslinking reagent, variable spacer arm length or zero-length crosslinking reagents, cleavable or non-cleavable crosslinking reagents, and photoreactive crosslinking reagents. Non-limiting examples of crosslinking reagents that may be used to crosslink protein complexes and/or protein complexes and nucleic acids may include formaldehyde, glutaraldehyde, disuccinimidyl glutarate, disuccinimidyl suberate, a photoreactive amino acid such as photo-leucine or photo-methionine, and succinimidyl-diazirine. The degree of crosslinking can and will vary depending on the application of a method of the invention, and may be experimentally determined.

In a preferred embodiment, a complex of proteins with a nucleic acid in a chromatin of the invention may be preserved by crosslinking protein and nucleic acid complexes in a cell prior to lysing using formaldehyde. In an exemplary embodiment, a complex of proteins with a nucleic acid in a chromatin of the invention may be preserved by crosslinking protein and nucleic acid complexes in a cell prior to lysing using formaldehyde as described in the examples.

A skilled practitioner of the art will appreciate that protocols for lysing a cell can and will vary depending on the type of cell, the target chromatin of the invention, and the specific application of a method of the invention. Non limiting examples of methods that may be used to lyse a cell of the invention may include cell lysis using a detergent, an enzyme such as lysozyme, incubation in a hypotonic buffer which causes a cell to swell and burst, mechanical disruption such as liquid homogenization by forcing a cell through a narrow space, sonication, freeze/thaw, mortar and pestle, glass beads, and combinations thereof. In some embodiments, when a cell of the invention is a yeast cell, the cell may be cryogenically lysed under liquid nitrogen temperature with glass beads. In exemplary embodiments, when a cell of the invention is a yeast cell, the cell may be cryogenically lysed under liquid nitrogen temperature with glass beads as described in the examples.

Buffer conditions used during lysing and isolation of a chromatin of the invention can and will be altered to control stringent conditions during cell lysis and isolation to preserve association of proteins and nucleic acid sequences of a chromatin. “Stringent conditions” in the context of chromatin isolation are conditions capable of preserving specific association of proteins and nucleic acids of a chromatin, but minimizing non-specific association of proteins and nucleic acids. Stringent condition can and will vary depending on the application of a method of the invention, the target chromatin of the invention, the nucleic acid sequence in a target chromatin, the proteins or protein complexes associated with a target chromatin of the invention, whether or not proteins, protein complexes and nucleic acid sequences are crosslinked, and the conditions used for crosslinking proteins, protein complexes and nucleic acid sequences of a target chromatin. For instance, more stringent buffer conditions may be used in a method of the invention wherein proteins, protein-protein complexes, and protein-nucleic acid complexes are crosslinked compared to a method of the invention wherein proteins, protein-protein complexes, and protein-nucleic acid complexes are not crosslinked. As such, stringent buffer conditions used during cell lysis and isolation of a nucleic acid sequence of the invention may be experimentally determined for each application wherein a method of the invention is used. Buffer conditions that may alter stringent conditions during cell lysis and isolation may include pH and salt concentration. In preferred embodiments, proteins, protein-protein complexes, and protein-nucleic acid complexes of a target chromatin of the invention are crosslinked, and stringent buffer conditions are used during lysis and isolation of a chromatin of the invention. In exemplary embodiments, proteins, protein-protein complexes, and protein-nucleic acid complexes of a target chromatin of the invention are crosslinked, and stringent buffer conditions are used during lysis and isolation of a chromatin of the invention and are as described in the examples.

(d) Chromatin Isolation

According to the invention, a tagged target chromatin is isolated from a combined cell lysate. As described in Sections I(a) and I(c) above, a combined cell lysate comprises a lysate of two combined cell samples, or a combination of two cell lysates derived from two cell samples, wherein a target chromatin is tagged in one of the lysates, or one of the cell samples. As such, a target chromatin is isolated from a cell lysate comprising a combination of a tagged target chromatin and an untagged target chromatin. The ratio of tagged target chromatin to untagged target chromatin reflects the ratio at which the two cell samples or the lysates derived from the two cell sample are combined. In addition, proteins in one of the cell samples or lysate derived from one of the cell samples are metabolically labeled. Therefore, when a tagged target chromatin is from a cell sample wherein proteins are metabolically labeled, a cell lysate of the invention comprises a combination of a tagged target chromatin comprising metabolically labeled proteins, and an untagged target chromatin comprising unlabeled proteins. Conversely, when a tagged target chromatin is from a cell sample wherein proteins are unlabeled, a cell lysate of the invention comprises a combination of a tagged target chromatin comprising unlabeled proteins, and an untagged target chromatin comprising labeled proteins.

A target chromatin may be isolated from a mixture of chromatins or chromatin fragments in a cell lysate as described in this section. As used herein, a target nucleic acid sequence is said to be “isolated” or “purified” when it is substantially free of proteins not associated with the target chromatin, nucleic acid sequences other than the nucleic acid sequences associated with the target chromatin, and other cell debris and cell contents resulting from extraction and preparation of the target chromatin from a cell. A target chromatin of the present invention may be purified to homogeneity or other degrees of purity. In general, the level of purity of an isolated target chromatin can and will vary depending on the cell type, the specific chromatin to be isolated, and the intended use of a target chromatin of the invention. The level of purity of an isolated target chromatin may be determined using methods known in the art. For instance, the level of purity of an isolated target chromatin may be determined by determining the level of purity of a nucleic acid sequence associated with a target chromatin, by determining the level of purity of a protein associated with a target chromatin, or by determining the level of enrichment of a target chromatin, compared to a non-target chromatin in a cell. In preferred embodiments, the level of purity of an isolated target chromatin is determined by determining the level of enrichment of a target chromatin, compared to a non-target chromatin in a cell. Determining the level of enrichment of a target chromatin, compared to a non-target chromatin in a cell may be as described in this section below.

A target chromatin of the invention may be isolated using methods known in the art, such as electrophoresis, molecular, immunological and chromatographic techniques, ion exchange, hydrophobic, affinity, and reverse-phase HPLC chromatography, size exclusion chromatography, precipitation, dialysis, chromatofocusing, ultrafiltration and diafiltration techniques, and combinations thereof. For general guidance in suitable purification techniques, see Scopes, R., Protein Purification, Springer-Vertag, NY (1982).

In general, a method of the invention comprises isolating a target chromatin by affinity purification, or affinity purification in combination with other methods of isolating chromatin described above. In a preferred embodiment, a method of the invention comprises isolating a target chromatin by affinity purification. Non limiting examples of affinity purification techniques that may be used to isolate a target chromatin of the invention may include affinity chromatography, immunoaffinity chromatography, size exclusion chromatography, and combinations thereof. See, for example, Roe (ed), Protein Purification Techniques: A Practical Approach, Oxford University Press, 2nd edition, 2001.

In essence, affinity purification of a target chromatin may comprise tagging a target chromatin by contacting the target chromatin of the invention with a tag capable of specifically recognizing and binding one or more portions of a target chromatin. As used herein, “specifically recognizing” refers to a binding reaction between two separate molecules that is at least two times the background and more typically more than 10 to 100 times the background molecular associations under physiological conditions. As described in Section (I), two cell samples, or lysates derived from the cell samples of the invention are combined, and a target chromatin in one of the cell samples or an extract from one of the cell samples is tagged. In addition, proteins in one cell sample, but not both of the cell samples are metabolically labeled. As such, a target chromatin may be tagged in a cell or an extract from a cell wherein proteins are metabolically labeled, and proteins specifically associated with an isolated target chromatin are metabolically labeled. Alternatively, a target chromatin may be tagged in a cell or an extract from a cell wherein proteins are not metabolically labeled, and proteins specifically associated with an isolated target chromatin are not metabolically labeled. In some embodiments, a target chromatin is tagged in a cell or an extract from a cell wherein proteins are metabolically labeled. In other embodiments, a target chromatin is tagged in a cell or an extract from a cell wherein proteins are metabolically labeled.

A tag may be capable of specifically recognizing and binding 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 components of a target chromatin. In preferred embodiments, a tag is capable of specifically recognizing and binding one component of a target chromatin.

A tag may be capable of specifically recognizing and binding a component in a target chromatin. A component in a target chromatin may be a nucleic acid sequence in a nucleic acid associated with a target chromatin, a protein associated with a target chromatin, or a chromatin structural or functional feature in a target chromatin. In some embodiments, a tag is capable of specifically recognizing and binding a protein associated with a target chromatin. In other embodiments, a tag is capable of specifically recognizing and binding a chromatin structural or functional feature in a target chromatin. In preferred embodiments, a tag is capable of specifically recognizing and binding a nucleic acid sequence associated with a target chromatin.

A nucleic acid sequence associated with a target chromatin that may be specifically recognized and bound by a tag of the invention may be a nucleic acid sequence normally found in a chromatin of a cell of the invention. Alternatively, a nucleic acid sequence associated with a target chromatin that may be specifically recognized and bound by a tag of the invention may be an exogenous nucleic acid sequence introduced into a cell to facilitate tagging a target chromatin of the invention. In some embodiments, a nucleic acid sequence that may be recognized and bound by a tag is a nucleic acid sequence normally found in a chromatin of a cell of the invention. In other embodiments, a nucleic acid sequence that may be recognized and bound by a tag of the invention is an exogenous nucleic acid sequence introduced into a cell of the invention to facilitate tagging a chromatin of the invention. Non limiting examples of an exogenous nucleic acid sequence introduced into a cell to facilitate tagging a target chromatin of the invention may be the lexA binding sequence, and the Lac operator. In a preferred embodiment, a heterologous nucleic acid sequence introduced into a cell to facilitate tagging a target nucleic acid sequence of the invention is the lexA binding sequence. In an exemplary embodiment, a heterologous nucleic acid sequence introduced into a cell to facilitate tagging a target nucleic acid sequence of the invention is the lexA binding sequence immediately upstream of the transcription start site.

Individuals of ordinary skill in the art will recognize that an exogenous chromatin component introduced into a cell to facilitate tagging a target chromatin of the invention cannot and will not disrupt a target chromatin, or a structural or functional feature of a target chromatin. Methods of designing a chromatin component and a tag capable of binding the chromatin component that do not disrupt a chromatin of the invention may depend on the particular application of a method of the invention, and may be determined experimentally. For instance, if an application of a method of the invention comprises promoter function, a tag may be designed to bind anywhere adjacent to the promoter, but without disrupting the promoter.

A tag of the invention may further comprise one or more affinity handles. As used herein, the term “affinity handle” may refer to any handle that may be bound by a substrate for affinity purification, as described below. A tag may comprise one or more than one affinity handle. The inclusion of more than one affinity handle in a tag of the invention may significantly increase the efficiency of affinity purification for a low copy number chromatin target. As such, a tag may further comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more affinity handles. In a preferred embodiment, a tag of the invention comprises one affinity handle.

Affinity handles may include any affinity handle for which a cognate binding agent is readily available. An affinity handle may be an aptamer, an antibody, an antibody fragment, a double-stranded DNA sequence, modified nucleic acids and nucleic acid mimics such as peptide nucleic acids, locked nucleic acids, phosphorodiamidate morpholino oligomers (PMO), a ligand, a ligand fragment, a receptor, a receptor fragment, a polypeptide, a peptide, a coenzyme, a coregulator, an allosteric molecule, non-immunoglobulin scaffolds such as Affibodies, Anticalins, designed Ankyrin repeat proteins and others, an ion, or a small molecule for which a cognate binding agent is readily available. The term “aptamer” refers to a polypeptide or a polynucleotide capable of binding to a target molecule at a specific region. It is generally accepted that an aptamer, which is specific in its binding to any polypeptide, may be synthesized and/or identified by in vitro evolution methods. Non limiting examples of handles that may be suitable for isolating a chromatin may include biotin or a biotin analogue such as desthiobiotin, digoxigenin, dinitrophenol or fluorescein, a macromolecule that binds to a nucleic acid or a nucleic acid binding protein such as the Lac repressor, a zinc finger protein, a transcription activator protein capable of binding a nucleic acid, or a transcription activator-like (TAL) protein, antigenic polypeptides such as protein A, or peptide ‘tags’ such as polyhistidine, FLAG, HA and Myc tags. In preferred embodiments, a tag of the invention comprises an antigenic polypeptide. In exemplary embodiments, a tag of the invention comprises the protein A antigenic polypeptide, or derivatives thereof. Protein A is capable of binding the lexA binding site, and comprises an affinity handle capable of binding IgG. As such, protein A may be used as an affinity purification tag for purifying a target chromatin comprising a lexA binding tag.

In some embodiments, a tag of the invention is a nucleic acid tag capable of binding a nucleic acid sequence component of a chromatin, wherein the nucleic acid sequence component of the chromatin is introduced into a cell of the invention. In some embodiments, a tag of the invention is a nucleic acid tag capable of binding a nucleic acid sequence component of a chromatin, wherein the nucleic acid sequence component of the chromatin is normally present in a cell of the invention. Non-limiting examples of nucleic acid tags capable of binding a nucleic acid sequence component of a chromatin include antisense RNA or DNA nucleic acid tags, and tags comprising modified nucleic acids and nucleic acid mimics such as peptide nucleic acids, locked nucleic acids, phosphorodiamidate morpholino oligomers (PMO). In some embodiments, a tag of the invention is a nucleic acid tag comprising locked nucleotides. For instance, a nucleic acid tag comprising locked nucleotides may be as described in US20110262908 or US20120040857, and a peptide nucleic acid tag may be as described in Boffa et al. 1995 PNAS 92:1901-1905, the disclosures of all of which are incorporated herein in their entirety.

In some preferred embodiments, a tag of the invention is a protein tag capable of binding a nucleic acid sequence component of a chromatin, wherein the nucleic acid sequence component of the chromatin is a nucleic acid sequence normally found in a chromatin of a cell of the invention. Non limiting examples of a protein tag capable of binding a nucleic acid sequence normally found in a chromatin of a cell may be a nucleic acid binding protein such as protein A, the Lac repressor, a zinc finger protein, a transcription activator protein capable of binding a nucleic acid, or a transcription activator-like (TAL) protein. In one embodiment, a tag of the invention is a transcription activator protein capable of binding a nucleic acid sequence normally found in a chromatin of a cell of the invention. In another embodiment, a tag of the invention is a zinc finger protein capable of binding a nucleic acid sequence normally found in a chromatin of a cell of the invention. In yet another embodiment, a tag of the invention is a transcription activator-like (TAL) protein capable of binding a nucleic acid sequence normally found in a chromatin of a cell of the invention.

A nucleic acid binding protein tag of the invention may be a wild type nucleic acid binding protein capable of binding a nucleic acid sequence normally found in a target chromatin. Alternatively, a nucleic acid binding protein tag of the invention may be engineered to have binding specificity for a nucleic acid sequence component normally found in a target chromatin of the invention. Individuals of ordinary skill in the art will recognize that nucleic acid binding proteins such as zinc finger proteins, transcription activator proteins, and transcription activator-like (TAL) proteins may be engineered to have novel nucleic acid binding specificity compared to naturally-occurring forms of the proteins. See, for example, U.S. Pat. Nos. 6,453,242 and 6,534,261, and U.S. Pate. Appl. Nos 20110239315, 20120110685, and 20120270273, the disclosures of which are incorporated by reference herein in their entireties. In some embodiments, a nucleic acid binding protein tag of the invention is a wild type nucleic acid binding protein capable of binding a nucleic acid sequence normally found in a target chromatin. In other embodiments, a nucleic acid binding protein tag of the invention is a nucleic acid binding protein engineered to have binding specificity for a nucleic acid sequence component of a target chromatin of the invention. In a preferred embodiment, a nucleic acid binding protein tag of the invention is a zinc finger protein engineered to have binding specificity for a nucleic acid sequence component of a target chromatin of the invention. In another preferred embodiment, a nucleic acid binding protein tag of the invention is a TAL protein engineered to have binding specificity for a nucleic acid sequence component of a target chromatin of the invention.

In other preferred embodiments, a tag of the invention is a protein tag capable of binding a nucleic acid sequence component of a chromatin, wherein the nucleic acid sequence component of the chromatin is an exogenous nucleic acid sequence introduced into a cell of the invention. In exemplary embodiments, a tag of the invention is a protein A tag capable of binding the lexA exogenous nucleic acid sequence introduced in a cell of the invention. In an exemplary embodiment, a tag of the invention is a protein A tag capable of binding the lexA exogenous nucleic acid sequence introduced upstream of the transcriptional start site of the GAL1 promoter of a S. cereviseae cell as described in the examples.

A target chromatin may be contacted with a tag at any time during a method of the invention leading to isolation of target chromatin. For instance, a target chromatin may be contacted with a protein tag during cell culture by expressing the protein tag in a cell of the invention. Alternatively, a target chromatin may be contacted with a tag after cell culture but before cell lysis, after cell lysis, or after fragmentation of chromatin to generate chromatin fragments comprising a target chromatin.

In some embodiments, a target chromatin is contacted with a tag after cell culture but before cell lysis. As such, a tag may be introduced into a cell before cell lysis. Methods of introducing a tag into a cell of the invention can and will vary depending on the type of cell, the tag, and the application of a method of the invention. For instance, a nucleic acid tag may be electroporated into a cell after culture. In other embodiments, a target chromatin is contacted with a tag after cell lysis. In such an embodiment, a tag may be added to the cell lysate as a recombinant protein. The recombinant protein may be expressed, isolated and purified via methods standard in the art for protein purification. In yet other embodiments, a target chromatin is contacted with a tag after cell lysis and chromatin fragmentation. In preferred embodiments, a target chromatin is contacted with a tag during cell culture by expressing the tag in a cell of the invention during cell culture. In exemplary embodiments, a target chromatin comprises the lexA binding site, and the lexA binding site is contacted with a protein A tag during cell culture by expressing the protein A in a cell of the invention during cell culture. In an exemplary embodiment, a target chromatin comprises the lexA binding site, and the lexA binding site is contacted with a protein A tag during cell culture by expressing the protein A in a yeast cell of the invention during cell culture as described in the examples.

A target chromatin contacted and bound by a tag as described above may be isolated using an affinity handle of the tag. The term “isolated”, may be used herein to describe a purified preparation of a target chromatin that is enriched for the target chromatin, but wherein the target chromatin is not necessarily in a pure form. That is, an isolated target chromatin is not necessarily 100% pure, but may be about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% pure. An isolated target chromatin may be enriched for the target chromatin, relative to a chromatin in the lysed preparation that was not contacted by a tag of the invention. An isolated target chromatin may be enriched by 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 fold relative to a chromatin that is not contacted by a tag of the invention. In some embodiments, an isolated target chromatin is enriched by 2, 3, 4, or 5 fold relative to a chromatin that was not contacted by a tag of the invention. In other embodiments, an isolated target chromatin is enriched by 5, 6, 7, 8, 9, or 10 fold relative to a chromatin that was not contacted by a tag of the invention. In an exemplary embodiment, an isolated target chromatin is enriched 4, 5, or 6 fold relative to a chromatin that was not contacted by a tag of the invention.

A target chromatin contacted and bound by a tag as described above may be isolated using any affinity purification method known in the art. In short, a tagged target chromatin is bound to a substrate capable of binding the affinity handle. The substrate comprising a bound target chromatin may then be washed to remove non-target chromatin and other cell debris, and the target chromatin may be released from substrate. Methods of affinity purification of material comprising an affinity handle are known in the art and may include binding the affinity handle to a substrate capable of binding the affinity handle. The substrate may be a gel matrix such as gel beads, the surface of a container, or a chip. The tagged target chromatin bound to the substrate may then be purified. Methods of purifying tagged molecules are known in the art and will vary depending on the target molecule, the tag, and the substrate. For instance, if the tag is a protein A tag bound to a lexA binding site in a target chromatin, the target chromatin may be bound to a magnetic bead substrate comprising IgG, and purified using a magnet.

(e) Protein Extraction, Identification, and Determination of Labeling

Proteins and peptides associated with an isolated target chromatin are extracted from the isolated target chromatin. Methods of extracting proteins from chromatin are generally known in the art of protein biochemistry. Generally, any extraction protocol suitable for isolating proteins and known to those of skill in the art may be used. Extracted proteins may also be further purified before protein identification. For instance, protein extracts may be further purified by differential precipitation, differential solubilization, ultracentrifugation, using chromatographic methods such as size exclusion chromatography, hydrophobic interaction chromatography, ion exchange chromatography, affinity chromatography, metal binding, immunoaffinity chromatography, HPLC, or gel electrophoriesis such as SDS-PAGE and QPNC-PAGE. In a preferred embodiment, extracted proteins are further purified using SDS-PAGE.

Extracted and purified intact proteins and post-translational modification of proteins may then be identified. Alternatively, extracted and purified intact proteins may be further digested, and the resulting peptide fragments are identified. In some embodiments, intact extracted proteins are identified. In preferred embodiments, extracted proteins are further digested, and the resulting peptide fragments are identified. For instance, protein extracts may be fragmented by enzymatically digesting the proteins using a protease such as trypsin. In exemplary embodiments, extracted proteins are further digested as described in the examples.

Methods of identifying proteins or protein fragments are known in the art and may include mass spectrometry (MS) analysis, or a combination of mass spectrometry with a chromatographic technique. Non limiting examples of mass spectrometer techniques may include tandem mass spectrometry (MS/MS), matrix-assisted laser desorption/ionization source with a time-of-flight mass analyzer (MALDI-TOF), inductively coupled plasma-mass spectrometry (ICP-MS), accelerator mass spectrometry (AMS), thermal ionization-mass spectrometry (TIMS), isotope ratio mass spectrometry (IRMS), and spark source mass spectrometry (SSMS). Chromatographic techniques that may be used with MS may include gas chromatography, liquid chromatography, and ion mobility spectrometry. In a preferred embodiment, proteins may be identified using tandem mass spectrometry in combination with liquid chromatography (LC-MS/MS). In another preferred embodiment, post-translational modification of proteins may be identified using tandem mass spectrometry in combination with liquid chromatography (LC-MS/MS).

As described above, proteins isolated with a chromatin of the invention may be labeled, unlabeled or a combination of labeled and unlabeled proteins. As described in Section I(d), if a target chromatin is tagged in a cell or an extract from a cell wherein proteins are metabolically labeled, proteins specifically associated with an isolated target chromatin are metabolically labeled, whereas unlabeled proteins, or proteins comprising a combination of labeled and unlabeled proteins are not specifically associated with the target chromatin. Alternatively, if a target chromatin may be tagged in a cell or an extract from a cell wherein proteins are not metabolically labeled, proteins specifically associated with an isolated target chromatin are metabolically labeled, whereas unlabeled proteins, or proteins comprising a combination of labeled and unlabeled proteins are not specifically associated with the target chromatin.

When an isolated and identified protein is a combination of labeled and unlabeled protein, the ratio of labeled to unlabeled protein may reflect a ratio at which a metabolically labeled cell sample and an unlabeled cell sample are combined to generate a combined cell sample, or lysates derived from the two cell samples are combined to generate a combined cell lysate. For instance, if a metabolically labeled cell sample and an unlabeled cell sample, or lysates derived from the two cell samples, are combined at a ratio of 1:1, the ratio of labeled to unlabeled isolated protein may be 1:1.

However, since the ratio of labeled to unlabeled isolated protein depends on the rate of exchange of the identified protein during extraction and processing of a cell sample, a ratio of labeled to unlabeled isolated protein may differ from the ratio at which a metabolically labeled cell sample and an unlabeled cell sample are combined to generate a combined cell sample, or lysates derived from the two cell samples are combined to generate a combined cell lysate. For example, if a metabolically labeled cell sample and an unlabeled cell sample, or lysates derived from the two cell samples, are combined at a ratio of 1:1, a ratio of labeled to unlabeled isolated protein may deviate from a ratio of 1:1. As such, a ratio of labeled to unlabeled isolated protein may be compared to a baseline for non-specifically associated proteins. For instance, a baseline for non-specifically associated proteins may be a ratio of labeled to unlabeled of one or more proteins in a combined lysate, wherein the one or more proteins are not associated with a chromatin. Non-limiting examples of proteins not associated with a chromatin may include enzymes required for metabolism, receptors, and ribosomal proteins. In preferred embodiments, proteins not associated with a chromatin are ribosomal proteins, and a baseline for non-specifically associated proteins is a ratio of a labeled to unlabeled ribosomal protein, or an average of ratios of labeled to unlabeled ribosomal proteins. In a preferred embodiment, proteins not associated with a chromatin are 20 ribosomal proteins, and a baseline for non-specifically associated proteins is an average of ratios of the 20 labeled to unlabeled ribosomal proteins.

Isolated proteins with a ratio of labeled to unlabeled isolated protein may be specifically associated with a chromatin if the ratio of labeled to unlabeled isolated protein is significantly different from a baseline ratio. A significantly different ratio may be a ratio of labeled to unlabeled isolated protein greater than about 1, 2, 3, 4, 5, or more standard deviations than a baseline ratio. In some embodiments, a significantly different ratio is a ratio of labeled to unlabeled isolated protein greater than about 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, or more standard deviations than a baseline ratio. In other embodiments, a significantly different ratio is a ratio of labeled to unlabeled isolated protein greater than about 1, 1.5, 2, or about 2.5 standard deviations than a baseline ratio. In preferred embodiments, a significantly different ratio is a ratio of labeled to unlabeled isolated protein greater than about 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9 or about 3 standard deviations than a baseline ratio. In exemplary embodiments, a significantly different ratio is a ratio of labeled to unlabeled isolated protein greater than about 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, or about 2.5 standard deviations than a baseline ratio.

Methods of determining if a protein or a protein fragment is labeled can and will vary depending on the type of label. For instance, if a protein is labeled using a tag, labeling may be determined using methods designed to detect the tag. For example, determining if a protein comprising a his-tag is tagged, untagged, or a combination of tagged and untagged may be by detecting the proteins comprising the his tag. If a protein is labeled using a radioactive isotope, labeling may be determined by determining the degree of radioactivity of isolated proteins or protein fragments. Alternatively, if a protein is labeled using a heavy isotope, MS analysis may be used to determine if a protein or a protein fragment is labeled or unlabeled. Advantageously, when a protein is labeled using a heavy isotope, MS analysis may be used to identify a protein or a protein fragment as described above, and to derive the MS data to determine if a protein or a protein fragment is labeled, unlabeled, or a combination of labeled and unlabeled protein or protein fragment.

In preferred embodiments, a protein is labeled using a heavy isotope, and MS analysis is used to identify a protein or a protein fragment, and to determine if a protein or a protein fragment is labeled, unlabeled, or a combination of labeled and unlabeled protein or protein fragment. Methods of deriving MS data to determine if a protein or a protein fragment is labeled, unlabeled, or a combination of labeled and unlabeled protein or protein fragment are known in the art, and may include using known computational techniques to distill MS data such as Mascot Distiller, Rosetta Elucidator, and MaxQuant. In some embodiments, MS data is derived using Rosetta Elucidator. In other embodiments, MS data is derived using MaxQuant. In preferred embodiments, MS data is derived using Mascot Distiller.

II. Method of TAL-ChAP-MS

In another aspect, the invention provides a method of isolating and identifying proteins specifically associated with a target chromatin using the TAL protein as described in Example 4 and FIG. 7. The TAL-ChAP-MS approach achieves high resolution and specificity by using the genomic targeting ability of the TALEN system for local epiproteome isolation and analysis. To alleviate genomic engineering for affinity enrichment of chromatin sections, a specific TAL-protein is designed with specificity for a target chromatin. This second-generation technology provides quantitative identification of specifically bound proteins and histone PTMs to a native chromatin region using label-free quantitative mass spectrometry.

To determine which of the identified proteins and posttranslational modifications of proteins associated with a target chromatin isolated from a cell are specifically or non-specifically associated with the target chromatin, a method of high-resolution mass spectrometry coupled with label-free proteomics was used. One with skill in the art will appreciate that label-free quantitative proteomics methods include the following fundamental steps: (i) sample preparation including protein extraction, reduction, alkylation, and digestion; (ii) sample separation by liquid chromatography (LC or LC/LC) and analysis by MS/MS; (iii) data analysis including peptide/protein identification, quantification, and statistical analysis. A method of the invention provides two cell samples, or lysates derived from two cell samples, comprising the target chromatin, wherein the target chromatin in one cell sample, but not both of the cell samples is tagged. With label-free quantitiative methods, each sample is separately prepared, then subjected to individual LC-MS/MS or LC/LC-MS/MS runs. As reviewed in Zhu et al., J Biomed Biotechnol 2010, and incorporated by reference herein, protein quantification is generally based on two categories of measurements. In the first are the measurements of ion intensity changes such as peptide peak areas or peak heights in chromatography. The second is based on spectral counting of identified proteins after MS/MS analysis. Peptide peak intensity or spectral count is measured for individual LC-MS/MS or LC/LC-MS/MS runs and changes in protein abundance are calculated via a direct comparison between different analyses.

In the present invention, the method of spectral counting is used to categorize whether proteins enriched with a section of chromatin are specific or contaminant. As such, determining the abundance of an identified protein in a tagged chromatin sample compared to the same protein in an untagged chromatin sample, may determine if the protein was specifically associated with the target chromatin of the invention. If a protein associated with a target chromatin is enriched in a tagged chromatin sample compared to the same protein in an untagged chromatin sample, then the protein is specifically associated with the target chromatin. If an identified protein is not enriched in a tagged chromatin sample compared to an untagged chromatin sample, then association of that protein with the target chromatin is not specific.

In the present invention, to measure enrichment of a protein, the normalized spectral abundance factor (NSAF) is calculated for each protein in each lane of an SDS-PAGE gel by dividing the number of spectral counts (normalized for the size of the protein) of a given protein by the sum of all normalized spectral counts of all proteins in the gel lane. The enrichment level for each protein is identified by calculating the fold enrichment (tagged chromatin/untagged chromatin) using the NSAF values.

(a) Cells

A target nucleic acid sequence may be isolated from any cell comprising the target nucleic acid sequence of the invention. A cell may be an archaebacterium, a eubacterium, or a eukaryotic cell. For instance, a cell of the invention may be a methanogen, a halophile or a thermoacidophile archaeabacterium, a gram positive, a gram negative, a cyanobacterium, a spirochaete, or a firmicute bacterium, a fungal cell, a moss cell, a plant cell, an animal cell, or a protist cell.

In some embodiments, a cell of the invention is a cell from an animal. A cell from an animal cell may be a cell from an embryo, a juvenile, or an adult. Suitable animals include vertebrates such as mammals, birds, reptiles, amphibians, and fish. Examples of suitable mammals include without limit rodents, companion animals, livestock, and primates. Non-limiting examples of rodents include mice, rats, hamsters, gerbils, and guinea pigs. Suitable companion animals include but are not limited to cats, dogs, rabbits, hedgehogs, and ferrets. Non-limiting examples of livestock include horses, goats, sheep, swine, cattle, llamas, and alpacas. Suitable primates include but are not limited to humans, capuchin monkeys, chimpanzees, lemurs, macaques, marmosets, tamarins, spider monkeys, squirrel monkeys, and vervet monkeys. Non-limiting examples of birds include chickens, turkeys, ducks, and geese. In some embodiments, a cell is a cell from a human.

In some embodiments, a cell may be from a model organism commonly used in laboratory research. For instance, a cell of the invention may be an E. coli, a Bacillus subtilis, a Caulobacter crescentus, a Mycoplasma genitalium, an Aliivibrio fischeri, a Synechocystis, or a Pseudomonas fluorescens bacterial cell; a Chlamydomonas reinhardtii, a Dictyostelium discoideum, a Tetrahymena thermophila, an Emiliania huxleyi, or a Thalassiosira pseudonana protist cell; an Ashbya gossypii, an Aspergillus nidulans, a Coprinus cinereus, a Cunninghamella elegans, a Neurospora crassa, a Saccharomyces cerevisiae, a Schizophyllum commune, a Schizosaccharomyces pombe, or an Ustilago maydis fungal cell; an Arabidopsis thaliana, a Selaginella moellendorffii, a Brachypodium distachyon, a Lotus japonicus, a Lemna gibba, a Zea mays, a Medicago truncatula, a Mimulus, a tobacco, a rice, a Populus, or a Nicotiana benthamiana plant cell; a Physcomitrella patens moss; an Amphimedon queenslandica sponge, an Arbacia punctulata sea urchin, an Aplysia sea slug, a Branchiostoma floridae deuterostome, a Caenorhabditis elegans nematode, a Ciona intestinalis sea squirt, a Daphnia spp. crustacean, a Drosophila fruit fly, a Euprymna scolopes squid, a Hydra Cnidarian, a Loligo pealei squid, a Macrostomum lignano flatworm, a Mnemiopsis leidyicomb jelly, a Nematostella vectensis sea anemone, an Oikopleura dioica free-swimming tunicate, an Oscarella carmela sponge, a Parhyale hawaiensis crustacean, a Platynereis dumerilii marine polychaetous annelid, a Pristionchus pacificus roundworm, a Schmidtea mediterranea freshwater planarian, a Stomatogastric ganglion of various arthropod species, a Strongylocentrotus purpuratus sea urchin, a Symsagittifera roscoffensis flatworm, a Tribolium castaneum beetle, a Trichoplax adhaerens Placozoa, a Tubifex tubifex oligochaeta, a laboratory mouse, a Guinea pig, a Chicken, a Cat, a Dog, a Hamster, a Lamprey, a Medaka fish, a Rat, a Rhesus macaque, a Cotton rat, a Zebra finch, a Takifugu pufferfish, an African clawed frog, or a Zebrafish. In exemplary embodiments, a cell is a Saccharomyces cerevisiae yeast cell. In particularly exemplary embodiments, a cell is a Saccharomyces cerevisiae W303a yeast cell.

A cell of the invention may be derived from a tissue or from a cell line grown in tissue culture. A cell line may be adherent or non-adherent, or a cell line may be grown under conditions that encourage adherent, non-adherent or organotypic growth using standard techniques known to individuals skilled in the art. Cell lines and methods of culturing cell lines are known in the art. Non-limiting examples of cell lines commonly cultured in a laboratory may include HeLa, a cell line from the National Cancer Institute's 60 cancer cell lines, DU145 (prostate cancer), Lncap (prostate cancer), MCF-7 (breast cancer), MDA-MB-438 (breast cancer), PC3 (prostate cancer), T47D (breast cancer), THP-1 (acute myeloid leukemia), U87 (glioblastoma), SHSY5Y Human neuroblastoma cells, Saos-2 cells (bone cancer), Vero, GH3 (pituitary tumor), PC12 (pheochromocytoma), MC3T3 (embryonic calvarium), Tobacco BY-2 cells, Zebrafish ZF4 and AB9 cells, Madin-Darby canine kidney (MDCK), or Xenopus A6 kidney epithelial cells.

A cell of the invention may be derived from a biological sample. As used herein, the term “biological sample” refers to a sample obtained from a subject. Any biological sample containing a cell is suitable. Numerous types of biological samples are known in the art. Suitable biological sample may include, but are not limited to, tissue samples or bodily fluids. In some embodiments, the biological sample is a tissue sample such as a tissue biopsy. The tissue biopsy may be a biopsy of a known or suspected tumor. The biopsied tissue may be fixed, embedded in paraffin or plastic, and sectioned, or the biopsied tissue may be frozen and cryosectioned. Alternatively, the biopsied tissue may be processed into individual cells or an explant, or processed into a homogenate, a cell extract, a membranous fraction, or a protein extract. The sample may also be primary and/or transformed cell cultures derived from tissue from the subject. In other embodiments, the sample may be a bodily fluid. Non-limiting examples of suitable bodily fluids include blood, plasma, serum, and urine. The fluid may be used “as is”, the cellular components may be isolated from the fluid, or a protein fraction may be isolated from the fluid using standard techniques.

Suitable subjects include, but are not limited to, a human, a livestock animal, a companion animal, a lab animal, and a zoological animal. In one embodiment, the subject may be a rodent, e.g. a mouse, a rat, a guinea pig, etc. In another embodiment, the subject may be a livestock animal. Non-limiting examples of suitable livestock animals may include pigs, cows, horses, goats, sheep, llamas and alpacas. In yet another embodiment, the subject may be a companion animal. Non-limiting examples of companion animals may include pets such as dogs, cats, rabbits, and birds. In yet another embodiment, the subject may be a zoological animal. As used herein, a “zoological animal” refers to an animal that may be found in a zoo. Such animals may include non-human primates, large cats, wolves, and bears. In preferred embodiments, the animal is a laboratory animal. Non-limiting examples of a laboratory animal may include rodents, canines, felines, and non-human primates. In a preferred embodiment, the subject is human.

As will be appreciated by a skilled artisan, the method of collecting a biological sample can and will vary depending upon the nature of the biological sample and the type of analysis to be performed. Any of a variety of methods generally known in the art may be utilized to collect a biological sample. Generally speaking, the method preferably maintains the integrity of the sample such that chromatin can be accurately detected and measured according to the invention.

As described in Section II above, two cell samples, or lysates derived from two cell samples may be subjected to mass-spectrometry coupled with label-free proteomics, one sample of which contains a tagged target chromatin of the invention. Typically, cells in two cell samples of the invention are from the same type of cells or they may be derived from the same type of cells or derived from the same biological sample. In some embodiments, cells may comprise a heterologous protein expressed in a cell of the invention. The heterologous protein expressed in a cell may be used for tagging a target chromatin as described in Section II(d). In some embodiments, cells in two cell samples of the invention are from the same type of cells. In other embodiments, cells in the first cell sample are derived from the same cell type as cells in the second cell sample.

Two cell samples of the invention may be from the same genus, species, variety or strain of cells or from the same biological sample. In a specific embodiment, two cell samples of the invention are Saccharomyces cerevisiae yeast cells or derivatives of Saccharomyces cerevisiae yeast cells. In exemplary embodiments, two cell samples of the invention are Saccharomyces cerevisiae W303a yeast cells or derivatives of Saccharomyces cerevisiae W303a yeast cells. In exemplary embodiments, two cell samples of the invention are derivatives of Saccharomyces cerevisiae W303a yeast cells, wherein-protein A tagged transcription activator-like (TAL) protein engineered to bind upstream of the GAL1 transcription start site is expressed in one of the cell samples of derived Saccharomyces cerevisiae W303a yeast cells.

The number of cells in a cell sample can and will vary depending on the type of cells, the abundance of a target chromatin in a cell, and the method of protein identification used, among other variables. For instance, if a cell of the invention is Saccharomyces cerevisiae, about 5×10¹⁰ to about 5×10¹², more preferably, about 1×10¹¹ to about 1×10¹² cells may be used in a cell sample. In some embodiments, about about 1×10¹¹ to about 1×10¹² Saccharomyces cerevisiae cells are used in a cell sample.

Two cell samples of the invention are typically grown identically. Identically grown cell samples minimizes potential structural or functional differences at a target chromatin present in both cell samples. As used herein, “grown identically” refers to cultured cell samples grown using similar culture condition, or cells from a tissue harvested using identical harvesting techniques, or biological samples collected, and optionally processed, via identical techniques.

(b) Chromatin

A method of the invention comprises identification of a protein and post-translational modification of a protein associated with a target chromatin. Generally, chromatin refers to the combination of nucleic acids and proteins in the nucleus of a eukaryotic cell. However, it is contemplated that the term “chromatin” may also refer to the combination of any nucleic acid sequence and proteins associated with the nucleic acid sequence in any cell.

Chromatin of the invention may be as described in Section I(b) above.

(c) Preparation of Cell Lysate

A target chromatin is isolated from a cell lysate derived from a cell sample, wherein a target chromatin is tagged in the cell sample. The method of isolating a target chromatin is also performed on a cell lysate derived from a cell sample, wherein a target chromatin is untagged in the cell sample. A skilled practitioner of the art will appreciate that structural and functional features of a target chromatin must be preserved during cell lysis and isolation of the target chromatin. The association of proteins with a target chromatin may be preserved during cell lysis and isolation of the target chromatin using methods known in the art for preserving a complex of proteins with a nucleic acid sequence. For instance, lysing of a cell and isolation of a target chromatin may be performed under refrigeration or using cryogenic methods and buffer conditions capable of preserving association of proteins and nucleic acid sequences. In addition, a complex of proteins with a nucleic acid may be preserved by crosslinking protein and nucleic acid complexes in a cell prior to lysing and isolating a chromatin. Crosslinking protein and nucleic acid complexes in a cell may also capture, or preserve, transient protein-protein and protein-nucleic acid interactions.

In some embodiments, a complex of proteins with a nucleic acid may be preserved by crosslinking protein and nucleic acid complexes in a chromatin prior to lysing a cell and isolating the chromatin. Crosslinking is the process of joining two or more molecules such as two proteins or a protein and a nucleic acid molecule, by a covalent bond. Molecules may be crosslinked by irradiation with ultraviolet light, or by using chemical crosslinking reagents. Chemical crosslinking reagents capable of crosslinking proteins and nucleic acids are known in the art and may include crosslinking reagents that target amines, sulfhydryls, carboxyls, carbonyls or hydroxyls; omobifunctional or heterobifunctional crosslinking reagent, variable spacer arm length or zero-length crosslinking reagents, cleavable or non-cleavable crosslinking reagents, and photoreactive crosslinking reagents. Non-limiting examples of crosslinking reagents that may be used to crosslink protein complexes and/or protein complexes and nucleic acids may include formaldehyde, glutaraldehyde, disuccinimidyl glutarate, disuccinimidyl suberate, a photoreactive amino acid such as photo-leucine or photo-methionine, and succinimidyl-diazirine. The degree of crosslinking can and will vary depending on the application of a method of the invention, and may be experimentally determined.

In a preferred embodiment, a complex of proteins with a nucleic acid in a chromatin of the invention may be preserved by crosslinking protein and nucleic acid complexes in a cell prior to lysing using formaldehyde. In an exemplary embodiment, a complex of proteins with a nucleic acid in a chromatin of the invention may be preserved by crosslinking protein and nucleic acid complexes in a cell prior to lysing using formaldehyde as described in the examples.

A skilled practitioner of the art will appreciate that protocols for lysing a cell can and will vary depending on the type of cell, the target chromatin of the invention, and the specific application of a method of the invention. Non limiting examples of methods that may be used to lyse a cell of the invention may include cell lysis using a detergent, an enzyme such as lysozyme, incubation in a hypotonic buffer which causes a cell to swell and burst, mechanical disruption such as liquid homogenization by forcing a cell through a narrow space, sonication, freeze/thaw, mortar and pestle, glass beads, and combinations thereof. In some embodiments, when a cell of the invention is a yeast cell, the cell may be cryogenically lysed under liquid nitrogen temperature with glass beads. In exemplary embodiments, when a cell of the invention is a yeast cell, the cell may be cryogenically lysed under liquid nitrogen temperature with glass beads as described in the examples.

Buffer conditions used during lysing and isolation of a chromatin of the invention can and will be altered to control stringent conditions during cell lysis and isolation to preserve association of proteins and nucleic acid sequences of a chromatin. “Stringent conditions” in the context of chromatin isolation are conditions capable of preserving specific association of proteins and nucleic acids of a chromatin, but minimizing non-specific association of proteins and nucleic acids. Stringent conditions can and will vary depending on the application of a method of the invention, the target chromatin of the invention, the nucleic acid sequence in a target chromatin, the proteins or protein complexes associated with a target chromatin of the invention, whether or not proteins, protein complexes and nucleic acid sequences are crosslinked, and the conditions used for crosslinking proteins, protein complexes and nucleic acid sequences of a target chromatin. For instance, more stringent buffer conditions may be used in a method of the invention wherein proteins, protein-protein complexes, and protein-nucleic acid complexes are crosslinked compared to a method of the invention wherein proteins, protein-protein complexes, and protein-nucleic acid complexes are not crosslinked. As such, stringent buffer conditions used during cell lysis and isolation of a nucleic acid sequence of the invention may be experimentally determined for each application wherein a method of the invention is used. Buffer conditions that may alter stringent conditions during cell lysis and isolation may include pH and salt concentration. In preferred embodiments, proteins, protein-protein complexes, and protein-nucleic acid complexes of a target chromatin of the invention are crosslinked, and stringent buffer conditions are used during lysis and isolation of a chromatin of the invention. In exemplary embodiments, proteins, protein-protein complexes, and protein-nucleic acid complexes of a target chromatin of the invention are crosslinked, and stringent buffer conditions are used during lysis and isolation of a chromatin of the invention and are as described in the examples.

(d) Chromatin Isolation

According to the invention, the method of isolating a target chromatin is performed on cell lysates derived from cell samples, wherein one sample comprises a target chromatin that is tagged in the cell sample and one sample comprises a target chromatin that is untagged in the cell sample. As described in Sections II(a) and II(c) above, a cell lysate comprises a lysate of a cell sample, wherein a target chromatin is tagged in one of the lysates, or one of the cell samples. A cell lysate also comprises a lysate of a cell sample, wherein a target chromatin is not tagged in one of the lysates, or one of the cell samples.

A target chromatin may be isolated from a mixture of chromatins or chromatin fragments in a cell lysate as described in this section. As used herein, a target nucleic acid sequence is said to be “isolated” or “purified” when it is substantially free of proteins not associated with the target chromatin, nucleic acid sequences other than the nucleic acid sequences associated with the target chromatin, and other cell debris and cell contents resulting from extraction and preparation of the target chromatin from a cell. A target chromatin of the present invention may be purified to homogeneity or other degrees of purity. In general, the level of purity of an isolated target chromatin can and will vary depending on the cell type, the specific chromatin to be isolated, and the intended use of a target chromatin of the invention. The level of purity of an isolated target chromatin may be determined using methods known in the art. For instance, the level of purity of an isolated target chromatin may be determined by determining the level of purity of a nucleic acid sequence associated with a target chromatin, by determining the level of purity of a protein associated with a target chromatin, or by determining the level of enrichment of a target chromatin, compared to a non-target chromatin in a cell. In preferred embodiments, the level of purity of an isolated target chromatin is determined by determining the level of enrichment of a target chromatin, compared to a non-target chromatin in a cell. Determining the level of enrichment of a target chromatin, compared to a non-target chromatin in a cell may be as described in this section below.

A target chromatin of the invention may be isolated using methods known in the art, such as electrophoresis, molecular, immunological and chromatographic techniques, ion exchange, hydrophobic, affinity, and reverse-phase HPLC chromatography, size exclusion chromatography, precipitation, dialysis, chromatofocusing, ultrafiltration and diafiltration techniques, and combinations thereof. For general guidance in suitable purification techniques, see Scopes, R., Protein Purification, Springer-Vertag, NY (1982).

In general, a method of the invention comprises isolating a target chromatin by affinity purification, or affinity purification in combination with other methods of isolating chromatin described above. In a preferred embodiment, a method of the invention comprises isolating a target chromatin by affinity purification. Non-limiting examples of affinity purification techniques that may be used to isolate a target chromatin of the invention may include affinity chromatography, immunoaffinity chromatography, size exclusion chromatography, and combinations thereof. See, for example, Roe (ed), Protein Purification Techniques: A Practical Approach, Oxford University Press, 2nd edition, 2001.

In essence, affinity purification of a target chromatin may comprise tagging a target chromatin by contacting the target chromatin of the invention with a tag capable of specifically recognizing and binding one or more portions of a target chromatin. As described in Section II, a target chromatin from one cell sample, or lysate derived from the cell sample of the invention, but not both of the cell samples, is tagged.

A tag may be capable of specifically recognizing and binding 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 components of a target chromatin. In preferred embodiments, a tag is capable of specifically recognizing and binding one component of a target chromatin.

A tag may be capable of specifically recognizing and binding a component in a target chromatin. A component in a target chromatin may be a nucleic acid sequence in a nucleic acid associated with a target chromatin, a protein associated with a target chromatin, or a chromatin structural or functional feature in a target chromatin. In some embodiments, a tag is capable of specifically recognizing and binding a protein associated with a target chromatin. In other embodiments, a tag is capable of specifically recognizing and binding a chromatin structural or functional feature in a target chromatin. In preferred embodiments, a tag is capable of specifically recognizing and binding a nucleic acid sequence associated with a target chromatin.

A nucleic acid sequence associated with a target chromatin that may be specifically recognized and bound by a tag of the invention may be a nucleic acid sequence normally found in a chromatin of a cell of the invention. Individuals of ordinary skill in the art will recognize that a tag introduced into a cell to facilitate tagging a target chromatin of the invention cannot and will not disrupt a target chromatin, or a structural or functional feature of a target chromatin. Methods of designing a tag capable of binding the chromatin component that do not disrupt a chromatin of the invention may depend on the particular application of a method of the invention, and may be determined experimentally. For instance, if an application of a method of the invention comprises promoter function, a tag may be designed to bind anywhere adjacent to the promoter, but without disrupting the promoter.

In some embodiments, a tag of the invention is a nucleic acid tag capable of binding a nucleic acid sequence component of a chromatin, wherein the nucleic acid sequence component of the chromatin is introduced into a cell of the invention. In some embodiments, a tag of the invention is a nucleic acid tag capable of binding a nucleic acid sequence component of a chromatin, wherein the nucleic acid sequence component of the chromatin is normally present in a cell of the invention. Non-limiting examples of nucleic acid tags capable of binding a nucleic acid sequence component of a chromatin include antisense RNA or DNA nucleic acid tags, and tags comprising modified nucleic acids and nucleic acid mimics such as peptide nucleic acids, locked nucleic acids, phosphorodiamidate morpholino oligomers (PMO). In some embodiments, a tag of the invention is a nucleic acid tag comprising locked nucleotides. For instance, a nucleic acid tag comprising locked nucleotides may be as described in US20110262908 or US20120040857, and a peptide nucleic acid tag may be as described in Boffa et al. 1995 PNAS 92:1901-1905, the disclosures of all of which are incorporated herein in their entirety.

In specific embodiments, a tag of the invention is a protein tag capable of binding a nucleic acid sequence component of a chromatin, wherein the nucleic acid sequence component of the chromatin is a nucleic acid sequence normally found in a chromatin of a cell of the invention. Non limiting examples of a protein tag capable of binding a nucleic acid sequence normally found in a chromatin of a cell may be a nucleic acid binding protein such as protein A, the Lac repressor, a zinc finger protein, a transcription activator protein capable of binding a nucleic acid, or a transcription activator-like (TAL) protein. In one embodiment, a tag of the invention is a transcription activator protein capable of binding a nucleic acid sequence normally found in a chromatin of a cell of the invention. In another embodiment, a tag of the invention is a zinc finger protein capable of binding a nucleic acid sequence normally found in a chromatin of a cell of the invention. In an exemplary embodiment, a tag of the invention is transcription activator-like (TAL) protein capable of binding a nucleic acid sequence normally found in a chromatin of a cell of the invention.

A nucleic acid binding protein tag of the invention may be a wild type nucleic acid binding protein capable of binding a nucleic acid sequence normally found in a target chromatin. Alternatively, a nucleic acid binding protein tag of the invention may be engineered to specifically recognize a nucleic acid sequence component normally found in a target chromatin of the invention. Individuals of ordinary skill in the art will recognize that nucleic acid binding proteins such as zinc finger proteins, transcription activator proteins, and transcription activator-like (TAL) proteins may be engineered to have novel nucleic acid binding specificity compared to naturally-occurring forms of the proteins. See, for example, U.S. Pat. Nos. 6,453,242 and 6,534,261, and U.S. Pate. Appl. Nos 20110239315, 20120110685, and 20120270273, the disclosures of which are incorporated by reference herein in their entireties. In some embodiments, a nucleic acid binding protein tag of the invention is a wild type nucleic acid binding protein capable of binding a nucleic acid sequence normally found in a target chromatin. In other embodiments, a nucleic acid binding protein tag of the invention is a nucleic acid binding protein engineered to specifically recognize a nucleic acid sequence component of a target chromatin of the invention. In a preferred embodiment, a nucleic acid binding protein tag of the invention is a zinc finger protein engineered to specifically recognize a nucleic acid sequence component of a target chromatin of the invention. In an exemplary embodiment, a nucleic acid binding protein tag of the invention is a TAL protein engineered to specifically recognize a nucleic acid sequence component of a target chromatin of the invention.

A tag of the invention may further comprise one or more affinity handles. As used herein, the term “affinity handle” may refer to any handle that may be bound by a substrate for affinity purification, as described below. A tag may comprise one or more than one affinity handle. The inclusion of more than one affinity handle in a tag of the invention may significantly increase the efficiency of affinity purification for a low copy number chromatin target. As such, a tag may further comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more affinity handles. In a preferred embodiment, a tag of the invention comprises one affinity handle.

Affinity handles may include any affinity handle for which a cognate binding agent is readily available. An affinity handle may be an aptamer, an antibody, an antibody fragment, a double-stranded DNA sequence, modified nucleic acids and nucleic acid mimics such as peptide nucleic acids, locked nucleic acids, phosphorodiamidate morpholino oligomers (PMO), a ligand, a ligand fragment, a receptor, a receptor fragment, a polypeptide, a peptide, a coenzyme, a coregulator, an allosteric molecule, non-immunoglobulin scaffolds such as Affibodies, Anticalins, designed Ankyrin repeat proteins and others, an ion, or a small molecule for which a cognate binding agent is readily available. The term “aptamer” refers to a polypeptide or a polynucleotide capable of binding to a target molecule at a specific region. It is generally accepted that an aptamer, which is specific in its binding to any polypeptide, may be synthesized and/or identified by in vitro evolution methods. Non limiting examples of handles that may be suitable for isolating a chromatin may include biotin or a biotin analogue such as desthiobiotin, digoxigenin, dinitrophenol or fluorescein, antigenic polypeptides such as protein A, or peptide ‘tags’ such as polyhistidine, FLAG, HA and Myc tags. In preferred embodiments, a tag of the invention comprises an antigenic polypeptide as an affinity handle. In other preferred embodiments, a tag of the invention comprises protein A or derivatives thereof as an affinity handle. In a specific embodiment, a tag of the invention comprises protein A-tagged TAL protein. The TAL protein can be engineered to specifically recognize a nucleic acid sequence component of a target chromatin of the invention. As such, TAL may be used as an affinity purification tag for purifying a target chromatin. Protein A comprises an affinity handle capable of binding IgG. In exemplary embodiments, a tag of the invention comprises the protein A tagged TAL protein engineered to bind upstream of the GAL1 transcription start site.

A target chromatin may be contacted with a tag at any time during a method of the invention leading to isolation of target chromatin. For instance, a target chromatin may be contacted with a protein tag during cell culture by expressing the protein tag in a cell of the invention. Alternatively, a target chromatin may be contacted with a tag after cell culture but before cell lysis, after cell lysis, or after fragmentation of chromatin to generate chromatin fragments comprising a target chromatin. In such embodiments, a tag may be added to the cell culture or cell lysate as a recombinant protein. The recombinant protein may be expressed, isolated and purified via methods standard in the art for protein purification.

In some embodiments, a target chromatin is contacted with a tag after cell culture but before cell lysis. As such, a tag may be introduced into a cell before cell lysis. Methods of introducing a tag into a cell of the invention can and will vary depending on the type of cell, the tag, and the application of a method of the invention. For instance, a nucleic acid tag may be electroporated into a cell after culture. In other embodiments, a target chromatin is contacted with a tag after cell lysis. In such an embodiment, a tag may be added to the cell lysate as a recombinant protein. In yet other embodiments, a target chromatin is contacted with a tag after cell lysis and chromatin fragmentation. In certain embodiments, a target chromatin is contacted with a tag during cell culture by expressing the tag in a cell of the invention during cell culture. In exemplary embodiments, a target chromatin is contacted with a protein A tagged TAL protein during cell culture by expressing the protein A tagged TAL protein in a cell of the invention during cell culture.

A target chromatin contacted and bound by a tag as described above may be isolated using an affinity handle of the tag. The term “isolated”, may be used herein to describe a purified preparation of a target chromatin that is enriched for the target chromatin, but wherein the target chromatin is not necessarily in a pure form. That is, an isolated target chromatin is not necessarily 100% pure, but may be about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% pure. An isolated target chromatin may be enriched for the target chromatin, relative to a chromatin in the lysed preparation that was not contacted by a tag of the invention. An isolated target chromatin may be enriched by 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 fold relative to a chromatin that is not contacted by a tag of the invention. In some embodiments, an isolated target chromatin is enriched by 2, 3, 4, or 5 fold relative to a chromatin that was not contacted by a tag of the invention. In other embodiments, an isolated target chromatin is enriched by 5, 6, 7, 8, 9, or 10 fold relative to a chromatin that was not contacted by a tag of the invention. In an exemplary embodiment, an isolated target chromatin is enriched 4, 5, or 6 fold relative to a chromatin that was not contacted by a tag of the invention.

A target chromatin contacted and bound by a tag as described above may be isolated using any affinity purification method known in the art. In short, a tagged target chromatin is bound to a substrate capable of binding the affinity handle. The substrate comprising a bound target chromatin may then be washed to remove non-target chromatin and other cell debris, and the target chromatin may be released from substrate. Methods of affinity purification of material comprising an affinity handle are known in the art and may include binding the affinity handle to a substrate capable of binding the affinity handle. The substrate may be a gel matrix such as gel beads, the surface of a container, or a chip. The tagged target chromatin bound to the substrate may then be purified. Methods of purifying tagged molecules are known in the art and will vary depending on the target molecule, the tag, and the substrate. For instance, if the tag is a TAL-protein A tag bound to a site in a target chromatin, the target chromatin may be bound to a magnetic bead substrate comprising IgG, and purified using a magnet.

(e) Protein Extraction, Identification, and Determination of Labeling

Proteins and peptides associated with an isolated target chromatin are extracted from the isolated target chromatin. Methods of extracting proteins from chromatin are generally known in the art of protein biochemistry. Generally, any extraction protocol suitable for isolating proteins and known to those of skill in the art may be used. Extracted proteins may also be further purified before protein identification. For instance, protein extracts may be further purified by differential precipitation, differential solubilization, ultracentrifugation, using chromatographic methods such as size exclusion chromatography, hydrophobic interaction chromatography, ion exchange chromatography, affinity chromatography, metal binding, immunoaffinity chromatography, HPLC, or gel electrophoriesis such as SDS-PAGE and QPNC-PAGE. In a preferred embodiment, extracted proteins are further purified using SDS-PAGE.

Extracted and purified intact proteins and post-translational modification of proteins may then be identified. Alternatively, extracted and purified intact proteins may be further digested, and the resulting peptide fragments are identified. In some embodiments, intact extracted proteins are identified. In preferred embodiments, extracted proteins are further digested, and the resulting peptide fragments are identified. For instance, protein extracts may be fragmented by enzymatically digesting the proteins using a protease such as trypsin. In exemplary embodiments, extracted proteins are further digested as described in the examples.

Methods of identifying proteins or protein fragments are known in the art and may include mass spectrometry (MS) analysis, or a combination of mass spectrometry with a chromatographic technique. Non limiting examples of mass spectrometer techniques may include tandem mass spectrometry (MS/MS), matrix-assisted laser desorption/ionization source with a time-of-flight mass analyzer (MALDI-TOF), inductively coupled plasma-mass spectrometry (ICP-MS), accelerator mass spectrometry (AMS), thermal ionization-mass spectrometry (TIMS), isotope ratio mass spectrometry (IRMS), and spark source mass spectrometry (SSMS). Chromatographic techniques that may be used with MS may include gas chromatography, liquid chromatography, and ion mobility spectrometry. In a preferred embodiment, proteins may be identified using tandem mass spectrometry in combination with liquid chromatography (LC-MS/MS). In another preferred embodiment, post-translational modification of proteins may be identified using tandem mass spectrometry in combination with liquid chromatography (LC-MS/MS).

In the present invention, the method of label-free proteomics is used to categorize whether proteins enriched with a section of chromatin are specific or contaminant. Label-free methods of quantifying proteins or protein fragments are known in the art. In label-free quantitative proteomics, each sample is separately prepared, then subjected to individual methods of identifying proteins or protein fragments which may include LC-MS/MS or LC/LC-MS/MS. According to the invention, one sample comprises a target chromatin that is tagged in the cell sample and one sample comprises a target chromatin that is untagged in the cell sample. Label-free protein quantification is generally based on two categories of measurement. In the first are the measurements of ion intensity changes such as peptide peak areas or peak heights in chromatography. The second is based on the spectral counting of identified proteins after MS/MS analysis. Peptide peak intensity or spectral count is measured for individual LC-MS/MS or LC/LC-MS/MS runs and changes in protein abundance are calculated via a direct comparison between different analyses. In a preferred embodiment, the proteins identified using mass spectrometry are quantified and identified as enriched in the sample containing the tagged target chromatin compared to the sample containing the untagged target chromatin using label-free proteomics. In an exemplary embodiment, the proteins identified using mass spectrometry are quantified and identified as enriched in the sample containing the tagged target chromatin compared to the sample containing the untagged target chromatin using spectral counting.

The method of protein quantification by spectral count is known in the art and is reviewed in Zhu et al., J Biomed Biotechnol 2010, which is incorporated by reference herein. In spectral counting, relative protein quantification is achieved by comparing the number of identified MS/MS spectra from a protein of one sample to the same protein in the other sample. In the present invention, one sample comprises a target chromatin that is tagged and another sample comprises a target chromatin that is untagged. Protein quantification in spectral counting utilizes the fact that an increase in protein abundance typically results in an increase in the number of its proteolytic peptides, and vice versa. This increased number of (tryptic) digests then usually results in an increase in protein sequence coverage, the number of identified unique peptides, and the number of identified total MS/MS spectra (spectral count) for each protein.

As such, determining the abundance of an identified protein in a tagged chromatin sample compared to the same protein in an untagged chromatin sample, may determine if the protein was specifically associated with a target chromatin of the invention. If an identified protein associated with a target chromatin is in enriched in a tagged chromatin sample compared to the same protein in an untagged chromatin sample, then the protein was specifically associated with a target chromatin of the invention. If an identified protein is not enriched in a tagged chromatin sample compared to an untagged chromatin sample, then the protein is non-specifically associated with a target chromatin of the invention.

A skilled artisan in spectral counting will appreciate that normalization and statistical analysis of spectral counting datasets are necessary for accurate and reliable detection of protein changes. Since large proteins tend to contribute more peptide/spectra than small ones, a normalized spectral abundance factor (NSAF) is defined to account for the effect of protein length on spectral count. NSAF is calculated as the number of spectral counts (SpC) identifying a protein, divided by the protein's length (L), divided by the sum of SpC/L for all proteins in the experiment. NSAF allows the comparison of abundance of individual proteins in multiple independent samples and has been applied to quantify the expression changes in various complexes.

In the present invention, to measure enrichment of a protein, the normalized spectral abundance factor (NSAF) is calculated for each protein in each lane of an SDS-PAGE gel by dividing the number of spectral counts (normalized for the size of the protein) of a given protein by the sum of all normalized spectral counts of all proteins in the gel lane. The enrichment level for each protein is identified by calculating the fold enrichment (tagged chromatin/untagged chromatin) using the NSAF values. In an exemplary embodiment, proteins enriched in a sample containing a tagged target chromatin compared to a sample containing an untagged target chromatin are enriched by at least about 2 fold. In other embodiments, proteins enriched in a sample containing a tagged target chromatin compared to a sample containing the untagged target chromatin are enriched by at least about 1.5 fold. In other embodiments, proteins enriched in a sample containing a tagged target chromatin compared to a sample containing an untagged target chromatin are enriched by at least about 3 fold, about 4 fold, about 5 fold, about 6 fold, about 7 fold, about 8 fold, about 9 fold, about 10 fold, about 11 fold, about 12 fold, about 13 fold, about 14 fold, about 15 fold, about 16 fold, about 17 fold, about 18 fold, about 19 fold or about 20 fold. As such, a protein enriched by at least about 2 fold in a tagged chromatin sample compared to an untagged chromatin sample, is specifically associated with the chromatin. For instance, a baseline for non-specifically associated proteins may be proteins enriched by less than about 1.5 fold in a tagged chromatin sample compared to an untagged chromatin sample, wherein one or more proteins are not associated with chromatin. Non-limiting examples of proteins not associated with a chromatin may include enzymes required for metabolism, receptors, and ribosomal proteins. In preferred embodiments, proteins not associated with a chromatin are ribosomal proteins, and a baseline for non-specifically associated proteins is an enrichment less than about 1.5 fold in a tagged chromatin sampled compared to an untagged chromatin sample. In an exemplary embodiment, proteins or protein fragments enriched by at least 15 fold in a tagged chromatin sample compared to an untagged chromatin sample are specifically associated with a target chromatin.

In preferred embodiments, a target chromatin is tagged in one cell sample and a target chromatin is untagged in a second cell sample, and MS analysis is used to identify proteins or protein fragments isolated during affinity purification of each sample, and label-free proteomics is used to determine if a protein or a protein fragment is specifically or non-specifically associated with the target chromatin. Methods of deriving MS data to identify proteins or protein fragments are known in the art, and may include using known computational techniques to distill MS data such as Mascot Distiller, Rosetta Elucidator, and MaxQuant. In some embodiments, MS data is derived using Rosetta Elucidator. In other embodiments, MS data is derived using MaxQuant. In preferred embodiments, MS data is derived using Mascot Distiller.

III. Method of CRISPR-ChAP-MS

In yet another aspect, the invention provides a method of isolating and identifying proteins specifically associated with a target chromatin using the Cas9 and guide RNA (gRNA) components of the CRISPR system as described in Example 6 and FIG. 9. The CRISPR-ChAP-MS approach provides a new tool to study epigenetic regulation. Identification of proteins and histone PTMs at 1 kb resolution does not depend on a priori knowledge of a protein/PTM target, which distinguishes this method from traditional ChIP. This third-generation technology provides quantitative identification of specifically bound proteins and histone PTMs with an enhanced ability to isolate targeted chromatin only requiring site-directed mutagenesis to alter the gRNA for genomic targeting.

The present disclosure provides a method of identifying proteins including proteins comprising posttranslational modifications specifically associated with a target chromatin in a cell. The method comprises providing a first cell sample comprising nucleic acid binding proteins and the target chromatin, wherein the target chromatin is tagged by contacting the target chromatin with a tag capable of specifically recognizing and binding one or more portions of the target chromatin and wherein the tag comprises an affinity handle, and a second cell sample comprising nucleic acid binding proteins and the target chromatin, wherein the target chromatin is not tagged by contacting the target chromatin with a non-functional tag that is not capable of specifically recognizing and binding one or more portions of the target chromatin and wherein the non-functional tag comprises an affinity handle. Affinity handle from each sample is isolated wherein affinity handle isolated from the first cell sample consists of affinity handle bound to tagged target chromatin bound to specifically associated nucleic acid binding proteins and affinity handle bound to non-specifically associated nucleic acid binding proteins and affinity handle isolated from the second cell sample consists of affinity handle bound to non-specifically associated nucleic acid binding proteins, wherein isolating the affinity handle enriches for the tagged target chromatin. Bound protein in each cell sample is identified. Then, the amount of each bound protein in each cell sample is determined, wherein bound proteins that are enriched in the first cell sample as compared to the second cell sample are specifically associated with the tagged chromatin in the first cell sample.

The key to success with the CRISPR-ChAP-MS is the enhanced ability to isolate targeted chromatin. Further, CRISPR-ChAP-MS only requires site-directed mutagenesis to alter the gRNA for genomic targeting, which provides a more cost effective approach that can easily be multiplexed to target additional sites. The chromatin enrichment methodology described herein is quantitative mass spectrometry used to determine proteins/PTMs specific to the isolated chromatin. The mass spectrometric approach used in the CRISPR-ChAP-MS approach is label-free. With label-free quantitative methods, each sample is separately prepared, then subjected to individual LC-MS/MS or LC/LC-MS/MS runs. The method of spectral counting is used to categorize whether proteins enriched with a section of chromatin are specific or contaminant. As such, determining the abundance of an identified protein in a tagged chromatin sample compared to the same protein in an untagged chromatin sample, may determine if the protein was specifically associated with the target chromatin of the invention. If a protein associated with a target chromatin is enriched in a tagged chromatin sample compared to the same protein in an untagged chromatin sample, then the protein is specifically associated with the target chromatin. If an identified protein is not enriched in a tagged chromatin sample compared to an untagged chromatin sample, then association of that protein with the target chromatin is not specific.

(a) Cells

A target nucleic acid sequence may be isolated from any cell comprising the target nucleic acid sequence of the invention. According to the invention, a method comprises, in part, providing a first cell sample and a second cell sample. A cell of a cell sample of the invention may be an archaebacterium, a eubacterium, or a eukaryotic cell. For instance, a cell of a cell sample of the invention may be a methanogen, a halophile or a thermoacidophile archaeabacterium, a gram positive, a gram negative, a cyanobacterium, a spirochaete, or a firmicute bacterium, a fungal cell, a moss cell, a plant cell, an animal cell, or a protist cell.

In some embodiments, a cell of a cell sample of the invention is a cell from an animal. A cell from an animal cell may be a cell from an embryo, a juvenile, or an adult. Suitable animals include vertebrates such as mammals, birds, reptiles, amphibians, and fish. Examples of suitable mammals include without limit rodents, companion animals, livestock, and primates. Non-limiting examples of rodents include mice, rats, hamsters, gerbils, and guinea pigs. Suitable companion animals include but are not limited to cats, dogs, rabbits, hedgehogs, and ferrets. Non-limiting examples of livestock include horses, goats, sheep, swine, cattle, llamas, and alpacas. Suitable primates include but are not limited to humans, capuchin monkeys, chimpanzees, lemurs, macaques, marmosets, tamarins, spider monkeys, squirrel monkeys, and vervet monkeys. Non-limiting examples of birds include chickens, turkeys, ducks, and geese. In some embodiments, a cell is a cell from a human.

In some embodiments, a cell of a cell sample may be from a model organism commonly used in laboratory research. For instance, a cell of the invention may be an E. coli, a Bacillus subtilis, a Caulobacter crescentus, a Mycoplasma genitalium, an Aliivibrio fischeri, a Synechocystis, or a Pseudomonas fluorescens bacterial cell; a Chlamydomonas reinhardtii, a Dictyostelium discoideum, a Tetrahymena thermophila, an Emiliania huxleyi, or a Thalassiosira pseudonana protist cell; an Ashbya gossypii, an Aspergillus nidulans, a Coprinus cinereus, a Cunninghamella elegans, a Neurospora crassa, a Saccharomyces cerevisiae, a Schizophyllum commune, a Schizosaccharomyces pombe, or an Ustilago maydis fungal cell; an Arabidopsis thaliana, a Selaginella moellendorffii, a Brachypodium distachyon, a Lotus japonicus, a Lemna gibba, a Zea mays, a Medicago truncatula, a Mimulus, a tobacco, a rice, a Populus, or a Nicotiana benthamiana plant cell; a Physcomitrella patens moss; an Amphimedon queenslandica sponge, an Arbacia punctulata sea urchin, an Aplysia sea slug, a Branchiostoma floridae deuterostome, a Caenorhabditis elegans nematode, a Ciona intestinalis sea squirt, a Daphnia spp. crustacean, a Drosophila fruit fly, a Euprymna scolopes squid, a Hydra Cnidarian, a Loligo pealei squid, a Macrostomum lignano flatworm, a Mnemiopsis leidyicomb jelly, a Nematostella vectensis sea anemone, an Oikopleura dioica free-swimming tunicate, an Oscarella carmela sponge, a Parhyale hawaiensis crustacean, a Platynereis dumerilii marine polychaetous annelid, a Pristionchus pacificus roundworm, a Schmidtea mediterranea freshwater planarian, a Stomatogastric ganglion of various arthropod species, a Strongylocentrotus purpuratus sea urchin, a Symsagittifera roscoffensis flatworm, a Tribolium castaneum beetle, a Trichoplax adhaerens Placozoa, a Tubifex tubifex oligochaeta, a laboratory mouse, a guinea pig, a chicken, a cat, a dog, a hamster, a lamprey, a medaka fish, a rat, a rhesus macaque, a cotton rat, a zebra finch, a Takifugu pufferfish, an African clawed frog, or a zebrafish. In exemplary embodiments, a cell is a Saccharomyces cerevisiae yeast cell. In particularly exemplary embodiments, a cell is a Saccharomyces cerevisiae W303a yeast cell.

A cell of a cell sample of the invention may be derived from a tissue or from a cell line grown in tissue culture. A cell line may be adherent or non-adherent, or a cell line may be grown under conditions that encourage adherent, non-adherent or organotypic growth using standard techniques known to individuals skilled in the art. Cell lines and methods of culturing cell lines are known in the art. Non-limiting examples of cell lines commonly cultured in a laboratory may include HeLa, a cell line from the National Cancer Institute's 60 cancer cell lines, DU145 (prostate cancer), Lncap (prostate cancer), MCF-7 (breast cancer), MDA-MB-438 (breast cancer), PC3 (prostate cancer), T47D (breast cancer), THP-1 (acute myeloid leukemia), U87 (glioblastoma), SHSY5Y Human neuroblastoma cells, Saos-2 cells (bone cancer), Vero, GH3 (pituitary tumor), PC12 (pheochromocytoma), MC3T3 (embryonic calvarium), Tobacco BY-2 cells, Zebrafish ZF4 and AB9 cells, Madin-Darby canine kidney (MDCK), or Xenopus A6 kidney epithelial cells.

A cell of a cell sample may be derived from a biological sample. As used herein, the term “biological sample” refers to a sample obtained from a subject. Any biological sample containing a cell is suitable. Numerous types of biological samples are known in the art. Suitable biological sample may include, but are not limited to, tissue samples or bodily fluids. In some embodiments, the biological sample is a tissue sample such as a tissue biopsy. The tissue biopsy may be a biopsy of a known or suspected tumor. The biopsied tissue may be fixed, embedded in paraffin or plastic, and sectioned, or the biopsied tissue may be frozen and cryosectioned. Alternatively, the biopsied tissue may be processed into individual cells or an explant, or processed into a homogenate, a cell extract, a membranous fraction, or a protein extract. The sample may also be primary and/or transformed cell cultures derived from tissue from the subject. In other embodiments, the sample may be a bodily fluid. Non-limiting examples of suitable bodily fluids include blood, plasma, serum, and urine. The fluid may be used “as is”, the cellular components may be isolated from the fluid, or a protein fraction may be isolated from the fluid using standard techniques.

Suitable subjects include, but are not limited to, a human, a livestock animal, a companion animal, a lab animal, and a zoological animal. In one embodiment, the subject may be a rodent, e.g. a mouse, a rat, a guinea pig, etc. In another embodiment, the subject may be a livestock animal. Non-limiting examples of suitable livestock animals may include pigs, cows, horses, goats, sheep, llamas and alpacas. In yet another embodiment, the subject may be a companion animal. Non-limiting examples of companion animals may include pets such as dogs, cats, rabbits, and birds. In yet another embodiment, the subject may be a zoological animal. As used herein, a “zoological animal” refers to an animal that may be found in a zoo. Such animals may include non-human primates, large cats, wolves, and bears. In preferred embodiments, the animal is a laboratory animal. Non-limiting examples of a laboratory animal may include rodents, canines, felines, and non-human primates. In a preferred embodiment, the subject is human.

As will be appreciated by a skilled artisan, the method of collecting a biological sample can and will vary depending upon the nature of the biological sample and the type of analysis to be performed. Any of a variety of methods generally known in the art may be utilized to collect a biological sample. Generally speaking, the method preferably maintains the integrity of the sample such that chromatin can be accurately detected and measured according to the invention.

As described in Section III above, two cell samples, or lysates derived from two cell samples may be subjected to mass-spectrometry coupled with label-free proteomics, one sample of which contains a tagged target chromatin of the invention. Typically, cells in a first cell sample and a second cell sample of the invention are from the same type of cells or may be derived from the same type of cells or derived from the same biological sample. In some embodiments, cells may comprise a heterologous nucleic acid expressed in a cell of the invention, and may also comprise a heterologous protein expressed in a cell of the invention. The heterologous nucleic acid and protein expressed in a cell may be used for tagging a chromatin of the invention as described in Section III(c). In an exemplary embodiment, cells from a first cell sample may comprise a heterologous nucleic acid and protein expressed in a cell of the invention, and cells from a second cell sample may comprise a heterologous protein expressed in a cell of the invention.

A first cell sample and a second cell sample of the invention may be from the same genus, species, variety or strain of cells or from the same biological sample. In an exemplary embodiment, a first cell sample and a second cell sample of the invention are Saccharomyces cerevisiae yeast cells.

The number of cells in a cell sample can and will vary depending on the type of cells, the abundance of a target chromatin in a cell, and the method of protein identification used, among other variables. For instance, about 1×10⁵ to about 1×10¹² cells may be used. Accordingly, about 1×10⁵, about 1×10⁶, about 1×10⁷, about 1×10⁸, about 1×10⁹, about 1×10¹⁰, about 1×10¹¹, about 1×10¹², or more cells may be used. Preferably, about 1×10⁹ to about 1×10¹¹ cells may be used in a cell sample. In some embodiments, about 1×10¹⁰ cells are used in a cell sample. In an exemplary embodiment, about 1×10¹⁰ Saccharomyces cerevisiae cells are used.

A first cell sample and a second cell sample of the invention are typically grown identically. Identically grown cell samples minimizes potential structural or functional differences at a target chromatin present in both cell samples. As used herein, “grown identically” refers to cultured cell samples grown using similar culture condition, or cells from a tissue harvested using identical harvesting techniques, or biological samples collected, and optionally processed, via identical techniques.

(b) Chromatin

According to the invention, a first cell sample and a second cell sample of the invention comprise nucleic acid binding proteins and a target chromatin. As used herein, “nucleic acid binding proteins” refers to proteins that bind nucleic acid. Nucleic acid binding proteins are proteins that are composed of nucleic acid-binding domains and thus have specific or general specificity for either single or double stranded nucleic acid. A nucleic acid binding protein may bind nucleic acid specifically or nonspecifically. Non-specific association of nucleic acid binding proteins with chromatin makes it challenging to identify proteins that are specifically bound to chromatin. The methodology of the present disclosure overcomes this challenge by reducing the amount of non-specific proteins bound to chromatin and enriching for proteins specifically bound to chromatin.

As used herein, “chromatin” refers to a target nucleic acid sequence that may be isolated from a cell. Generally, chromatin refers to the combination of nucleic acids and proteins in the nucleus of a eukaryotic cell. However, it is contemplated that the term “chromatin” may also refer to the combination of a nucleic acid sequence and proteins associated with the nucleic acid sequence in a cell.

A chromatin of the invention may comprise single stranded nucleic acid, double stranded nucleic acid, or a combination thereof. In some embodiments, a chromatin comprises single stranded nucleic acid. In other embodiments, a chromatin comprises a combination of single stranded and double stranded nucleic acids. In yet other embodiments, a chromatin comprises double stranded nucleic acid.

A chromatin of the invention may comprise a ribonucleic acid (RNA), a deoxyribonucleic acid (DNA), or a combination of RNA and DNA. In some embodiments, a chromatin of the invention comprises a combination of a RNA sequence and proteins associated with the RNA sequence in a cell. Non-limiting examples of RNA sequences may include mRNA, and non-coding RNA such as tRNA, rRNA, snoRNAs, microRNAs, siRNAs, piRNAs and the long noncoding RNA (IncRNA). In preferred embodiments, a chromatin of the invention comprises a combination of a DNA sequence and proteins associated with the DNA sequence in a cell. In other preferred embodiments, a chromatin of the invention comprises a combination of RNA and DNA sequences, and proteins associated with the RNA and DNA sequence in a cell. Non limiting examples of chromatin that may comprise a combination of RNA and DNA may include genomic DNA undergoing transcription, or genomic DNA comprising non-coding RNA such as IncRNA.

A chromatin of the invention may be genomic chromatin such as, chromatin from a chromosome of a cell, or chromatin from an organelle in the cell. Alternatively, a chromatin may be chromatin from an extrachromosomal nucleic acid sequence. In some embodiments, a chromatin of the invention is chromatin from an organelle in the cell. Non-limiting examples of a chromatin from an organelle may include mitochondrial nucleic acid sequence in plant and animal cells, and a chloroplast nucleic acid sequence in plant cells. In some embodiments, a nucleic acid sequence of the invention is a mitochondrial nucleic acid sequence. In other embodiments, a nucleic acid sequence of the invention is a chloroplast nucleic acid sequence.

In some embodiments, a chromatin of the invention is chromatin from an extrachromosomal nucleic acid sequence. The term “extrachromosomal,” as used herein, refers to any nucleic acid sequence not contained within the cell's genomic nucleic acid sequence. An extrachromosomal nucleic acid sequence may comprise some sequences that are identical or similar to genomic sequences in the cell, however, an extrachromosomal nucleic acid sequence as used herein does not integrate with genomic sequences of the cell. Non-limiting examples of an extrachromosomal nucleic acid sequence may include a plasmid, a virus, a cosmid, a phasmid, and a plasmid.

In some preferred embodiments, a chromatin of the invention is genomic chromatin. In exemplary embodiments, a chromatin of the invention is genomic chromatin of a eukaryotic cell. A eukaryotic cell of the invention may be as described in Section III(a) above.

Primary functions of genomic chromatin of a eukaryotic cell may be DNA packaging into a smaller volume to fit in the cell, strengthening of the DNA to allow mitosis, prevent DNA damage, and to control gene expression and DNA replication. As described above, genomic chromatin of a eukaryotic cell may comprise DNA sequences and a plurality of DNA-binding proteins as well as certain RNA sequences, assembled into higher order structural or functional regions. As used herein, a “structural or functional feature of a chromatin”, refers to a chromatin feature characterized by, or encoding, a function such as a regulatory function of a promoter, terminator, translation initiation, enhancer, etc., or a structural feature such as heterochromatin, euchromatin, a nucleosome, a telomere, or a centromere. A physical feature of a nucleic acid sequence may comprise a functional role and vice versa. As described below, a chromatin of the invention may be a chromatin fragment, and as such may comprise a fragment of a physical or functional feature of a chromatin, or no physical or functional features or known physical or functional features.

The primary protein components of genomic eukaryotic chromatin are histones that compact the DNA into a nucleosome. The nucleosome comprises an octet of histone proteins around which is wound a stretch of double stranded DNA sequence of about 150 to about 250 bp in length. Histones H2A, H2B, H3 and H4 are part of the nucleosome while histone H1 may act to link adjacent nucleosomes together into a higher order structure. Histones are subject to post translational modification which may affect their function in regulating chromatin function. Such modifications may include methylation, citrullination, acetylation, phosphorylation, SUMOylation, ubiquitination, and ADP-ribosylation.

Many further polypeptides and protein complexes interact with the nucleosome and the histones to regulate chromatin function. A “polypeptide complex” as used herein, is intended to describe proteins and polypeptides that assemble together to form a unitary association of factors. The members of a polypeptide complex may interact with each other via non-covalent or covalent bonds. Typically members of a polypeptide complex will cooperate to enable binding either to a nucleic acid sequence or to polypeptides and proteins already associated with or bound to a nucleic acid sequence in chromatin. Chromatin associated polypeptide complexes may comprise a plurality of proteins and/or polypeptides which each serve to interact with other polypeptides that may be permanently associated with the complex or which may associate transiently, dependent upon cellular conditions and position within the cell cycle. Hence, particular polypeptide complexes may vary in their constituent members at different stages of development, in response to varying physiological conditions or as a factor of the cell cycle. By way of example, in animals, polypeptide complexes with known chromatin remodelling activities include Polycomb group gene silencing complexes as well as Trithorax group gene activating complexes.

A chromatin of the invention may be an intact and complete chromatin from the cell, or may be a fragment of a chromatin in a cell. In some embodiments, a chromatin of the invention is an intact chromatin isolated from a cell. For instance, a chromatin of the invention may be a plasmid, a cosmid, or a phage chromatin or a complete organellar chromatin. In preferred embodiments, a chromatin of the invention is a fragment of a chromatin from a cell. In exemplary embodiments, a chromatin of the invention is a fragment of a genomic chromatin from a cell.

When a chromatin of the invention is a fragment of a chromatin in a cell, any method of fragmenting a chromatin known in the art may be used. Such methods may include physical methods of fragmenting a chromatin, or enzymatic digestion of a nucleic acid sequence of a chromatin. In some embodiments, a fragment of a chromatin may be generated using enzymatic digestion of a nucleic acid sequence in chromatin. Non-limiting examples of enzymatic digestion may include random or sequence specific enzymatic digestion using restriction enzymes, nucleases, combinations of restriction enzymes and nucleases, or combinations of nicking and other nucleases such as NEBNext™ fragmentase, which comprises a nicking enzyme that randomly generates nicks in double stranded DNA and another enzyme that cuts the strand opposite to the generated nicks.

In other embodiments, a fragment of a chromatin may be generated using a physical method of fragmenting a chromatin. Non-limiting examples of physical fragmenting methods that may be used to fragment a chromatin of the invention may include nebulization, sonication, and hydrodynamic shearing. In some embodiments, a fragment of a chromatin may be generated using nebulization. In other embodiments, a fragment of a chromatin may be generated using hydrodynamic shearing. In preferred embodiments, a fragment of a chromatin may be generated using sonication. During sonication, a sample comprising chromatin is subjected to ultrasonic waves, whose vibrations produce gaseous cavitations in the liquid that shear or break high molecular weight molecules such as chromatin through resonance vibration. Sonication methods that may be used to generate a chromatin of the invention are known in the art

A fragment of a chromatin of the invention may comprise a nucleic acid sequence fragment and may be about 10, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850, 1900, 1950, 2000, 2050, 2100, 2150, 2200, 2250, 2300, 2350, 2400, 2450, 2500, 2550, 2600, 2650, 2700, 2750, 2800, 2850, 2900, 2950, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or about 10000 bases long or more. In some embodiments, a chromatin of the invention may comprise a nucleic acid sequence fragment of about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, or about 500 bases long. In other embodiments, a chromatin of the invention may comprise a nucleic acid sequence fragment of about 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, or about 1000 bases long. In yet other embodiments, a chromatin of the invention may comprise a nucleic acid sequence fragment of about 1000, 1010, 1020, 1030, 1040, 1050, 1060, 1070, 1080, 1090, 1100, 1110, 1120, 1130, 1140, 1150, 1160, 1170, 1180, 1190, 1200, 1210, 1220, 1230, 1240, 1250, 1260, 1270, 1280, 1290, 1300, 1310, 1320, 1330, 1340, 1350, 1360, 1370, 1380, 1390, 1400, 1410, 1420, 1430, 1440, 1450, 1460, 1470, 1480, 1490, or about 1500 bases long. In other embodiments, a chromatin of the invention may comprise a nucleic acid sequence fragment of about 1500, 1510, 1520, 1530, 1540, 1550, 1560, 1570, 1580, 1590, 1600, 1610, 1620, 1630, 1640, 1650, 1660, 1670, 1680, 1690, 1700, 1710, 1720, 1730, 1740, 1750, 1760, 1770, 1780, 1790, 1800, 1810, 1820, 1830, 1840, 1850, 1860, 1870, 1880, 1890, 1900, 1910, 1920, 1930, 1940, 1950, 1960, 1970, 1980, 1990, or about 2000 bases long. In additional embodiments, a chromatin of the invention may comprise a nucleic acid sequence fragment of about 2000, 2100, 2150, 2200, 2250, 2300, 2350, 2400, 2450, or about 2500 bases long. In other embodiments, a chromatin of the invention may comprise a nucleic acid sequence fragment of about 2000, 2050, 2100, 2150, 2200, 2250, 2300, 2350, 2400, 2450, or about 2500 bases long. In still other embodiments, a chromatin of the invention may comprise a nucleic acid sequence fragment of about 2500, 2550, 2600, 2650, 2700, 2750, 2800, 2850, 2900, 2950, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or about 10000 bases long or more.

In some preferred embodiments, a chromatin fragment of the invention may comprise a nucleic acid sequence fragment of about 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, 1000, 1010, 1020, 1030, 1040, 1050, 1060, 1070, 1080, 1090, 1100, 1110, 1120, 1130, 1140, 1150, 1160, 1170, 1180, 1190, 1200, 1210, 1220, 1230, 1240, or about 1250 bases long. In a preferred embodiment, a chromatin of the invention may comprise a nucleic acid sequence fragment of about 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, or about 850 bases long. In another preferred embodiment, a chromatin of the invention may comprise a nucleic acid sequence fragment of about 950, 960, 970, 980, 990, 1000, 1010, 1020, 1030, 1040, or about 1050 bases long.

In other preferred embodiments, a chromatin fragment of the invention may comprise a nucleic acid sequence fragment of about 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, 1000, 1010, 1020, 1030, 1040, 1050, 1060, 1070, 1080, 1090, 1100, 1110, 1120, 1130, 1140, 1150, 1160, 1170, 1180, 1190, 1200, 1210, 1220, 1230, 1240, 1250, 1260, 1270, 1280, 1290, 1300, 1310, 1320, 1330, 1340, 1350, 1360, 1370, 1380, 1390, 1400, 1410, 1420, 1430, 1440, 1450, 1460, 1470, 1480, 1490, or about 1500 bases long. In a preferred embodiment, a chromatin of the invention may comprise a nucleic acid sequence fragment of about 950, 960, 970, 980, 990, 1000, 1010, 1020, 1030, 1040, or about 1050 bases long. In another preferred embodiment, a chromatin of the invention may comprise a nucleic acid sequence fragment of about 1200, 1210, 1220, 1230, 1240, 1250, 1260, 1270, 1280, 1290, or about 1300 bases long.

As described in this section above, a chromatin of the invention may comprise one or more nucleosomes. As such, a chromatin fragment of the invention may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or about 20 nucleosomes. In some embodiments, a chromatin fragment of the invention may comprise about 1, 2, 3, 4, or about 5 nucleosomes. In other embodiments, a chromatin fragment of the invention may comprise about 5, 6, 7, 8, 9, or about 10 nucleosomes. In yet other embodiments, a chromatin fragment of the invention may comprise about 10, 11, 12, 13, 14, or about 15 nucleosomes. In other embodiments, a chromatin fragment of the invention may comprise about 15, 16, 17, 18, 19, or about 20 nucleosomes. In preferred embodiments, a chromatin fragment of the invention may comprise about 4 nucleosomes. In other preferred embodiments, a chromatin fragment of the invention may comprise about 5 nucleosomes.

A target chromatin fragment of the invention may comprise a structural or a functional feature of chromatin as described above, a fragment of a physical or functional feature, or no physical or functional features or known physical or functional features. In some embodiments, a target chromatin fragment of the invention comprises a structural feature of chromatin. In other embodiments, a target chromatin fragment of the invention comprises no physical or functional features or known physical or functional features. In yet other embodiments, a target chromatin fragment of the invention comprises a functional feature of chromatin. In exemplary embodiments, a target chromatin is a promoter.

(c) Tagging the Target Chromatin

According to the invention, a target chromatin from a first cell sample is tagged and a target chromatin from a second cell sample is not tagged. In essence, tagging a target chromatin may comprise contacting the target chromatin of the invention with a tag capable of specifically recognizing and binding one or more portions of a target chromatin. As used herein, “specifically recognizing” refers to a binding reaction between two separate molecules that is at least two times the background and more typically more than 10 to 100 times the background molecular associations under physiological conditions. A tag may be capable of specifically recognizing and binding 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 components of a target chromatin. In preferred embodiments, a tag is capable of specifically recognizing and binding one component of a target chromatin. Alternatively, not tagging a target chromatin may comprise contacting the target chromatin with a non-functional tag that is not capable of specifically recognizing and binding one or more portions of the target chromatin. Specifically, the non-functional tag lacks a component of the tag that is essential for specifically recognizing and thus tagging the target chromatin.

A tag may be capable of specifically recognizing and binding a component in a target chromatin. A component in a target chromatin may be a nucleic acid sequence in a nucleic acid associated with a target chromatin, a protein associated with a target chromatin, or a chromatin structural or functional feature in a target chromatin. A nucleic acid sequence associated with a target chromatin that may be specifically recognized and bound by a tag of the invention may be a nucleic acid sequence normally found in a chromatin of a cell of the invention.

Individuals of ordinary skill in the art will recognize that an exogenous component introduced into a cell to facilitate tagging a target chromatin of the invention cannot and will not disrupt a target chromatin, or a structural or functional feature of a target chromatin. Methods of designing a chromatin component and a tag capable of binding the chromatin component that does not disrupt a chromatin of the invention may depend on the particular application of a method of the invention, and may be determined experimentally. For instance, if an application of a method of the invention comprises promoter function, a tag may be designed to bind anywhere adjacent to the promoter, but without disrupting the promoter.

In an embodiment, a tag of the invention comprises a nucleic acid sequence capable of binding a nucleic acid sequence component of a target chromatin, wherein the nucleic acid sequence component of the chromatin is normally present in a cell of the invention. Non-limiting examples of nucleic acids capable of binding a nucleic acid sequence component of a chromatin include antisense RNA or DNA nucleic acids, and modified nucleic acids and nucleic acid mimics such as peptide nucleic acids, locked nucleic acids, phosphorodiamidate morpholino oligomers (PMO). In some embodiments, a tag of the invention comprises a nucleic acid sequence comprising locked nucleotides. For instance, a nucleic acid sequence comprising locked nucleotides may be as described in US20110262908 or US20120040857, and a peptide nucleic acid tag may be as described in Boffa et al. 1995 PNAS 92:1901-1905, the disclosures of all of which are incorporated herein in their entirety. Importantly, a non-functional tag of the invention lacks the nucleic acid component of the tag such that the non-functional tag is not capable of specifically recognizing a nucleic acid sequence component of a target chromatin.

In specific embodiments, a tag of the invention comprises a guide RNA (gRNA) capable of binding a nucleic acid sequence component of a chromatin, wherein the nucleic acid sequence component of the chromatin is normally present in a cell of the invention. A gRNA may be part of the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) Type II system. There are two distinct components to this system: (1) a guide RNA and (2) an endonuclease, in this case the CRISPR associated (Cas) nuclease, Cas9. The guide RNA is a combination of the endogenous bacterial crRNA and tracrRNA into a single chimeric guide RNA (gRNA) transcript. The gRNA combines the targeting specificity of the crRNA with the scaffolding properties of the tracrRNA into a single transcript. When the gRNA and the Cas9 are expressed in the cell, the gRNA/Cas9 complex is recruited to the target sequence by the base-pairing between the gRNA sequence and the complement to the target sequence in the genomic DNA. For successful binding of Cas9, the genomic target sequence must also contain the correct Protospacer Adjacent Motiff (PAM) sequence immediately following the target sequence. The binding of the gRNA/Cas9 complex localizes the Cas9 to the genomic target sequence. Accordingly, guide RNA corresponds to a nucleic acid comprising a complementary sequence to a nucleic acid sequence component of a chromatin. In the present invention, guide RNA is engineered to comprise a sequence complementary to a portion of a nucleic acid sequence component of a chromatin such that it is capable of targeting the nucleic acid sequence component of a chromatin. In a particular embodiment, the guide RNA comprises a sequence of 5 to 50 nucleotides, preferably at least 12 nucleotides which is complementary to the nucleic acid sequence component of a chromatin. In a more particular embodiment, the guide RNA is a sequence of at least 30 nucleotides which comprises at least 10 nucleotides, preferably 12 nucleotides complementary to the nucleic acid sequence component of a chromatin. In certain embodiments, a target nucleic add sequence comprises a PAM sequence immediately following the nucleic acid sequence component of a chromatin. The typical length of the nucleic acid sequence component of a chromatin is about 20 base pairs, although sequences that are longer or shorter can be used.

A tag of the invention further comprises a protein that associates with the nucleic acid portion of the tag. Accordingly, a tag further comprises a protein capable of binding the nucleic acid portion of the tag, wherein the nucleic acid portion of the tag specifically recognizes a nucleic acid sequence normally found in a cell of the invention. The protein may be a wild type nucleic acid binding protein capable of binding a nucleic acid tag bound to a target chromatin. Alternatively, the protein may be engineered to have binding specificity for the nucleic acid portion of the tag. In preferred embodiments, the protein comprises a nuclease inactivated Cas9 protein, or derivatives thereof, wherein the Cas9 protein binds to the nucleic acid portion of the tag of the invention. In exemplary embodiments, a tag comprises Cas9, wherein Cas9 binds to guide RNA (gRNA). Importantly, the non-functional tag comprises the same protein as the functional tag of the invention.

A tag of the invention further comprises an affinity handle. An affinity handle may be used as an affinity purification handle for purifying a tagged target chromatin. Affinity handles may include any affinity handle for which a cognate binding agent is readily available. An affinity handle may be an aptamer, an antibody, an antibody fragment, a double-stranded DNA sequence, modified nucleic acids and nucleic acid mimics such as peptide nucleic acids, locked nucleic acids, phosphorodiamidate morpholino oligomers (PMO), a ligand, a ligand fragment, a receptor, a receptor fragment, a polypeptide, a peptide, a coenzyme, a coregulator, an allosteric molecule, non-immunoglobulin scaffolds such as Affibodies, Anticalins, designed Ankyrin repeat proteins and others, an ion, or a small molecule for which a cognate binding agent is readily available. The term “aptamer” refers to a polypeptide or a polynucleotide capable of binding to a target molecule at a specific region. It is generally accepted that an aptamer, which is specific in its binding to any polypeptide, may be synthesized and/or identified by in vitro evolution methods. Non limiting examples of handles that may be suitable for isolating a chromatin may include biotin or a biotin analogue such as desthiobiotin, digoxigenin, dinitrophenol or fluorescein, a macromolecule that binds to a nucleic acid or a nucleic acid binding protein such as the Lac repressor, a zinc finger protein, a transcription activator protein capable of binding a nucleic acid, or a transcription activator-like (TAL) protein, antigenic polypeptides such as protein A, or peptide ‘tags’ such as polyhistidine, FLAG, HA and Myc tags. In preferred embodiments, an affinity handle may be an antigenic polypeptide. In specific embodiments, an affinity handle may be the protein A antigenic polypeptide, or derivatives thereof. Due to the properties of an affinity handle, the affinity handle may also non-specifically associate with nucleic acid binding proteins. Importantly, the non-functional tag comprises the same affinity handle as the functional tag of the invention.

In specific embodiments, a tag of the invention comprises protein A as the affinity handle. In other specific embodiments, a tag of the invention comprises catalytically inactive Cas9 nuclease as the protein. In exemplary embodiments, a tag of the invention comprises protein A and a catalytically inactive Cas9 nuclease. In another exemplary embodiment, a tag of the invention comprises protein A tagged nuclease inactivated Cas9 protein and a gRNA which has been modified to bind a nucleic acid sequence normally found in a cell. In still another exemplary embodiment, a non-functional tag of the invention comprises protein A tagged nuclease inactivated Cas9 protein and does not comprise a gRNA. The Cas9 and gRNA of the invention may be components of the CRISPR system as discussed above.

A target chromatin may be contacted with a tag or non-functional tag at any time during a method of the invention leading to isolation of target chromatin. For instance, a target chromatin may be contacted with a tag or non-functional tag during cell culture by expressing the tag or non-functional tag in a cell of the invention. Alternatively, a target chromatin may be contacted with a tag or non-functional tag after cell culture but before cell lysis, after cell lysis, or after fragmentation of chromatin to generate chromatin fragments comprising a target chromatin. In such embodiments, a tag or non-functional tag may be added to the cell culture or cell lysate as a recombinant protein. The recombinant protein may be expressed, isolated and purified via methods standard in the art for protein purification.

In some embodiments, a target chromatin is contacted with a tag or non-functional tag after cell culture but before cell lysis. As such, a tag or non-functional tag may be introduced into a cell before cell lysis. Methods of introducing a tag or non-functional tag into a cell of the invention can and will vary depending on the type of cell, the tag, and the application of a method of the invention. For instance, a nucleic acid (i.e. a plasmid) capable of expressing a tag or non-functional tag of the invention may be introduced into a cell after culture such that the tag or non-functional tag is expressed during cell culture. In other embodiments, a target chromatin is contacted with a tag or non-functional tag after cell lysis. In yet other embodiments, a target chromatin is contacted with a tag or non-functional tag after cell lysis and chromatin fragmentation. In both of the foregoing embodiments, the tag or non-functional tag may be introduced as a recombinant protein. In specific embodiments, a target chromatin is contacted with a tag or non-functional tag during cell culture by expressing the tag or non-functional tag in a cell of the invention during cell culture. In an exemplary embodiment, a target chromatin is contacted with a tag during cell culture by expressing a tag comprising a gRNA, inactivated Cas9, and an affinity handle in a cell of the invention during cell culture. In another exemplary embodiment, a target chromatin is contacted with a non-functional tag during cell culture by expressing a tag comprising an inactivated Cas9 and an affinity handle in a cell of the invention during cell culture, wherein the non-functional tag does not comprise a gRNA.

(d) Preparation of Cell Lysate

According to the invention, affinity handle bound to a tagged target chromatin bound to nucleic acid binding proteins and affinity handle bound to non-specific nucleic acid binding proteins in a first cell sample is isolated and affinity handle bound to non-specific nucleic acid binding proteins in a second cell sample is isolated. The method of isolating affinity handle in a first cell sample and second cell sample may be performed on a cell lysate derived from a cell sample. A skilled practitioner of the art will appreciate that structural and functional features of an affinity handle and a tagged target chromatin must be preserved during cell lysis and isolation of the affinity handle and the tagged target chromatin. The association of proteins with a tagged target chromatin may be preserved during cell lysis using methods known in the art for preserving a complex of proteins with a nucleic acid sequence. For instance, lysing of a cell may be performed under refrigeration or using cryogenic methods and buffer conditions capable of preserving association of proteins and nucleic acid sequences. In addition, a complex of proteins with a nucleic acid may be preserved by crosslinking protein and nucleic acid complexes in a cell prior to lysing. Crosslinking protein and nucleic acid complexes in a cell may also capture, or preserve, transient protein-protein and protein-nucleic acid interactions.

In some embodiments, a complex of proteins with a nucleic acid may be preserved by crosslinking protein and nucleic acid complexes in a chromatin prior to lysing a cell and isolating the affinity handle and target chromatin. Crosslinking is the process of joining two or more molecules such as two proteins or a protein and a nucleic acid molecule, by a covalent bond. Molecules may be crosslinked by irradiation with ultraviolet light, or by using chemical crosslinking reagents. Chemical crosslinking reagents capable of crosslinking proteins and nucleic acids are known in the art and may include crosslinking reagents that target amines, sulfhydryls, carboxyls, carbonyls or hydroxyls; omobifunctional or heterobifunctional crosslinking reagent, variable spacer arm length or zero-length crosslinking reagents, cleavable or non-cleavable crosslinking reagents, and photoreactive crosslinking reagents. Non-limiting examples of crosslinking reagents that may be used to crosslink protein complexes and/or protein complexes and nucleic acids may include formaldehyde, glutaraldehyde, disuccinimidyl glutarate, disuccinimidyl suberate, a photoreactive amino acid such as photo-leucine or photo-methionine, and succinimidyl-diazirine. The degree of crosslinking can and will vary depending on the application of a method of the invention, and may be experimentally determined.

In a preferred embodiment, a complex of proteins with a nucleic acid in a chromatin of the invention may be preserved by crosslinking protein and nucleic acid complexes in a cell prior to lysing using formaldehyde. In an exemplary embodiment, a complex of proteins with a nucleic acid in a chromatin of the invention may be preserved by crosslinking protein and nucleic acid complexes in a cell prior to lysing using formaldehyde as described in the examples.

A skilled practitioner of the art will appreciate that protocols for lysing a cell can and will vary depending on the type of cell, the target chromatin of the invention, and the specific application of a method of the invention. Non-limiting examples of methods that may be used to lyse a cell of the invention may include cell lysis using a detergent, an enzyme such as lysozyme, incubation in a hypotonic buffer which causes a cell to swell and burst, mechanical disruption such as liquid homogenization by forcing a cell through a narrow space, sonication, freeze/thaw, mortar and pestle, glass beads, and combinations thereof. In some embodiments, when a cell of the invention is a yeast cell, the cell may be cryogenically lysed under liquid nitrogen temperature with glass beads. In exemplary embodiments, when a cell of the invention is a yeast cell, the cell may be cryogenically lysed under liquid nitrogen temperature with glass beads as described in the examples.

Buffer conditions used during lysing and isolation of a chromatin of the invention can and will be altered to control stringent conditions during cell lysis and isolation to preserve association of proteins and nucleic acid sequences of a chromatin. “Stringent conditions” in the context of chromatin isolation are conditions capable of preserving specific association of proteins and nucleic acids of a chromatin, but minimizing non-specific association of proteins and nucleic acids. Stringent condition can and will vary depending on the application of a method of the invention, the target chromatin of the invention, the nucleic acid sequence in a target chromatin, the proteins or protein complexes associated with a target chromatin of the invention, whether or not proteins, protein complexes and nucleic acid sequences are crosslinked, and the conditions used for crosslinking proteins, protein complexes and nucleic acid sequences of a target chromatin. For instance, more stringent buffer conditions may be used in a method of the invention wherein proteins, protein-protein complexes, and protein-nucleic acid complexes are crosslinked compared to a method of the invention wherein proteins, protein-protein complexes, and protein-nucleic acid complexes are not crosslinked. As such, stringent buffer conditions used during cell lysis and isolation of a nucleic acid sequence of the invention may be experimentally determined for each application wherein a method of the invention is used. Buffer conditions that may alter stringent conditions during cell lysis and isolation may include pH and salt concentration. In preferred embodiments, proteins, protein-protein complexes, and protein-nucleic acid complexes of a target chromatin of the invention are crosslinked, and stringent buffer conditions are used during lysis and isolation of a chromatin of the invention. In exemplary embodiments, proteins, protein-protein complexes, and protein-nucleic acid complexes of a target chromatin of the invention are crosslinked, and stringent buffer conditions are used during lysis and isolation of a chromatin of the invention and are as described in the examples. In an exemplary embodiment, a first cell sample and a second cell sample are crosslinked to stabilize protein-protein and protein-nucleic acid interactions with a target chromatin, then the first cell sample and the second cell sample are lysed, and then the target chromatin in the first cell sample and the second cell sample is fragmented resulting in 500 to 1500 base pair fragments.

(e) Chromatin Isolation

According to the invention, the method of isolating an affinity handle from each cell sample may be performed on cell lysates derived from the cell samples. As described in Sections III(d) above, a cell lysate comprises a lysate of a cell sample, wherein a target chromatin is tagged in one of the lysates, or one of the cell samples. A cell lysate also comprises a lysate of a cell sample, wherein a target chromatin is not tagged in one of the lysates, or one of the cell samples.

Isolating an affinity handle may enrich for a tagged target chromatin. An affinity handle bound to a tagged target chromatin may be isolated from a mixture of chromatins or chromatin fragments in a cell lysate. As used herein, the term “isolated” or “purified” may be used to describe a purified preparation of a target chromatin that is enriched for the target chromatin, but wherein the target chromatin is not necessarily in a pure form due to the presence of non-specifically bound nucleic acid binding proteins. A target chromatin of the present invention may be purified to homogeneity or other degrees of purity. In general, the level of purity of an isolated target chromatin can and will vary depending on the cell type, the specific chromatin to be isolated, and the intended use of a target chromatin of the invention. The level of purity of an isolated target chromatin may be determined using methods known in the art. For instance, the level of purity of an isolated target chromatin may be determined by determining the level of purity of a nucleic acid sequence associated with a target chromatin, by determining the level of purity of a protein associated with a target chromatin, or by determining the level of enrichment of a target chromatin, compared to a non-target chromatin in a cell. In preferred embodiments, the level of purity of an isolated target chromatin is determined by determining the level of enrichment of a target chromatin, compared to a non-target chromatin in a cell.

For example, an isolated target chromatin is not necessarily 100% pure, but may be about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% pure. An isolated target chromatin may be enriched for the target chromatin, relative to a chromatin in the lysed preparation that was contacted with a non-functional tag of the invention. An isolated target chromatin may be enriched by 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 fold relative to a chromatin that was contacted with a non-functional tag of the invention. In some embodiments, an isolated target chromatin is enriched by 10, 20, 30, 40 or 50 fold relative to a chromatin that was contacted with a non-functional tag of the invention. In other embodiments, an isolated target chromatin is enriched by 50, 60, 70, 80, 90, or 100 fold relative to a chromatin that was was contacted with a non-functional tag of the invention. In an exemplary embodiment, an isolated target chromatin is enriched 60, 65, 70, 75 or 80 fold relative to a chromatin that was contacted with a non-functional tag of the invention.

An affinity handle may be isolated using methods known in the art, such as electrophoresis, molecular, immunological and chromatographic techniques, ion exchange, hydrophobic, affinity, and reverse-phase HPLC chromatography, size exclusion chromatography, precipitation, dialysis, chromatofocusing, ultrafiltration and diafiltration techniques, and combinations thereof. For general guidance in suitable purification techniques, see Scopes, R., Protein Purification, Springer-Vertag, NY (1982).

In general, a method of the invention comprises isolating an affinity handle by affinity purification, or affinity purification in combination with other methods of isolating chromatin described above. In a preferred embodiment, a method of the invention comprises isolating an affinity handle by affinity purification. Non limiting examples of affinity purification techniques that may be used to isolate an affinity handle may include affinity chromatography, immunoaffinity chromatography, size exclusion chromatography, and combinations thereof. See, for example, Roe (ed), Protein Purification Techniques: A Practical Approach, Oxford University Press, 2nd edition, 2001.

A target chromatin contacted and bound by a tag may be isolated using any affinity purification method known in the art. In short, a target chromatin is bound to an affinity handle capable of binding to a substrate. The substrate comprising a bound affinity handle bound to target chromatin may then be washed to remove non-target chromatin and other cell debris, and the target chromatin may be released from substrate. Methods of affinity purification of material comprising an affinity handle are known in the art and may include binding the affinity handle to a substrate capable of binding the affinity handle. The substrate may be a gel matrix such as gel beads, the surface of a container, or a chip. The target chromatin bound to the affinity handle may then be purified. Methods of purifying tagged molecules are known in the art and will vary depending on the target molecule, the tag, and the substrate. For instance, if the affinity handle is bound to a target chromatin, the affinity handle may be bound to a magnetic bead substrate comprising IgG, and purified using a magnet. Importantly, the non-functional tag comprising an affinity handle in the second cell sample is subjected to the same affinity purification method as the first cell sample.

(f) Protein Extraction, Identification, and Determination of Labeling

Proteins and peptides associated with an isolated tagged target chromatin are extracted from the isolated tagged target chromatin. Methods of extracting proteins from chromatin are generally known in the art of protein biochemistry. Generally, any extraction protocol suitable for isolating proteins and known to those of skill in the art may be used. Extracted proteins may also be further purified before protein identification. For instance, protein extracts may be further purified by differential precipitation, differential solubilization, ultracentrifugation, using chromatographic methods such as size exclusion chromatography, hydrophobic interaction chromatography, ion exchange chromatography, affinity chromatography, metal binding, immunoaffinity chromatography, HPLC, or gel electrophoriesis such as SDS-PAGE and QPNC-PAGE. In a preferred embodiment, extracted proteins are further purified using SDS-PAGE.

Extracted and purified intact proteins and post-translational modification of proteins may then be identified. Alternatively, extracted and purified intact proteins may be further digested, and the resulting peptide fragments are identified. In some embodiments, intact extracted proteins are identified. In preferred embodiments, extracted proteins are further digested, and the resulting peptide fragments are identified. For instance, protein extracts may be fragmented by enzymatically digesting the proteins using a protease such as trypsin. In exemplary embodiments, extracted proteins are further digested as described in the examples.

Methods of identifying proteins or protein fragments are known in the art and may include mass spectrometry (MS) analysis, or a combination of mass spectrometry with a chromatographic technique. Non limiting examples of mass spectrometer techniques may include tandem mass spectrometry (MS/MS), matrix-assisted laser desorption/ionization source with a time-of-flight mass analyzer (MALDI-TOF), inductively coupled plasma-mass spectrometry (ICP-MS), accelerator mass spectrometry (AMS), thermal ionization-mass spectrometry (TIMS), isotope ratio mass spectrometry (IRMS), and spark source mass spectrometry (SSMS). Chromatographic techniques that may be used with MS may include gas chromatography, liquid chromatography, and ion mobility spectrometry. In a preferred embodiment, proteins may be identified using tandem mass spectrometry in combination with liquid chromatography (LC-MS/MS). In another preferred embodiment, post-translational modification of proteins may be identified using tandem mass spectrometry in combination with liquid chromatography (LC-MS/MS).

In the present invention, the method of label-free proteomics is used to categorize whether proteins enriched with a section of chromatin are specific or contaminant. Label-free methods of quantifying proteins or protein fragments are known in the art. In label-free quantitative proteomics, each sample is separately prepared, then subjected to individual methods of identifying proteins or protein fragments which may include LC-MS/MS or LC/LC-MS/MS. According to the invention, one sample comprises a target chromatin that is tagged in the cell sample and one sample comprises a target chromatin that is untagged in the cell sample. Label-free protein quantification is generally based on two categories of measurement. In the first are the measurements of ion intensity changes such as peptide peak areas or peak heights in chromatography. The second is based on the spectral counting of identified proteins after MS/MS analysis. Peptide peak intensity or spectral count is measured for individual LC-MS/MS or LC/LC-MS/MS runs and changes in protein abundance are calculated via a direct comparison between different analyses. In a preferred embodiment, the proteins identified using mass spectrometry are quantified and identified as enriched in the sample containing the tagged target chromatin compared to the sample containing the untagged target chromatin using label-free proteomics. In an exemplary embodiment, the proteins identified using mass spectrometry are quantified and identified as enriched in the sample containing the tagged target chromatin compared to the sample containing the untagged target chromatin using spectral counting.

The method of protein quantification by spectral count is known in the art and is reviewed in Zhu et al., J Biomed Biotechnol 2010, which is incorporated by reference herein. In spectral counting, relative protein quantification is achieved by comparing the number of identified MS/MS spectra from a protein of one sample to the same protein in the other sample. In the present invention, one sample comprises a target chromatin that is tagged and another sample comprises a target chromatin that is untagged. Protein quantification in spectral counting utilizes the fact that an increase in protein abundance typically results in an increase in the number of its proteolytic peptides, and vice versa. This increased number of (tryptic) digests then usually results in an increase in protein sequence coverage, the number of identified unique peptides, and the number of identified total MS/MS spectra (spectral count) for each protein.

As such, determining the abundance of an identified protein in a tagged chromatin sample compared to the same protein in an untagged chromatin sample, may determine if the protein was specifically associated with a target chromatin of the invention. If an identified protein associated with a target chromatin is in enriched in a tagged chromatin sample compared to the same protein in an untagged chromatin sample, then the protein was specifically associated with a target chromatin of the invention. If an identified protein is not enriched in a tagged chromatin sample compared to an untagged chromatin sample, then the protein is non-specifically associated with a target chromatin of the invention.

A skilled artisan in spectral counting will appreciate that normalization and statistical analysis of spectral counting datasets are necessary for accurate and reliable detection of protein changes. Since large proteins tend to contribute more peptide/spectra than small ones, a normalized spectral abundance factor (NSAF) is defined to account for the effect of protein length on spectral count. NSAF is calculated as the number of spectral counts (SpC) identifying a protein, divided by the protein's length (L), divided by the sum of SpC/L for all proteins in the experiment. NSAF allows the comparison of abundance of individual proteins in multiple independent samples and has been applied to quantify the expression changes in various complexes.

In the present invention, to measure enrichment of a protein, the normalized spectral abundance factor (NSAF) is calculated for each protein in each lane of an SDS-PAGE gel by dividing the number of spectral counts (normalized for the size of the protein) of a given protein by the sum of all normalized spectral counts of all proteins in the gel lane. The enrichment level for each protein is identified by calculating the fold enrichment (tagged chromatin/untagged chromatin) using the NSAF values. In an exemplary embodiment, proteins enriched in a sample containing a tagged target chromatin compared to a sample containing an untagged target chromatin are enriched by at least about 2 fold. In other embodiments, proteins enriched in a sample containing a tagged target chromatin compared to a sample containing the untagged target chromatin are enriched by at least about 1.5 fold. In other embodiments, proteins enriched in a sample containing a tagged target chromatin compared to a sample containing an untagged target chromatin are enriched by at least about 3 fold, about 4 fold, about 5 fold, about 6 fold, about 7 fold, about 8 fold, about 9 fold, about 10 fold, about 11 fold, about 12 fold, about 13 fold, about 14 fold, about 15 fold, about 16 fold, about 17 fold, about 18 fold, about 19 fold or about 20 fold. As such, a protein enriched by at least about 2 fold in a tagged chromatin sample compared to an untagged chromatin sample, is specifically associated with the chromatin. For instance, a baseline for non-specifically associated proteins may be proteins enriched by less than about 1.5 fold in a tagged chromatin sample compared to an untagged chromatin sample, wherein one or more proteins are not associated with chromatin. Non-limiting examples of proteins not associated with a chromatin may include enzymes required for metabolism, receptors, and ribosomal proteins. In preferred embodiments, proteins not associated with a chromatin are ribosomal proteins, and a baseline for non-specifically associated proteins is an enrichment less than about 1.5 fold in a tagged chromatin sampled compared to an untagged chromatin sample. In an exemplary embodiment, proteins or protein fragments enriched by at least 15 fold in a tagged chromatin sample compared to an untagged chromatin sample are specifically associated with a target chromatin.

In preferred embodiments, a target chromatin is tagged in one cell sample and a target chromatin is not tagged in a second cell sample, and MS analysis is used to identify proteins or protein fragments isolated during affinity purification of each sample, and label-free proteomics is used to determine if a protein or a protein fragment is specifically or non-specifically associated with the target chromatin. Methods of deriving MS data to identify proteins or protein fragments are known in the art, and may include using known computational techniques to distill MS data such as Mascot Distiller, Rosetta Elucidator, and MaxQuant. In some embodiments, MS data is derived using Rosetta Elucidator. In other embodiments, MS data is derived using MaxQuant. In preferred embodiments, MS data is derived using Mascot Distiller.

IV. Applications

A method of the invention may be used for any application wherein a determination of chromatin structure or function may be required. For instance, a method of the invention may be used to determine rearrangement in chromatin structure, genome metabolism, epigenetic regulatory mechanisms, transient association of proteins with chromatin, initiation or silencing of expression of a nucleic acid sequence, identify proteins transiently associated with a chromatin, or post-translational modification of proteins associated with a chromatin or chromatin rearrangement. An application of a method of the invention may include determining changes in chromatin function and structure in response to changing growth conditions, exposure to a drug or small molecule, or during stages of cell cycles.

A method of the invention may also be used to determine proteins localized to a target chromatin associated with a specific disease state. For example, a biological sample may be obtained from a subject with a specific disease and a biological sample may be obtained from a subject without a specific disease. A method of the invention may be performed on each of the biological samples. The difference in proteins associated with the target chromatin between the disease sample and the non-disease sample may then be compared. Such a method allows the determination of proteins localized to a target chromatin associated with a specific disease state. In certain embodiments, the disease may be cancer. The information gleaned from the foregoing method may be used to identify potential targets for drug development.

Additionally, a method of the invention may be used to diagnose a disease. For example, a biological sample may be obtained from a subject suspected of having a specific disease. A method of the invention may be performed on the biological sample. The identification of proteins specifically associated with a target chromatin may be compared to a reference sample, wherein when the reference sample is from a diseased subject, the proteins specifically associated with a target chromatin are the same or wherein when the reference sample is from a non-diseased subject, the proteins specifically associated with a target chromatin are different, then the subject may be diagnosed with the disease.

Further, a method of the invention may be used to map the 4D architecture of chromatin. Accordingly, a method of the invention may be used to study regions of chromosomes that come in contact with each other. Additionally, a method of the invention may be used to understand the proteins involved in chromosomal architecture.

In some embodiments, a method of the invention is used to determine differences in chromatin structure and function between a transcriptionally silent and a transcriptionally active state of a genomic locus. As such, proteins specifically associated with a genomic locus, and post-translational modifications of proteins associated with a chromatin comprising the genomic locus may be determined in cells comprising a transcriptionally silent state of a genomic locus, and in cells comprising a transcriptionally active state of a genomic locus.

V. Kits

In other aspects, the present invention provides kits for isolating and identifying proteins specifically associated with a chromatin. The kits may comprise, for example, a growth medium comprising a metabolic label, or a metabolic label that may be added to a growth medium, and cells comprising a tagged target chromatin, and instructions describing a method of the invention. A kit may further comprise material necessary for affinity purification of a tagged target chromatin, and a sample comprising metabolically labeled and unlabeled non-specifically associated proteins for determination of a baseline for non-specifically associated proteins. A kit my also comprise material necessary for affinity purification of a tagged target chromatin, and instructions describing a method of the invention.

In other embodiments, a kit may comprise a protein A-tagged TAL protein engineered to bind a target chromatin. In alternative embodiments, a kit may comprise a vector for expressing a protein A-tagged TAL protein, wherein the TAL protein may be engineered to bind a target chromatin.

In still other embodiments, a kit may comprise an affinity handle-tagged inactivated Cas9 and gRNA engineered to bind a target chromatin. A kit may comprise nucleic acids suitable for expressing an affinity handle-tagged inactivated Cas9 and gRNA engineered to bind a target chromatin or cells comprising nucleic acids suitable for expressing an affinity handle-tagged inactivated Cas9 and gRNA engineered to bind a target chromatin. A kit may also comprise instructions for expressing and purifying an affinity handle-tagged inactivated Cas9 and gRNA engineered to bind a target chromatin. In each of the foregoing embodiments, a kit may further comprise an affinity handle-tagged inactivated Cas9 without a gRNA for use as a control.

Cells and methods of the invention may be as described in Section I, Section II, and Section III above.

EXAMPLES

The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent techniques discovered by the inventors to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

Introduction for Examples 1-3

It has long been appreciated that chromatin-associated proteins and epigenetic factors play central roles in cell-fate reprogramming of genotypically identical stem cells through lineage-specific transcription or repression of precise genes and large chromosomal regions (Martin, 1981; Ho and Crabtree, 2010; Rossant, 2008). However, the hierarchy of chromatin-templated events orchestrating the formation and inheritance of different epigenetic states remains poorly understood at a molecular level. Since misregulation of chromatin structure and post-translational modification of histones (PTMs) is linked to cancer and other epigenetic diseases (Jones and Baylin, 2007; Chi et al., 2010), it is imperative to establish new methodologies that will allow comprehensive studies and unbiased screens for participants in epigenetic mechanisms. Unfortunately, defining how chromatin regulators collectively assemble and operate on a precise region of the genome is difficult to elucidate; there are no current methodologies that allow for determination of all proteins present at a defined, small region of chromatin.

Technical challenges have precluded the ability to determine positioning of chromatin factors along the chromosome. Chromatin immunoprecipitation (ChIP) assays have been used to better understand genome-wide distribution of proteins and histone modifications within a genome at the nucleosome level (Dedon at al., 1991; Ren et al., 2000; Pokholok et al., 2005; Robertson et al., 2007; Johnson et al., 2007; Barski at al., 2007; Mikkelsen et al, 2007). However, major drawbacks of ChIP-based chromatin enrichment methods include experiments that are largely confined to examining singular histone PTMs or proteins rather than simultaneous profiling of multiple targets, the inability to determine the co-occupancy of particular histone PTMs, and that ChIP is reliant on the previous identification of the molecular target. Affinity purification approaches have been devised for the isolation of a chromatin region (Griesenbeck et al., 2003; Agelopoulos et al., 2012); however, these approaches were not done at a level for proteomic analysis and they do not provide a mechanism for determining the specificity of protein interactions. More recently, groups biochemically enriching for intact chromatin have reported characterization of proteins associated with large chromatin structures such as telomeres (Dejardin and Kingston, 2009) and engineered plasmids (Akiyoshi el al., 2009; Unnikrishnan et al., 2010); however, these approaches do not enrich for a small integrated genomic locus and do not employ specialized mass spectrometric techniques to detect protein contamination in purified material.

We sought to compare differences in chromatin between the transcriptionally active and silent states of a single genomic locus, and developed a technology, called chromatin affinity purification with mass spectrometry (ChAP-MS). ChAP-MS provides for the site-specific enrichment of a given ˜1,000 base pair section of a chromosome followed by unambiguous identification of both proteins and histone PTMs associated with this chromosome section using highly selective mass spectrometry. Using ChAP-MS, we were able to purify chromatin at the Saccharomyces cerevisiae GAL.1 locus in transcriptionally silent and active states. We identified proteins and combinatorial histone PTMs unique to each of these functional states and validated these findings with ChIP. The ChAP-MS technique will greatly improve the field of epigenomics as an unbiased approach to study regulatory mechanisms on chromatin.

Example 1

ChAP-MS Technology

FIG. 1A provides an overview of the ChAP-MS approach that was used to screen for proteins and histone PTMs associated with a specific genomic locus in transcriptionally active or repressive states. A LexA DNA binding site was engineered immediately upstream of the GAL1 start codon in a S. cerevisiae strain constitutively expressing a LexA-Protein A (LexA-PrA) fusion protein. The LexA DNA binding site directs the localization of the LexA-PrA protein affinity “handle” to the GAL1 promoter in vivo. The positioning of the LexA DNA was designed to specifically enrich for chromatin-associated proteins and histone PTMs regulating gene expression near the transcriptional start site of GAL1. This strain was cultured in glucose to repress gene transcription, or galactose to activate gene transcription. Following in vivo chemical crosslinking to preserve the native protein-protein interactions at GAL1 promoter chromatin, the chromatin was sheared to ˜1,000 base pair sections. The PrA moiety of the LexA-PrA fusion protein was then used to affinity purify the ˜1,000 base pair section of chromatin at the 5′ end of the GAL1 gene for high resolution mass spectrometric identification of proteins and histone PTMs. It was anticipated that culturing these cells in glucose would result in the isolation of proteins and PTMs correlated to silent chromatin, while culturing cells in the presence of galactose would purify histone PTMs and proteins, like RNA polymerase, that are involved with active gene transcription.

The GAL1 gene is present at one copy per haploid cell; due to the relative low abundance of the targeted chromatin region in cellular lysates, it was fully anticipated that proteins nonspecifically associating with GAL1 chromatin would complicate analysis of the resulting purified material. Copurification of nonspecifically associating proteins is one of the major complications of affinity purifications; however, isotopic labeling of media provides a means to gauge in vivo protein-protein interactions and quantitate differences in peptide abundance (Smart et al., 2009; Tackett et al., 2005a). The inventors had previously developed a variation of this labeling technique called iDIRT (isotopic differentiation of interactions as random or targeted) that provides a solution for determining which coenriched proteins are specifically or nonspecifically associated with a complex of proteins (Smart et al., 2009; Tackett et al., 2005a). The iDIRT technique was adapted (as described in FIG. 1B) to control for proteins nonspecifically enriching with LexA-PrA and the resin. By using this adaptation of iDIRT on chromatin enriched from active and repressed chromatin states, the proteins nonspecifically enriching with the isolated GAL1 chromatin section were identified. The strain containing the LexA DNA binding site and LexA-PrA fusion protein was cultured in isotopically light media, while a strain lacking the LexA DNA binding site (but still containing the LexA-PrA fusion protein) was cultured in isotopically heavy media (¹³C₆ ¹⁵N₂-lysine). Following isolation of the cells, the light and heavy strains were mixed and colysed. The growth and mixing of light/heavy strains was performed separately under glucose and galactose growth conditions. The affinity purification of the GAL1 chromatin was performed from this mixture of light/heavy lysates. Proteins and histone PTMs specifically associated with the GAL1 chromatin containing the LexA DNA binding site were isotopically light as they arose from the cells grown in light media. Proteins that were nonspecific to the purification were a 1:1 mix of light and heavy as they were derived equally from the light and heavy lysates. Analysis of peptides from the enriched proteins with high-resolution mass spectrometry was used to determine the level of isotopically light and heavy proteins, thereby determining whether the detected protein was either a specific in vivo constituent of GAL1 chromatin or a nonspecific contaminant.

Example 2

Affinity Purification of a Specific Chromosome Section

To provide for enrichment of a specific chromosome section, a DNA affinity handle was engineered at the GAL1 gene in S. cerevisiae (FIG. 2A). A LexA DNA binding site was inserted via homologous recombination just upstream of the GAL1 start codon to create strain LEXA::GAL1. To create this strain, GAL1 was genomically deleted with URA3 in the W303a background, and then the GAL1 gene was reinserted with the upstream LEXA DNA sequence by homologous recombination. A plasmid constitutively expressing LexA-PrA was introduced into the strain to create LEXA::GAL1 pLexA-PrA (FIG. 2A). This strain provides a DNA affinity handle at the GAL1 gene and a protein affinity handle for specific enrichment. To determine if insertion of this LexA DNA binding site at GAL1 affected gene transcription, LEXA::GAL1 pLexA-PrA was cultured in glucose to repress gene transcription at GAL1, and separately in galactose to activate transcription. From these growths, cDNA was prepared and real-time PCR was used to measure the activation of GAL1 transcription in the presence of galactose (FIG. 2B). Insertion of the LexA DNA binding site just upstream of the GAL1 start codon did not drastically affect the activation of gene transcription; thus, this strain was used for ChAP-MS purification of GAL1 chromatin in the transcriptionally active and silent states.

To determine the effectiveness of isolation of GAL1 chromatin, the stringency and specificity of different purification conditions was analyzed. Purification of protein complexes under increasing stringencies such as high salt levels provides for the isolation of fewer nonspecifically interacting proteins (Smart et al., 2009; Taverna et al., 2006). Since the proteins purified with GAL1 chromatin will be chemically crosslinked, the stringency of the purification can potentially be quite high. Indeed, ChIP-qPCR against GAL1 showed that the PrA-based purification can survive relatively stringent conditions (FIG. 3A). From these studies, 1M NaCl and 1M urea were selected for future purifications, as these conditions are quite stringent and provide for enrichment of the GAL1 chromatin. Using an identical ChIP approach, the specificity of the GAL1 chromatin enrichment was determined (FIG. 3B). Using primers targeted to the indicated regions of chromatin surrounding GAL1, it was detected that the first 1,000 base pair section of the GAL/gene was indeed enriched. Enrichment of GAL1 chromatin was observed at a similar level under glucose and galactose growth conditions (FIG. 3C). The slightly less efficient isolation under galactose growth conditions may reflect availability of the DNA affinity site due to alterations in chromatin structure.

Example 3

ChAP-MS Analysis of Transcriptionally Active Anti Silent GAL1 Chromatin

Strain LEXA::GAL1 pLexA-PrA was subjected to the ChAP-MS procedure as outlined in FIG. 1. Strain LEXA::GAL1 pLexA-PrA was grown in isotopically light media, while strain pLexA-PrA was grown in isotopically heavy media. Following growth of each strain to mid-log phase, the cells were treated with 1.25% formaldehyde to trap protein interactions on the chromosomes. A detailed analysis of the amount of formaldehyde crosslinking required to preserve the in vivo state of chromatin during affinity purifications was recently published by the inventors (Byrum et al., 2011a, 2011b). Approximately 2.5×10¹¹ LEXA::GAL1 pLexA-PrA cells were mixed with an equivalent amount of isotopically heavy pLexA-PrA cells (separately for media containing glucose and galactose) and then subjected to lysis under cryogenic conditions with a Retch MM301 ball mill (Tackett et al., 2005a). Lysates were suspended in 20 mM HEPES (pH 7.4), 0.1% Tween 20, 1 M NaCl, 1 M urea, and 2 mM MgCl₂. Lysates were then subjected to sonication and chromatin was sheared to sections of ˜1,000 base pairs. LexA-PrA was collected on IgG-coated Dynabeads and coenriching proteins were resolved by SDS-PAGE and visualized by Coomassie staining (FIG. 4A). Gel lanes were sliced into 2 mm sections and subjected to in-gel trypsin digestion (Smart et al., 2009; Tackett et al., 2005a, 2005b). Peptides from proteins were identified by high-resolution mass spectrometry with a Thermo Velos Orbitrap mass spectrometer equipped with a Waters nanoACQUITY UPLC system. Proteins and PTM-containing peptides were identified and the level of isotopically light to heavy peptide was calculated with Mascot Distiller (Smart et al., 2009), Representative spectra are shown in FIG. 4B-D. Major bands observed in the gel lanes correspond to the affinity purification protein LexA-PrA and IgG chains as anticipated. Other proteins identified correspond to specifically and nonspecifically enriched proteins. Tables 1 and 2 list the proteins identified and percent isotopically light peptides (352 proteins from the glucose ChAP-MS and 399 proteins from the galactose ChAP-MS).

Once proteins were identified, a baseline was established for nonspecifically associated proteins in accordance to the iDIRT approach (Smart et al., 2009). Nonspecifically enriching ribosomal proteins were used to establish the nonspecifically associating baseline (Smart et al., 2009). The average percent isotopically light peptides from 20 ribosomal proteins from the glucose and galactose growth conditions were used to establish this nonspecifically associating baseline (Table 3). This resulted in a nonspecifically associating baseline of 49.93%±2.12% light for the glucose ChAP-MS and 66.8%±7.1% light for the galactose ChAP-MS (FIG. 5). Proteins were categorized as specifically associating with GAL1 chromatin if the percent light was greater than 2 SDs above the ribosomal level (Smart et al., 2009). FIG. 5 shows the proteins and histone PTMs specifically enriched with GAL1 chromatin under glucose and galactose growth conditions. Tables 4 and 5 list proteins that were identified as specifically enriched in both the glucose and galactose ChAP-MS analyses. Specifically enriched proteins or histone PTMs known to be involved in transcriptional regulation are listed in FIG. 5. For the glucose and galactose ChAP-MS analyses, 11 and 17 (respectively) additional proteins were detected as specifically enriched (FIG. 5, Tables 4 and 5). These additional proteins are abundant metabolic and heat shock proteins that are typical contaminants and false positives for this study. However, narrowing down 352 proteins identified from the glucose ChAP-MS and 399 proteins from the galactose ChAP-MS to 12 proteins and 27 proteins/PTMs specifically enriched produced a short list of candidates that was easily validated.

The ChAP-MS analyses of GAL1 chromatin revealed association of Gal3, Spt16, Rpb1, Rpb2, H3K14ac, H3K9acK14ac, H3K18acK23ac, H4K5acK8ac, and H4K12acK16ac under transcriptionally active conditions, while transcriptionally repressive conditions showed the enrichment of H3K36me3. In order to validate the ChAP-MS approach, standard ChIP was performed to specific interactions detected in the transcriptionally active and silent chromatin state at GAL1 (FIG. 6). These ChIP experiments validated the proteins and PTMs found associated with the transcriptionally active and repressed states of GAL1 chromatin determined from the ChAP-MS approach.

Discussion for Examples 1-3

The chromatin biology and epigenomics research communities have been limited to biased technologies that restrict targeted genome localization studies to previously identified proteins or histone PTMs. Here, a newly developed technology, called ChAP-MS, is described that circumvents this limitation by providing for isolation of a ˜1,000 base pair section of a chromosome for proteomic identification of specifically bound proteins and PTMs. In essence, the ChAP-MS approach allows one to take a “molecular snapshot” of chromatin dynamics at a specific genomic locus. Furthermore, employing this approach to target other chromatin regions will likely provide unprecedented insight on a variety of epigenetic regulatory mechanisms, chromatin structure, and genome metabolism.

Validation of the ChAP-MS Approach

The ChAP-MS approach was validated on the well-studied GAL1 locus in S. cerevisiae. The GAL1 gene is activated for gene transcription in the presence of galactose, while glucose represses transcription. Accordingly, it was rationalized that a purified ˜1,000 base pair section of chromatin at the 5′ end of the GAL1 gene from cells grown in galactose would contain histone PTMs correlated with active transcription and cellular machinery necessary for transcription, while the same chromatin section from cells grown in glucose would be enriched with histone PTMs associated with transcriptional repression. Prior publications have documented that H3 acetylation is enriched on the 5′ end of the active galactose-induced GAL1 gene, while in the presence of glucose it contains H3K36me3 (Shukla et al., 2006; Houseley et al., 2008). Results presented in the Examples herein with ChAP-MS, support each of these prior findings (FIG. 5). Furthermore, the presence of doubly acetylated histones (H3K9acK14ac, H3K18acK23ac, H4 K5acK8ac, H4K12acK16ac) during transcriptional activation was identified. This demonstrates how ChAP-MS may be used to study the combinatorial “code” of histone modifications at given chromosome regions without the need for prior identification of PTMs, PTM-specific antibodies, or sequential chromatin put-downs. Considering H4K12acK16ac for example, the identification of the double acetylation is unique to the ChAP-MS approach as antibodies to this double acetylation do not exist, thus one could not have performed a biased ChIP analysis. Additionally, it has been reported that commercially available antibodies to single acetylation at H4K12 or H4K16 are cross-reactive with other H4 acetylations and that double acetylation of H4K12K16 significantly alters the specificity of the antibody to the singly acetylated sites (Bock et al., 2011)—a limitation specific to antibodies used in biased ChIP studies and not to the unbiased ChAP-MS approach that uses quantitative mass spectrometric readout. The ChAP-MS approach simultaneously identified the presence of RNA polymerase (Rpb1, Rpb2) and FACT component Spt16 (which aids in reorganizing chromatin for RNA pol activity) under these transcriptionally active conditions. Also of interest was the identification of Gal3 at actively transcribing GAL1, which has previously been shown to inhibit the repressive activity of Gal80 at the GAL10/GAL1 locus (Platt and Reece, 1998). It was demonstrated how the ChAP-MS approach may be utilized to study chromatin dynamics at GAL1 under different states of gene transcription. Of particular interest for future functional studies may be the upstream activating sequence which binds the Gal4 actuator and Gal80 repressor which may allow better understand of the events surrounding the switch from repression to activation at GAL1 and GAL10, as well as the middle and 3′ end of GAL1 to understand the processes of elongation and termination, respectively.

Utility of ChAP-IViS as a General Tool for Studying Chromatin Biology

The ChAP-MS technology presented here demonstrates the ability to purify a unique chromosome section on the order of four to five nucleosomes in length from an in vivo source that can subsequently be subjected to sensitive proteomic studies. ChAP-MS has numerous advantages relative to traditional ChIP, including the ability to unbiasedly detect proteins/PTMs at a specific genomic locus and the identification of combinatorial histone modifications on a single histone molecule. Furthermore, ChAP-MS only requires approximately an order of magnitude more cells relative to biased ChIP studies, which is a huge advantage if doing more than ten blind ChIP studies at a given region is factored in (chances are many antibodies for many proteins would be heavily invested in, trying to guess a specifically bound protein/PTM). In this regard, ChAP-MS is a more cost-effective option for characterizing specifically bound proteins and histone PTMs relative to ChIP. Future derivations of this technology may employ targeted mass spectrometric approaches for better determination of combinatorial histone PTMs as well as identification of other regulatory PTMs on nonhistone proteins from these isolated sections (Taverna et al., 2007). Given the sensitivity of the mass spectrometry analysis employed and the relatively modest biological starting material, the findings presented in the Examples herein also establish a framework for applying ChAP-MS to profile across entire regions of chromosomes or investigate higher eukaryotic systems. Regardless, any advances that permit ChAP-MS analysis of in vivo untagged or unaltered samples, like tissues, will undoubtedly have valuable applications for investigating altered gene transcription mechanisms in human disease states, as this technique could provide a comprehensive way to intelligently identify targets for therapeutics.

Experimental Procedures for Examples 1-3

Construction of the LEXA::GAL1 pLexA-PrA Strain

The LEXA::GAL1 pLexA-PrA strain used to affinity enrich GAL1 chromatin was designed to have a LexA DNA binding site just upstream of the GAL1 start codon and contains a plasmid constitutively expressing a LexA-PrA fusion protein. In S. cerevisiae from the W303a background, the GAL1 gene was genomically replaced with URA3 using homologous recombination. Next, the GAL1 gene (+50 base pairs up- and downstream) was PCR amplified with primers that incorporated a LexA DNA binding site (5′-CACTTGATACTGTATGAGCATACAGTATAATTGC) immediately upstream of the GAL1 start codon. This LEXA::GAL1 cassette was transformed into the gal1::URA3 strain and selected for growth with 5-fluoroorotic acid, which is lethal in URA3 expressing cells. Positive transformants were sequenced to ensure homologous recombination of the cassette to create the LEXA::GAL1 strain. A plasmid that constitutively expresses LexA-PrA fusion protein with TRP selection was created by amplification of the PrA sequence from template pOM60 via PCR and subcloning into the Sac1/Sma1 ends of the expression plasmid pLexA-C. Transforming this plasmid into the LEXA:GAL1 strain gave rise to the LEXA:GAL1 pLexA-PrA strain. Additionally, a control used in these studies was W303a S. cerevisiae transformed only with pLexA-PrA.

Cell Culture

Strains LEXA:GAL1 pLexA-PrA and pLexA-PrA were grown in yeast synthetic media lacking tryptophan to mid-log phase at 30° C. LEXA:GAL1 pLexA-PrA strain growths were done with isotopically light lysine, while strain pLexA-PrA was cultured exclusively with isotopically heavy ¹³C6 ¹⁵N₂-lysine. For each strain, 12 l of media containing either 2% glucose or 3% galactose were grown to yield ˜5×10¹¹ cells per growth condition. At mid-log phase, the cultures were crosslinked with 1.25% formaldehyde for 5 min at room temperature and then quenched with 125 mM glycine for 5 min at room temperature. Cells were harvested by centrifugation (2,500×g) and frozen in liquid nitrogen as pellets in suspension with 20 mM HEPES (pH 7.4), 1.2% polyvinylpyrrolidone (1 ml/10 g of cell pellet). Frozen cell pellets were mixed as follows at 1:1 cell weight ratios: (1) LEXA:GAL1 pLexA-PrA isotopically light in glucose plus pLexA-PrA isotopically heavy control in glucose (2) LEXA:GAL1 pLexA-PrA isotopically light in galactose plus pLexA-PrA isotopically heavy control in galactose. Cell mixtures were cryogenically lysed under liquid nitrogen temperature with a Retsch MM301 ball mill (Smart et al., 2009; Tackett et al., 2005a).

ChAP-MS Procedure

Each of the following two cell lysates were processed for purification of GAL1 chromatin: (1) LEXA:GAL1 pLexA-PrA isotopically light in glucose plus pLexA-PrA isotopically heavy control in glucose, referred to as the glucose ChAP-MS, and (2) LEXA:GAL1 pLexA-PrA isotopically light in galactose plus pLexA-PrA isotopically heavy control in galactose, referred to as the galactose ChAP-MS. Twenty grams of frozen cell lysate (˜5×10¹¹ cells) was used for each of the glucose and galactose ChAP-MS analyses. ChAP-MS steps were performed at 4° C. unless otherwise noted. Lysates were resuspended in 20 mM HEPES (pH 7.4), 1 M NaCl, 2 mM MgCl₂, 1 M urea, 0.1% Tween 20, and 1% Sigma fungal protease inhibitor cocktail with 5 ml buffer per gram of frozen lysate. Lysates were subjected to sonication with a Diagenode Bioruptor UCD-200 (low setting, 30 s on/off cycle, 12 min total time) in 20 ml aliquots to yield ˜1 kb chromatin fragments. Supernatants from sonicated lysates were collected by centrifugation at 2,000×g for 10 min. Dynabeads (80 mg) coated with rabbit IgG were added to the lysates and incubated for 4 hr with constant agitation (Byrum et al., 2012a). Dynabeads were collected with a magnet and washed 5 times with the purification buffer listed above and 3 times with 20 mM HEPES (pH 7.4), 2 mM MgCl₂, 10 mM NaCl, 0.1% Tween 20. Washed Dynabeads were treated with 0.5 N ammonium hydroxide/0.5 mM EDTA for 5 min at room temperature to elute proteins. Eluants were lyophilized with a Savant SpeedVac Concentrator. Lyophilized proteins were resuspended in Laemmli SDS-PAGE loading buffer, heated to 95° C. for 20 min, resolved with 4%-20% tris-glycine Invitrogen precast gels, and visualized by colloidal Coomassie staining.

High-Resolution Mass Spectrometry and Data Analysis

Gel lanes were sliced into 2 mm sections and subjected to in-gel trypsin digestion (Byrum et al., 2011a, Byrum et al., 2011b, Byrum et al., 2012a; Tackett et al., 2005b). Peptides were analyzed with a Thermo Velos Orbitrap mass spectrometer coupled to a Waters nanoACQUITY liquid chromatography system (Byrum et al., 2011b). Using a data-dependent mode, the most abundant 15 peaks were selected for MS² from a high-resolution MS scan. Proteins were identified and the ratio of isotopically light/heavy lysine-containing tryptic peptide intensity was determined with Mascot and Mascot Distiller. The search parameters included: precursor ion tolerance 10 ppm, fragment ion tolerance 0.65 Da, fixed modification of carbamidomethyl on cysteine, variable modification of oxidation on methionine, and two missed cleavages possible with trypsin. A threshold of 95% confidence for protein identification, 50% confidence for peptide identification and at least two identified peptides per protein was used, which gave a 2% peptide false discovery rate. All specifically associating protein identifications and ratios were manually validated.

A baseline was established for nonspecifically associated proteins with nonspecifically enriched ribosomal proteins (Smart et al., 2009). The average percent isotopically light peptides from 20 ribosomal proteins from the glucose and galactose growth condition were used to establish this nonspecifically associated baseline. This resulted in a nonspecifically associated baseline of 49.93%±2.12% light for the glucose ChAP-MS and 66.8%±7.1% light for the galactose CHAP-MS. Proteins were categorized as specifically associating if the percent light was greater than 2 SDs above the ribosomal level (Tables 4 and 5) (Smart et al., 2009). Duplicate ChAP-MS procedures showed Pearson and Spearman correlation coefficient p values of <0.001.

ChIP and Gene Transcription Assays

ChIP and gene transcription assays were performed as previously reported (Tackett et al., 2005b; Taverna et al., 2006). Assays were performed in triplicate and analyzed by real time PCR.

Introduction for Examples 4-5

One of the most compositionally diverse structures in a eukaryotic cell is a chromosome. A multitude of macromolecular protein interactions and epigenetic modifications must properly occur on chromatin to drive functional aspects of chromosome biology like gene transcription, DNA replication, recombination, repair and sister chromatid segregation. Analyzing how proteins interact in vivo with chromatin to direct these activities and how epigenetics factors into these mechanisms remains a significant challenge owing to the lack of technologies to comprehensively analyze protein associations and epigenetics at specific native chromosome sites. Chromatin immunoprecipitation (ChIP) assays have traditionally been used to better understand genome-wide distributions of chromatin-associated proteins and histone post-translational modifications (PTMs) at the nucleosome level (Cermak et al., 2011). However, major drawbacks of current ChIP-based methods include their confinement to examining singular histone PTMs or proteins rather than simultaneous profiling of multiple targets, the inability of ChIP to directly determine the co-occupancy of particular histone PTMs and that ChIP is reliant on the previous identification and development of affinity reagents against the molecular target. A more comprehensive and unbiased approach would be the biochemical isolation of a specific native genomic locus for proteomic identification of proteins-associated and histone PTMs. Similar approaches have been performed for large structures like telomeres, engineered plasmids or engineered loci (Griesenbeck et al., 2003; Dejardin and Kingston, 2009; Hoshino and Fuji, 2009; Akiyoshi et al., 2009; Unnikrishnan et al., 2010; Byrum et al., 2012b); however, the proteomic analysis of a small native genomic region without genomic engineering has yet to be performed. To work toward proteomic studies of native chromatin regions (i.e. sections of chromatin that are unaltered genetically and spatially the genome), we recently developed a technique termed Chromatin Affinity Purification with Mass Spectrometry (ChAP-MS) that provides for the enrichment of a native 1-kb section of a chromosome for site-specific identification of protein interactions and associated histone PTMs (Byrum et al., 2012b). This ChAP-MS approach uses the association of an ectopically expressed affinity-tagged LexA protein with a genomically incorporated LexA DNA binding site for site-specific chromatin enrichment. The ChAP-MS approach provides for the isolation of chromatin from the native site in the chromosome; however, one must genomically engineer a LexA DNA binding site, which could alter the native state of the chromatin and which requires a biological system readily amendable to genomic engineering.

To alleviate genomic engineering for affinity enrichment of chromatin sections, we report the use of modified transcription activator-like (TAL) effector proteins to site-specifically target a native section of a chromosome for purification and proteomic analysis. We term this approach TAL-ChAP-MS (FIG. 7A). TAL effector proteins are from Xanthomonas, which infects plants and translocates TAL effectors into cells where they serve as transcription activators (Scholze and Boch, 2010; Scholze and Boch, 2011; Doyle et al., 2012). TALs contain a central domain of 18 tandem repeats of 34 amino acids each, which direct sequence-specific DNA binding (Doyle et al., 2012; Cermak et al., 2011). Binding to a given nucleobase in DNA is determined by two adjacent amino acids (12 and 13) within each of the 18 repeats (Scholze and Boch, 2010). Thus, by mutating these amino acids in each of the 18 tandem repeats, one can ‘program’ binding to a given 18-nt region of DNA in vivo. TAL proteins have been validated in cell culture for targeting nucleases for genome editing and for targeting transcription activators (Miller et al., 2011; Geissler et al., 2011). To test the ability of a TAL protein to serve as an affinity enrichment reagent for native chromatin isolation, a TAL protein was designed that bound a unique 18-nt region of DNA in the promoter region of the GAL1 gene in Saccharomyces cerevisiae (FIG. 7B). We chose to analyze proteins and histone PTMs regulating the galactose-induced gene transcription of GAL1 because (1) this is a well-studied genomic locus, which will provide for proof-of-principle analysis, and (2) we previously used this locus to develop the ChAP-MS technique (Byrum et al., 2012b); thus, a comparison can be made to the new TAL-ChAP-MS approach.

One of the major complications for studying specific protein associations with purified protein complexes or with chromatin is the co-enrichment of non-specifically associating proteins. This particularly becomes an issue when studying low copy number entities such as a single genomic locus. With the advancement of high-resolution and sensitive mass spectrometry in recent years, it has been suggested that >10⁹ cell equivalents are needed to study single genomic loci with proteomic approaches (Chait, 2011). In agreement, our ChAP-MS studies used 10¹¹ cells for isolation of GAL1 promoter chromatin at levels sufficient for proteomic analysis (Byrum et al., 2012b). When scaling up purifications of low copy entities to meet the sensitivity necessary for high-resolution mass spectrometric analysis, the issue of co-purifying abundant non-specific proteins becomes a major challenge. In the ChAP-MS approach (Byrum et al., 2012b), we used an isotope-labeling strategy to categorize whether a protein co-enriching with a section of chromatin was specifically associated or a contaminant. Limitations for isotope-labeling approaches are cost and having biological systems of study that are amendable to stable isotope-labeling with amino acids. To circumvent the use of isotope-labeling, we now have incorporated label-free quantitative mass spectrometry in the TAL-ChAP-MS workflow. The described TAL-ChAP-MS approach can therefore provide for the purification of a native chromatin region for label-free quantitative proteomic analysis, which will greatly simplify studies of how proteins and combinatorial histone PTMs regulate chromosome metabolism.

Example 4

Development of TAL-ChAP-MS

A schematic of the TAL-ChAP-MS approach to purify native chromatin for proteomic analysis is shown in FIG. 7A. To demonstrate the utility of the TAL-ChAP-MS approach, we used a TAL protein to target the promoter chromatin region upstream of the galactose-inducible GAL1 gene in S. cerevisiae (FIG. 7B). Yeast cells were grown in the presence of galactose to induce transcription of the GAL1 gene, which will recruit proteins and histone PTMs that activate transcription. A wild-type culture and a culture of cells containing a plasmid that expressed a PrA-tagged TAL protein that bound the GAL1 promoter region were grown and subjected to in vivo formaldehyde cross-linking to preserve chromatin structure during purification (Byrum et al., 2011a; Byrum et al., 2011b). Following cryogenic cell lysis and sonication of chromatin sections to ˜1 kb, each lysate was independently subjected to affinity enrichment of PrA with IgG-coated Dynabeads. Proteins co-enriching with TAL-PrA from the cells containing the pTAL-PrA plasmid and those enriching as contamination from the control cells with no plasmid were identified by high-resolution mass spectrometry. Using label-free quantitative analyses, the relative enrichment of proteins and histone PTMs specifically hound to the GAL1 promoter chromatin were identified.

Saccharomyces cerevisiae cells were transformed with pTAL-PrA, and protein expression was validated by western blotting (FIG. 7C). To evaluate whether TAL-PrA expression affected galactose-induced transcription of GAL1, cDNA was prepared from wild-type and wild-type (+pTAL-PrA) cells under glucose (transcriptionally repressed GAL1) and galactose (transcriptionally active GAL1) growth conditions. Quantitative rtPCR of this cDNA revealed that expression of TAL-PrA did not affect galactose-induced GAL1 transcription (FIG. 7D). To determine whether TAL-PrA enriched chromatin at the GAL1 promoter region, ChIP was performed to the PrA-tag in cells from glucose and galactose growths (FIG. 7E-G). Under transcriptionally active conditions, TAL-PrA specifically enriched chromatin from the GAL1 promoter region relative to sequences 2 kb up- and downstream (FIG. 7F). The level of chromatin enrichment by TAL-PrA under transcriptionally active conditions was similar to the level used for proteomic studies with LexA-PrA affinity enrichment in the ChAP-MS approach (Byrum et al., 2012b). Interestingly, the TAL-PrA protein did not show enrichment of the GAL1 promoter chromatin under transcriptionally repressive glucose growth conditions (FIG. 7G). One possibility of many is that the lack of enrichment could be due to inaccessibility of the TAL-PrA to the genomic target due to altered chromatin structure under transcriptionally repressive conditions—highlighting the importance for measuring specific chromatin enrichment of the TAL protein before using this approach for specific chromatin enrichment. In the previous publication of the ChAP approach (Byrum et al., 2012b), a LexA-PrA was targeted just upstream of the start codon of GAL1 for enrichment of chromatin, which showed enrichment under both glucose and galactose growth conditions. Importantly, the TAL used in the current study was targeted 193 bp upstream of the target site of LexA, which suggests that proximal regions may be differentially accessible to DNA-binding affinity reagents under various transcriptional states. In addition to analyzing enrichment of GAL1 chromatin relative to proximal sequences (FIG. 7E-G), enrichment of GAL1 chromatin was measured relative to the five most homologous sequences in the genome (Table 6). The GAL1 target DNA showed 4.6-fold better enrichment relative to the next five most similar sites in the genome—demonstrating specificity of the TAL protein used in this study to the targeted sequence at the GAL1 promoter region. Collectively, the data in FIG. 7C-G and Table 6 demonstrate that the TAL-ChAP-MS approach can provide enriched chromatin from the GAL1 promoter under transcriptionally active conditions that would be suitable for proteomic studies.

Example 5

Using TAL-ChAP-MS to Identify Proteins and Histone PTMs at the GAL1 Promoter

As detailed in the Experimental Procedures for Examples 4-5 section, chromatin from the transcriptionally active GAL1 promoter was enriched with TAL-PrA and resolved by SDS-PAGE (FIG. 8A). The similar Coomassie-stained protein pattern for the TAL-PrA and wild-type control samples in FIG. 8A demonstrates that the co-enrichment of contaminating proteins was a major issue for this approach. Accordingly, the label-free spectral counting approach described in the Experimental Procedures for Examples 4-5 section was used to identify proteins specifically enriched with the TAL-PrA. High-resolution mass spectrometry coupled with label-free proteomics was used to identify proteins and histone PTMs specifically enriched with the GAL1 promoter chromatin (FIG. 8B and Table 7). We focused our analysis on the top 10% of enriched proteins (54 proteins) that each showed >15-fold enrichment with the TAL-PrA (Table 7). Four of these 54 proteins (Rpb1, Rpb2, Spt16 and Gal3) are involved with active transcription of GAL1, and these are the same four proteins previously identified at the promoter of GAL1 with the ChAP-MS approach (Byrum et al., 2012b). Rpb1 and Rpb2 are RNA polymerise components, and Spt16 is a subunit of yFACT that aids in re-organizing chromatin for RNA polymerase activity. Gal3 has previously been shown to inhibit the repressive activity of Gal80 at GAL1 locus (Platt and Reece, 1998). Rpb1, Rpb2, Spt16 and Gal3 were confirmed to be associated adjacent to the TAL-PrA genomic binding site with standard ChIP (FIG. 8C). Thus, the TAL-ChAP-MS approach identified precisely the same proteins as the published ChAP-MS approach during transcriptional activation at the promoter of GAL1, thereby validating the TAL-ChAP-MS approach for studying the local proteome of small chromatin regions and the use of label-free proteomic approaches for quantifying such enrichments. Many of the other 50 proteins identified as >15-fold enriched with TAL-PrA are typical non-specific protein associations found in affinity purifications (e.g. highly abundant metabolic and ribosomal proteins).

In addition to protein associations with the GAL1 promoter, the following single histone PTMs were identified under transcriptionally active conditions: H3K14ac, H3K56ac, H3K79me1/me2/me3, H2BKI7ac and H2AK7ac; and the following combinatorial histone PTMs: H3K9acK14ac, H3K18acK23ac, H2BK6acK11ac and H2BK11acK17ac (FIG. 8B and Table 8). The presence of H3K14ac was confirmed by standard ChIP (FIG. 8C). Previously using ChAP-MS and routine ChIPs (Byrum et al., 2012b), a similar profile of singly acetylated H3 lysine residues was identified at the GAL1 promoter region, thus confirming the utility of the TAL-ChAP-MS approach. In addition to the acetylations observed in the ChAP-MS study, the TAL-ChAP-MS approach additionally identified methylation of H3K79. As previously reported for the ChAP-MS approach, the TAL-ChAP-MS approach uncovered combinatorial sets (i.e. multiple PTMs on single peptides) of histone PTMs under transcriptionally active conditions at the promoter of GAL1. The use of a technology like TAL-ChAP-MS to identify previously unknown combinatorial modifications is crucial to understand the epigenome, as specific antibodies to combinatorial histone PTMs are not usually available for standard approaches like ChIP. In general terms, acetylation of histone lysine residues and methylation of H3K79 correlate to transcriptional activation (Kouzarides, 2007); thus, the histone PTMs uncovered by TAL-ChAP-MS correlate to the active transcription state of GAL1 in the presence of galactose.

Discussion for Examples 4-5

We describe a novel approach called TAL-ChAP-MS that provides for the biochemical isolation of 1-kb native chromatin sections for proteomic identification of specifically associated proteins and combinatorial histone PTMs. The described TAL-ChAP-MS approach overcomes limitations of the ChAP-MS approach (Byrum et al., 2012b), as genomic engineering is not necessary for TAL-based affinity enrichment and because protein enrichment with a given locus can now be determined with label-free proteomics. Even without genomic engineering of the DNA, the ChAP-MS approach does require targeting of a DNA-binding affinity enrichment reagent (i.e. the TAL protein), which has the potential to perturb the chromatin state. However, the data in FIG. 7D demonstrate that transcription of GAL1 is not altered on TAL targeting, which supports maintenance of the chromatin integrity for the studies reported here. Targeting TALs to different sequences in adjacent genomic regions that would provide for purification of overlapping chromatin sections is one possible way for investigators to overcome concerns of TAL binding (i.e. a tiling approach). The implications of the TAL-ChAP-MS approach are far-reaching as investigators can now begin to elucidate the dynamics of chromatin regulation in a site-specific and comprehensive manner. Researchers will now only need to ‘reprogram’ the DNA-binding specificity of the TAL protein to obtain a unique affinity purification reagent for their chromosome region of interest. Using the TAL-ChAP-MS approach brings researchers closer to being able to take molecular ‘snapshots’ of the assembly and disassembly of proteins on chromatin and how epigenetic states are modulated at small genomic loci.

Experimental Procedures for Examples 4-5

pTAL-PrA Plasmid, Real-Time rtPCR and ChIP

For affinity enrichment of chromatin from the promoter region of the GAL1 gene in S. cerevisiae, a TAL protein was designed (by the GeneArt Precision TAL services of Life Technologies) to bind a unique 18-nt sequence (GGGGTAATTAATCAGCGA) 193 base pairs upstream of the GAL1 open-reading frame (FIG. 7B). The TAL protein was designed as a truncation that lacked the native N-terminal transcription activation domain, but it contained the site-specific DNA-binding region. To develop an affinity enrichment reagent, the LexA-coding region of pLexA-PrA [plasmid that constitutively expresses a PrA-tagged LexA protein under TRP selection; from (Byrum et al., 2012b)] was replaced with the TAL-coding region to generate pTAL-PrA. Real-time qPCR measurement of galactose-induced transcription of GAL1 and all ChIP studies were performed as reported in (Byrum et al., 2012b).

TAL-ChAP-MS

To test the TAL-ChAP-MS approach at the promoter region of GAL1, wild-type and wild-type (+pTAL-PrA) S. cerevisiae (W303 matA) cells were cultured to mid-log phase in 3% galactose-containing media, subjected to 1.25% formaldehyde cross-linking, cryogenically lysed and subjected to sonication to shear genomic DNA to ˜1 kb [as detailed in (Byrum et al., 2012b; Byrum et al., 2011a; Byrum et al., 2011b)]. Immunoglobulin G (IgG)-coated Dynabeads were added to lysate from ˜10¹¹ cells from each growth separately [as detailed in (Byrum et al., 2012b)]. Proteins co-enriching with the TAL-PrA (wild-type cells +pTAL-PrA lysate) or proteins non-specifically binding to the Dynabeads (wild-type cell lysate) were resolved by SDS-PAGE/Coomassie-staining (FIG. 8A), excised as 2-mm bands from the entire gel lane, digested in-gel with trypsin and subjected to high-resolution tandem mass spectrometric analysis with a Thermo Velos Orbitap mass spectrometer [as reported in (Byrum et al., 2012b)]. Proteins and typical histone PTMs (lysine acetylation and methylation) were identified using Mascot (Tables 7 and 8). To measure enrichment of a protein, the normalized spectral abundance factor (Zybailov et al., 2006) was calculated for each protein in each lane by dividing the number of spectral counts (normalized for the size of the protein) of a given protein by the sum of all normalized spectral counts of all proteins in the gel lane (Byrum et al., 2011c). The enrichment level for each protein was identified by calculating the fold enrichment (TAL-PrA/wild type) using the normalized spectral abundance factor values (Table 7). Proteins with a fold enrichment >2 (511 of 1459 proteins identified) were used to generate a quantile plot of fold enrichment with GAL1 promoter chromatin (FIG. 8B).

Introduction for Example 6

For the work presented, a “local epiproteome” refers to not only the histone PTMs at a specific chromosomal location that are involved in a particular activity (Dai and Rasmussen, 2007), but also to the other proteins associated with the region in addition to the histones. Identifying the components of a specific epiproteome can provide unprecedented insight into the molecular and epigenetic mechanisms regulating an activity. For example, gene transcription could have various epiproteomes that regulate initiation, elongation and termination. A recently realized milestone for measuring local epiproteomes has been the development of affinity enrichment procedures to isolate small regions of chromatin (Byrum et al., 2013; Byrum et al., 2012b; Dejardin and Kingston, 2009; Akiyoshi et al., 2009; Hoshino and Fujii, 2009; Griesenbeck et al., 2003; Unnikrishnan et al., 2010; Hamperl et al., 2014). Purification of a small region of chromatin from the cellular milieu is one of the most challenging aspects of these approaches as the proteins and histone PTMs specifically isolated with the targeted chromatin typically constitute a small fraction of the identified proteins—most of which are non-specific associations (Byrum et al., 2013; Byrum et al., 2012b; Byrum et al., 2011a). We developed two approaches using quantitative high resolution mass spectrometry that distinguish whether proteins and histone PTMs identified during epiproteome measurements are “specific” to the target chromatin or are “non-specific” contaminants (Byrum et al., 2013; Byrum et al., 2012b). These quantitative approaches are critical components of our ChAP-MS (Chromatin Affinity Purification with Mass Spectrometry) platform of technologies that enable local epiproteome analysis. Included in this platform are the first generation ChAP-MS and second generation TAL-ChAP-MS approaches (Byrum et al., 2013; Byrum et al., 2012b). The ChAP-MS approach, which used a targeted LexA protein as an affinity reagent, demonstrated the first unambiguous epiproteome measurement. The TAL-ChAP-MS approach achieved similar high resolution and specificity by using the genomic targeting ability of the TALEN (Transcription Activator-Like Effector Nuclease) system for local epiproteome isolation and analysis (Byrum et al., 2012b; Scholze and Boch, 2011).

Described here is the third generation technology termed CRISPR-ChAP-MS (FIG. 9). The prokaryotic viral defense system CRISPR (Clustered Regularly Interspaced Palindromic Repeats) has recently been developed as a genome-editing tool for eukaryotes (Mali et al., 2013). The core components of this system include the Cas9 nuclease, which is able to create double-strand breaks in DNA, and guide RNA (gRNA), which is bound by Cas9 and serves to direct this complex to a target sequence complementary to the gRNA. Using the Type II CRISPR system from S. pyogenes, we have harnessed the specific gene-targeting capability of the Cas9/gRNA complex to isolate and unambiguously identify a specific local epiproteome. We created a PrA-tagged version of Cas9 with a catalytically inactive nuclease along with a gRNA to target the promoter region of the GAL1 gene in S. cerevisiae to validate the CRISPR-ChAP-MS technology (FIG. 9).

To isolate the targeted chromatin, cells were treated with formaldehyde to stabilize interactions (Byrum et al., 2012b), chromatin was sheared to fragments approximately 1 kb in length, and the target chromatin was affinity purified using the PrA tag. Affinity tagged versions of Cas9 have been shown to target chromatin for partial enrichment (Fujita and Fujii, 2013); however, a quantitative analysis of the specifically bound proteins and histone PTMs has not been reported. Here using our CRISPR-ChAP-MS approach that does provide for quantitative identification of specifically bound proteins and histone PTMs, the GAL1 promoter chromatin from yeast was isolated under transcriptionally active conditions and subjected to a label-free quantitative mass spectrometric workflow to identify the specific components of the local epiproteome. Relative to the first and second generations of the ChAP-MS technological platform, CRISPR-ChAP-MS shows an enhanced ability to isolate targeted chromatin, which is critical for epiproteome analysis. The TAL-based approach also requires design of a specific TAL protein for each sequence targeted whereas CRISPR-ChAP-MS only requires site-directed mutagenesis to alter the gRNA for genomic targeting, which provides a more cost effective approach that can easily be multiplexed to target additional sites.

Example 6

A CRISPR-Based Approach for High Resolution Epiproteome Identification

To validate the CRISPR-ChAP-MS approach, the promoter chromatin of the GAL1 gene was targeted for enrichment in S. cerevisiae. This region of chromatin is an attractive target for validation studies as one can supply yeast with galactose in place of glucose to rapidly and synchronously stimulate transcriptional activation of GAL1—thereby setting a transcriptionally active chromatin state for epiproteome analysis. Cells were transformed with plasmids expressing a nuclease inactive and PrA-tagged version of Cas9 (pPrA-Cas9) and/or expressing gRNA specific to the promoter region of the GAL1 gene (pgRNA-GAL1). Similar expression of PrA-Cas9 in glucose and galactose was demonstrated by Western-blotting (FIG. 10A). To evaluate whether expression of this PrA-Cas9/gRNA complex affected transcription of GAL1, cDNA was prepared from cells in glucose (transcriptionally repressed GAL1) and galactose (transcriptionally active GAL1) and was analyzed by quantitative real-time PCR. GAL1 transcription was similar in cells expressing PrA-Cas9/gRNA compared to cells expressing only PrA-Cas9, indicating that expression of PrA-Cas9/gRNA does not drastically alter transcriptional activation (FIG. 10B). To determine whether this expressed PrA-Cas9/gRNA complex was bound to and could enrich chromatin at the GAL1 promoter region, ChIP was performed to PrA-Cas9 in cells from glucose and galactose cultures. GAL1 promoter chromatin was enriched in a gRNA dependent manner with PrA-Cas9 from both glucose (4.9-fold) and galactose (70-fold) growth conditions (FIG. 10C). Regions 2 kb up- or downstream did not show enrichment (FIG. 10C), demonstrating that chromatin purification was localized to the gRNA target region. In previous studies using TAL proteins targeted to the same chromatin region (Byrum et al., 2013), a ˜6-fold enrichment was observed under galactose growth conditions and no enrichment under glucose growth. Therefore, the enrichment observed with PrA-Cas9/gRNA in galactose-containing media is greater than an order of magnitude higher relative to a TAL targeted to this region of chromatin.

To determine if enrichment using CRISPR-ChAP was specific, a series of potential off-target sites were analyzed (FIG. 10C). The four most similar sites in the genome to the first 12 base-pairs of the 20 base-pairs targeted at GAL1 by gRNA-GAL1 were analyzed by qPCR-ChIP for PrA-Cas9/gRNA binding. The first 12 base-pairs of the 20 base-pair target sequence strongly influence gRNA-directed binding specificity (Fu et al., 2013). The off-target (OT) sites contained 14/20 (OT1), 15/20 (OT2), 15/20 (OT3) and 13/20 (OT4) of sequence identity relative to the GAL1 target DNA. Two of the four off-target sites showed 3.2- and 4.4-fold (OT1 & OT2) enrichment with PrA-Cas9/gRNA (FIG. 10C). For most effective targeting of Cas9 to a genomic region, the 20 base-pair target region needs to contain a protospacer-activation motif (PAM motif) immediately 3′ to the target DNA. In the type II S. pyogenes system used in this work, the PAM motif is NGG (Mali et al., 2013; DiCarlo et al., 2013). Accordingly, OT1 and OT2 that showed Cas9/gRNA enrichment contained a PAM motif, while OT3 and OT4 did not. This demonstrated that off-target binding of the PrA-Cas9/gRNA complex targeting GAL1 is enhanced with a PAM motif and can provide ˜4-fold off-target enrichment. This ˜4-fold off-target enrichment is much lower than the 70-fold enrichment observed for transcriptionally active GAL1 promoter chromatin and will not complicate large scale proteomic approaches as the specifically bound proteins/PTMs will dominate the mass spectrometric data collection. The enrichment of GAL1 promoter chromatin under glucose growth conditions was 4.9-fold whereas off-target binding can contribute up to ˜4-fold enrichments. Therefore, purification of GAL1 promoter chromatin under glucose growth conditions was not pursued for large scale proteomic analysis, but rather the 70-fold enriched chromatin from galactose growth conditions was used for subsequent proteomic studies. The Cas9/gRNA and previously reported TAL results illustrate that DNA-binding affinity reagents may differentially access chromatin in different states; thus, care has to be taken to test for specific enrichment prior to proteomic studies (Byrum et al., 2013). As the CRISPR-based approaches become more engineered for DNA-binding specificity, off-target issues will have less impact on the CRISPR-ChAP-MS approach (Jiang et al., 2013).

To demonstrate the utility of the CRISPR-ChAP-MS approach, the GAL1 promoter chromatin was enriched from 1×10¹⁰ cells that were grown in media containing galactose. As a control for quantitative mass spectrometric identification of proteins as “specific” or “non-specific” to the purification, CRISPR-ChAP-MS was performed with PrA-Cas9 expressing cells either with or without gRNA-GAL1. Of particular importance for purification of small regions of chromatin, an experimentally-determined amount of formaldehyde cross-linking and sonication must be used to ensure that a native chromatin region can be isolated and analyzed (Byrum et al., 2013; Byrum et al., 2012b; Byrum et al., 2011a). Cells were cross-linked with 1.25% formaldehyde, lysed under cryogenic conditions with a ball mill, and after thawing were sonicated in purification buffer to yield chromatin fragments ˜1 kb in length. Dynabeads coated with IgG were used to affinity purify the PrA-Cas9/gRNA complex or control PrA-Cas9 with any associated proteins and posttranslationally modified histones. Isolated proteins were resolved by SDS-PAGE (FIG. 11A), excised from the entire gel lane in 2 mm bands and subjected to in-gel trypsin digestion. Tryptic peptides were analyzed by high resolution mass spectrometry with a Thermo Velos Orbitrap mass spectrometer as reported (Byrum et al., 2013). Proteins and histone PTMs (acetylation and mono-, di- and trimethylation of lysine) were identified with Mascot (Tables 9 & 10).

To determine which proteins were specifically enriched with the GAL1 promoter chromatin, a quantitative mass spectrometric approach was used to compare proteins identified with PrA-Cas9/gRNA and PrA-Cas9 alone. This reported approach uses normalized spectral abundance factors to represent the relative level of each protein in each sample, which can then be cross-compared to identify those proteins/PTMs enriched with PrA-Cas9/gRNA (Byrum et al., 2013; Zybailov et al., 2006; Byrum et al., 2013b). Using this approach, 86 out of 1832 identified proteins were found to enrich with PrA-Cas9/gRNA (Table 9). 11 of the 86 proteins were related to transcription (Rebl, Spt5, Toa2, Bafl, Sin3, H2B2, Ume1, Pob3, Rsc6, Rpa14, Rsc7), while the other 75 were common contaminants found in affinity enrichments (Byrum et al., 2013; Byrum et al. 2012b). In addition to proteins, acetylation of lysine 14 on histone H3 (H3K14) and H3K23 were found enriched with the GAL1 promoter chromatin (Table 10). Both H3K14ac and H3K23ac are correlated to active transcriptional states of chromatin. ChIP for a subset of these proteins/PTMs (Spt5, Pob3, Rsc6, Rsc7 and H3K14ac) was used to verify that these proteins/PTMs are components of the epiproteome at the targeted region of GAL1 promoter chromatin (FIG. 11B). H3K14ac was identified at the GAL1 promoter region with our first and second generation ChAP technologies (Byrum et al., 2013; Byrum et al. 2012b), while Pob3, Spt5, Rsc6 and Rsc7 are unique to this study. Pob3 forms a complex with Spt16 to make yFACT, which promotes chromatin rearrangement to allow progression of RNA polymerase. Spt16 was identified with our first and second generation ChAP technologies at GAL1 (Byrum et al., 2013; Byrum et al. 2012b); thus, providing compelling evidence that yFACT is localized to this chromatin region during transcriptional activation. Spt5 is an elongation factor that aids RNA polymerase II, while the RSC complex of proteins serves as a chromatin remodeler that is involved with transcription. Taken together our results present a snapshot of the dynamics of transcriptional activation within a 1 kb viewing window at the GAL1 promoter chromatin. This analysis demonstrates that the CRISPR-ChAP-MS approach can be used to identify a local epiproteome.

The CRISPR-ChAP-MS approach provides a new tool to study epigenetic regulation. Researchers can now identify proteins and histone PTMs at 1 kb resolution using proteomic approaches that do not depend on a priori knowledge of the protein/PTM target, which distinguishes this method from traditional ChIP. Key to success with chromatin enrichment procedures is the quantitative mass spectrometry used to determine which identified proteins/PTMs are “specific” to the isolated chromatin. These mass spectrometric approaches can be label-free, as used here and in our TAL-based second generation ChAP methodology (Byrum et al., 2013), or utilize an isotopically heavy label, as used in our LexA-based first generation methodology (Byrum et al. 2012b). Relative to the TAL-based and LexA-based ChAP methodology, our PrA-Cas9/gRNA approach showed greatly enhanced enrichment of targeted chromatin, which is instrumental for analyzing low copy cellular entities like specific chromatin sections. Furthermore, the Cas9/gRNA system is easily manipulated by simply altering the gRNA sequence, which provides for adaptability and multiplexing approaches. Recent and future efforts to further engineer the specificity of the Cas9/gRNA system will only expand the capabilities of the CRISPR-ChAP-MS approach (Jiang et al., 2013). This technology is immediately applicable to cell culture and in vivo systems that provide for expression of the Cas9/gRNA machinery. The CRISPR-ChAP-MS approach suggests far-reaching applicability for identifying molecular components driving chromosomal activities.

Methods for Example 6

Cloning, Western-Blotting, Real-Time Reverse Transcription PCR and Chromatin Immunoprecipitation (ChIP)

Cas9 was subcloned from Addgene plasmid 44246 (www.addgene.org/CRISPR/; Cross Lab) into pPrA-LexA (TRP1 selection) (Byrum et al. 2012b)—fusing Cas9 with a PrA (Protein A) tag to make pPrA-Cas9. Addgene plasmid 43803 (www.addgene.org/CRISPR/; Cross Lab) was used to express the gRNA (URA3 selection). The gRNA sequence in the plasmid was mutated in two steps using a Stratagene site-directed mutagenesis kit to produce the following sequence matching 20 base-pairs in the GAL1 promoter region:

(SEQ ID NO: 372)
5′ATTTGAAGGTTTGTGGGGCC.

Three S. cerevisiae strains (W303 matA) were created by transforming the resulting plasmids: pgRNA-GAL1, pPrA-Cas9, and pPrA-Cas9+pgRNA-GAL1. Western-blotting, real-time reverse transcription PCR and chromatin immunoprecipation (ChIP) were as described (Byrum et al. 2013; Byrum et al., 2012b). Off-target sites used in FIG. 10C were:

(SEQ ID NO: 373)
OT1 5′ATGAAAAAATTAGTGGGGCC,
(SEQ ID NO: 374)
OT2 5′ATACGTAGTCTTGTGGGGCC,
(SEQ ID NO: 375)
OT3 5′TACGGAAGGTTGGTGGGGCC,
(SEQ ID NO: 376)
OT4 5′TATGTCGCGTTTGTGGGGCC.

CRISPR-ChAP-MS.

S. cerevisiae with pPrA-Cas9 or pPrA-Cas9+gRNA-GAL1 were grown to mid-log phase in synthetic yeast media (minus tryptophan and minus tryptophan/uracil respectively) with 3% galactose and subjected to 1.25% formaldehyde cross-linking for 6 minutes. Cross-linking was quenched with 125 mM glycine for 5 minutes. Cells were collected by centrifugation and lysed under cryogenic conditions (Byrum et al., 2012b). Lysate from 10¹⁰ cells was re-suspended in purification buffer (25 mM HEPES-KOH, 0.5 mM EGTA, 1 mM EDTA, 10% glycerol, 0.02% NP-40, 150 mM KCl, 1× Sigma fungal protease inhibitor cocktail, 4 μg/mL Pepstatin A, 2 mM PMSF) at 5 mL/gram cell lysate. Re-suspended cell lysate was subjected to sonication with a Bioruptor to shear chromatin to ˜1 kb in size as described (Byrum et al. 2013; Byrum et al. 2012b). PrA-tagged Cas9/gRNA complex and associated proteins were affinity purified on 144 mg of IgG-coated Dynabeads (Byrum et al. 2013; Byrum et al. 2012b). IgG-coated beads were incubated with lysate for 7 hr at 4° C. with constant agitation. Beads were collected with magnets and washed twice in purification buffer, once with purification buffer with 1 M NaCl/1 M urea, and once in purification buffer. Proteins were eluted from the washed beads with 0.5 N ammonium hydroxide/0.5 mM EDTA for 5 minutes at room temperature. Eluted proteins were lyophilized, re-suspended in Laemmli loading buffer, resolved by 4-20% gradient SDS-PAGE, and visualized by colloidal Coomassie-staining. Gel lanes were sliced into 2 mm sections and subjected to in-gel trypsin digestion (Byrum et al. 2012b). Tryptic peptides were analyzed by high resolution tandem mass spectrometry with a Thermo Velos Orbitrap mass spectrometer coupled to a Waters nanoACQUITY LC system (Byrum et al. 2013; Byrum et al. 2012b). Proteins and histone PTMs (lysine acetylation and methylation) were identified with Mascot (Tables 9 & 10). To determine if a protein was “specific” or “non-specific” to the purification, a previously reported quantitative mass spectrometry approach was utilized (Byrum et al. 2013). In brief, a normalized spectral abundance factor (NSAF) value was calculated for each protein in the PrA-Cas9 and PrA-Cas9/gRNA purifications. The NSAF value is the number of spectral counts assigned to a given protein (normalized by the molecular weight of that protein) divided by the sum of all normalized spectral counts of all proteins identified in the specific purification (Zybailov et al., 2006). A fold-change of normalized NSAF values was then used to identify proteins specific to the PrA-Cas9/gRNA purification (Table 9).

References for Examples 1-6

• 1. Agelopoulos, M., McKay, D. J., and Mann, R. S. (2012). Developmental regulation of chromatin conformation by Hox proteins in Drosophila. Cell Rep. 1, 350-359.
• 2. Akiyoshi, B., Nelson, C. R., Ranish, J. A., and Biggins, S. (2009). Quantitative proteomic analysis of purified yeast kinetochores identifies a PP1 regulatory subunit. Genes Dev. 23, 2887-2899.
• 3. Barski, A., Cuddapah, S., Cui, K., Roh, T. Y., Schones, D. E., Wang, Z., Wei, G., Chepelev, I., and Zhao, K. (2007). High-resolution profiling of histone methylations in the human genome. Cell 129, 823-837.
• 4. Bock, I., Dhayalan, A., Kudithipudi, S., Brandt, O., Rathert, P., and Jeltsch, A. (2011). Detailed specificity analysis of antibodies binding to modified histone tails with peptide arrays. Epigenetics 6, 256-263.
• 5. Boffa, L. C., Carpaneto, E. M., and Allfrey, V. G. (1995). Isolation of active genes containing CAG repeats by DNA strand invasion by a peptide nucleic acid. Proc. Natl. Acad. Sci. USA 92, 1901-1905.
• 6. Byrum, S. D., Taverna, S. D., and Tackett, A. J. (2011a). Quantitative analysis of histone exchange for transcriptionally active chromatin. J. Clin. Bioinforma 1, 17.
• 7. Byrum, S., Mackintosh, S. G., Edmondson, R. D., Cheung, W. L., Taverna, S. D., and Tackett, A. J. (2011 b). Analysis of histone exchange during chromatin purification. J Integr OMICS 1, 61-65.
• 8. Byrum, S., Avaritt, N. L., Mackintosh, S. G., Munkberg, J. M., Badgwell, B. D., Cheung, W. L. and Tackett, A. J. (2011c) A quantitative proteomic analysis of FFPE melanoma. J. Culan. Pathol., 38, 933-936.
• 9. Byrum, S., Smart, S. K., Larson, S., and Tackett, A. J. (2012a). Analysis of stable and transient protein-protein interactions. Methods Mol. Biol. 833, 143-152.
• 10. Byrum, S., Raman, A., Taverna, S. D. and Tackett, A. J. (2012b) ChAP-MS: a method for identification of proteins and histone posttranslational modifications at a single genomic locus. Cell Rep., 2, 198-205.
• 11. Byrum, S. D., Taverna, S. D. & Tackett, A. J. Purification of a specific native genomic locus for proteomic analysis. Nucleic Acids Res 41, 1-6 doi:10.1093/nar/gkt822 (2013a).
• 12. Byrum, S. D., Larson, S. K., Avaritt, N. L., Moreland, L. E., Mackintosh, S. G., Cheung, W. & Tackett, A. J. Quantitative Proteomics Identifies Activation of Hallmark Pathways of Cancer in Patient Melanoma. J Proteomics Bioinform 6, 43-50 (2013b).
• 13. Cermak, T., Doyle, E. L., Christian, M., Wang, L., Zhang, Y., Schmidt, D., Baller, J. A., Bogdanove, A. J. and Voytas, D. F. (2011) Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Nucleic Acids Res., 39, e82.
• 14. Chait, B. T. (2011) Mass spectrometry in the Postgenomic Era. Anna. Rev. Bioche., 80, 239-246.
• 15. Chi, P., Allis, C. D., and Wang, G. G. (2010). Covalent histone modifications—miswritten, misinterpreted and mis-erased in human cancers. Nat. Rev. Cancer 10, 457-469.
• 16. Dai, B. & Rasmussen, T. P. Global epiproteomic signatures distinguish embryonic stem cells from differentiated cells. Stern Cells 25, 2567-2574 (2007).
• 17. Dedon, P. C., Soults, J. A., Allis, C. D., and Gorovsky, M. A. (1991). Formaldehyde cross-linking and immunoprecipitation demonstrate developmental changes in H1 association with transcriptionally active genes. Mol. Cell. Biol. 11, 1729-1733.
• 18. Déjardin, J., and Kingston, R. E. (2009). Purification of proteins associated with specific genomic loci. Cell 136, 175-186.
• 19. DiCarlo J. E., Norville, J. E., Mali, P., Rios, X., Aach, J. & Church, G. M. Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res 41, 4336-4343 (2013).
• 20. Doyle, E. L., Booher, N. J., Standage, D. S., Voytas, D. F., Brendel, V. P., Vandyk, J. K. and Bogdanove, A. J. (2012) TAL Effector-Nucleotide Targeter (TALE-NT) 2.0: tools for TAL effector design and target prediction. Nucleic-Acids Res., 40, 117-122.
• 21. Fu, Y. et al., High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol 31, 822-826 (2013).
• 22. Fujita, T. & Fujii, H. Efficient isolation of specific genomic regions and identification of associated proteins by engineered DNA-binding molecule-mediated chromatin immunoprecipitation (enChIP) using CRISPR. Biochem Biophys Res Commun 439, 132136 (2013).
• 23. Geissler, R., Scholze, H., Hahn, S., Streubel, J., Bonas, U., Behrens, S. E. and Boch, J. (2011) Transcriptional activators of human genes with programmable DNA-specificity. PLoS One, 6, e19509.
• 24. Griesenbeck, J., Boeger, H., Strattan, J. S., and Kornberg, R. D. (2003). Affinity purification of specific chromatin segments from chromosomal loci in yeast. Mol. Cell. Biol. 23, 9275-9282.
• 25. Hamperl, S. et al., Compositional and structural analysis of selected chromosomal domains from Saccharomyces cerevisiae. Nucleic Acids Res 42, doi: 10.1093/narigkt891 (2014).
• 26. Ho, L., and Crabtree, G. R. (2010). Chromatin remodelling during development. Nature 463, 474-484.
• 27. Hoshino, A. and Fujii, H. (2009) Insertional chromatin immunoprecipitation: a method for isolating specific genomic regions. J. Biosci. Bioeng., 108, 446-449.
• 28. Houseley, J., Rubbi, L., Grunstein, M., Tollervey, D., and Vogelauer, M. (2008). A ncRNA modulates histone modification and mRNA induction in the yeast GAL gene cluster. Mol. Cell 32, 685-695.
• 29. Jiang, W., Bikard, D., Cox, D., Zhang, F. & Marraffini, L. A. RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nat Biotechnol 31, 233-239 (2013).
• 30. Johnson, D. S., Mortazavi, A., Myers, R. M., and Wold, B. (2007). Genome-wide mapping of in vivo protein-DNA interactions. Science 316, 1497-1502.
• 31. Jones, P. A., and Baylin, S. B. (2007). The epigenomics of cancer. Cell 128, 683-692.
• 32. Kouzarides, T. (2007) Chromatin modifications and their function. Cell, 128, 693-705.
• 33. Mali, P., Esvelt, K. M. & Church, G. M. Cas9 as a versatile tool for engineering biology. Nat Methods 10, 957-963 (2013).
• 34. Martin, G. R. (1981). Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc. Natl. Acad. Sci. USA 78, 7634-7638.
• 35. Mikkelsen, T. S., Ku, M., Jaffe, D. B., Issac, B., Lieberman, E., Giannoukos, G., Alvarez, P., Brockman, W., Kim, T. K., Koche, R. P., et al. (2007). Genome-wide maps of chromatin state in pluripotent and lineage-committed cells. Nature 448, 553-560.
• 36. Miller, J. C., Tan, S., Qiao, G., Barlow, K. A., Wang, J., Xia, D. F., Meng, X., Paschon, D. E., Leung, E., Hinkley, S. J. et al. (2011) A TALE nuclease architecture for efficient genome editing. Not. Biotech., 29, 143-148.
• 37. Platt, A., and Reece, R. J. (1998). The yeast galactose genetic switch is mediated by the formation of a Gal4p-Gal80p-Gal3p complex. EMBO J. 17, 4086-4091.
• 38. Pokholok, D. K., Harbison, C. T., Levine, S., Cole, M., Hannett, N. M., Lee, T. I., Bell, G. W., Walker, K., Rolfe, P. A., Herbolsheimer, E., et al. (2005). Genomewide map of nucleosome acetylation and methylation in yeast. Cell 122, 517-527.
• 39. Ren, B., Robert, F., Wyrick, J. J., Aparicio, O., Jennings, E. G., Simon, I., Zeitlinger, J., Schreiber, J., Hannett, N., Kanin, E., et al. (2000). Genome-wide location and function of DNA binding proteins. Science 290, 2306-2309.
• 40. Robertson, G., Hirst, M., Bainbridge, M., Bilenky, M., Zhao, Y., Zeng, T., Euskirchen, G., Bernier, B., Varhol, R., Delaney, A., et al. (2007). Genome-wide profiles of STAT1 DNA association using chromatin immunoprecipitation and massively parallel sequencing. Nat. Methods 4, 651-657.
• 41. Rossant, J. (2008). Stem cells and early lineage development. Cell 132, 527-531.
• 42. Scholze, H. and Boch, J. (2010) TAL effector-DNA specificity. Virulence, 1, 428-432.
• 43. Scholze, H. and Boch, J. (2011) TAL effectors are remote controls for gene activation. Curr. Opin. Microbiol., 14, 47-53.
• 44. Shukla, A., Bajwa, P., and Bhaumik, S. R. (2006). SAGA-associated Sgf73p facilitates formation of the preinitiation complex assembly at the promoters either in a HAT-dependent or independent manner in vivo. Nucleic Acids Res. 34, 6225-6232.
• 45. Smart, S. K., Mackintosh, S. G., Edmondson, R. D., Taverna, S. D., and Tackett, A. J. (2009). Mapping the local protein interactome of the NuA3 histone acetyltransferase. Protein Sci. 18, 1987-1997.
• 46. Tackett, A. J., DeGrasse, J. A., Sekedat, M. D., Oeffinger, M., Rout, M. P., and Chait, B. T. (2005a). I-DIRT, a general method for distinguishing between specific and nonspecific protein interactions. J. Proteome Res. 4, 1752-1756.
• 47. Tackett, A. J., Dilworth, D. J., Davey, M. J., O'Donnell, M., Aitchison, J. D., Rout, M. P., and Chait, B. T. (2005b). Proteomic and genomic characterization of chromatin complexes at a boundary. J. Cell Biol. 169, 35-47.
• 48. Taverna, S. D., Ilin, S., Rogers, R. S., Tanny, J. C., Lavender, H., Li, H., Baker, L., Boyle, J., Blair, L. P., Chait, B. T., et al. (2006). Yng1 PHD finger binding to histone H3 trimethylated at lysine 4 promotes NuA3 HAT activity at lysine 14 of H3 and transcription at a subset of targeted ORFs. Mol. Cell 24, 785-796.
• 49. Taverna, S. D., Ueberheide, B. M., Liu, Y., Tackett, A. J., Diaz, R. L., Shabanowitz, J., Chait, B. T., Hunt, D. F., and Allis, C. D. (2007). Long-distance combinatorial linkage between methylation and acetylation on histone H3 N termini. Proc. Natl. Acad. Sci. USA 104, 2086-2091.
• 50. Unnikrishnan, A., Gafken, P. R., and Tsukiyama, T. (2010). Dynamic changes in histone acetylation regulate origins of DNA replication. Nat. Struct. Mol. Biol. 17, 430-437.
• 51. Zybailov, B., Mosley, A. L., Sardiu, M. E., Coleman, M. K., Florens, L. and Washburn, M. P. (2006) Statistical analysis of membrane proteome expression changes in Saccharomyces cerevisiae. J. Proteome Res., 5, 2339-2347.

TABLE 1
Proteins identified by Mascot Distiller from ChAP-MS analysis of GAL1 chromatin
isolated from cells grown in glucose.
Mascot Distiller Quantitation Report
Mascot search results:
Glucose
	Log ratio versus	Log ratio versus
	Intensity (all	Intensity (selected
	positive ratios)	ratios)
L/	0 1.00e+7 2.00e+7	0 5.00e+6 1.00e+7
(L +	3.00e+7 4.00e+7	1.50e+7 2.00e+7 −4 −3
H)	−15 −10 −5 0 5	−2 −1 0 1
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
1	P00925	1180	46885	0.5797	1.009	7
ENO2_YEAST Enolase 2 OS = Saccharomyces cerevisiae GN = ENO2 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	ANLDVKDQK		0.8222	0.03008	0.05098	0.4849	14020.00
2	3	YDLDFKNPESDK		0.4886	0.04889	0.1516	0.7	2.59E+05
3	2	YDLDFKNPESDK	X	0.5785	0.01343	0.2062	0.9094	1.62E+05
4	2	AVDDFLLSLDGTANK	X	0.5762	0.001	0.2292	0.9942	1.02E+07
5	3	AVDDFLLSLDGTANK	X	0.5799	0.00158	0.6342	0.9975	8.26E+05
6	2	DGKYDLDFKNPESDK	X	0.5622	0.00842	0.1735	0.989	1.71E+05
7	2	GVMNAVNNVNNVIAAAFVK		0.7536	0.05322	0.594	0.4909	2.12E+05
8	3	YPIVSIEDPFAEDDWEAWSHF	X	0.5768	0	0.8459	0.9995	2.58E+06
		FK
9	3	RYPIVSIEDPFAEDDWEAWSH	X	0.5641	0.0183	0.5271	0.9778	1.27E+05
		FFK
10	3	YGASAGNVGDEGGVAPNIQTA	X	0.5825	0	0.9229	0.9993	1.78E+07
		EEALDLIVDAIK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
2	P00924	1117	46773	0.5798	1.008	5
ENO1_YEAST Enolase 1 OS = Saccharomyces cerevisiae GN = ENO1 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	ANIDVKDQK		0.8222	0.03008	0.05098	0.4849	1.40E+04
2	2	AVDDFLISLDGTANK	X	0.5762	0.001	0.2292	0.9942	1.02E+07
3	3	AVDDFLISLDGTANK	X	0.5799	0.00158	0.6342	0.9975	8.26E+05
4	3	IEEELGDNAVFAGENFHHGDK	X	0.6064	0.00518	0.5017	0.978	3.82E+05
		L
5	3	YPIVSIEDPFAEDDWEAWSHF	X	0.5768	0	0.8459	0.9995	2.58E+06
		FK
6	3	RYPIVSIEDPFAEDDWEAWSH	X	0.5641	0.0183	0.5271	0.9778	1.27E+05
		FFK
7	3	YGASAGNVGDEGGVAPNIQTA	X	0.5825	0	0.9229	0.9993	1.78E+07
		EEALDLIVDAIK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
3	P10592	565	69844	0.5495		10
H5P72_YEAST Heat shock protein SSA2 OS = Saccharomyces cerevisiae GN = SSA2 PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	ITITNDKGR	X	0.9873	0.0152	0.06237	0.9611	4.21E+04
2	2	NFNDPEVQGDMK	X	0.554	0.0076	0.3809	0.9603	8.52E+05
3	2	FKEEDEKESQR	X	0.5702	0.0088	0.0696	0.9865	9.27E+04
4	2	NFTPEQISSMVLGK	X	0.5605	0.00872	0.1288	0.9508	5.66E+05
5	2	LIDVDGKPQIQVEFK	X	0.5488	0.00255	0.256	0.9909	4.00E+05
6	3	LIDVDGKPQIQVEFK	X	0.5555	0.00158	0.624	0.9945	2.37E+06
7	3	IINEPTAAAIAYGLDKK	X	0.5399	0.00584	0.05784	0.938	3.22E+05
8	3	LDKSQVDEIVLVGGSTR	X	0.528	0.02077	0.3666	0.7616	7.53E+05
9	3	NTISEAGDKLEQADKDAVTK	X	0.5444	0.00255	0.3405	0.9868	2.60E+06
10	3	TQDLLLLDVAPLSLGIETAGGV	X	0.5041	0.07248	0.196	0.9741	1.75E+05
		MTK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
4	P06169	555	61737	0.5581	1.008	5
PDC1_YEAST Pyruvate decarboxylase isozyme 1 OS = Saccharomyces cerevisiae GN = PDC1 PE = 1
SV = 7
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	NATFPGVQMK	X	0.5499	0.00466	0.3978	0.9842	1.13E+06
2	3	VATTGEWDKLTQDK	X	0.5476	0.00455	0.265	0.9899	1.17E+06
3	3	LLQTPIDMSLKPNDAESEK	X	0.5635	0.00264	0.4617	0.9956	2.39E+05
4	2	MIEIMLPVFDAPQNLVEQAK	X	0.5603	0.0038	0.7877	0.9907	7.07E+06
5	3	LLQTPIDMSLKPNDAESEKEVI	X	0.56	0.00158	0.5686	0.9967	2.71E+06
		DTILALVK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
5	P10591	551	70039	0.5549		9
H5P71_YEAST Heat shock protein SSA1 OS = Saccharomyces cerevisiae GN = SSA1 PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	ITITNDKGR	X	0.9873	0.0152	0.06237	0.9611	4.21E+04
2	2	NFNDPEVQADMK	X	0.595	0.00755	0.1662	0.9451	4.27E+05
3	2	FKEEDEKESQR	X	0.5702	0.0088	0.0696	0.9865	9.27E+04
4	2	NFTPEQISSMVLGK	X	0.5605	0.00872	0.1288	0.9508	5.66E+05
5	2	LIDVDGKPQIQVEFK	X	0.5488	0.00255	0.256	0.9909	4.00E+05
6	3	LIDVDGKPQIQVEFK	X	0.5555	0.00158	0.624	0.9945	2.37E+06
7	3	IINEPTAAAIAYGLDKK	X	0.5399	0.00584	0.05784	0.938	3.22E+05
8	3	LDKSQVDEIVLVGGSTR	X	0.528	0.02077	0.3666	0.7616	7.53E+05
9	3	TQDLLLLDVAPLSLGIETAGGV	X	0.5041	0.07248	0.196	0.9741	1.75E+05
		MTK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
6	P15108	548	80850	0.4277		10
HSC82_YEAST ATP-dependent molecular chaperone HSC82 OS = Saccharomyces cerevisiae
GN = H5C82 PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	SPFLDALK	X	0.594	0.00899	0.5359	0.9605	4.97E+05
2	3	ALKDILGDQVEK	X	0.5513	0.02217	0.189	0.9214	5.90E+04
3	3	VKEEVQELEELNK	X	0.5794	0.01043	0.07342	0.9201	7.47E+04
4	2	LEEVDEEEEEKKPK		0.1049	999	0.1111	0.1643	2.69E+04
5	2	LFLKDDQLEYLEEK	X	0.5684	0.02513	0.191	0.9399	5.88E+05
6	3	LFLKDDQLEYLEEKR	X	0.4997	0.04689	0.1356	0.8192	3.36E+05
7	3	TLVDITKDFELEETDEEK	X	0.4212	0.04847	0.09843	0.7318	2.17E+05
8	2	VFITDEAEDLIPEWLSFVK	X	0.5569	0.00991	0.227	0.9585	1.35E+06
9	3	VFITDEAEDLIPEWLSFVK	X	0.5764	0.00772	0.5192	0.9965	3.80E+05
10	3	RVFITDEAEDLIPEWLSFVK	X	0.5766	0.02142	0.2893	0.9293	1.19E+05
11	3	TLVDITKDFELEETDEEKAER	X	0.216	0.1336	0.2606	0.801	1.35E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
7	P00560	506	44711	0.5584		4
PGK_YEAST Phosphoglycerate kinase OS = Saccharomyces cerevisiae GN = PGK1 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	VDFNVPLDGKK	X	0.3003	0.01134	0.1059	0.8842	3.08E+05
2	2	VLENTEIGDSIFDK		0.9928	0.00158	0.8106	0.3129	3.18E+07
3	2	SSAAGNTVIIGGGDTATVAK	X	0.577	0.00158	0.6503	0.9976	1.77E+06
4	3	GVEVVLPVDFIIADAFSADANT	X	0.6021	0.00634	0.4734	0.9828	1.32E+06
		K
5	2	GVEVVLPVDFIIADAFSADANT	X	0.5722	0.00525	0.5529	0.9973	1.42E+06
		K
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
8	P00359	492	35724	0.5592	1.017	5
G3P3_YEAST Glyceraldehyde-3-phosphate dehydrogenase 3 OS = Saccharomyces cerevisiae
GN = TDH3 PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	ELDTAQK	X	0.5482	0.00832	0.1767	0.9264	2.25E+04
2	2	VVDLVEHVAK	X	0.5557	0.001	0.6963	0.9976	2.33E+06
3	2	YAGEVSHDDK		0.7269	0.01789	0.2422	0.6988	8.10E+04
4	2	TASGNIIPSSTGAAK	X	0.5621	0.00158	0.7985	0.9966	9.13E+06
5	3	VPTVDVSVVDLTVK	X	0.5299	0.00836	0.3828	0.9782	2.33E+05
6	3	YAGEVSHDDKHIIVDGK		0.4138	0.03022	0.1569	0.4338	1.27E+06
7	2	YAGEVSHDDKHIIVDGK		0.4604	0.01421	0.386	0.4585	4.81E+05
8	2	DPANLPWGSSNVDIAIDSTGV	X	0.5497	0.00466	0.5417	0.9953	1.10E+06
		FK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
9	P00950	289	27592	0.5753	1.028	4
PMG1_YEAST Phosphoglycerate mutase 1 OS = Saccharomyces cerevisiae GN = GPM1 PE = 1
SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	KVYPDVLYTSK	X	0.6133	0.00839	0.05839	0.9039	9.79E+04
2	2	LLPYWQDVIAK	X	0.5686	0.001	0.6124	0.9984	3.23E+06
3	2	SFDVPPPPIDASSPFSQK	X	0.579	0.00467	0.7461	0.9747	5.95E+06
4	3	RSFDVPPPPIDASSPFSQK	X	0.5607	0.0055	0.1214	0.9811	2.74E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
10	P00942	273	26779	0.8938	1.241	4
TPIS_YEAST Triosephosphate isomerase OS = Saccharomyces cerevisiae GN = TPI1 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	KPQVTVGAQNAYLK	X	1	0	0.6505	0.7407	2.01E+06
2	2	ASGAFTGENSVDQIK	X	0.8721	0.00784	0.8579	0.9988	1.90E+06
3	3	SYFHEDDKFIADK	X	0.5635	0.00564	0.2565	0.9791	2.28E+05
4	2	ASGAFTGENSVDQIKDVGAK	X	0.5037	0.05902	0.5738	0.8696	1.28E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
11	P23254	258	74104	0.5924	1.089	4
TKT1_YEAST Transketolase 1 OS = Saccharomyces cerevisiae GN = TKL1 PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	LFSEYQK		0.7783	0.02398	0.136	0.6468	1.69E+05
2	2	ILAVDTVSK	X	0.6661	0.02039	0.1191	0.8514	6.18E+05
3	3	KFPELGAELAR	X	0.4889	0.01828	0.08146	0.9458	3.41E+04
4	2	LSGQLPANWESK		0.9991	0.00158	0.5921	0.6509	1.69E+06
5	2	VVSLPDFFTFDK	X	0.5277	0.01746	0.3974	0.82	4.93E+05
6	2	QNLPQLEGSSIESASK	X	0.5395	0.00842	0.1282	0.9767	9.63E+04
7	2	SFVVPQEVYDHYQK		0.4152	0.04681	0.3912	0.41	1.50E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
12	P34760	251	21688	0.5583		1
TSA1_YEAST Peroxiredoxin TSAI OS = Saccharomyces cerevisiae GN = TSA1 PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	TAVVDGVFDEVSLDK	X	0.5583	0.01341	0.4102	0.9415	7.29E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
13	P02994	242	50001	0.5996		5
EF1A_YEAST Elongation factor 1-alpha OS = Saccharomyces cerevisiae GN = TEF1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	FQEIVK	X	0.9909	0.00329	0.1232	0.9948	5.97E+05
2	2	LPLQDVYK	X	0.5266	0.002	0.5985	0.9845	4.55E+06
3	3	SHINVVVIGHVDSGK	X	0.5427	0.01093	0.07069	0.9813	4.33E+04
4	3	TLLEAIDAIEQPSRPTDKPLR	X	0.6222	0.01	0.3809	0.7963	1.58E+07
5	3	SVEMHHEQLEQGVPGDNVGF	X	0.5271	0.00255	0.8205	0.9972	2.24E+06
		NVK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
14	P11484	235	66937	0.5697	1.042	3
HSP75_YEAST Heat shock protein SSB1 OS = Saccharomyces cerevisiae GN = SSB1 PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	LLSDFFDGK	X	0.5313	0.004	0.3939	0.9936	1.18E+06
2	2	VIDVDGNPVIEVQYLEETK	X	0.5573	0.03139	0.2885	0.9312	2.81E+05
3	3	STSGNTHLGGQDFDTNLLEHF	X	0.6018	0.01912	0.5754	0.975	1.64E+06
		K
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
15	P16521	220	115920	0.4751	1.086	3
EF3A_YEAST Elongation factor 3A OS = Saccharomyces cerevisiae GN = YEF3 PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	QINENDAEAMNK	X	0.502	0.03789	0.1931	0.9204	1.87E+05
2	2	ATETVDNKDIER	X	0.5572	0.01016	0.3336	0.9535	2.92E+05
3	2	LVEDPQVIAPFLGK	X	0.4314	0.01731	0.1193	0.9722	5.89E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
16	P14540	217	39812	0.5455	1.017	4
ALF_YEAST Fructose-bisphosphate aldolase OS = Saccharomyces cerevisiae GN = FBA1 PE = 1
SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	LLPWFDGMLEADEAYFK	X	0.5387	0.01791	0.6343	0.9901	2.73E+06
2	3	LLPWFDGMLEADEAYFK	X	0.5693	0.00324	0.7442	0.9942	4.58E+05
3	2	KLLPWFDGMLEADEAYFK	X	0.5497	0.02627	0.3049	0.8469	4.81E+04
4	3	KLLPWFDGMLEADEAYFK	X	0.5579	0.00588	0.6699	0.9919	6.41E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
17	P05750	214	26630	0.5144		1
RS3_YEAST 40S ribosomal protein S3 OS = Saccharomyces cerevisiae GN = RPS3 PE = 1 SV = 5
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	ALPDAVTIIEPKEEEPILAPSVK	X	0.5144	0.00787	0.0782	0.9853	1.22E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
18	P38788	196	58515	0.5268	1.003	2
SSZ1_YEAST Ribosome-associated complex subunit SSZ1 OS = Saccharomyces cerevisiae
GN = SSZ1 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	EAVLTVPTNFSEEQK	X	0.5251	0.00574	0.2728	0.9966	3.66E+05
2	3	LISDYDADELAEALQPVIVNTP	X	0.5276	0.00557	0.6012	0.9986	7.77E+05
		HLK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
19	P40150	195	66930	0.5697	1.042	3
HSP76_YEAST Heat shock protein SSB2 OS = Saccharomyces cerevisiae GN = SSB2 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	LLSDFFDGK	X	0.5313	0.004	0.3939	0.9936	1.18E+06
2	2	VIDVDGNPVIEVQYLEETK	X	0.5573	0.03139	0.2885	0.9312	2.81E+05
3	3	STSGNTHLGGQDFDTNLLEHF	X	0.6018	0.01912	0.5754	0.975	1.64E+06
		K
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
20	P32324	189	93719	0.4948	1.141	4
EF2_YEAST Elongation factor 2 OS = Saccharomyces cerevisiae GN = EFT1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	TGTLTTSETAHNMK	X	0.5494	0.05488	0.2574	0.9685	3.09E+04
2	2	ETVESESSQTALSK	X	0.4964	0.00945	0.5999	0.989	1.00E+06
3	3	WTNKDTDAEGKPLER	X	0.4881	0.01896	0.04008	0.9109	1.19E+05
4	2	WTNKDTDAEGKPLER	X	0.383	0.06499	0.03736	0.93	1.87E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
21	P32589	184	77318			0
HSP7F_YEAST Heat shock protein homolog SSE1 OS = Saccharomyces cerevisiae GN = SSE1
PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	QVEDEDHMEVFPAGSSFPSTK		0.6809	0.02791	0.3031	0.3098	9.21E+05
2	3	QSISEAFGKPLSTTLNQDEAIA		0.5365	0.06281	0.4112	0.2745	3.29E+05
		K
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
22	P54115	183	54380	0.6157		1
ALDH6_YEAST Magnesium-activated aldehyde dehydrogenase, cytosolic OS = Saccharomyces
cerevisiae GN = ALD6 PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	SAHLVFDDANIKK	X	0.6157	0.0168	0.06354	0.9683	1.83E+04
2	3	IVKEEIFGPVVTVAK		0.01367	0.6603	0.692	0.03687	2.37E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
23	P00360	179	35728	0.5624	1.059	4
G3P1_YEAST Glyceraldehyde-3-phosphate dehydrogenase 1 OS = Saccharomyces cerevisiae
GN = TDH1 PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	ELDTAQK	X	0.5482	0.00832	0.1767	0.9264	2.25E+04
2	2	TASGNIIPSSTGAAK	X	0.5621	0.00158	0.7985	0.9966	9.13E+06
3	3	VPTVDVSVVDLTVK	X	0.5299	0.00836	0.3828	0.9782	2.33E+05
4	3	IATYQERDPANLPWGSLK	X	0.6109	0.00894	0.4762	0.9875	2.36E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
24	P05694	159	86296	0.5474	1.143	4
METE_YEAST 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase
OS = Saccharomyces cerevisiae GN = MET6 PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	VATSGVANK	X	0.4292	0.05981	0.2367	0.7626	5.78E+05
2	2	ITVDELFK	X	0.7613	0.02167	0.4122	0.9349	3.00E+05
3	2	ALDADVVSIEFSK	X	0.5995	0.00506	0.3617	0.9908	4.15E+05
4	3	APEQFDEVVAAIGNK	X	0.5769	0.02178	0.2145	0.9228	7.39E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
25	P00817	159	32280	0.3148	1.707	2
IPYR_YEAST Inorganic pyrophosphatase OS = Saccharomyces cerevisiae GN = IPP1 PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	LNDIEDVEK	X	0.1915	0.08967	0.192	0.967	2.15E+05
2	3	LEITKEETLNPIIQDTKK		0.5691	0.01513	0.1321	0.6614	3.55E+04
3	3	AVGDNDPIDVLEIGETIAYTGQ	X	0.5565	0.00915	0.5386	0.9951	1.89E+05
		VK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
26	P46655	156	81369	0.4215	1.269	2
SYEC_YEAST Glutamyl-tRNA synthetase, cytoplasmic OS = Saccharomyces cerevisiae GN = GUS1
PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	KNDDGSMVAK	X	0.5902	0.05607	0.0228	0.8152	515.7
2	3	EKEEFQDSILEDLDLLGIK	X	0.4214	0.04183	0.2818	0.7588	6.23E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
27	P09436	156	123651	0.9973		1
SYIC_YEAST Isoleucyl-tRNA synthetase, cytoplasmic OS = Saccharomyces cerevisiae GN = ILS1
PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	MSNIDFQYDDSVK	X	0.9973	0.00158	0.6248	0.961	3.01E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
28	P61864	148	8552	0.8538		1
UBIQ_YEAST Ubiquitin OS = Saccharomyces cerevisiae GN = UBI1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	IQDKEGIPPDQQR	X	0.8538	0.01276	0.1534	0.8756	1.67E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
29	P04456	146	15748	0.5126		1
RL25_YEAST 60S ribosomal protein L25 OS = Saccharomyces cerevisiae GN = RPL25 PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	ELYEVDVLK	X	0.5126	0.00785	0.1734	0.9804	4.97E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
30	P12709	146	61261	0.5947		3
G6PI_YEAST Glucose-6-phosphate isomerase OS = Saccharomyces cerevisiae GN = PGI1 PE = 1
SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	NWFLSK	X	0.5893	0.01445	0.08506	0.8965	1.22E+04
2	2	TFTTAETITNANTAK		0.7863	0.02669	0.2797	0.4859	1.42E+05
3	2	NLVNDEIIAALIELAK	X	0.7445	0.01763	0.05341	0.9308	1.58E+04
4	3	ANKPMYVDGVNVAPEVDSVLK	X	0.5898	0.03119	0.315	0.7014	4.18E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
31	P08524	145	40738	0.5181		1
FPPS_YEAST Farnesyl pyrophosphate synthase OS = Saccharomyces cerevisiae GN = FPP1 PE = 1
SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	TVEQLGQEEYEK	X	0.5181	0.00585	0.1843	0.9906	4.80E+05
2	2	IEQLYHEYEESIAK		0.3587	0.08308	0.1586	0.6297	6.38E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
32	P00330	142	36800	0.5295	1.039	3
ADH1_YEAST Alcohol dehydrogenase 1 OS = Saccharomyces cerevisiae GN = ADH1 PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	ANELLINVK	X	0.5781	0.01445	0.406	0.9865	4.01E+05
2	2	VVGLSTLPEIYEK	X	0.518	0.001	0.6074	0.9963	5.17E+06
3	3	VLGIDGGEGKEELFR	X	0.5414	0.00403	0.7131	0.9802	3.52E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
33	P07262	138	49763	0.2171		1
DHE4_YEAST NADP-specific glutamate dehydrogenase 1 OS = Saccharomyces cerevisiae
GN = GDH1 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	VTWENDKGEQEVAQGYR	X	0.2171	0.1184	0.5086	0.7666	6.81E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
34	P31373	138	42692	0.6023	1.05	2
CYS3_YEAST Cystathionine gamma-lyase OS = Saccharomyces cerevisiae GN = CYS3 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	ISVGIEDTDDLLEDIK	X	0.613	0.00887	0.1862	0.967	6.82E+05
2	3	ISVGIEDTDDLLEDIKQALK	X	0.5634	0.01345	0.3481	0.9112	1.80E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
35	P22202	137	70009	0.5832	1.457	2
HSP74_YEAST Heat shock protein SSA4 OS = Saccharomyces cerevisiae GN = SSA4 PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	ITITNDKGR	X	0.9873	0.0152	0.06237	0.9611	4.21E+04
2	3	IINEPTAAAIAYGLDKK	X	0.5399	0.00584	0.05784	0.938	3.22E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
36	A6ZP47	134	65697	0.3172		1
DED1_YEAS7 ATP-dependent RNA helicase DED1 OS = Saccharomyces cerevisiae (strain
YJM789) GN = DED1 PE = 3 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	TGGFLFPVLSESFK	X	0.3172	0.03297	0.08265	0.8019	3.08E+05
2	3	DVPEPITEFTSPPLDGLLLENIK		0.00052	7.122	0.6671	0.1659	1.16E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
37	P00549	134	54510	0.5402	2.375	2
KPYK1_YEAST Pyruvate kinase 1 OS = Saccharomyces cerevisiae GN = PYK1 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	EVLGEQGKDVK		0.8211	0.01418	0.5587	0.4163	9.19E+05
2	3	MNFSHGSYEYHK	X	0.159	0.3656	0.233	0.8491	3.57E+04
3	3	GVNLPGTDVDLPALSEKDKED	X	0.5499	0.00705	0.3217	0.9634	2.45E+06
		LR
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
38	P29311	134	30073	0.5686	1.063	3
BMH1_YEAST Protein BMH1 OS = Saccharomyces cerevisiae GN = BMH1 PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	LAEQAERYEEMVENMK	X	0.6493	0.01923	0.1302	0.8619	2.33E+04
2	3	QAFDDAIAELDTLSEESYK	X	0.5798	0.00382	0.3875	0.9933	2.42E+05
3	3	ISDDILSVLDSHLIPSATTGESK	X	0.5643	0.01199	0.1289	0.8075	1.04E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
39	P26321	133	33890			0
RL5_YEAST 60S ribosomal protein L5 OS = Saccharomyces cerevisiae GN = RPL5 PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
40	P26263	130	61542			0
PDC6_YEAST Pyruvate decarboxylase isozyme 3 OS = Saccharomyces cerevisiae GN = PDC6 PE = 1
SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
41	A6ZQJ1	121	44837	0.5295		1
IF4A_YEAS7 ATP-dependent RNA helicase elF4A OS = Saccharomyces cerevisiae (strain YJM789)
GN = TIF1 PE = 3 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	AIMPIIEGHDVLAQAQSGTGK	X	0.5295	0.00498	0.5721	0.9845	4.30E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
42	Q02753	119	18231	0.4842		1
RL21A_YEAST 60S ribosomal protein L21-A OS = Saccharomyces cerevisiae GN = RPL21A PE = 1
SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	VGDIVDIK	X	0.4842	0.00614	0.01566	0.9582	1.27E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
43	P05030	119	99941	0.5928		1
PMA1_YEAST Plasma membrane ATPase 1 OS = Saccharomyces cerevisiae GN = PMA1 PE = 1
SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	TVEEDHPIPEDVHENYENK	X	0.5928	0.02245	0.3764	0.8651	3.27E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
44	Q03195	119	68297			0
RLI1_YEAST Translation initiation factor RLI1 OS = Saccharomyces cerevisiae GN = RLI1 PE = 1
SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	LLAGALKPDEGQDIPK		0.1154	0.2281	0.1563	0.679	1.09E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
45	P38011	119	34936	0.4788		1
GBLP_YEAST Guanine nucleotide-binding protein subunit beta-like protein OS = Saccharomyces
cerevisiae GN = ASC1 PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	VVPNEKADDDSVTIISAGNDK	X	0.4788	0.00934	0.03497	0.9434	2.43E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
46	P19097	117	206818	0.6972		1
FAS2_YEAST Fatty acid synthase subunit alpha OS = Saccharomyces cerevisiae GN = FAS2 PE = 1
SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	EIYYTPDPSELAAK	X	0.6972	0.02896	0.2436	0.8764	4.39E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
47	P22768	116	47175			0
ASSY_YEAST Argininosuccinate synthase OS = Saccharomyces cerevisiae GN = ARG1 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
48	P41277	112	28138	0.5193	1.003	2
GPP1_YEAST (DL)-glycerol-3-phosphatase 1 OS = Saccharomyces cerevisiae GN = GPP1 PE = 1
SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	FAPDFADEEYVNK		0.2622	0.08634	0.2384	0.6536	3.56E+05
2	3	FAPDFADEEYVNKLEGEIPEK	X	0.5189	0.00547	0.2526	0.9631	1.44E+06
3	2	VGEYNAETDEVELIFDDYLYAK	X	0.5217	0.01439	0.5462	0.9935	2.38E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
49	P49090	110	64857	0.5527	1.053	2
ASNS2_YEAST Asparagine synthetase [glutamine-hydrolyzing] 2 OS = Saccharomyces cerevisiae
GN = ASN2 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	YFTPDWLDEK	X	0.5819	0.02038	0.1065	0.9343	3.09E+05
2	3	AFDTTDEPDVKPYLPEEILWR	X	0.5251	0.03417	0.2562	0.9393	3.11E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
50	P15624	110	67691	0.9837	1.076	3
SYFB_YEAST Phenylalanyl-tRNA synthetase beta chain OS = Saccharomyces cerevisiae GN = FRS1
PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	SKEGAEPK	X	0.9916	0.00141	0.07152	0.9856	1.79E+06
2	2	GYWIEEDDSVK	X	0.8641	0.05554	0.05094	0.8192	3.24E+04
3	2	NSGFEIIQGLLGK	X	0.8704	0.03036	0.142	0.8105	8.54E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
51	P19882	109	60714	0.4595		1
HSP60_YEAST Heat shock protein 60, mitochondrial OS = Saccharomyces cerevisiae GN = HSP60
PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	NVLIEQPFGPPK		0.3833	0.07553	0.1289	0.6499	8.66E+04
2	2	AAVEEGILPGGGTALVK	X	0.4595	0.03115	0.1117	0.9559	1.38E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
52	P38088	109	75845			0
SYG_YEAST Glycyl-tRNA synthetase 1 OS = Saccharomyces cerevisiae GN = GRS1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
53	P07284	105	53276			0
SYSC_YEAST Seryl-tRNA synthetase, cytoplasmic OS = Saccharomyces cerevisiae GN = SES1
PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
54	P53184	99	24978	0.4323		1
PNC1_YEAST Nicotinamidase OS = Saccharomyces cerevisiae GN = PNC1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	TTVLLDYTRPISDDPEVINK	X	0.4323	0.02539	0.2814	0.7218	1.46E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
55	P36008	99	46827	0.8918	1.457	2
EF1G2_YEAST Elongation factor 1-gamma 2 OS = Saccharomyces cerevisiae GN = TEF4 PE = 1
SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	LLGSDVIEK	X	0.9663	0.00996	0.4982	0.9961	1.44E+06
2	2	WFNTVAASPIVK	X	0.527	0.01203	0.07669	0.8876	2.21E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
56	Q01560	95	45444			0
NOP3_YEAST Nucleolar protein 3 OS = Saccharomyces cerevisiae GN = NPL3 PE =  SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
57	P40213	94	15974			0
RS16_YEAST 40S ribosomal protein S16 OS = Saccharomyces cerevisiae GN = RPS16A PE = 1
SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	YVDEQSKNELK		0.9917	0.00434	0.3579	0.08027	4.77E+05
2	2	YVDEQSKNELKK		0.9999	0.00574	0.1204	0.1164	4.58E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
58	P16140	94	57922			0
VATB_YEAST V-type proton ATPase subunit B OS = Saccharomyces cerevisiae GN = VMA2 PE = 1
SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
59	P25293	93	47855	0.5024		1
NAP1_YEAST Nucleosome assembly protein OS = Saccharomyces cerevisiae GN = NAP1 PE = 1
SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	LGSLVGQDSGYVGGLPK	X	0.5024	0.03188	0.08129	0.758	2.53E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
60	P41940	93	39781	0.5624	1.009	2
MPG1_YEAST Mannose-1-phosphate guanyltransferase OS = Saccharomyces cerevisiae
GN = MPG1 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	LATGANIVGNALIDPTAK	X	0.5695	0.00687	0.05507	0.9887	2.54E+04
2	3	INAGLYILNPEVIDLIEMKPTSIE	X	0.562	0.00414	0.5133	0.9966	4.50E+05
		K
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
61	P15705	93	66705			0
STI1_YEAST Heat shock protein STI1 OS = Saccharomyces cerevisiae GN = STI1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
62	Q03048	91	15979			0
COFI_YEAST Cofilin OS = Saccharomyces cerevisiae GN = COF1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	SGVAVADESLTAFNDLK		0.2984	0.1196	0.0948	0.4874	1.00E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
63	P38707	90	62168	0.6442		1
SYNC_YEAST Asparaginyl-tRNA synthetase, cytoplasmic OS = Saccharomyces cerevisiae
GN = DED81 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	SVQYVLEDPIAGPLVK	X	0.6442	0.02511	0.182	0.8768	2.97E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
64	P49089	89	64734	0.4454	1.252	2
ASNS1_YEAST Asparagine synthetase [glutamine-hydrolyzing] 1 OS = Saccharomyces cerevisiae
GN = ASN1 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	YFTPDWLDEK	X	0.5819	0.02038	0.1065	0.9343	3.09E+05
2	2	ATNDVEPSTYDSK	X	0.375	0.01032	0.3126	0.9726	4.80E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
65	P14832	88	17380			0
CYPH_YEAST Peptidyl-prolyl cis-trans isomerase OS = Saccharomyces cerevisiae GN = CPR1 PE = 1
SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	KVESLGSPSGATK		0.5598	0.00415	0.2553	0.5249	4.83E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
66	P0C0W9	86	19844	0.3135		1
RL11A_YEAST 60S ribosomal protein L11-A OS = Saccharomyces cerevisiae GN = RPL11A PE = 1
SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	VLEQLSGQTPVQSK		0.000776	0.4364	0.8707	0.2733	1.50E+07
2	3	VLEQLSGQTPVQSK	X	0.3135	0.169	0.1611	0.8233	1.39E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
67	P14120	84	11504	0.5841		1
RL30_YEAST 60S ribosomal protein L30 OS = Saccharomyces cerevisiae GN = RPL30 PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	VYYFQGGNNELGTAVGK	X	0.5841	0.02582	0.205	0.8988	9.20E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
68	P26755	84	13863			0
RFA3_YEAST Replication factor A protein 3 OS = Saccharomyces cerevisiae GN = RFA3 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
69	P04147	83	64304			0
PABP_YEAST Polyadenylate-binding protein, cytoplasmic and nuclear OS = Saccharomyces
cerevisiae GN = PAB1 PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	TAEQLENLNIQDDQK		0.001099	1.859	0.4682	0.9671	3.84E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
70	P32527	82	49439			0
ZUO1_YEAST Zuotin OS = Saccharomyces cerevisiae GN = ZUO1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
71	P38625	82	58750	0.5454		1
GUAA_YEAST GMP synthase [glutamine-hydrolyzing] OS = Saccharomyces cerevisiae GN = GUA1
PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	VTYDITSKPPATVEWE	X	0.5454	0.01078	0.239	0.9456	3.32E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
72	P31412	80	44434	0.6452		1
VATC_YEAST V-type proton ATPase subunit C OS = Saccharomyces cerevisiae GN = VMA5 PE = 1
SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	IGSLDTLIVESEELSK	X	0.6452	0.01519	0.07177	0.9753	2.77E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
73	P05753	80	29608			0
RS4_YEAST 40S ribosomal protein S4 OS = Saccharomyces cerevisiae GN = RPS4A PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
74	P26783	79	25023	0.4952		1
RS5_YEAST 40S ribosomal protein S5 OS = Saccharomyces cerevisiae GN = RPS5 PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	TIAETLAEELINAAK	X	0.4952	0.0071	0.5691	0.9574	1.53E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
75	P17076	76	28396			0
RL8A_YEAST 60S ribosomal protein L8-A OS = Saccharomyces cerevisiae GN = RPL8A PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
76	P53030	76	24470	0.5139		1
RL1_YEAST 60S ribosomal protein L1 OS = Saccharomyces cerevisiae GN = RPL1A PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	FPTPVSHNDDLYGK	X	0.5139	0.02598	0.07442	0.8939	3.55E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
77	P25694	74	92331	0.5765		1
CDC48_YEAST Cell division control protein 48 OS = Saccharomyces cerevisiae GN = CDC48 PE = 1
SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	AAAPTVVFLDELDSIAK	X	0.5765	0.01988	0.2107	0.9888	1.27E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
78	P40303	73	28574			0
PSA7_YEAST Proteasome component PRE6 OS = Saccharomyces cerevisiae GN = PRE6 PE = 1
SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
79	P16861	73	108408			0
K6PF1_YEAST 6-phosphofructokinase subunit alpha OS = Saccharomyces cerevisiae GN = PFK1
PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
80	P35691	73	18729			0
TCTP_YEAST Translationally-controlled tumor protein homolog OS = Saccharomyces cerevisiae
GN = TMA19 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	LQETNPEEVPKFEK		0.01574	0.05686	0.3046	0.3037	2.21E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
81	P05738	72	21556	0.6443		1
RL9A_YEAST 60S ribosomal protein L9-A OS = Saccharomyces cerevisiae GN = RPL9A PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	FLDGIYVSHK	X	0.6443	0.01495	0.1913	0.8882	2.99E+04
2	3	YIQTEQQIEVPEGVTVSIK		0.008727	0.6329	0.355	0.4397	1.88E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
82	P00899	71	56732			0
TRPE_YEAST Anthranilate synthase component 1 OS = Saccharomyces cerevisiae GN = TRP2 PE = 1
SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
83	P17079	71	17956	0.5847		1
RL12_YEAST 60S ribosomal protein L12 OS = Saccharomyces cerevisiae GN = RPL12A PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	VDFKNPHDIIEGINAGEIEIPEN	X	0.5847	0.02535	0.1429	0.8697	3.12E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
84	P07806	70	126596	0.4001	1.235	2
SYV_YEAST Valyl-tRNA synthetase, mitochondrial OS = Saccharomyces cerevisiae GN = VAS1
PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	TGVFEPEFTADGK	X	0.365	0.03845	0.2789	0.8561	4.52E+05
2	2	LNTAISNLEVENK	X	0.5312	0.02003	0.0767	0.9905	1.46E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
85	P26781	70	17898	0.4992		1
RS11_YEAST 40S ribosomal protein S11 OS = Saccharomyces cerevisiae GN = RPS11A PE = 1
SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	TAIEGSYIDKK	X	0.4992	0.0041	0.1365	0.9905	1.73E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
86	P53252	70	38326	0.5822		1
PIL1_YEAST Sphingolipid long chain base-responsive protein PIL1 OS = Saccharomyces cerevisiae
GN = PIL1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	APTASQLQNPPPPPSTTK	X	0.5822	0.02737	0.2412	0.8526	1.83E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
87	P22943	68	11686			0
HSP12_YEAST 12 kDa heat shock protein OS = Saccharomyces cerevisiae GN = HSP12 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	GKDNAEGQGESLADQAR		0.01324	0.7291	0.2434	0.4791	3.47E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
88	P02407	67	15891			0
RS17A_YEAST 40S ribosomal protein S17-A OS = Saccharomyces cerevisiae GN = RPS17A PE = 1
SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
89	P04801	66	84467			0
SYTC_YEAST Threonyl-tRNA synthetase, cytoplasmic OS = Saccharomyces cerevisiae GN = THS1
PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	TVSQADFPGLEGVAK		0.9625	0.01322	0.639	0.3281	3.05E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
90	P09733	63	49945			0
TBA1_YEAST Tubulin alpha-1 chain OS = Saccharomyces cerevisiae GN = TUB1 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
91	P33204	62	19959			0
ARPC4_YEAST Actin-related protein 2/3 complex subunit 4 OS = Saccharomyces cerevisiae
GN = ARC19 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
92	P23301	62	17208	0.4447		1
IF5A2_YEAST Eukaryotic translation initiation factor 5A-2 OS = Saccharomyces cerevisiae
GN = HYP2 PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	KLEDLSPSTHNMEVPVVK	X	0.4447	0.02507	0.3275	0.7978	8.63E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
93	P06168	61	44565			0
ILV5_YEAST Ketol-acid reductoisomerase, mitochondrial OS = Saccharomyces cerevisiae GN = ILV5
PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
94	P05744	59	12219	0.6527		1
RL33A_YEAST 60S ribosomal protein L33-A OS = Saccharomyces cerevisiae GN = RPL33A PE = 1
SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	IEGVATPQDAQFYLGK	X	0.6527	0.01745	0.2096	0.9659	1.36E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
95	P04807	58	53908	0.6227		1
HXKB_YEAST Hexokinase-2 OS = Saccharomyces cerevisiae GN = HXK2 PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	TKYDITIDEESPRPGQQTFEK	X	0.6227	0.02524	0.2555	0.8918	7.65E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
96	P03965	58	124439			0
CARB_YEAST Carbamoyl-phosphate synthase arginine-specific large chain OS = Saccharomyces
cerevisiae GN = CPA2 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
97	Q00955	58	250197			0
ACAC_YEAST Acetyl-CoA carboxylase OS = Saccharomyces cerevisiae GN = FAS3 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	IGSFGPQEDEFFNK		0.8663	0.02199	0.1144	0.6383	4.24E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
98	P32598	58	35884	0.499		1
PP12_YEAST Serine/threonine-protein phosphatase PP1-2 OS = Saccharomyces cerevisiae
GN = GLC7 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	GSKPGQQVDLEENEIR	X	0.499	0.03409	0.1183	0.9862	2959
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
99	P02365	58	27204	0.4787		1
RS6_YEAST 40S ribosomal protein S6 OS = Saccharomyces cerevisiae GN = RPS6A PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	KGEQELEGLTDTTVPK	X	0.4787	0.01467	0.0397	0.9854	2.01E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
100	P37012	57	63049			0
PGM2_YEAST Phosphoglucomutase-2 OS = Saccharomyces cerevisiae GN = PGM2 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	IIKDFPELDLGTIGK		0.6291	0.02728	0.1059	0.6921	5.18E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
101	P10664	57	39325	0.482	1.07	2
RL4A_YEAST 60S ribosomal protein L4-A OS = Saccharomyces cerevisiae GN = RPL4A PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	IPEIPLVVSTDLESIQK	X	0.4871	0.01446	0.3459	0.9946	8.51E+05
2	3	IINSSEIQSAIRPAGQATQK	X	0.4381	0.02184	0.2528	0.953	9.33E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
102	P17536	55	23527			0
TPM1_YEAST Tropomyosin-1 OS = Saccharomyces cerevisiae GN = TPM1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	QTEQDNVEKENQIK		0.4204	0.1271	0.03615	0.4953	1.04E+04
2	3	NKDLEQENVEKENQIK		0.438	0.04989	0.1615	0.6221	6.92E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
103	P32469	55	33970			0
DPH5_YEAST Diphthine synthase OS = Saccharomyces cerevisiae GN = DPH5 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
104	P35271	54	17115	0.5135		1
RS18_YEAST 40S ribosomal protein S18 OS = Saccharomyces cerevisiae GN = RPS18A PE = 1
SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	QNDITDGKDYHTLANNVESK	X	0.5135	0.01629	0.07641	0.9441	5.50E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
105	P13663	54	39735			0
DHAS_YEAST Aspartate-semialdehyde dehydrogenase OS = Saccharomyces cerevisiae GN = HOM2
PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
106	P54839	53	54979			0
HMCS_YEAST Hydroxymethylglutaryl-CoA synthase OS = Saccharomyces cerevisiae GN = ERG13
PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	DYDESLTDKNIEK		0.1337	0.1737	0.3775	0.4027	2.38E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
107	P40016	53	60385			0
RPN3_YEAST 26S proteasome regulatory subunit RPN3 OS = Saccharomyces cerevisiae
GN = RPN3 PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
108	P05317	52	33866	0.5164		1
RLA0_YEAST 60S acidic ribosomal protein P0 OS = Saccharomyces cerevisiae GN = RPP0 PE = 1
SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	GTIEIVSDVK	X	0.5164	0.00778	0.1538	0.9872	4.30E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
109	P15992	51	23865			0
HSP26_YEAST Heat shock protein 26 OS = Saccharomyces cerevisiae GN = HSP26 PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	NQILVSGEIPSTLNEESKDK		0.6438	0.03278	0.3187	0.6599	2.01E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
110	P32481	50	57829			0
IF2G_YEAST Eukaryotic translation initiation factor 2 subunit gamma OS = Saccharomyces
cerevisiae GN = GCD11 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	LGDEIEIRPGIVTK		0.6051	0.09736	0.2626	0.3614	1.13E+05
2	3	VAFTGLEEDGETEEEKR		0.3223	0.05784	0.09351	0.5764	1.71E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
111	P41056	49	12233			0
RL33B_YEAST 60S ribosomal protein L33-B OS = Saccharomyces cerevisiae GN = RPL33B PE = 1
SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	IEGVATPQEAQFYLGK		0.000032	376.9	0.3763	0.1226	1.13E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
112	P14126	49	44075			0
RL3_YEAST 60S ribosomal protein L3 OS = Saccharomyces cerevisiae GN = RPL3 PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
113	B3LLJ2	49	29059	0.5829		1
RS3A2_YEAS1 40S ribosomal protein S1-B OS = Saccharomyces cerevisiae (strain RM11-1a)
GN = RPS1B PE = 3 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	VSGFKDEVLETV	X	0.5829	0.0184	0.1617	0.9565	4.47E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
114	P35997	49	8930			0
RS27A_YEAST 40S ribosomal protein S27-A OS = Saccharomyces cerevisiae GN = RPS27A PE = 1
SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
115	P39954	48	49094	0.1786		1
SAHH_YEAST Adenosylhomocysteinase OS = Saccharomyces cerevisiae GN = SAH1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	LKVPAINVNDSVTK	X	0.1786	0.1265	0.1537	0.7426	1.16E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
116	P05736	48	27392	0.5256		1
RL2_YEAST 60S ribosomal protein L2 OS = Saccharomyces cerevisiae GN = RPL2A PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	ASLNVGNVLPLGSVPEGTIVS	X	0.5256	0.00852	0.3563	0.9201	1.23E+06
		NVEEKPGDR
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
117	Q12306	47	11662			0
SMT3_YEAST Ubiquitin-like protein SMT3 OS = Saccharomyces cerevisiae GN = SMT3 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
118	Q14467	47	16394	0.7594		1
MBF1_YEAST Multiprotein-bridging factor 1 OS = Saccharomyces cerevisiae GN = MBF1 PE = 1
SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	INEKPTVVNDYEAAR	X	0.7594	0.04153	0.08694	0.7815	1.61E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
119	Q08438	46	73997			0
VHS3_YEAST Protein VHS3 OS = Saccharomyces cerevisiae GN = VHS3 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
120	P38708	46	77337	0.3265		1
YHI0_YEAST Putative prolyl-tRNA synthetase YHR020W OS = Saccharomyces cerevisiae
GN = YHR020W PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	IPEILEEMQGDLFK	X	0.3265	0.09196	0.1283	0.9662	6.43E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
121	P40069	44	122981	0.8151		1
IMB4_YEAST Importin subunit beta-4 OS = Saccharomyces cerevisiae GN = KAP123 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	FHEEYLPLIIDIIDSAK	X	0.8151	0.02809	0.2967	0.9444	3.29E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
122	P05737	42	27621	0.5221		1
RL7A_YEAST 60S ribosomal protein L7-A OS = Saccharomyces cerevisiae GN = RPL7A PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	ATLELLK	X	0.5221	0.00509	0.1793	0.9871	8.87E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
123	P38715	42	37095	0.03996		1
GRE3_YEAST NADPH-dependent aldose reductase GRE3 OS = Saccharomyces cerevisiae
GN = GRE3 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	TTPTLFENDVIK	X	0.03996	0.4915	0.0985	0.8748	1.48E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
124	P15019	40	37302	0.5972		1
TAL1_YEAST Transaldolase OS = Saccharomyces cerevisiae GN = TAL1 PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	DYKGEADPGVISVK	X	0.5972	0.01513	0.05713	0.9284	1.93E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
125	P39939	40	13438			0
RS26B_YEAST 40S ribosomal protein S26-B OS = Saccharomyces cerevisiae GN = RPS26B PE = 1
SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	DLSEASVYPEYALPK		0.4244	0.02522	0.09777	0.5891	8.08E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
126	P25443	40	27433	0.4963		1
RS2_YEAST 40S ribosomal protein S2 OS = Saccharomyces cerevisiae GN = RPS2 PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	EFQIIDTLLPGLQDEVMNIKPV	X	0.4963	0.00439	0.4363	0.9932	1.18E+06
		OK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
127	P43620	39	75867	0.5908		1
RMD8_YEAST Sporulation protein RMD8 OS = Saccharomyces cerevisiae GN = RMD8 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	REQLLK	X	0.5908	0.00487	0.1874	0.9696	5.33E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
128	P52910	39	75765			0
ACS2_YEAST Acetyl-coenzyme A synthetase 2 OS = Saccharomyces cerevisiae GN = ACS2 PE = 1
SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
129	P60010	38	41663			0
ACT_YEAST Actin OS = Saccharomyces cerevisiae GN = ACT1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	DLTDYLMK		0.8897	0.01324	0.1224	0.6466	4.23E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
130	P41805	37	25522	0.7348		1
RL10_YEAST 60S ribosomal protein L10 OS = Saccharomyces cerevisiae GN = RPL10 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	WGFTNLDRPEYLK	X	0.7348	0.02758	0.107	0.8056	2.97E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
131	Q86ZR7	37	26338			0
YKD3A_YEAST Putative uncharacterized hydrolase YKL033W-A OS = Saccharomyces cerevisiae
GN = YKL033W-A PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
132	P38205	35	77830			0
NCL1_YEAST tRNA (cytosine-5-)-methyltransferase NCL1 OS = Saccharomyces cerevisiae
GN = NCL1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	LSSETPALESEGPQTK		0.3404	0.01969	0.1416	0.3584	2.22E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
133	P17255	35	118562			0
VATA_YEAST V-type proton ATPase catalytic subunit A OS = Saccharomyces cerevisiae GN = TFP1
PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	AIKEESQSIYIPR		0.2979	0.2188	0.09557	0.4074	1.46E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
134	P05739	35	20183	0.5423		1
RL6B_YEAST 60S ribosomal protein L6-B OS = Saccharomyces cerevisiae GN = RPL6B PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	HLEDNTLLVTGPFK	X	0.5423	0.02668	0.2265	0.9184	1.35E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
135	Q07530	35	34457	0.9709		1
YD114_YEAST Uncharacterized oxidoreductase YDL114W OS = Saccharomyces cerevisiae
GN = YDL114W PE = 2 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	INRASGTTK	X	0.9709	0.00996	0.1262	0.9924	1.27E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
136	P15625	34	57804			0
SYFA_YEAST Phenylalanyl-tRNA synthetase alpha chain OS = Saccharomyces cerevisiae
GN = FRS2 PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
137	Q02209	33	41274	0.9909		1
YKZ1_YEAST Uncharacterized protein YKR011C OS = Saccharomyces cerevisiae GN = YKR011C
PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	FQLVEK	X	0.9909	0.00329	0.1232	0.9948	5.97E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
138	A6ZZJ1	32	143286	0.5908		1
MYO3_YEAS7 Myosin-3 OS = Saccharomyces cerevisiae (strain YJM789) GN = MYO3 PE = 3 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	RIDAAIK	X	0.5908	0.00487	0.1874	0.9696	5.33E+05
2	3	IIKSANELVETLSK		0.5256	0.06512	0.2213	0.1936	2.39E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
139	P40077	32	64327			0
DSE1_YEAST Protein DSE1 OS = Saccharomyces cerevisiae GN = DSE1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	MNSPILRK		0.003135	3.635	0.06896	0.9784	7203
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
140	A7A1S5	31	76547			0
DUS3_YEAS7 tRNA-dihydrouridine synthase 3 OS = Saccharomyces cerevisiae (strain YJM789)
GN = DUS3 PE = 3 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	QNENQK		0.4468	0.05701	0.00365	0.6454	6837
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
141	P02557	31	51011			0
TBB_YEAST Tubulin beta chain OS = Saccharomyces cerevisiae GN = TUB2 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
142	P17423	31	38792			0
KHSE_YEAST Homoserine kinase OS = Saccharomyces cerevisiae GN = THR1 PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
143	P04076	30	52173			0
ARLY_YEAST Argininosuccinate lyase OS = Saccharomyces cerevisiae GN = ARG4 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
144	A6ZWD3	29	68204			0
DBP1_YEAS7 ATP dependent RNA helicase DBP1 OS = Saccharomyces cerevisiae (strain
YJM789) GN = DBP1 PE = 3 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
145	P07702	29	155248			0
LYS2_YEAST L-aminoadipate-semialdehyde dehydrogenase OS = Saccharomyces cerevisiae
GN = LYS2 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	EYFVEPNSAEGK		0.0214	0.957	0.3831	0.02822	9.46E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
146	P39976	27	55190			0
DLD3_YEAST D-lactate dehydrogenase [cytochrome] 3 OS = Saccharomyces cerevisiae GN = DLD3
PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	LNAAGLIGDAPKPVVK		1	0.00277	0.1741	0.2978	8.97E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
147	P53953	27	98881	0.4536		1
SFB2_YEAST SED5-binding protein 2 OS = Saccharomyces cerevisiae GN = SFB2 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	SEQGILNTPK	X	0.4536	0.03249	0.3059	0.9489	4.80E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
148	Q08647	27	77419			0
PUS7_YEAST Multisubstrate pseudouridine synthase 7 OS = Saccharomyces cerevisiae GN = PUS7
PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
149	Q07798	26	102104	0.9876		1
SPO75_YEAST Sporulation-specific protein 75 OS = Saccharomyces cerevisiae GN = SPO75 PE = 1
SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	ILDKIIR	X	0.9876	0.00489	0.02083	0.9895	5.42E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
150	P29509	26	34409	0.3208		1
TRXB1_YEAST Thioredoxin reductase 1 OS = Saccharomyces cerevisiae GN = TRR1 PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	IVAGQVDTDEAGYIK	X	0.3208	0.06408	0.4281	0.9649	5.48E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
151	P38720	26	53774			0
6PGD1_YEAST 6-phosphogluconate dehydrogenase, decarboxylating 1 OS = Saccharomyces
cerevisiae GN = GND1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
152	P26785	26	22444			0
RL16B_YEAST 60S ribosomal protein L16-B OS = Saccharomyces cerevisiae GN = RPL16B PE = 1
SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
153	P06843	25	38928	0.5908		1
SPT2_YEAST Protein SPT2 OS = Saccharomyces cerevisiae GN = SPT2 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	RQELLK	X	0.5908	0.00487	0.1874	0.9696	5.33E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
154	P06101	25	58845	0.9702		1
CDC37_YEAST Hsp90 co-chaperone Cdc37 OS = Saccharomyces cerevisiae GN = CDC37 PE = 1
SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	VFEDIPIEEAEK	X	0.9702	0.01138	0.1397	0.737	1.27E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
155	P07149	25	228547			0
FAS1_YEAST Fatty acid synthase subunit beta OS = Saccharomyces cerevisiae GN = FAS1 PE = 1
SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	WETTTQFK		0.3417	0.07701	0.06965	0.6964	5.87E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
156	P35169	24	280962	1.001		1
TOR1_YEAST Serine/threonine-protein kinase TOR1 OS = Saccharomyces cerevisiae GN = TOR1
PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	EIKFIK	X	1.001	0	0.1891	0.9934	1.08E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
157	Q05016	24	29301			0
YM71_YEAST Uncharacterized oxidoreductase YMR226C OS = Saccharomyces cerevisiae
GN = YMR226C PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	IKPFIENLPQEFK		0.4711	0.02328	0.1926	0.2766	5.31E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
158	P23796	24	59181			0
RIT1_YEAST tRNA A64-2′-O-ribosylphosphate transferase OS = Saccharomyces cerevisiae
GN = RIT1 PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	LNELFMGK		0.173	0.1599	0.1023	0.6886	5.41E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
159	Q12734	23	124772	0.9979		1
CSR2_YEAST Transcription factor CSR2 OS = Saccharomyces cerevisiae GN = CSR2 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	STTLSDIK	X	0.9979	0	0.5316	0.9992	3.05E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
160	P24384	23	130674	0.5908		1
PRP22_YEAST Pre-mRNA-splicing factor ATP-dependent RNA helicase PRP22
OS = Saccharomyces cerevisiae GN = PRP22 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	ERALGIK	X	0.5908	0.00487	0.1874	0.9696	5.33E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
161	Q04412	23	54780	0.9523		1
AGE1_YEAST ADP-ribosylation factor GTPase-activating protein effector protein 1
OS = Saccharomyces cerevisiae GN = AGE1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	LTNILLK	X	0.9523	0.00751	0.01207	0.9072	1.83E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
162	P53191	22	70950			0
PIB2_YEAST Phosphatidylinositol-3-phosphate-binding protein 2 OS = Saccharomyces cerevisiae
GN = PIB2 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
163	Q03497	22	102940	1		1
STE20_YEAST Serine/threonine-protein kinase STE20 OS = Saccharomyces cerevisiae GN = STE20
PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	ETLSGLEFLHSK	X	1	0.00609	0.6136	0.9975	1.27E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
164	P40462	22	107655	0.9911		1
TM108_YEAST Protein TMA108 OS = Saccharomyces cerevisiae GN = TMA108 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	FINLEK	X	0.9911	0.00377	0.122	0.9964	5.91E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
165	P05755	22	22285			0
RS9B_YEAST 40S ribosomal protein S9-B OS = Saccharomyces cerevisiae GN = RPS9B PE = 1
SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	LDYVLALK		0.005702	1.64	0.079	0.8879	9978
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
166	P46679	22	97766			0
STB2_YEAST Protein STB2 OS = Saccharomyces cerevisiae GN = STB2 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	SSLQGQGKTGICSAIDPKSDK		0.9544	0.00932	0.1894	0.3151	7.47E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
167	POCOW1	22	14705			0
RS22A_YEAST 40S ribosomal protein S22-A OS = Saccharomyces cerevisiae GN = RPS22A PE = 1
SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
168	P36096	22	88064	0.9908		1
TUL1_YEAST Transmembrane E3 ubiquitin-protein ligase 1 OS = Saccharomyces cerevisiae
GN = TUL1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	IDLVSNNK	X	0.9908	0.00823	0.03719	0.9728	1.54E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
169	P38967	21	65362			0
TAT2_YEAST Tryptophan permease OS = Saccharomyces cerevisiae GN = TAT2 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
170	Q05955	21	57795	0.8578		1
ADY4_YEAST Accumulatesd yads protein 4 OS = Saccharomyces cerevisiae GN = ADY4 PE = 1
SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	DVDYQTFK	X	0.8578	0.03111	0.08023	0.9212	1.78E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
171	P26786	21	21761			0
RS7A_YEAST 40S ribosomal protein S7-A OS = Saccharomyces cerevisiae GN = RPS7A PE = 1
SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
172	P18759	21	84004	1		1
SEC18_YEAST Vesicular-fusion protein SEC18 OS = Saccharomyces cerevisiae GN = SEC18 PE = 1
SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	FKIPGFGK	X	1	0.00372	0.3628	0.9814	2.01E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
173	P02309	21	11361	0.4287		1
H4_YEAST Histone H4 OS = Saccharomyces cerevisiae GN = HHF1 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	DSVTYTEHAK	X	0.4287	0.05722	0.06178	0.844	1.78E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
174	P36139	20	31428			0
PET10_YEAST Protein PET10 OS = Saccharomyces cerevisiae GN = PET10 PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	LDELVNLLVFK		0.001257	0.6587	0.7685	0.9993	1.17E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
175	Q02773	20	140029			1
RPM2_YEAST Ribonuclease P protein component, mitochondrial OS = Saccharomyces cerevisiae
GN = RPM2 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	SLLRKSKPLQA	X	0	999	0.00047	0.8095	271.1
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
176	P38697	20	56494	0.3128		1
IMDH2_YEAST Inosine-5′-monophosphate dehydrogenase IMD2 OS = Saccharomyces cerevisiae
GN = IMD2 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	TASAQLEGGVHNLHSYEK	X	0.3128	0.09825	0.218	0.8306	1.40E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
177	P41832	20	221017	0.02392		1
BNI1_YEAST Protein BNI1 OS = Saccharomyces cerevisiae GN = BNI1 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	RLKELETK	X	0.02392	0.2888	0.00547	0.8577	1621
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
178	P17119	20	83952	0.09389		1
KAR3_YEAST Kinesin-like protein KAR3 OS = Saccharomyces cerevisiae GN = KAR3 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	TNLETLEK	X	0.09389	0.2254	0.0084	0.9135	5.14E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
179	P15303	20	85579			0
SEC23_YEAST Protein transport protein SEC23 OS = Saccharomyces cerevisiae GN = SEC23 PE = 1
SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
180	P32565	20	104768			0
RPN2_YEAST 26S proteasome regulatory subunit RPN2 OS = Saccharomyces cerevisiae
GN = RPN2 PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
181	Q03660	20	128787			0
TR130_YEAST Transport protein particle 130 kDa subunit OS = Saccharomyces cerevisiae
GN = TRS130 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
182	P39081	19	71853			0
PCF11_YEAST Protein PCF11 OS = Saccharomyces cerevisiae GN = PCF11 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	INNLYASLKAEGLIYTPPK		0.9323	0.01402	0.3541	0.6434	6.37E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
183	B3LRC2	19	36810			0
UTH1_YEAS1 Protein UTH1 OS = Saccharomyces cerevisiae (strain RM11-1a) GN = UTH1 PE = 3
SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
184	P07259	19	244972			0
PYR1_YEAST Protein URA1 OS = Saccharomyces cerevisiae GN = URA2 PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
185	P18963	19	350758	0.9999		1
IRA1_YEAST Inhibitory regulator protein IRA1 OS = Saccharomyces cerevisiae GN = IRA1 PE = 1
SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	GNKYLIK	X	0.9999	0.00158	0.0893	0.9713	3.78E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
186	P38850	18	123854			0
RT107_YEAST Regulator of Ty1 transposition protein 107 OS = Saccharomyces cerevisiae
GN = RTT107 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
187	Q04199	18	51420			0
CAC2_YEAST Chromatin assembly factor 1 subunit p60 OS = Saccharomyces cerevisiae GN = CAC2
PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	IPCNSSDSK		0.9943	0.00328	0.1865	0.52	1.44E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
188	Q12345	17	28402			0
IES3_YEAST Ino eighty subunit 3 OS = Saccharomyces cerevisiae GN = IE53 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	IDILTKIQENLLEEYQK		0.04155	1.417	0.06472	0.5595	1068
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
189	P53598	17	35010	1.001		1
SUCA_YEAST Succinyl-CoA ligase [ADP-forming] subunit alpha, mitochondrial
OS = Saccharomyces cerevisiae GN = LSC1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	ESIPYDK	X	1.001	0.001	0.6215	0.9959	3.11E+06

TABLE 2
Proteins identified by Mascot Distiller from ChAP-MS analysis of GAL1 chromatin isolated from cells
grown in galactose.
Mascot Distiller Quantitation Report
Mascot search results:
Galactose
	Log ratio versus	Log ratio versus
	Intensity (all	Intensity (selected
	positive ratios)	ratios)
L/	02.00e+7	05.00e+6
(L +	4.00e+7 6.00e+7	1.00e+7 1.50e+7
H)	−15 −10 −5 0 5	−6 −4 −2 0 2
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
1	P00924	952	46773	0.727	1.077	10
ENO1_YEAST Enolase 1 OS = Saccharomyces cerevisiae GN = ENO1 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	RIATAIEK	X	0.9922	0.001	0.0623	0.9937	78080.00
2	2	VNQIGTLSESIK	X	0.7237	0.001	0.6107	0.9971	1.48E+06
3	3	AVDDFLISLDGTANK	X	0.6953	0.00258	0.5605	0.9825	2.57E+05
4	2	AVDDFLISLDGTANK	X	0.678	0.00158	0.1606	0.9839	3.20E+06
5	2	TAGIQIVADDLTVTNPK	X	0.8499	0	0.4502	0.9983	8.74E+05
6	3	IEEELGDNAVFAGENFHHGDK	X	0.7139	0.01531	0.04418	0.7314	3.10E+04
7	2	IEEELGDNAVFAGENFHHGDKL	X	0.8709	0.00321	0.8165	0.9933	1.28E+05
8	3	IEEELGDNAVFAGENFHHGDKL	X	0.8482	0.00579	0.7751	0.9956	5.69E+05
9	3	YPIVSIEDPFAEDDWEAWSHFFK	X	0.743	0.001	0.7934	0.9984	1.74E+06
10	3	RYPIVSIEDPFAEDDWEAWSHFFK		0.2589	0.1734	0.2248	0.5408	1353
11	3	YGASAGNVGDEGGVAPNIQTAEE	X	0.7223	0.00158	0.9201	0.9993	1.05E+07
		ALDLIVDAIK
					SD
Hit	Accession	Score	Mass	L(L + H)	(geo)	#
2	P00925	827	46885	0.7156	1.024	5
ENO2_YEAST Enolase 2 OS = Saccharomyces cerevisiae GN = ENO2 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	VNQIGTLSESIK	X	0.7237	0.001	0.6107	0.9971	1.48E+06
2	3	AVDDFLLSLDGTANK	X	0.6953	0.00258	0.5605	0.9825	2.57E+05
3	2	AVDDFLLSLDGTANK	X	0.678	0.00158	0.1606	0.9839	3.20E+06
4	2	DGKYDLDFKNPESDK		0.593	0.03836	0.2515	0.6481	3.31E+05
5	3	DGKYDLDFKNPESDK		0.2183	0.1283	0.2233	0.1889	8.04E+05
6	3	YPIVSIEDPFAEDDWEAWSHFFK	X	0.743	0.001	0.7934	0.9984	1.74E+06
7	3	RYPIVSIEDPFAEDDWEAWSHFFK		0.2589	0.1734	0.2248	0.5408	1353
8	3	YGASAGNVGDEGGVAPNIQTAEE	X	0.7223	0.00158	0.9201	0.9993	1.05E+07
		ALDLIVDAIK
					SD
Hit	Accession	Score	Mass	L(L + H)	(geo)	#
3	P00359	773	35724	0.6771	1.019	7
G3P3_YEAST Glyceraldehyde-3-phosphate dehydrogenase 3 OS = Saccharomyces cerevisiae
GN = TDH3 PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	ETTYDEIKK	X	0.6838	0.00472	0.3538	0.9553	3.68E+05
2	2	TASGNIIPSSTGAAK	X	0.6648	0.00158	0.6513	0.9983	3.86E+06
3	2	VPTVDVSVVDLTVK	X	0.7282	0.0064	0.2127	0.8286	6.60E+05
4	3	LNKETTYDEIKK		0.7548	0.04527	0.0313	0.2068	5.04E+04
5	3	YAGEVSHDDKHIIVDGK		0.688	0.0049	0.1652	0.6807	4.07E+06
6	2	YAGEVSHDDKHIIVDGK	X	0.6826	0.00224	0.3878	0.8652	2.07E+06
7	3	KVVITAPSSTAPMFVMGVNEEK	X	0.7193	0.00631	0.1023	0.9512	2.42E+05
8	2	DPANLPWGSSNVDIAIDSTGVFK	X	0.6776	0.00494	0.5179	0.9695	1.47E+06
9	3	DPANLPWGSSNVDIAIDSTGVFK		0.6946	0.02605	0.3559	0.4268	1.47E+06
10	3	VINDAFGIEEGLMTTVHSLTATQK	X	0.6612	0.0114	0.3918	0.9512	5.69E+05
					SD
Hit	Accession	Score	Mass	L(L + H)	(geo)	#
4	P02994	662	50394	0.8504	1.012	7
EF1A_YEAST Elongation factor 1-alpha OS = Saccharomyces cerevisiae GN = TEF1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	FDELLEK	X	0.826	0.00158	0.3074	0.9923	4.71E+06
2	3	SHINVVVIGHVDSGK		0.8651	0.00919	0.1342	0.4249	1.91E+05
3	2	TLLEAIDAIEQPSRPTDKPLR	X	0.8558	0	0.7243	0.9974	1.11E+06
4	3	TLLEAIDAIEQPSRPTDKPLR	X	0.8371	0.00322	0.6393	0.9893	8.82E+06
5	3	VETGVIKPGMVVTFAPAGVTTEVK	X	0.8774	0.001	0.7139	0.9992	6.53E+06
6	2	VETGVIKPGMVVTFAPAGVTTEVK	X	0.8911	0	0.7784	0.9982	2.27E+06
7	3	SVEMHHEQLEQGVPGDNVGFNV	X	0.8474	0.00071	0.7764	0.9988	1.10E+07
		K
8	2	SVEMHHEQLEQGVPGDNVGFNV	X	0.8482	0.001	0.8709	0.999	1.09E+06
		K
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
5	P54115	486	54380	0.6881	1.024	5
ALDH6_YEAST Magnesium-activated aldehyde dehydrogenase, cytosolic OS = Saccharomyces
cerevisiae GN = ALD6 PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	SVAVDSSESNLK	X	0.7081	0.0109	0.05156	0.971	5.45E+05
2	3	SVAVDSSESNLKK	X	0.6272	0.01694	0.1014	0.9286	2.04E+05
3	2	SVAVDSSESNLKK	X	0.6886	0.00158	0.2331	0.997	7.45E+05
4	3	SAHLVFDDANIKK	X	0.6792	0.004	0.1402	0.9596	2.03E+05
5	3	IVKEEIFGPVVTVAK		0.2547	0.07849	0.4923	0.06903	3.53E+06
6	2	IVKEEIFGPVVTVAK	X	0.6996	0.00158	0.1833	0.9947	3.23E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
6	P10591	482	70039	0.8188	1.018	4
HSP71_YEAST Heat shock protein SSA1 OS = Saccharomyces cerevisiae GN = SSA1 PE = 1
SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	MKETAESYLGAK	X	0.7735	0.00986	0.2692	0.9866	2.32E+05
2	2	NFNDPEVQADMK	X	0.8218	0.00856	0.2133	0.9657	9.80E+05
3	2	NQAAMNPSNTVFDAK	X	0.8186	0.0035	0.4594	0.9975	1.37E+06
4	3	NTISEAGDKLEQADKDTVTK		0.3583	0.06491	0.4424	0.4808	1.01E+07
5	2	NTISEAGDKLEQADKDTVTK	X	0.8301	0.00158	0.6157	0.995	7.24E+05
					SD
Hit	Accession	Score	Mass	L(L + H)	(geo)	#
7	P50095	425	56813	0.9382	1.024	5
IMDH3_YEAST Probable inosine-5′-monophosphate dehydrogenase IMD3 OS = Saccharomyces
cerevisiae GN = IMD3 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	TASAQLEGGVHNLHSYEK		0.4222	0.1268	0.5294	0.3116	7.78E+05
2	2	TASAQLEGGVHNLHSYEK	X	0.893	0.02366	0.2283	0.9113	2.44E+05
3	2	NPVTGAQGITLSEGNEILK	X	0.9433	0.00754	0.3647	0.9924	1.01E+06
4	3	NPVTGAQGITLSEGNEILK	X	0.9335	0.00158	0.3228	0.9933	3.39E+05
5	2	YFSESDSVLVAQGVSGAVVDK	X	1	0.001	0.4121	0.9864	7.24E+04
6	2	GGLTYNDFLVLPGLVDFPSSEVSL	X	0.9534	0	0.8179	0.9932	2.35E+05
		QTK
					SD
Hit	Accession	Score	Mass	L(L + H)	(geo)	#
8	P07262	383	49539	0.5666	1.061	3
DHE4_YEAST NADP-specific glutamate dehydrogenase 1 OS = Saccharomyces cerevisiae
GN = GDH1 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	STATGPSEAVWYGPPK	X	0.6132	0.00959	0.3565	0.9733	2.44E+05
2	3	VTWENDKGEQEVAQGYR	X	0.535	0.02836	0.5322	0.8087	5.75E+05
3	2	VTWENDKGEQEVAQGYR	X	0.6306	0.00328	0.4773	0.9937	1.29E+05
					SD
Hit	Accession	Score	Mass	L(L + H)	(geo)	#
9	P06169	369	61737	0.5627		5
PDC1_YEAST Pyruvate decarboxylase isozyme 1 OS = Saccharomyces cerevisiae GN = PDC1
PE = 1 SV = 7
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	VATTGEWDKLTQDK	X	0.5604	0.00308	0.3782	0.9946	8.35E+05
2	3	YGGVYVGTLSKPEVK	X	0.5512	0.00325	0.3138	0.9816	4.29E+05
3	2	YGGVYVGTLSKPEVK	X	0.5578	0.001	0.3925	0.9961	8.00E+05
4	3	LLQTPIDMSLKPNDAESEK	X	0.6389	0.08423	0.3737	0.9119	2000
5	2	MIEIMLPVFDAPQNLVEQAK	X	0.6331	0.00453	0.5965	0.979	1.63E+05
					SD
Hit	Accession	Score	Mass	L(L + H)	(geo)	#
10	P29311	363	30209	0.7744	1.108	3
BMH1_YEAST Protein BMH1 OS = Saccharomyces cerevisiae GN = BMH1 PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	QAFDDAIAELDTLSEESYK	X	0.7998	0.00255	0.5395	0.9946	4.35E+05
2	2	ISDDILSVLDSHLIPSATTGESK	X	0.625	0.01278	0.271	0.7283	1.76E+05
3	3	ISDDILSVLDSHLIPSATTGESK	X	0.7868	0.00158	0.1746	0.9972	1.49E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
11	P15108	361	81435	0.007455		6
HSC82_YEAST ATP-dependent molecular chaperone H5C82 OS = Saccharomyces cerevisiae
GN = HSC82 PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	AILFIPK	X	0.7304	0.00664	0.3427	0.9954	5.12E+04
2	2	RVDEGGAQDK	X	0.734	0.007	0.04224	0.965	9084
3	2	KDEDDKKPK		0.4443	0.1702	0.04474	0.339	2202
4	2	ALKDILGDQVEK	X	0.7398	0.01231	0.03927	0.8976	8.40E+04
5	3	VKEEVQELEELNK	X	0.711	0.00306	0.1697	0.9942	2.85E+05
6	2	LEEVDEEEEEKKPK	X	0.6241	0.03842	0.06528	0.873	2.25E+05
7	3	TLVDITKDFELEETDEEKAER	X	0.005607	0.09361	0.4759	0.9104	1.04E+07
					SD
Hit	Accession	Score	Mass	L(L + H)	(geo)	#
12	P46655	353	81369	0.8084		4
SYEC_YEAST Glutamyl-tRNA synthetase, cytoplasmic OS = Saccharomyces cerevisiae
GN = GUS1 PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	ANFEIDLPDAK	X	0.8028	0.00578	0.1682	0.9743	6.26E+05
2	2	IHLEGSEAPQEPK	X	0.8001	0.01046	0.2506	0.9636	5.39E+05
3	3	EKEEFQDSILEDLDLLGIK	X	0.8258	0.00576	0.2679	0.9657	5.87E+05
4	2	EKEEFQDSILEDLDLLGIK	X	0.7985	0.00441	0.3707	0.9948	1.96E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
13	P32589	346	77318	0.7318	1.014	3
HSP7F_YEAST Heat shock protein homolog SSE1 OS = Saccharomyces cerevisiae GN = SSE1
PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	EELEELVKPLLER	X	0.7536	0.03052	0.07918	0.8999	7.17E+04
2	2	GKLEEEYAPFASDAEK		0.6193	0.01623	0.1684	0.5929	1.11E+06
3	2	IIGLDYHHPDFEQESK	X	0.7328	0.01091	0.08547	0.9763	8.03E+04
4	3	QVEDEDHMEVFPAGSSF	X	0.7218	0.01002	0.3701	0.8889	1.59E+05
		PSTK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
14	P00560	322	44711	0.5639	1.448	3
PGK_YEAST Phosphoglycerate kinase OS = Saccharomyces cerevisiae GN = PGK1 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	VDFNVPLDGK	X	0.272	0.04331	0.3024	0.8665	1.97E+06
2	2	VLENTEIGDSIFDK		0.9987	0	0.8558	0.2984	5.35E+07
3	2	SSAAGNTVIIGGGDTATV	X	0.7606	0.00838	0.6009	0.9775	2.98E+06
		AK
4	2	GVEVVLPVDFIIADAFSAD	X	0.8169	0.00271	0.6174	0.9986	1.47E+06
		ANTK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
15	P00549	296	54807	0.7976	1.025	5
KPYK1_YEAST Pyruvate kinase 1 OS = Saccharomyces cerevisiae GN = PYK1 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	MNFSHGSYEYHK	X	0.7461	0.02847	0.1614	0.8404	2.71E+05
2	2	MNFSHGSYEYHK	X	0.8117	0.00999	0.1068	0.9731	4.19E+05
3	2	GVNLPGTDVDLPALSEK	X	0.8043	0.00272	0.5459	0.9882	6.30E+06
4	2	GDLGIEIPAPEVLAVQK	X	0.7994	0.001	0.5602	0.9987	7.61E+06
5	2	SEELYPGRPLAIALDTK		0.002097	3.304	0.1291	0.6758	1.89E+05
6	3	KSEELYPGRPLAIALDTK	X	0.7575	0.00877	0.1331	0.7972	1.12E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
16	P38720	295	53509	0.9328	1.029	4
6PGD1_YEAST 6-phosphogluconate dehydrogenase, decarboxylating 1 OS = Saccharomyces
cerevisiae GN = GND1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	SIIGATSIEDFISK	X	0.9129	0.001	0.1873	0.9973	1.68E+05
2	3	LGGFTDKEISDVFAK	X	0.949	0.00158	0.2086	0.9846	6.26E+05
3	2	AYREEPDLENLLFNK	X	0.936	0.00484	0.3345	0.723	3.06E+06
4	3	YGPSLMPGGSEEAWPHI	X	0.8712	0.00561	0.3785	0.9595	2.62E+05
		K
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
17	P04385	290	57907	0.6139	1.13	4
GAL1_YEAST Galactokinase OS = Saccharomyces cerevisiae GN = GAL1 PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	NPSITLINADPK	X	0.7365	0.001	0.5381	0.9953	2.36E+06
2	3	MLVLVEESLANKK	X	0.7882	0.0105	0.2982	0.9203	2.53E+05
3	2	SHSEEVIVPEFNSSAK	X	0.5377	0.04126	0.3609	0.9033	3.79E+06
4	2	VLNEKNPSITLINADPK	X	0.7577	0.00342	0.1352	0.9951	4.28E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
18	P04397	264	78146	0.6778		7
GAL10_YEAST Bifunctional protein GAL10 OS = Saccharomyces cerevisiae GN = GAL10 PE = 1
SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	1	LEVLTK	X	0.8734	0.001	0.01287	0.9936	9.32E+04
2	2	DYIHVVDLAK	X	0.8614	0.00158	0.2342	0.9952	1.38E+06
3	3	DYIHVVDLAK	X	0.9574	0	0.4691	0.9578	4.66E+05
4	2	AGDVLNLTAKPDR	X	0.8088	0.00531	0.07739	0.9941	4.67E+05
5	2	EIATFNSTKPTVLGPK	X	1.003	0.01104	0.02312	0.9843	1.39E+04
6	2	YAIENILNDLYNSDK	X	0.5331	0.02963	0.3656	0.7372	2.83E+06
7	2	SVDVDKNMIPTGNIVDR	X	0.8696	0.00158	0.2804	0.9956	3.03E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
19	P11484	262	66561	0.8176	1.003	3
HSP75_YEAST Heat shock protein SSB1 OS = Saccharomyces cerevisiae GN = SSB1 PE = 1
SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	LLSDFFDGK	X	0.8188	0.001	0.534	0.998	9.62E+05
2	2	RFDDESVQK	X	0.8212	0.00341	0.3458	0.9841	1.10E+06
3	2	ENTLLGEFDLK	X	0.8144	0.00158	0.4074	0.9981	1.59E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
20	P08431	261	42358	0.6343	8.653	3
GAL7_YEAST Galactose-1-phosphate uridylyltransferase OS = Saccharomyces cerevisiae
GN = GAL7 PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	EHNTDLFADYVK	X	0.01158	0.4988	0.2836	0.9602	5.87E+05
2	2	LDQPILPQNDSNEDNLK	X	0.918	0	0.8548	0.9997	6.17E+06
3	3	RPWLGQQEAAYKPTAPL	X	0.7836	0.01208	0.1133	0.9209	3.76E+05
		YDPK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
21	Q01560	247	45444			0
NOP3_YEAST Nucleolar protein 3 OS = Saccharomyces cerevisiae GN = NPL3 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
22	P07284	238	53677	0.2383		4
SYSC_YEAST Seryl-tRNA synthetase, cytoplasmic OS = Saccharomyces cerevisiae GN = SES1
PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	YIPGEPEFLPFVNELPK	X	0.8227	0.00158	0.4653	0.9473	1.11E+05
2	3	NASVEIVDEIISDYKDWVK	X	0.7951	0.00573	0.4831	0.9887	3.44E+05
3	2	NASVEIVDEIISDYKDWVK	X	0.7696	0.01392	0.1984	0.9426	6.67E+04
4	3	IEQFVITEPEKSWEEFEK	X	0.114	0.1522	0.1374	0.9075	8.56E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
23	P38088	234	75364	0.8224	1.006	2
SYG_YEAST Glycyl-tRNA synthetase 1 OS = Saccharomyces cerevisiae GN = GRS1 PE = 1
SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	IDDSGVSIGK	X	0.8259	0.01171	0.1781	0.9752	4.43E+05
2	2	LDDDVVKEYEEILAK	X	0.8161	0.01051	0.07847	0.9658	2.44E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
24	P17709	225	55342	0.1024	15.72	2
HXKG_YEAST Glucokinase-1 OS = Saccharomyces cerevisiae GN = GLK1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	EGHTLASDK	X	0.003844	0.1695	0.7656	0.9015	6.01E+05
2	2	YDVVIDQK	X	0.836	0.0107	0.2711	0.9649	9.39E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
25	P10592	223	69844	0.6324	1.099	3
HSP72_YEAST Heat shock protein SSA2 OS = Saccharomyces cerevisiae GN = SSA2 PE = 1
SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	MKETAESYLGAK	X	0.7735	0.00986	0.2692	0.9866	2.32E+05
2	2	NFNDPEVQGDMK	X	0.5921	0.01773	0.3417	0.9151	3.96E+05
3	3	NTISEAGDKLEQADKDAV	X	0.6179	0.00324	0.3113	0.9818	8.87E+05
		TK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
26	P34760	203	21688	0.8525		1
TSA1_YEAST Peroxiredoxin TSA1 OS = Saccharomyces cerevisiae GN = TSA1 PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	TAVVDGVFDEVSLDK	X	0.8525	0.003	0.2304	0.9765	1.37E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
27	P07806	202	126596	0.902	1.08	2
SYV_YEAST Valyl-tRNA synthetase, mitochondrial OS = Saccharomyces cerevisiae GN = VAS1
PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	TAEDQKDSIVSLIK	X	0.8245	0.0142	0.06813	0.9834	6.02E+04
2	2	TGEVIINPLKEDGSPK	X	0.9585	0.02748	0.09926	0.894	8.93E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
28	P39015	200	29977	0.8734	1.037	2
STM1_YEAST Suppressor protein STM1 OS = Saccharomyces cerevisiae GN = STM1 PE = 1
SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	TAQLSLQDYLNQQANNQ	X	0.9037	0.0159	0.345	0.8549	1.14E+05
		FNK
2	2	EAQADAAAEIAEDAAEAE	X	0.8405	0.03245	0.2666	0.956	1.01E+05
		DAGKPK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
29	P14540	196	39596	0.7378	1.02	2
ALF_YEAST Fructose-bisphosphate aldolase OS = Saccharomyces cerevisiae GN = FBA1 PE = 1
SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	GISNEGQNASIK	X	0.7232	0.00563	0.2971	0.9957	2.70E+06
2	2	LLPWFDGMLEADEAYFK	X	0.7527	0.00701	0.6657	0.9971	2.69E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
30	P07259	183	245990	0.6064		1
PYR1_YEAST Protein URA1 OS = Saccharomyces cerevisiae GN = URA2 PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	SISGPVITDVASLK	X	0.6064	0.03681	0.07372	0.792	2.43E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
31	P16521	177	115920	0.7059	1.311	3
EF3A_YEAST Elongation factor 3A OS = Saccharomyces cerevisiae GN = YEF3 PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	TQLRLKR	X	0.9013	0.00444	0.3845	0.99	2.38E+06
2	2	AYEELSNTDLEFK	X	0.7997	0.02628	0.5649	0.9771	1.97E+06
3	3	AYEELSNTDLEFKFPEPG	X	0.3863	0.03175	0.257	0.8484	1.37E+06
		YLEGVK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
32	P11412	168	57830	0.5867	1.242	2
G6PD_YEAST Glucose-6-phosphate 1-dehydrogenase OS = Saccharomyces cerevisiae
GN = ZWF1 PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	AVAPIDTDDVLLGQYGK	X	0.5629	0.04227	0.2849	0.9375	7.08E+05
2	3	SEDGSKPAYVDDDTVDK	X	0.7949	0.00856	0.1299	0.9748	9.45E+04
		DSK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
33	P07149	160	228547	0.8094		1
FAS1_YEAST Fatty acid synthase subunit beta OS = Saccharomyces cerevisiae GN = FAS1
PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	GNYTDFENTFQK	X	0.8094	0.01799	0.0845	0.9521	3.39E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
34	P28240	159	62369	0.3227		1
ACEA_YEAST Isocitrate lyase OS = Saccharomyces cerevisiae GN = ICL1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	LDADAAEIEK	X	0.3227	0.07711	0.202	0.9617	8.83E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
35	P00330	155	36800	0.8664	1.009	3
ADH1_YEAST Alcohol dehydrogenase 1 OS = Saccharomyces cerevisiae GN = ADH1 PE = 1
SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	VVGLSTLPEIYEK	X	0.8678	0.00158	0.5758	0.9962	2.12E+06
2	2	VLGIDGGEGKEELFR	X	0.8513	0.00158	0.397	0.9977	2.05E+06
3	3	VLGIDGGEGKEELFR	X	0.8778	0.00344	0.5496	0.9935	2.51E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
36	P32527	155	48990	0.8655		1
ZUO1_YEAST Zuotin OS = Saccharomyces cerevisiae GN = ZUO1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	ATTIDEQVGLIVDSLNDEE	X	0.8655	0.00448	0.4525	0.9613	2.75E+05
		LVSTADK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
37	P04806	155	53705	0.8304		1
HXKA_YEAST Hexokinase-1 OS = Saccharomyces cerevisiae GN = HXK1 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	LSGNHTFDTTQSK		0.1191	0.209	0.1488	0.6634	3.26E+05
2	3	TKYDVAVDEQSPRPGQQ	X	0.8304	0.01169	0.1392	0.9589	2.37E+04
		AFEK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
38	P05750	153	26486	0.7359		1
R53_YEAST 40S ribosomal protein S3 OS = Saccharomyces cerevisiae GN = RPS3 PE = 1 SV = 5
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	ALPDAVTIIEPKEEEPILAP	X	0.7359	0.01251	0.06703	0.9895	3.55E+05
		SVK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
39	P53252	152	38486	0.8196		1
PIL1_YEAST Sphingolipid long chain base-responsive protein PIL1 OS = Saccharomyces
cerevisiae GN = PIL1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	APTASQLQNPPPPPSTTK	X	0.8196	0.01915	0.2011	0.9301	1.74E+05
2	3	ALLELLDDSPVTPGETRP		0.6536	0.03193	0.2367	0.6395	5.49E+05
		AYDGYEASK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
40	P00817	151	32280	0.467		4
IPYR_YEAST Inorganic pyrophosphatase OS = Saccharomyces cerevisiae GN = IPP1 PE = 1
SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	LNDIEDVEK	X	0.3227	0.07711	0.202	0.9617	8.83E+05
2	3	LEITKEETLNPIIQDTK	X	0.736	0.01106	0.2893	0.9314	4.97E+05
3	3	AVGDNDPIDVLEIGETIAY	X	0.7062	0.00365	0.6552	0.992	1.59E+05
		TGQVK
4	2	AVGDNDPIDVLEIGETIAY	X	0.741	0.002	0.7827	0.9921	7.42E+04
		TGQVK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
41	Q03048	144	15891			0
COFI_YEAST Cofilin OS = Saccharomyces cerevisiae GN = COF1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	SGVAVADESLTAFNDLK		0.519	0.05769	0.1215	0.5982	3.04E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
42	P32324	142	93230	0.7058		3
EF2_YEAST Elongation factor 2 OS = Saccharomyces cerevisiae GN = EFT1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	WTNKDTDAEGKPLER	X	0.7908	0.00868	0.07043	0.8558	2.83E+05
2	2	WTNKDTDAEGKPLER	X	0.1675	0.2545	0.2121	0.7622	2.57E+05
3	3	GQVVSEEQRPGTPLFTV	X	0.8025	0.001	0.5728	0.9927	2.98E+06
		K
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
43	A6ZP47	141	65697			0
DED1_YEAS7 ATP-dependent RNA helicase DED1 OS = Saccharomyces cerevisiae (strain
YJM789) GN = DED1 PE = 3 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	DVPEPITEFTSPPLDGLLL		0.00021	5.488	0.7663	0.08765	2.92E+06
		ENIK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
44	P22515	139	114195	0.756		1
UBA1_YEAST Ubiquitin-activating enzyme E11 OS = Saccharomyces cerevisiae GN = UBA1
PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	SDDSNSKPNVDEYK	X	0.756	0.02454	0.07431	0.9725	4.83E+04
2	2	QFMYFDSLESLPDPK		0.000528	7.296	0.0675	0.6501	1.43E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
45	P38701	137	14011	0.6173		1
R520_YEAST 40S ribosomal protein S20 OS = Saccharomyces cerevisiae GN = RPS20 PE = 1
SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	EKVEEQEQQQQQIIK	X	0.6173	0.00734	0.2134	0.9546	6.58E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
46	P14742	133	80357			0
GFA1_YEAST Glucosamine--fructose-6-phosphate aminotransferase [isomerizing]
OS = Saccharomyces cerevisiae GN = GFA1 PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
47	P22768	133	47175			0
ASSY_YEAST Argininosuccinate synthase OS = Saccharomyces cerevisiae GN = ARG1 PE = 1
SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
48	P10664	131	39325	0.7018	1.054	3
RL4A_YEAST 60S ribosomal protein L4-A OS = Saccharomyces cerevisiae GN = RPL4A PE = 1
SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	IPEIPLVVSTDLESIQK	X	0.7524	0.00693	0.3528	0.9385	3.17E+05
2	2	IPEIPLVVSTDLESIQK	X	0.6885	0.00408	0.4963	0.9979	7.46E+05
3	3	IINSSEIQSAIRPAGQATQ	X	0.6478	0.00324	0.4073	0.9947	9.65E+04
		K
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
49	P35691	128	18849	0.8547		1
TCTP_YEAST Translationally-controlled tumor protein homolog OS = Saccharomyces cerevisiae
GN = TMA19 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	DIFSNDELLSDAYDAK	X	0.8547	0.00941	0.2439	0.9901	9.80E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
50	P15303	127	85331			0
SEC23_YEAST Protein transport protein 5EC23 OS = Saccharomyces cerevisiae GN = SEC23
PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	FFLPLEQVEFK		0.7553	0.01157	0.2147	0.5191	1.45E+05
2	2	KAGYQDDPQYADFK		0.9927	0.02465	0.1877	0.3964	5.07E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
51	Q03690	124	145076	0.5813		1
TIF31_YEAST Protein TIF31 OS = Saccharomyces cerevisiae GN = TIF31 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	DANTGEEVTEDFVNDINV	X	0.5813	0.0468	0.1058	0.8113	3.64E+05
		K
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
52	P04807	117	54189	0.7785	1.004	2
HXKB_YEAST Hexokinase-2 OS = Saccharomyces cerevisiae GN = HXK2 PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	ELMQQIENFEK	X	0.7802	0.01438	0.2465	0.9009	7.27E+05
2	3	GFDIPNIENHDVVPMLQK	X	0.7742	0.01687	0.1579	0.835	2.97E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
53	P43545	115	31998	0.06161		1
SNZ3_YEAST Probable pyridoxine biosynthesis protein SNZ3 OS = Saccharomyces cerevisiae
GN = SNZ3 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	TKGEAGTGDVSEAVK	X	0.06161	0.5232	0.2013	0.789	4.12E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
54	P17536	115	23527	0.3192		1
TPM1_YEAST Tropomyosin-1 OS = Saccharomyces cerevisiae GN = TPM1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	KNQQLEEDLEESDTK	X	0.3192	0.1604	0.08858	0.7363	1.43E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
55	P07264	112	85741			0
LEUC_YEAST 3-isopropylmalate dehydratase OS = Saccharomyces cerevisiae GN = LEU1 PE = 1
SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	EFEYKDQDQSSPK		0.302	0.09083	0.02215	0.6239	1.86E+05
2	3	DDQGKDQETDFVLNVEP		0.5589	0.01861	0.2447	0.6753	2.83E+06
		WR
3	2	DDQGKDQETDFVLNVEP		0.8426	0.002	0.7265	0.4088	5.60E+05
		WR
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
56	P05744	110	12219	0.6213		1
RL33A_YEAST 60S ribosomal protein L33-A OS = Saccharomyces cerevisiae GN = RPL33A
PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	IEGVATPQDAQFYLGK	X	0.6213	0.0083	0.1734	0.995	1.38E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
57	P36008	110	46491	0.8109		1
EF1G2_YEAST Elongation factor 1-gamma 2 OS = Saccharomyces cerevisiae GN = TEF4 PE = 1
SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	GQDFAPAFDVAPDWESY	X	0.8109	0.01799	0.3455	0.9756	2.24E+05
		EYTK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
58	P16862	108	104953	0.8294	1.029	2
K6PF2_YEAST 6-phosphofructokinase subunit beta OS = Saccharomyces cerevisiae GN = PFK2
PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	SSPDENSTLLSNDSISLK	X	0.8127	0.01294	0.187	0.9353	1.95E+05
2	3	AAEENFNADDKTISDTAA	X	0.8594	0.01841	0.2622	0.9073	1.12E+05
		VVGVK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
59	P11154	107	130539	0.9707		1
PYC1_YEAST Pyruvate carboxylase 1 OS = Saccharomyces cerevisiae GN = PYC1 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	SFLSPLETDEEIEVVIEQG	X	0.9707	0.00158	0.4859	0.886	1.52E+06
		K
2	3	EVFVSDGENVDSSDLLVL		0.5025	0.07115	0.1391	0.5886	1.13E+05
		LEDQVPVETK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
60	P52910	106	75765			0
ACS2_YEAST Acetyl-coenzyme A synthetase 2 OS = Saccharomyces cerevisiae GN = ACS2
PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	TGTEGIPMK		0.6962	0.01855	0.4457	0.1173	7.72E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
61	P35844	106	49461	0.7224		1
KES1_YEAST Protein KES1 OS = Saccharomyces cerevisiae GN = KES1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	NAPSGTLVGDKEDR	X	0.7224	0.06623	0.06821	0.8339	1.10E+05
2	3	DFDYSVTPEEGALVPEKD		0.6484	0.09516	0.283	0.6012	1.42E+05
		DTFLK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
62	P36010	105	17268			0
NDK_YEAST Nucleoside diphosphate kinase OS = Saccharomyces cerevisiae GN = YNK1 PE = 1
SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	TFIAVKPDGVQR		0.03719	0.7149	0.1927	0.2162	1.95E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
63	P04802	104	63861	0.8286		1
SYDC_YEAST Aspartyl-tRNA synthetase, cytoplasmic OS = Saccharomyces cerevisiae
GN = DPS1 PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	EIGDFEDLSTENEK	X	0.8286	0.00835	0.2225	0.9736	4.26E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
64	P12709	104	61582	0.7709	1.002	2
G6PI_YEAST Glucose-6-phosphate isomerase OS = Saccharomyces cerevisiae GN = PGI1 PE = 1
SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	ANKPMYVDGVNVAPEVD	X	0.7705	0.01145	0.2097	0.7988	5.44E+05
		SVLK
2	2	ANKPMYVDGVNVAPEVD	X	0.7726	0.02338	0.1041	0.9243	1.51E+05
		SVLK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
65	P15019	104	37302	0.8418	1.446	2
TAL1_YEAST Transaldolase OS = Saccharomyces cerevisiae GN = TAL1 PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	DYKGEADPGVISVK	X	0.9932	0.01166	0.08304	0.9874	3.01E+05
2	2	NLAGVDYLTISPALLDK	X	0.5131	0.1041	0.121	0.9331	6.69E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
66	P14120	103	11504	0.6528		1
RL30_YEAST 60S ribosomal protein L30 OS = Saccharomyces cerevisiae GN = RPL30 PE = 1
SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	VYYFQGGNNELGTAVGK	X	0.6528	0.01167	0.1559	0.9767	1.26E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
67	P22943	102	11806			0
HSP12_YEAST 12 kDa heat shock protein OS = Saccharomyces cerevisiae GN = HSP12 PE = 1
SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
68	P0C217	101	199542	0.8624	1.013	2
YL14B_YEAST Transposon Ty1-LR4 Gag-Pol polyprotein OS = Saccharomyces cerevisiae
GN = TY1B-LR4 PE = 3 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	DILSVDYTDIMK	X	0.8498	0.02246	0.04882	0.8124	1.27E+05
2	2	EVHTNQDPLDVSASK	X	0.8722	0.01118	0.2043	0.9837	1.65E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
69	P0C215	101	198422	0.8624	1.013	2
YL12B_YEAST Transposon Ty1-LR2 Gag-Pol polyprotein OS = Saccharomyces cerevisiae
GN = TY1B-LR2 PE = 3 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	DILSVDYTDIMK	X	0.8498	0.02246	0.04882	0.8124	1.27E+05
2	2	EVHTNQDPLDVSASK	X	0.8722	0.01118	0.2043	0.9837	1.65E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
70	P32598	101	35884	0.8363		1
PP12_YEAST Serine/threonine-protein phosphatase PP1-2 OS = Saccharomyces cerevisiae
GN = GLC7 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	GSKPGQQVDLEENEIR	X	0.8363	0.01279	0.1472	0.9874	4.79E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
71	P25087	99	43403	0.8036		1
ERG6_YEAST Sterol 24-C-methyltransferase OS = Saccharomyces cerevisiae GN = ERG6 PE = 1
SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	KPENAETPSQTSQEATQ	X	0.8036	0.04785	0.08929	0.8981	4.04E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
72	P08524	98	40458			0
FPPS_YEAST Farnesyl pyrophosphate synthase OS = Saccharomyces cerevisiae GN = FPP1
PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	IEQLYHEYEESIAK		0.3329	0.09842	0.4172	0.2092	1.03E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
73	P15705	97	66224			0
STI1_YEAST Heat shock protein ST11 OS = Saccharomyces cerevisiae GN = STI1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
74	P25694	97	92331	0.8407		1
CDC48_YEAST Cell division control protein 48 OS = Saccharomyces cerevisiae GN = CDC48
PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	NAPAIIFIDEIDSIAPK	X	0.8407	0.0034	0.1098	0.9968	8.16E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
75	P00942	96	26947	0.9321		1
TPIS_YEAST Triosephosphate isomerase OS = Saccharomyces cerevisiae GN = TPI1 PE = 1
SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	ASGAFTGENSVDQIK	X	0.9321	0.00579	0.6559	0.9989	1.71E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
76	P02400	95	11099			0
RLA4_YEAST 60S acidic ribosomal protein P2-beta OS = Saccharomyces cerevisiae
GN = RPP2B PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
77	P40069	94	122525			0
IMB4_YEAST Importin subunit beta-4 OS = Saccharomyces cerevisiae GN = KAP123 PE = 1
SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
78	P32481	93	57829	0.8691	1.017	2
IF2G_YEAST Eukaryotic translation initiation factor 2 subunit gamma OS = Saccharomyces
cerevisiae GN = GCD11 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	LGDEIEIRPGIVTK		0.9246	0.04186	0.2121	0.3448	9.63E+04
2	3	VAFTGLEEDGETEEEKR	X	0.888	0.00751	0.1402	0.8705	2.90E+05
3	2	EFEEGGGLPEQPLNPDF	X	0.8595	0.00652	0.4126	0.9885	5.61E+05
		SK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
79	Q12230	92	38048	0.8619		1
LSP1_YEAST Sphingolipid long chain base-responsive protein LSP1 OS = Saccharomyces
cerevisiae GN = LSP1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	APTAAELQAPPPPPSSTK	X	0.8619	0.03102	0.1585	0.8149	4.28E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
80	P0C0W9	90	19707			0
RL11A_YEAST 60S ribosomal protein L11-A OS = Saccharomyces cerevisiae GN = RPL11A
PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	VLEQLSGQTPVQSK		0.007131	0.04219	0.7402	0.3062	5.33E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
81	P38788	86	58515			0
SSZ1_YEAST Ribosome-associated complex subunit SSZ1 OS = Saccharomyces cerevisiae
GN = SSZ1 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
82	P41811	85	99383			0
COPB2_YEAST Coatomer subunit beta OS = Saccharomyces cerevisiae GN = SEC27 PE = 1
SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	GEIEEAIENVLPNVEGK		0.473	0.09943	0.113	0.5911	1.71E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
83	P38707	85	62168			0
SYNC_YEAST Asparaginyl-tRNA synthetase, cytoplasmic OS = Saccharomyces cerevisiae
GN = DED81 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	SVQYVLEDPIAGPLVK		0.5764	0.02059	0.2109	0.4796	4.80E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
84	P00899	85	56732			0
TRPE_YEAST Anthranilate synthase component 1 OS = Saccharomyces cerevisiae GN = TRP2
PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	ESFLLESAK		0.9519	0.00995	0.2493	0.2379	2.91E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
85	P0C2H6	83	15522	0.6874		1
RL27A_YEAST 60S ribosomal protein L27-A OS = Saccharomyces cerevisiae GN = RPL27A
PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	NQWFFSK		0.618	0.04071	0.1012	0.5142	1.00E+05
2	2	YTLDVEAFK	X	0.6874	0.04111	0.01567	0.7996	2.90E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
86	P26321	83	33890			0
RL5_YEAST 60S ribosomal protein L5 OS = Saccharomyces cerevisiae GN = RPL5 PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
87	P38115	83	38859	0.118		1
ARA1_YEAST D-arabinose dehydrogenase [NAD(P)+] heavy chain OS = Saccharomyces
cerevisiae GN = ARA1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	TMYAADGDYLETYK	X	0.118	0.1798	0.2653	0.8455	1.50E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
88	P32599	82	72057			0
FIMB_YEAST Fimbrin OS = Saccharomyces cerevisiae GN = SAC6 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
89	A6ZXP4	81	50248	0.3547		1
SUB2_YEAS7 ATP-dependent RNA helicase SUB2 OS = Saccharomyces cerevisiae (strain
YJM789) GN = SUB2 PE = 3 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	FLQNPLEIFVDDEAK	X	0.3547	0.08683	0.2049	0.8314	2.82E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
90	P28273	80	140340			0
YKV5_YEAST Uncharacterized protein YKL215C OS = Saccharomyces cerevisiae
GN = YKL215C PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
91	P15625	80	57804	0.7091		1
SYFA_YEAST Phenylalanyl-tRNA synthetase alpha chain OS = Saccharomyces cerevisiae GN = FRS2 PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	DLQDTFYIKDPLTADLPD	X	0.7091	0.04609	0.1531	0.7641	1.01E+05
		DK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
92	P38934	80	54606	0.2713		1
BFR1_YEAST Nuclear segregation protein BFR1 OS = Saccharomyces cerevisiae GN = BFR1
PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	INEIEESIASGDLSLVQE	X	0.2713	0.04844	0.1734	0.8316	7.51E+05
		K
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
93	P05317	78	33866	0.9997		1
RLA0_YEAST 60S acidic ribosomal protein P0 OS = Saccharomyces cerevisiae GN = RPP0
PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	GTIEIVSDVK	X	0.9997	0	0.5768	0.9991	4.62E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
94	P07257	78	40702			0
QCR2_YEAST Cytochrome b-c1 complex subunit 2, mitochondrial OS = Saccharomyces
cerevisiae GN = QCR2 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
95	P46367	77	56688	0.916		1
ALDH4_YEAST Potassium-activated aldehyde dehydrogenase, mitochondrial
OS = Saccharomyces cerevisiae GN = ALD4 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	IAPALVTGNTVVLK	X	0.916	0.00158	0.04226	0.9968	5.28E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
96	P16140	77	57713	0.5186		1
VATB_YEAST V-type proton ATPase subunit B OS = Saccharomyces cerevisiae GN = VMA2
PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	AIVQVFEGTSGIDVK	X	0.5186	0.06922	0.03856	0.8934	1.27E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
97	P39708	74	49596	0.9962		1
DHE5_YEAST NADP-specific glutamate dehydrogenase 2 OS = Saccharomyces cerevisiae
GN = GDH3 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	HIGKDTDVPAGDIGVGG	X	0.9962	0.0039	0.09871	0.9621	8.21E+05
		R
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
98	P15992	74	23865			0
HSP26_YEAST Heat shock protein 26 OS = Saccharomyces cerevisiae GN = HSP26 PE = 1
SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	VITLPDYPGVDADNIK		0.1164	0.2258	0.295	0.3292	2.05E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
99	B3LP78	73	55768			0
BLH1_YEAS1 Cysteine proteinase 1, mitochondrial OS = Saccharomyces cerevisiae (strain
RM11-1a) GN = LAP3 PE = 3 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
100	P32327	73	130638	0.6239	3.892	2
PYC2_YEAST Pyruvate carboxylase 2 OS = Saccharomyces cerevisiae GN = PYC2 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	NFLAPAEPDEEIEVTIEQ	X	0.894	0.01442	0.2074	0.9142	9.25E+05
		GK
2	3	DGESVDASDLLVVLEEE	X	0.09446	0.1607	0.3531	0.8345	1.76E+05
		TLPPSQK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
101	P37291	73	52186			0
GLYC_YEAST Serine hydroxymethyltransferase, cytosolic OS = Saccharomyces cerevisiae
GN = SHM2 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	LITSHLVDTDPEVDSIIKD		0.6945	0.07766	0.1892	0.388	1.35E+05
		EIER
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
102	P60010	73	41663	0.8046		1
ACT_YEAST Actin OS = Saccharomyces cerevisiae GN = ACT1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	QEYDESGPSIVHHK		0.674	0.07934	0.1333	0.5876	6.38E+04
2	2	QEYDESGPSIVHHK	X	0.8046	0.02603	0.1087	0.8907	1.96E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
103	P32582	72	56396			0
CBS_YEAST Cystathionine beta-synthase OS = Saccharomyces cerevisiae GN = CYS4 PE = 1
SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
104	P01095	71	8585			0
IPB2_YEAST Protease B inhibitors 2 and 1 OS = Saccharomyces cerevisiae GN = PBI2 PE = 1
SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	HNDVIENVEEDKEVHTN		0.7575	0.01705	0.129	0.6437	5.58E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
105	Q00955	71	250197	0.8507		1
ACAC_YEAST Acetyl-CoA carboxylase OS = Saccharomyces cerevisiae GN = FAS3 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	QLSDGGLLIAIGGK	X	0.8507	0.01702	0.06509	0.973	1.45E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
106	P22203	70	26455			0
VATE_YEAST V-type proton ATPase subunit E OS = Saccharomyces cerevisiae GN = VMA4
PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	EQSLDGIFEETK		0.3294	0.1126	0.06772	0.6913	3.41E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
107	P38249	70	110276	0.9265		1
ElF3A_YEAST Eukaryotic translation initiation factor 3 subunit A OS = Saccharomyces
cerevisiae GN = TIF32 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	TAGGSSPATPATPATPA	X	0.9265	0.00916	0.2441	0.9925	7.88E+04
		TPTPSSGPK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
108	P09435	69	70504			0
HSP73_YEAST Heat shock protein SSA3 OS = Saccharomyces cerevisiae GN = SSA3 PE = 1
SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
109	P32588	69	50758			0
PUB1_YEAST Nuclear and cytoplasmic polyadenylated RNA-binding protein PUB1
OS = Saccharomyces cerevisiae GN = PUB1 PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	QYFQVGGPIANIK		0.9947	0.002	0.3581	0.3382	2.32E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
110	P53900	68	15171	0.05129		1
PFD4_YEAST Prefoldin subunit 4 OS = Saccharomyces cerevisiae GN = GIM3 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	NNTQVTFEDQQK	X	0.05129	0.3627	0.09004	0.7859	1.49E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
111	P40825	68	107940			0
SYAC_YEAST Alanyl-tRNA synthetase, cytoplasmic OS = Saccharomyces cerevisiae GN = ALA1
PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	TFFETNENAPYLVK		0.9828	0.00532	0.346	0.5419	8.94E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
112	P38631	68	214712			0
FKS1_YEAST 1,3-beta-glucan synthase component FKS1 OS = Saccharomyces cerevisiae
GN = FKS1 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	ILAEETAAYEGNENEAE		0.01026	1.465	0.2542	0.6992	1.23E+05
		KEDALK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
113	P47079	67	61952			0
TCPQ_YEAST T-complex protein 1 subunit theta OS = Saccharomyces cerevisiae GN = CCT8
PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
114	P38205	66	78319			0
NCL1_YEAST tRNA (cytosine 5)-methyltransferase NCL1 OS = Saccharomyces cerevisiae
GN = NCL1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	LSSETPALESEGPQTK		0.5913	0.04967	0.1079	0.3943	3.39E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
115	P39939	65	13438			0
R526B_YEAST 40S ribosomal protein S26-B OS = Saccharomyces cerevisiae GN = RPS26B
PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	DLSEASVYPEYALPK		0.3176	0.05414	0.1397	0.3309	6.58E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
116	P35189	64	27423	0.8078		1
TAF14_YEAST Transcription initiation factor TFIID subunit 14 OS = Saccharomyces cerevisiae
GN = TAF14 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	SGSTEETTANTGTIGK	X	0.8078	0.02101	0.0963	0.9487	1.58E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
117	Q08972	64	134247			0
NEW1_YEAST [NU+] prion formation protein 1 OS = Saccharomyces cerevisiae GN = NEW1
PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	ASNLAKPSVDDDDSPAN		0.3162	0.05206	0.143	0.3829	2.23E+05
		IK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
118	P05736	63	27392	0.622	1.054	2
RL2_YEAST 60S ribosomal protein L2 OS = Saccharomyces cerevisiae GN = RPL2A PE = 1
SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	KVISSDAR	X	0.5777	0.00446	0.06036	0.9809	2.68E+04
2	3	ASLNVGNVLPLGSVPEG	X	0.624	0.00764	0.308	0.9797	6.09E+05
		TIVSNVEEKPGDR
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
119	P06367	61	14600			0
RS14A_YEAST 40S ribosomal protein S14-A OS = Saccharomyces cerevisiae GN = RPS14A
PE = 1 SV = 5
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
120	Q03195	60	68297	0.3246		1
RLI1_YEAST Translation initiation factor RLI1 OS = Saccharomyces cerevisiae GN = RLI1 PE = 1
SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	FDDPPEWQEIIK	X	0.3246	0.05303	0.04664	0.8258	2.37E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
121	P23638	60	28697			0
PSA4_YEAST Proteasome component Y13 OS = Saccharomyces cerevisiae GN = PRE9 PE = 1
SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
122	P33327	60	124254	0.9911	1.026	2
DHE2_YEAST NAD-specific glutamate dehydrogenase OS = Saccharomyces cerevisiae
GN = GDH2 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	GDIESISDK	X	1.001	0.00158	0.3693	0.9924	5.15E+05
2	2	LVSFWAPESELK	X	0.957	0.01189	0.05111	0.9876	1.49E+05
3	3	RNDTTLLEIVENLK		0.1906	0.2454	0.2091	0.5903	2.89E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
123	P17076	59	28107	0.7946		1
RL8A_YEAST 60S ribosomal protein L8-A OS = Saccharomyces cerevisiae GN = RPL8A PE = 1
SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	YRPETAAEK	X	0.7946	0.00569	0.2624	0.987	1.02E+05
2	3	SKQDASPKPYAVK		0.000859	3.397	0.2839	0.2521	2.27E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
124	P00815	58	87666			0
HIS2_YEAST Histidine biosynthesis trifunctional protein OS = Saccharomyces cerevisiae
GN = HIS4 PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	IKEEAEELTEAK		0.1694	0.3439	0.09508	0.2327	1.01E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
125	P02309	57	11361			0
H4_YEAST Histone H4 OS = Saccharomyces cerevisiae GN = HHF1 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	DSVTYTEHAK		0.3491	0.08223	0.2286	0.1483	5.70E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
126	P37299	57	8587	0.04592		1
QCR10_YEAST Cytochrome b-c1 complex subunit 10 OS = Saccharomyces cerevisiae
GN = QCR10 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	IPLLGPTLEDHTPPEDKP	X	0.04592	0.3578	0.08934	0.7487	1.68E+05
		N
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
127	P23287	55	63355	1		1
PP2B1_YEAST Serine/threonine-protein phosphatase 2B catalytic subunit A1
OS = Saccharomyces cerevisiae GN = CNA1 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	ILNMSTVALSKEPNLLKL	X	1	0.001	0.05272	0.9692	2.68E+05
		K
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
128	P38011	54	34784	0.7242		1
GBLP_YEAST Guanine nucleotide-binding protein subunit beta-like protein
OS = Saccharomyces cerevisiae GN = ASC1 PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	VFSLDPQYLVDDLRPEF	X	0.7242	0.00801	0.4127	0.9795	8.90E+05
		AGYSK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
129	P53200	54	28564	0.5579		1
AML1_YEAST N(6) adenine-specific DNA methyltransferase-like 1 OS = Saccharomyces
cerevisiae GN = AML1 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	EEQQHQEAFQK	X	0.5579	0.1156	0.04329	0.7172	6.21E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
130	P32190	52	80158			0
GLPK_YEAST Glycerol kinase OS = Saccharomyces cerevisiae GN = GUT1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
131	P19358	51	42470	0.9999		1
METK2_YEAST S-adenosylmethionine synthase 2 OS = Saccharomyces cerevisiae GN = SAM2
PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	TQLQKDIVEK	X	0.9999	0.00317	0.04256	0.7785	2.46E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
132	Q12363	50	48353	0.7508		1
WTMl_YEAST Transcriptional modulator WTM1 OS = Saccharomyces cerevisiae GN = WTM1
PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	YNPDDTIAPPQDATEES	X	0.7508	0.002	0.7573	0.9978	2.44E+05
		QTK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
133	P31539	47	102533	0.8569		1
H5104_YEAST Heat shock protein 104 OS = Saccharomyces cerevisiae GN = HSP104 PE = 1
SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	GADTNTPLEYLSK	X	0.8569	0.01624	0.2723	0.9822	3.21E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
134	P39935	46	107036	0.815		1
IF4F1_YEAST Eukaryotic initiation factor 4F subunit p150 OS = Saccharomyces cerevisiae
GN = TIF4631 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	LKETSDSTSTSTPTPTP	X	0.815	0.05328	0.1577	0.8433	8.82E+04
		STNDSK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
135	P35732	46	83923	0.9125		1
YKF4_YEAST Uncharacterized protein YKL054C OS = Saccharomyces cerevisiae
GN = YKL054C PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	EQVKEEEQTAEELEQE	X	0.9125	0.02943	0.623	0.9847	1.75E+05
		QDNVAAPEEEVTVVEEK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
136	P17255	45	119131			0
VATA_YEAST V-type proton ATPase catalytic subunit A OS = Saccharomyces cerevisiae
GN = TFP1 PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
137	P02294	45	14229	0.8421		1
H2B2_YEAST Histone H2B.2 OS = Saccharomyces cerevisiae GN = HTB2 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	QTHPDTGISQK	X	0.8421	0.00914	0.1463	0.9218	1.30E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
138	P02293	45	14244	0.8421		1
H2B1_YEAST Histone H2B.1 OS = Saccharomyces cerevisiae GN = HTB1 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	QTHPDTGISQK	X	0.8421	0.00914	0.1463	0.9218	1.30E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
139	P05749	43	13789			0
RL22A_YEAST 60S ribosomal protein L22-A OS = Saccharomyces cerevisiae GN = RPL22A
PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
140	P40204	43	8477	1		1
RUXG_YEAST Small nuclear ribonucleoprotein G OS = Saccharomyces cerevisiae GN = SMX2
PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	KVAGILR	X	1	0	0.07689	0.9937	4.35E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
141	P08518	43	139256			0
RPB2_YEAST DNA-directed RNA polymerase 11 subunit RPB2 OS = Saccharomyces cerevisiae
GN = RPB2 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
142	P05755	43	22421			0
RS9B_YEAST 40S ribosomal protein S9-B OS = Saccharomyces cerevisiae GN = RPS9B PE = 1
SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
143	Q01855	43	15992			0
RS15_YEAST 40S ribosomal protein S15 OS = Saccharomyces cerevisiae GN = RPS15 PE = 1
SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	LLEMSTEDFVK		0.384	0.05738	0.2239	0.6167	5.45E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
144	P26781	42	17898	1		1
RS11_YEAST 40S ribosomal protein S11 OS = Saccharomyces cerevisiae GN = RPS11A PE = 1
SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	1	NAGLGFK	X	1	0	0.701	0.9998	2.17E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
145	P00950	42	27784			0
PMG1_YEAST Phosphoglycerate mutase 1 OS = Saccharomyces cerevisiae GN = GPM1 PE = 1
SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	ccations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
146	P32380	41	112692	0.9554		1
NUF1_YEAST Protein NUF1 OS = Saccharomyces cerevisiae GN = NUF1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	IIDLQKK		0.9984	0.00413	0.00899	0.6498	1.06E+04
2	2	IEIENWK	X	0.9554	0.01028	0.1168	0.9842	1.57E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
147	P16120	41	57439			0
THRC_YEAST Threonine synthase OS = Saccharomyces cerevisiae GN = THR4 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	LYIAQEEIPDADLKDLIK		0.04854	0.3108	0.1234	0.3822	1.17E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
148	P43616	41	52838	0.6185		1
DUG1_YEAST Cys-Gly metallodipeptidase DUG1 OS = Saccharomyces cerevisiae GN = DUG1
PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	ILIDGIDEMVAPLTEK	X	0.6185	0.00821	0.1115	0.9559	3.58E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
149	P25294	38	37567	0.5309		1
SIS1_YEAST Protein SIS1 OS = Saccharomyces cerevisiae GN = SIS1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	YHPDKPTGDTEK	X	0.5309	0.05698	0.03541	0.7338	2.13E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
150	P0C0T4	37	12002	0.8113		1
RS25B_YEAST 40S ribosomal protein S25-B OS = Saccharomyces cerevisiae GN = RPS25B
PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	AQHAVILDQEK	X	0.8113	0.04438	0.03423	0.7174	2.04E+04
2	3	AQHAVILDQEKYDR		0.1884	0.06967	0.3797	0.1743	2.54E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
151	Q08438	37	73997			0
VHS3_YEAST Protein VHS3 OS = Saccharomyces cerevisiae GN = VHS3 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
152	Q05506	36	69890			0
SYRC_YEAST Arginyl-tRNA synthetase, cytoplasmic OS = Saccharomyces cerevisiae
GN = YDR341C PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	YGNEEALVK		0.1829	0.1367	0.1933	0.1382	3.93E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
153	P06168	36	44565			0
ILV5_YEAST Ketol-acid reductoisomerase, mitochondrial OS = Saccharomyces cerevisiae
GN = ILV5 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
154	P38167	36	123534	0.5931		1
ECM21_YEAST Protein ECM21 OS = Saccharomyces cerevisiae GN = ECM21 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	SRFNNLDK	X	0.5931	0.03207	0.03169	0.8355	1.66E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
155	P04076	34	52173			0
ARLY_YEAST Argininosuccinate lyase OS = Saccharomyces cerevisiae GN = ARG4 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
156	P61864	33	8552	0.8436		1
UBIQ_YEAST Ubiquitin OS = Saccharomyces cerevisiae GN = UBI1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	IQDKEGIPPDQQR	X	0.8436	0.00578	0.2069	0.9679	1.11E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
157	P54839	33	55324			0
HMCS_YEAST Hydroxymethylglutaryl-CoA synthase OS = Saccharomyces cerevisiae
GN = ERG13 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
158	P40482	33	103842			0
SEC24_YEAST Protein transport protein SEC24 OS = Saccharomyces cerevisiae GN = SEC24
PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
159	P05694	31	85807			0
METE_YEAST 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase
OS = Saccharomyces cerevisiae GN = MET6 PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	APEQFDEVVAAIGNK		0.8993	0.03287	0.3114	0.6099	7.32E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
160	P0C0W1	31	14705			0
RS22A_YEAST 40S ribosomal protein S22-A OS = Saccharomyces cerevisiae GN = RPS22A
PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
161	P06105	30	135689			0
SC160_YEAST Protein SCP160 OS = Saccharomyces cerevisiae GN = SCP160 PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	FQFLIDAEELKEK		0.2574	0.1495	0.03011	0.4086	8.22E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
162	P14065	30	35057	0.8654		1
GCY_YEAST Protein GCY OS = Saccharomyces cerevisiae GN = GCY1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	GYVVLPK	X	0.8654	0.0811	0.06444	0.8822	3.00E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
163	P52490	29	17561			0
UBC13_YEAST Ubiquitin-conjugating enzyme E2 13 OS = Saccharomyces cerevisiae
GN = UBC13 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
164	P38994	28	89754			0
MSS4_YEAST Probable phosphatidylinositol-4-phosphate 5-kinase MSS4 OS = Saccharomyces
cerevisiae GN = M554 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	ISAVTATSTTIK		0.000063	7.067	0.305	0.9995	4.66E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
165	P32893	28	63328			0
KRE11_YEAST Beta-glucan synthesis-associated protein KRE11 OS = Saccharomyces
cerevisiae GN = KRE11 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	ASEQLTKK		0.3303	0.2361	0.02043	0.1669	9586
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
166	A6ZPZ1	28	95169	0.999		1
YJ00_YEAS7 UPF0508 protein SCY_2952 OS = Saccharomyces cerevisiae (strain YJM789)
GN = SCY_2952 PE = 3 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	SIQVPLSPK	X	0.999	0.00323	0.07993	0.9881	3.06E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
167	P15891	28	65536			0
ABP1_YEAST Actin-binding protein OS = Saccharomyces cerevisiae GN = ABP1 PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	AEAPKPEVPEDEPEGEP		0.2106	0.08472	0.3799	0.4288	9.13E+05
		DVK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
168	P32074	27	105239	0.8225		1
COPG_YEAST Coatomer subunit gamma OS = Saccharomyces cerevisiae GN = SEC21 PE = 1
SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	SETTLDTTPEAESVPEK	X	0.8225	0.02368	0.1323	0.7806	1.44E+05
		R
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
169	P04801	27	84987			0
SYTC_YEAST Threonyl-tRNA synthetase, cytoplasmic OS = Saccharomyces cerevisiae
GN = THS1 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
170	B3RHV0	27	28726	0.954		1
RS3A1_YEAS1 40S ribosomal protein S1-A OS = Saccharomyces cerevisiae (strain RM11-1a)
GN = RPS1A PE = 3 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	LRVDEVQGK	X	0.954	0.00845	0.1571	0.9013	1.03E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
171	Q01217	27	95307			0
ARG56_YEAST Protein ARG5,6, mitochondrial OS = Saccharomyces cerevisiae GN = ARG5,6
PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
172	P32861	27	56234	0.7068		1
UGPA1_YEAST UTP--glucose-1-phosphate uridylyltransferase OS = Saccharomyces cerevisiae
GN = UGP1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	YEIISQQPENVSNLSK	X	0.7068	0.00158	0.1676	0.9848	2.66E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
173	Q12462	27	26995			0
PEX11_YEAST Peroxisomal membrane protein PMP27 OS = Saccharomyces cerevisiae
GN = PEX11 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
174	P53583	27	61628	0.9997		1
MPA43_YEAST Protein MPA43 OS = Saccharomyces cerevisiae GN = MPA43 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	ALQKCLQKLNIR	X	0.9997	0	0.5408	0.9792	4.03E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
175	P38737	26	211316	1		1
ECM29_YEAST Proteasome component ECM29 OS = Saccharomyces cerevisiae GN = ECM29
PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	LKNLLR	X	1	0	0.07689	0.9937	4.35E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
176	P40494	26	90976	1		1
PRK1_YEAST Actin-regulating kinase PRK1 OS = Saccharomyces cerevisiae GN = PRK1 PE = 1
SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	LKNLIR	X	1	0	0.07689	0.9937	4.35E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
177	P36048	26	114578	1		1
SN114_YEAST 114 kDa U5 small nuclear ribonucleoprotein component OS = Saccharomyces
cerevisiae GN = SNU114 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	LKNLLR	X	1	0	0.07689	0.9937	4.35E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
178	Q01846	26	130637	0.08842		1
MDM1_YEAST Structural protein MDM1 OS = Saccharomyces cerevisiae GN = MDM1 PE = 1
SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	TKIYIR	X	0.08842	0.1027	0.1197	0.9815	7.92E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
179	P04456	26	15924			0
RL25_YEAST 60S ribosomal protein L25 OS = Saccharomyces cerevisiae GN = RPL25 PE = 1
SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
180	Q99186	24	55352	1.007		1
AP2M_YEAST AP-2 complex subunit mu OS = Saccharomyces cerevisiae GN = APM4 PE = 1
SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	HSGSDFGNK	X	1.007	0.00775	0.03715	0.9671	4599
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
181	Q04922	23	53135	0.9994		1
MFB1_YEAST Mitochondrial F-box protein MFB1 OS = Saccharomyces cerevisiae GN = MFB1
PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	KDNPRLK	X	0.9994	0.00158	0.4699	0.9983	3.45E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
182	Q03786	23	22353			0
GNTK_YEAST Probable gluconokinase OS = Saccharomyces cerevisiae GN = YDR248C PE = 1
SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	KYRDLIR		0.000004	1211	0.06617	0.9937	3.09E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
183	P04147	23	64304			0
PABP_YEAST Polyadenylate-binding protein, cytoplasmic and nuclear OS = Saccharomyces
cerevisiae GN = PAB1 PE = 1 SV = 4
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	YQGVNLFVK		0.6493	0.04431	0.1257	0.2785	2.62E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
184	P13663	23	39519			0
DHAS YEAST Aspartate-semialdehyde dehydrogenase OS = Saccharomyces cerevisiae
GN = HOM2 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	IREDPLLDFK		0.18	0.182	0.08109	0.1847	7.16E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
185	P19097	23	207964			0
FAS2_YEAST Fatty acid synthase subunit alpha OS = Saccharomyces cerevisiae GN = FAS2
PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
186	P38264	23	21123			0
PHO88_YEAST Inorganic phosphate transport protein PHO88 OS = Saccharomyces cerevisiae
GN = PHO88 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	SALEHNEVK		0.942	0.01455	0.09329	0.575	5.32E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
187	P33203	23	69023	0.9927		1
PRP40_YEAST Pre-mRNA-processing protein PRP40 OS = Saccharomyces cerevisiae
GN = PRP40 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	YLSNRSADQLLK	X	0.9927	0.00412	0.2098	0.996	4.72E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
188	P32386	22	189043			0
YBT1_YEAST ATP-dependent bile acid permease OS = Saccharomyces cerevisiae GN = YBT1
PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	IFNMILNK		0.004101	0.9579	0.2443	0.5181	1.15E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
189	P40075	22	26909			0
SCS2_YEAST Vesicle-associated membrane protein-associated protein SCS2
OS = Saccharomyces cerevisiae GN = SCS2 PE = 1 SV = 3
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	YLISPDVHPAQNQNIQE		0.6453	0.1021	0.2303	0.4558	6.49E+04
		NK
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
190	Q06685	22	129674	1.008		1
VIP1_YEAST Inositol hexakisphosphate and diphosphoinositol-pentakisphosphate kinase
OS = Saccharomyces cerevisiae GN = VIP1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	SSTSHPKPR	X	1.008	0.02117	0.06128	0.7799	7778
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
191	P46962	21	38057			0
CTK2_YEAST CTD kinase subunit beta OS = Saccharomyces cerevisiae GN = CTK2 PE = 1
SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
192	P13188	21	93075	0.9115		1
SYQ_YEAST Glutaminyl-tRNA synthetase OS = Saccharomyces cerevisiae GN = GLN4 PE = 1
SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	SDFSENVDDKEFFR	X	0.9115	0.00801	0.1843	0.8822	6.60E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
193	Q02208	21	86313	0.9576		1
TOF2_YEAST Topoisomerase 1-associated factor 2 OS = Saccharomyces cerevisiae GN = TOF2
PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	AESKDLDLLR	X	0.9576	0.00992	0.5313	0.8332	4.35E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
194	P43544	21	25116	0.9621		1
SNO3_YEAST Probable glutamine amidotransferase SNO3 OS = Saccharomyces cerevisiae
GN = SNO3 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	LDGKDNGGQELIVAAK	X	0.9621	0.00918	0.1046	0.9559	1.74E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
195	P53254	21	141262			0
UTP22_YEAST U3 small nucleolar RNA-associated protein 22 OS = Saccharomyces cerevisiae
GN = UTP22 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	LSERLTLAQYK		0.002931	1.18	0.313	0.9968	1.09E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
196	Q12507	21	38997	0.9995		1
SFG1_YEAST Superficial pseudohyphal growth protein 1 OS = Saccharomyces cerevisiae
GN = SFG1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	TSSKNVK	X	0.9995	0.00158	0.4979	0.9993	2.25E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
197	Q06625	20	175551			0
GDE_YEAST Glycogen debranching enzyme OS = Saccharomyces cerevisiae GN = GDB1 PE = 1
SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
198	P17555	20	57486	0.7116		1
CAP_YEAST Adenylyl cyclase-associated protein OS = Saccharomyces cerevisiae GN = SRV2
PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	SDGGNIYLSK	X	0.7116	0.00648	0.07351	0.9734	7.93E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
199	Q012345	20	28402			0
IES3_YEAST Ino eighty subunit 3 OS = Saccharomyces cerevisiae GN = IE53 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	IDILTKIQENLLEEYQK		0.7775	0.1023	0.03577	0.4115	952.5
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
200	P32802	20	75914	0.9962		1
TMN1_YEAST Transmembrane 9 superfamily member 1 OS = Saccharomyces cerevisiae
GN = EMP70 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	KIYSSIK	X	0.9962	0.02516	0.03919	0.9666	1.24E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
201	P53295	20	40980	0.9333		1
YG3Y_YEAST Uncharacterized GTP-binding protein YGR173W OS = Saccharomyces
cerevisiae GN = YGR173W PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	3	CLYVYNKIDAVSLEEVD	X	0.9333	0.01137	0.1522	0.9687	5.58E+05
		K
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
202	P53244	20	65724	0.03843		1
ART5_YEAST Arrestin-related trafficking adapter 5 OS = Saccharomyces cerevisiae GN = ART5
PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	GRLVLFDK	X	0.03843	0.07779	0.03009	0.8963	8.52E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
203	P53598	20	35010	0.9917		1
SUCA_YEAST Succinyl-CoA ligase [ADP-forming] subunit alpha, mitochondrial
OS = Saccharomyces cerevisiae GN = LSC1 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	ESIPYDK	X	0.9917	0.001	0.4495	0.9852	2.95E+06
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
204	P48524	19	109107.00			0
BUL1_YEAST Ubiquitin ligase-binding protein BUL1 OS = Saccharomyces cerevisiae GN = BUL1
PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	SPSLHSPK		0.5209	0.06221	0.06108	0.3577	1.00E+05
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
205	P35172	19	89623			0
TREB_YEAST Probable trehalase OS = Saccharomyces cerevisiae GN = NTH2 PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	RAFRAAIK		0.05024	0.1466	0.00365	0.2201	1.25E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
206	P10963	18	61201			0
PCKA_YEAST Phosphoenolpyruvate carboxykinase [ATP] OS = Saccharomyces cerevisiae
GN = PCK1 PE = 1 SV = 2
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
207	P53133	18	30896	0.8643		1
YGL7_YEAST Uncharacterized protein YGL117W OS = Saccharomyces cerevisiae
GN = YGL117W PE = 1 SV = 1
									Modifi-
	z	Sequence	Incl.	L(L + H)	Std. Err.	Fraction	Correlation	Intensity	cations
1	2	TSLKITHRR	X	0.8643	0.01604	0.0279	0.7852	9.11E+04
Hit	Accession	Score	Mass	L(L + H)	SD(geo)	#
208	Q07913	17	38310			0
NSE1_YEAST Non-structural maintenance of chromosomes element 1 OS = Saccharomyces
cerevisiae GN = NSE1 PE = 1 SV = 1

TABLE 3
Ribosomal proteins used to establish the non-specifically associating baseline for ChAP-MS analyses.
The percentage light and standard deviation are listed for each ribosomal protein.
		Stdev		Stdev
Ribosomal Proteins	Glucose	Glucose	Galactose	Galactose
40S ribosomal protein S10-A OS = Saccharomyces cerevisiae GN = RPS10A	48.01%	1.14%	65.47%	0.00%
PE = 1 SV = 1
40S ribosomal protein S17-A OS = Saccharomyces cerevisiae GN = RPS17A	47.77%	0.00%	70.60%	4.47%
PE = 1 SV = 1
40S ribosomal protein S21-A OS = Saccharomyces cerevisiae GN = RPS21A	53.30%	1.79%	56.17%	1.13%
PE = 1 SV = 1
60S ribosomal protein L14-B OS = Saccharomyces cerevisiae GN = RPL14B	52.21%	4.40%	77.37%	10.01%
PE = 1 SV = 1
60S ribosomal protein L19 OS = Saccharomyces cerevisiae GN = RPL19A PE = 1	50.26%	1.25%	71.05%	5.03%
SV = 5
60S ribosomal protein L26-A OS = Saccharomyces cerevisiae GN = RPL26A	51.09%	0.00%	70.20%	0.00%
PE = 1 SV = 3
60S ribosomal protein L3 OS = Saccharomyces cerevisiae GN = RPL3 PE = 1	49.39%	5.09%	66.83%	7.02%
SV = 4
60S ribosomal protein L30 OS = Saccharomyces cerevisiae GN = RPL30 PE = 1	48.85%	4.03%	62.85%	4.95%
SV = 3
40S ribosomal protein S12 OS = Saccharomyces cerevisiae GN = RPS12 PE = 1	50.92%	13.06%	78.21%	1.50%
SV = 1
40S ribosomal protein S19-A OS = Saccharomyces cerevisiae GN = RPS19A	49.03%	1.43%	59.47%	1.64%
PE = 1 SV = 2
40S ribosomal protein S26-A OS = Saccharomyces cerevisiae GN = RPS26A	50.63%	2.36%	71.70%	4.02%
PE = 1 SV = 1
40S ribosomal protein S4 OS = Saccharomyces cerevisiae GN = RPS4A PE = 1	44.54%	11.51%	54.31%	4.61%
SV = 3
40S ribosomal protein S7-A OS = Saccharomyces cerevisiae GN = RPS7A	51.87%	2.38%	75.86%	6.19%
PE = 1 SV = 4
40S ribosomal protein S11 OS = Saccharomyces cerevisiae GN = RPS11A	49.48%	3.94%	74.42%	3.71%
PE = 1 SV = 3
60S acidic ribosomal protein P0 OS = Saccharomyces cerevisiae GN = RPP0	50.01%	2.91%	62.25%	3.64%
PE = 1 SV = 1
60S ribosomal protein L10 OS = Saccharomyces cerevisiae GN = RPL10 PE = 1	53.45%	2.89%	63.81%	2.66%
SV = 1
60S ribosomal protein L12 OS = Saccharomyces cerevisiae GN = RPL12A PE = 1	51.79%	1.15%	66.76%	2.02%
SV = 1
60S ribosomal protein L30 OS = Saccharomyces cerevisiae GN = RPL30 PE = 1	48.85%	4.03%	63.49%	4.82%
SV = 3
60S ribosomal protein L9-A OS = Saccharomyces cerevisiae GN = RPL9A PE = 1	49.58%	3.07%	58.70%	2.73%
SV = 2
40S ribosomal protein S1-B OS = Saccharomyces cerevisiae (strain YJM789)	47.63%	4.27%	75.33%	9.16%
GN = RPS1B PE = 3 SV = 1

TABLE 4
Proteins and PTMs specifically associating with GAL1 chromatin isolated from cells cultured in galactose. Proteins and histone
posttranslational modifications listed are greater than two standard deviations from the non-specific threshold (80.9% Light).
	% Light	Stdev
Protein Name	Glucose	Glucose
DNA-directed RNA polymerase II 140 kDa polypeptide (EC 2.7.7.6) (B150)- S cerevisiae	100.00%	0.00%
Histone H3K18acK23ac	100.00%	0.00%
Histone H2A.1 OS = Saccharomyces cerevisiae GN = HTA1 PE = 1 SV = 2	97.10%	6.02%
NAD-specific glutamate dehydrogenase OS = Saccharomyces cerevisiae GN = GDH2 PE = 1 SV = 1	96.09%	2.70%
Histone H4K5acK8ac	95.89%	0.00%
DNA-directed RNA polymerase II largest subunit (EC 2.7.7.6) (RNA polymerase II subunit 1) (B220) -	94.36%	4.99%
S cerevisiae
Histone H3K9acK14ac	93.62%	0.00%
Histone H4K12acK16ac	90.56%	3.00%
Histone H2B.1 OS = Saccharomyces cerevisiae GN = HTB1 PE = 1 SV = 2	89.59%	9.51%
Acetyl-CoA carboxylase OS = Saccharomyces cerevisiae GN = FAS3 PE = 1 SV = 2	89.04%	3.39%
6-phosphogluconate dehydrogenase, decarboxylating 1 OS = Saccharomyces cerevisiae GN = GND1 PE = 1	87.74%	3.05%
SV = 1
Probable inosine-5′-monophosphate dehydrogenase IMD3 OS = Saccharomyces cerevisiae GN = IMD3	87.19%	14.00%
PE = 1 SV = 1
Eukaryotic translation initiation factor 3 subunit A OS = Saccharomyces cerevisiae GN = TIF32 PE = 1 SV = 1	86.97%	7.61%
Histone H3K14ac	85.83%	4.48%
Histone H3 OS = Saccharomyces cerevisiae GN = HHT1 PE = 1 SV = 2	85.83%	4.48%
Zuotin OS = Saccharomyces cerevisiae GN = ZUO1 PE = 1 SV = 1	85.33%	5.43%
Protein GCY OS = Saccharomyces cerevisiae GN = GCY1 PE = 1 SV = 1	85.18%	7.02%
Histone H4 OS = Saccharomyces cerevisiae GN = HHF1 PE = 1 SV = 2	90.42%	8.84%
Actin-related protein 2/3 complex subunit 4 OS = Saccharomyces cerevisiae GN = ARC19 PE = 1 SV = 2	84.74%	4.60%
Translationally-controlled tumor protein homolog OS = Saccharomyces cerevisiae GN = TMA19 PE = 1 SV = 1	84.64%	1.50%
Suppressor protein STM1 OS = Saccharomyces cerevisiae GN = STM1 PE = 1 SV = 3	84.58%	5.36%
FACT complex subunit SPT16 OS = Saccharomyces cerevisiae GN = SPT16 PE = 1 SV = 1	84.24%	3.60%
Hexokinase-2 OS = Saccharomyces cerevisiae GN = HXK2 PE = 1 SV = 4	84.22%	5.92%
Alcohol dehydrogenase 1 OS = Saccharomyces cerevisiae GN = ADH1 PE = 1 SV = 4	83.55%	11.23%
Pyruvate carboxylase 1 OS = Saccharomyces cerevisiae GN = PYC1 PE = 1 SV = 2	82.51%	7.74%
Protein GAL3 OS = Saccharomyces cerevisiae GN = GAL3 PE = 1 SV = 2	81.95%	8.37%
Cell division control protein 48 OS = Saccharomyces cerevisiae GN = CDC48 PE = 1 SV = 3	80.99%	2.13%

TABLE 5
Proteins and PTMs specifically associating with GAL1 chromatin isolated from cells cultured
in glucose. Proteins and histone posttranslational modifications listed are greater
than two standard deviations from the non-specific threshold (56.18% Light).
	% Light	Stdev
Protein Name	Glucose	Glucose
Histone H3K36me3	100.00%	0.00%
Glucose-6-phosphate isomerase OS = Saccharomyces cerevisiae GN = PGI1 PE = 1 SV = 3	66.33%	12.98%
Magnesium-activated aldehyde dehydrogenase, cytosolic OS = Saccharomyces cerevisiae GN = ALD6	58.78%	9.50%
PE = 1 SV = 4
Phosphoglycerate mutase 1 OS = Saccharomyces cerevisiae GN = GPM1 PE = 1 SV = 3	58.62%	6.39%
Plasma membrane ATPase 1 OS = Saccharomyces cerevisiae GN = PMA1 PE = 1 SV = 2	58.47%	6.81%
Cystathionine gamma-lyase OS = Saccharomyces cerevisiae GN = CYS3 PE = 1 SV = 2	58.10%	3.72%
Enolase 1 OS = Saccharomyces cerevisiae GN = ENO1 PE = 1 SV = 2	57.88%	2.93%
Enolase 2 OS = Saccharomyces cerevisiae GN = ENO2 PE = 1 SV = 2	57.40%	2.33%
Heat shock protein SSA4 OS = Saccharomyces cerevisiae GN = SSA4 PE = 1 SV = 3	56.99%	4.82%
Cell division control protein 48 OS = Saccharomyces cerevisiae GN = CDC48 PE = 1 SV = 3	56.59%	4.13%
Hexokinase-2 OS = Saccharomyces cerevisiae GN = HXK2 PE = 1 SV = 4	56.50%	3.43%
Fatty acid synthase subunit alpha OS = Saccharomyces cerevisiae GN = FAS2 PE = 1 SV = 2	56.19%	6.29%

TABLE 6
TAL protein DNA-binding specificity. ChIP was performed for the TAL-PrA used in this
study and relative genomic binding was measured with qPCR at each sequence listed below.
Real time qPCR primers were used to amplify regions containing the indicated sequences
and enrichment of each was measured relative to ACT1. The standard error of three
analyses is shown. The first listed DNA sequence at GAL1 (highlighted gray) was used
to design the TAL protein. A BLAST search was used to identify the next five closest
binding sites in the S. cerevisiae genome. Mismatches of these five sequences
relative to the GAL1 sequence are shown in bold.
					ChIP-qPCR for
			Closest		TAL-PrA binding
Sequence	Chromosome	Coordinates	Gene	Locus tag	Relative to Actin
	ChrII	278829-278846	GAL1	YBR020W, promoter region	6.14 ± 0.28
GGGGTAATTAATCATTTT	ChrIV	823079-823066	SCC2	YDR180W	0.65 ± 0.06
TTATACATTAATCAGCGA	ChrXV	18844-18855	ENB1	between YOL159C	1.34 ± 0.13
				and YOL158C
GGGGTAATTAATGTAAAT	ChrXIV	614716-614705	IDP3	YNL009W,	0.94 ± 0.46
				promoter region
AAATTAATCAGCGGTGAC	ChrIX	88064-88053	REV7	YIL139C	0.77 ± 0.27
GGGGTAATTAAAATTTCT	ChrXVI	94211-94221	IQG1	YPL242C	0.76 ± 0.10

TABLE 7
Significant proteins (>2-fold enriched) identified with GAL1 promoter chromatin from cells grown in galactose-containing
media. The top 10% of proteins that are >15-fold enriched are highlighted in gray.
			Spectral	Spectral
		Molecular	Counts	Counts
Proteins	Weight	TAL-PrA	Wild type
	PMA1_YEAST	99,621.60	558	0
	YH11B_YEAST (+2)	202,825.20	273	0
	DED1_YEAS7 (+1)	65,554.50	261	0
	TIF31_YEAST	145,171.10	226	0
	PYR1_YEAST	245,129.90	1356	3
	EF3B_YEAST	115,871.60	220	0
	YO11A_YEAST	49,006.10	216	0
	RS3A2_YEAS1 (+3)	28,812.90	204	0
	RS3A1_YEAS1 (+4)	28,743.80	189	0
	YD12A_YEAST	49,187.40	188	0
	GAL2_YEAST	63,627.00	183	0
	ASSY_YEAST	46,941.00	177	0
	PDR5_YEAST	170,444.10	152	0
	FKS1_YEAST	214,859.40	151	0
	HSP7E_YEAST	70,086.90	150	0
	PDC6_YEAST	61,582.40	150	0
	BFR1_YEAST	54,641.70	137	0
	RL18_YEAST	20,563.70	129	0
	RS2_YEAST	27,450.20	126	0
	FKS2_YEAST	216,998.10	126	0
	6PGD2_YEAST	53,925.30	118	0
	HXT7_YEAST	62,736.00	108	0
	GAL3_YEAST	58,130.40	107	0
	MS116_YEAST	76,272.50	105	0
	ATC6_YEAST	135,274.80	98	0
	HXT6_YEAST	62,706.00	98	0
	IF2P_YEAST	112,271.50	98	0
	RPB1_YEAST	191,615.10	96	0
	GAS1_YEAST	59,583.20	94	0
	EIF3B_YEAS7	88,131.50	93	0
	PGM1_YEAST	63,114.70	91	0
	TCPG_YEAST	58,814.70	90	0
	SPT16_YEAST	118,636.00	88	0
	DBP1_YEAS7 (+1)	67,992.10	87	0
	ODP2_YEAST	51,819.70	87	0
	CLH_YEAST	187,243.20	173	1
	RS8_YEAST	22,490.40	86	0
	RPB2_YEAST	138,757.20	85	0
	GLNA_YEAST	41,767.10	80	0
	TOM40_YEAST	42,039.40	79	0
	C1TC_YEAST	102,207.30	76	0
	FBRL_YEAST	34,465.50	75	0
	SC160_YEAST	134,813.70	300	2
	SEC23_YEAST	85,387.60	73	0
	NOP56_YEAST	56,867.30	73	0
	PYRF_YEAST	29,240.40	71	0
	HOSC_YEAST	47,100.30	68	0
	NDH1_YEAST	62,776.50	67	0
	EIF3C_YEAS7	93,225.20	67	0
	ZUO1_YEAST	49,021.50	66	0
	TPS2_YEAST	102,978.90	63	0
	CARP_YEAST	44,501.00	63	0
	RRP5_YEAST	193,141.40	63	0
	KAPR_YEAST	47,220.30	62	0
Galactokinase OS = Saccharomycescerevisiae GN = GAL1 PE = 1 SV = 4	GAL1_YEAST	57,945.00	1350	11
Probable 2-methylcitrate dehydratase OS = Saccharomycescerevisiae	PRPD_YEAST	57,685.70	61	0
GN = PDH1 PE = 1 SV = 1
2-isopropylmalate synthase 2, mitochondrial OS = Saccharomyces	LEU9_YEAST	67,201.00	61	0
cerevisiae GN = LEU9 PE = 1 SV =1
NADH-cytochrome b5 reductase 2 OS = Saccharomycescerevisiae	MCR1_YEAS7	34,109.10	61	0
(strain YJM789) GN = MCR1 PE = 2 SV = 1	(+1)
6,7-dimethyl-8-ribityllumazine synthase OS = Saccharomyces	RIB4_YEAST	18,555.70	60	0
cerevisiae GN = RIB4 PE = 1 SV = 2
N-(5′-phosphoribosyl)anthranilate isomerase OS = Saccharomyces	TRPF_YEAST	24,144.90	60	0
cerevisiae GN = TRP1 PE = 1 SV = 2
Glutamate synthase [NADH] OS = Saccharomycescerevisiae	GLT1_YEAST	238,108.30	58	0
GN = GLT1 PE = 1 SV = 2
Nuclear localization sequence-binding protein OS = Saccharomyces	NSR1_YEAST	44,536.10	55	0
cerevisiae GN = NSR1 PE = 1 SV = 1
V-type proton ATPase subunit a, vacuolar isoform	VPH1_YEAST	95,533.10	55	0
OS = Saccharomycescerevisiae GN = VPH1 PE = 1 SV = 3
4-aminobutyrate aminotransferase OS = Saccharomycescerevisiae	GATA_YEAST	52,948.60	55	0
GN = UGA1 PE = 1 SV = 2
Dihydroorotate dehydrogenase OS = Saccharomycescerevisiae	PYRD_YEAST	34,802.70	54	0
GN = URA1 PE = 1 SV = 1
Eukaryotic translation initiation factor 2A OS = Saccharomyces	EIF2A_YEAST	71,307.10	54	0
cerevisiae GN = YGR054W PE = 1 SV = 1
60S ribosomal protein L32 OS = Saccharomycescerevisiae GN = RPL32	RL32_YEAST	14,771.80	53	0
PE = 1 SV = 1
60S ribosomal protein L15-A OS = Saccharomycescerevisiae	RL15A_YEAST	24,422.60	105	1
GN = RPL15A PE = 1 SV =3
Mitochondrial import receptor subunit TOM70 OS = Saccharomyces	TOM70_YEAS7	70,127.70	51	0
cerevisiae (strain YJM789) GN = TOM70 PE = 3 SV = 1	(+1)
Mitochondrial acidic protein MAM33 OS = Saccharomycescerevisiae	MAM33_YEAST	30,132.70	51	0
GN = MAM33 PE = 1 SV = 1
H/ACA ribonucleoprotein complex subunit 4 OS = Saccharomyces	CBF5_YEAST	54,706.30	51	0
cerevisiae GN = CBF5 PE = 1 SV = 1
60S ribosomal protein L8-A OS = Saccharomycescerevisiae	RL8A_YEAST	28,125.50	201	2
GN = RPL8A PE = 1 SV = 4
Eukaryotic translation initiation factor 2 subunit alpha	IF2A_YEAST	34,718.70	50	0
OS = Saccharomycescerevisiae GN = SUI2 PE = 1 SV = 1
NADPH--cytochrome P450 reductase OS = Saccharomycescerevisiae	NCPR_YEAST	76,744.20	50	0
GN = NCP1 PE = 1 SV = 3
Nucleolar protein 58 OS = Saccharomycescerevisiae (strain YJM789)	NOP58_YEAS7	56,959.80	98	1
GN = NOP58 PE = 3 SV = 1	(+1)
60S ribosomal protein L14-B OS = Saccharomycescerevisiae	RL14B_YEAST	15,153.20	97	1
GN = RPL14B PE = 1 SV = 1
Pentafunctional AROM polypeptide OS = Saccharomycescerevisiae	ARO1_YEAST	174,758.00	97	1
GN = ARO1 PE = 1 SV = 1
60S ribosomal protein L8-B OS = Saccharomycescerevisiae	RL8B_YEAST	28,112.80	193	2
GN = RPL8B PE = 1 SV = 3
GTP-binding protein RHO1 OS = Saccharomycescerevisiae GN = RHO1	RHO1_YEAST	23,152.00	48	0
PE = 1 SV 3
Invertase 2 OS = Saccharomycescerevisiae GN = SUC2 PE = 1 SV = 1	INV2_YEAST	60,641.00	48	0
	(+1)
Squalene synthase OS = Saccharomycescerevisiae GN = ERG9 PE = 1	FDFT_YEAST	51,722.50	48	0
SV = 2
Eukaryotic translation initiation factor 3 subunit B OS = Saccharomyces	EIF3B_YEAST	88,131.50	95	1
cerevisiae GN = PRT1 PE = 1 SV = 1
Cytochrome c iso-2 OS = Saccharomycescerevisiae GN = CYC7 PE = 1	CYC7_YEAST	12,532.80	47	0
SV = 1
ATP-dependent permease PDR15 OS = Saccharomycescerevisiae	PDR15_YEAST	172,261.80	47	0
GN = PDR15 PE = 1 SV = 1
60S ribosomal protein L28 OS = Saccharomycescerevisiae GN = RPL28	RL28_YEAST	16,722.90	46	0
PE = 1 SV = 2
Methionyl-tRNA synthetase, cytoplasmic OS = Saccharomyces	SYMC_YEAST	85,680.90	46	0
cerevisiae GN = MES1 PE = 1 SV = 4
Eukaryotic translation initiation factor 3 subunit G OS = Saccharomyces	EIF3G_YEAST	30,501.60	45	0
cerevisiae GN = TIF35 PE = 1 SV = 1
General transcriptional corepressor TUP1 OS = Saccharomyces	TUP1_YEAST	78,307.20	45	0
cerevisiae GN = TUP1 PE = 1 SV = 2
Heat shock protein 42 OS = Saccharomycescerevisiae GN = HSP42	HSP42_YEAST	42,817.50	44	0
PE = 1 SV = 1
60S ribosomal protein L15-B OS = Saccharomycescerevisiae	RL15B_YEAST	24,422.60	84	1
GN = RPL15B PE = 1 SV = 2
40S ribosomal protein S23 OS = Saccharomycescerevisiae	RS23_YEAST	16,038.30	42	0
GN = RPS23A PE = 1 SV = 1
T-complex protein 1 subunit theta OS = Saccharomycescerevisiae	TCPQ_YEAST	61,663.60	42	0
GN = CCT9 PE = 1 SV = 1
26S protease regulatory subunit 8 homolog OS = Saccharomyces	PRS8_YEAST	45,272.60	41	0
cerevisiae GN = RPT6 PE = 1 SV = 4
SDO1-like protein YHR087W OS = Saccharomycescerevisiae	SDO1L_YEAST	12,009.80	41	0
GN = YHR087W PE = 1 SV = 1
Mitochondrial escape protein 2 OS = Saccharomycescerevisiae	YME2_YEAST	96,692.20	40	0
GN = YME2 PE = 1 SV = 1
Alpha-soluble NSF attachment protein OS = Saccharomycescerevisiae	SEC17_YEAST	32,804.40	40	0
GN = SEC17 PE = 1 SV = 4
Protein translocation protein SEC63 OS = Saccharomycescerevisiae	SEC63_YEAST	75,348.10	40	0
GN = SEC63 PE = 1 SV = 2
Delta-1-pyrroline-5-carboxylate dehydrogenase, mitochondrial	PUT2_YEAST	64,437.50	40	0
OS = Saccharomycescerevisiae GN = PUT2 PE = 1 SV = 2
Polyamine N-acetyltransferase 1 OS = Saccharomycescerevisiae	PAA1_YEAST	21,948.70	79	1
GN = PAA1 PE = 1 SV = 1
40S ribosomal protein S22-B OS = Saccharomycescerevisiae	RS22B_YEAST	14,626.50	79	1
GN = RPS22B PE = 1 SV = 3
Phosphoinositide phosphatase SAC1 OS = Saccharomycescerevisiae	SAC1_YEAST	71,125.90	38	0
GN = SAC1 PE = 1 SV = 1
40S ribosomal protein S26-A OS = Saccharomycescerevisiae	RS26A_YEAST	13,505.00	38	0
GN = RPS26A PE = 1 SV = 1
26S proteasome regulatory subunit RPN2 OS = Saccharomyces	RPN2_YEAST	104,237.00	76	1
cerevisiae GN = RPN2 PE = 1 SV = 4
Translational activator GCN1 OS = Saccharomycescerevisiae	GCN1_YEAST	296,710.20	38	0
GN = GCN1 PE = 1 SV = 1
Dolichyl-diphosphooligosaccharide--protein glycosyltransferase	STT3_YEAST	81,532.90	38	0
subunit STT3 OS = Saccharomycescerevisiae GN = STT3 PE = 1 SV = 2
1,3-beta-glucanosyltransferase GAS5 OS = Saccharomycescerevisiae	GAS5_YEAST	51,870.70	38	0
GN = GAS5 PE = 1 SV = 1
Acyl-CoA-binding protein OS = Saccharomycescerevisiae GN = ACB1	ACBP_YEAST	10,061.80	38	0
PE = 1 SV = 3
Tricalbin-1 OS = Saccharomycescerevisiae GN = TCB1 PE = 1 SV = 1	TCB1_YEAST	133,581.30	37	0
NADP-specific glutamate dehydrogenase 2 OS = Saccharomyces	DHE5_YEAST	49,627.60	37	0
cerevisiae GN = GDH3 PE = 1 SV = 1
Dolichyl-phosphate-mannose--protein mannosyltransferase 1	PMT1_YEAST	92,678.00	37	0
OS = Saccharomycescerevisiae GN = PMT1 PE = 1 SV = 1
Mitochondrial import inner membrane translocase subunit TIM10	TIM10_YEAST	10,304.60	37	0
OS = Saccharomycescerevisiae GN = MRS11 PE = 1 SV = 1
Ornithine carbamoyltransferase OS = Saccharomycescerevisiae	OTC_YEAST	37,846.40	37	0
GN = ARG3 PE = 1 SV = 1
Putative magnesium-dependent phosphatase YER134C	MGDP1_YEAST	20,442.40	36	0
OS = Saccharomycescerevisiae GN = YER134C PE = 1 SV = 1
Eukaryotic translation initiation factor 4B OS = Saccharomyces	IF4B_YEAST	48,522.50	36	0
cerevisiae GN = TIF3 PE = 1 SV = 1
Mitochondrial escape protein 2 OS = Saccharomycescerevisiae (strain	YME2_YEAS7	96,662.30	36	0
YJM789) GN = YME2 PE = 3 SV = 1
Vesicle-associated membrane protein-associated protein SCS2	SCS2_YEAST	26,924.80	36	0
OS = Saccharomycescerevisiae GN = SCS2 PE = 1 SV = 3
Importin beta SMX1 OS = Saccharomycescerevisiae GN = SXM1 PE = 1	SXM1_YEAST	108,410.90	36	0
SV = 1
Inorganic phosphate transport protein PHO88 OS = Saccharomyces	PHO88_YEAST	21,138.00	36	0
cerevisiae GN = PHO88 PE = 1 SV = 1
Transcription elongation factor SPT6 OS = Saccharomycescerevisiae	SPT6_YEAST	168,298.50	71	1
GN = SPT6 PE = 1 SV = 1
T-complex protein 1 subunit delta OS = Saccharomycescerevisiae	TCPD_YEAST	57,605.60	35	0
GN = CCT4 PE = 1 SV = 2
5′-3′ exoribonuclease 1 OS = Saccharomycescerevisiae GN = KEM1	XRN1_YEAST	175,468.00	70	1
PE = 1 SV = 1
Fumarate reductase OS = Saccharomycescerevisiae GN = YEL047C	FRDS_YEAST	50,845.00	35	0
PE = 1 SV = 1
3-hydroxy-3-methylglutaryl-coenzyme A reductase 1	HMDH1_YEAST	115,629.10	34	0
OS = Saccharomycescerevisiae GN = HMG1 PE = 1 SV = 1
26S proteasome regulatory subunit RPN9 OS = Saccharomyces	RPN9_YEAST	45,785.80	34	0
cerevisiae GN = RPN9 PE = 1 SV = 1
Dolichyl-phosphate-mannose--protein mannosyltransferase 2	PMT2_YEAST	86,872.80	34	0
OS = Saccharomycescerevisiae GN = PMT2 PE = 1 SV = 2
Bifunctional protein GAL10 OS = Saccharomycescerevisiae	GAL10_YEAST	78,197.30	939	14
GN = GAL10 PE = 1 SV = 2
ATP-dependent bile acid permease OS = Saccharomycescerevisiae	YBT1_YEAST	189,172.20	33	0
GN = YBT1 PE = 1 SV = 2
Saccharopine dehydrogenase [NAD+, L-lysine-forming]	LYS1_YEAST	41,466.20	33	0
OS = Saccharomycescerevisiae GN = LYS1 PE = 1 SV = 3
Coatomer subunit gamma OS = Saccharomycescerevisiae GN = SEC21	COPG_YEAST	104,836.20	32	0
PE = 1 SV = 2
Cell division control protein 53 OS = Saccharomycescerevisiae	CDC53_YEAST	93,949.60	32	0
GN = CDC53 PE = 1 SV = 1
Rotenone-insensitive NADH-ubiquinone oxidoreductase, mitochondrial	NDI1_YEAST	57,252.80	32	0
OS = Saccharomycescerevisiae GN = NDI1 PE = 1 SV = 1
Argininosuccinate lyase OS = Saccharomycescerevisiae GN = ARG4	ARLY_YEAST	51,991.40	32	0
PE = 1 SV = 2
Zinc finger protein GIS2 OS = Saccharomycescerevisiae GN = GIS2	GIS2_YEAST	17,102.60	31	0
PE = 1 SV = 1
Protein kinase MCK1 OS = Saccharomycescerevisiae GN = MCK1	MCK1_YEAST	43,137.90	31	0
PE = 1 SV = 1
Malate dehydrogenase, peroxisomal OS = Saccharomycescerevisiae	MDHP_YEAST	37,187.20	31	0
GN = MDH3 PE = 1 SV = 3
T-complex protein 1 subunit zeta OS = Saccharomycescerevisiae	TCPZ_YEAST	59,925.90	31	0
GN = CCT6 PE = 1 SV = 1
ATP-dependent RNA helicase DBP2 OS = Saccharomycescerevisiae	DBP2_YEAST	61,001.20	30	0
GN = DBP2 PE = 1 SV = 1
Cytochrome B pre-mRNA-processing protein 6 OS = Saccharomyces	CBP6_YEAST	18,679.70	30	0
cerevisiae GN = CBP6 PE = 1 SV = 1
Protein DCS2 OS = Saccharomycescerevisiae GN = DCS2 PE = 1 SV = 3	DCS2_YEAST	40,941.80	30	0
Eukaryotic translation initiation factor 3 subunit A OS = Saccharomyces	EIF3A_YEAST	110,348.50	176	3
cerevisiae GN = TIF32 PE = 1 SV = 1
Glucose-signaling factor 2 OS = Saccharomycescerevisiae GN = GSF2	GSF2_YEAST	45,872.50	58	1
PE = 1 SV = 1
Glycerol-3-phosphate dehydrogenase [NAD+] 2, mitochondrial	GPD2_YEAST	49,422.10	29	0
OS = Saccharomycescerevisiae GN = GPD2 PE = 1 SV = 2
Prohibitin-2 OS = Saccharomycescerevisiae GN = PHB2 PE = 1 SV = 2	PHB2_YEAST	34,407.20	29	0
40S ribosomal protein S29-A OS = Saccharomycescerevisiae	RS29A_YEAST	6,660.70	29	0
GN = RPS29A PE = 1 SV = 3
DNA-directed RNA polymerase I subunit RPA1 OS = Saccharomyces	RPA1_YEAST	186,435.30	29	0
cerevisiae GN = RPA1 PE = 1 SV = 2
Protein transport protein SEC24 OS = Saccharomycescerevisiae	SEC24_YEAST	103,638.70	29	0
GN = SEC24 PE = 1 SV = 1
Carboxypeptidase Y OS = Saccharomycescerevisiae GN = PRC1 PE = 1	CBPY_YEAST	59,803.60	28	0
SV = 1
V-type proton ATPase subunit d OS = Saccharomycescerevisiae	VA0D_YEAST	39,792.40	28	0
GN = VMA6 PE = 1 SV = 2
Uncharacterized protein YJL171C OS = Saccharomycescerevisiae	YJR1_YEAST	43,014.50	28	0
GN = YJL171C PE = 1 SV = 1
Vacuolar protein sorting/targeting protein PEP1 OS = Saccharomyces	PEP1_YEAST	177,783.50	28	0
cerevisiae GN = PEP1 PE = 1 SV = 1
FACT complex subunit POB3 OS = Saccharomycescerevisiae	POB3_YEAST	62,995.20	28	0
GN = POB3 PE = 1 SV = 1
Uncharacterized mitochondrial membrane protein FMP10	FMP10_YEAST	27,698.90	28	0
OS = Saccharomycescerevisiae GN = FMP10 PE = 1 SV = 1
RNA annealing protein YRA1 OS = Saccharomycescerevisiae	YRA1_YEAST	24,956.30	27	0
GN = YRA1 PE = 1 SV = 2
Mitochondrial outer membrane protein OM45 OS = Saccharomyces	OM45_YEAST	44,582.00	27	0
cerevisiae GN = OM45 PE = 1 SV = 2
Mitochondrial import receptor subunit TOM5 OS = Saccharomyces	TOM5_YEAST	5,987.70	27	0
cerevisiae GN = TOM5 PE = 1 SV = 1
T-complex protein 1 subunit alpha OS = Saccharomycescerevisiae	TCPA_YEAST	60,482.30	27	0
GN = TCP1 PE = 1 SV = 2
Eukaryotic translation initiation factor 1A OS = Saccharomyces	IF1A_YEAST	17,435.70	26	0
cerevisiae GN = TIF11 PE = 1 SV = 1
Protein MSN5 OS = Saccharomycescerevisiae GN = MSN5 PE = 1 SV = 1	MSN5_YEAST	142,126.30	26	0
Putative fatty aldehyde dehydrogenase HFD1 OS = Saccharomyces	HFD1_YEAST	59,981.90	26	0
cerevisiae GN = HFD1 PE = 1 SV = 1
Ergosterol biosynthetic protein 28 OS = Saccharomycescerevisiae	ERG28_YEAST	17,135.80	26	0
GN = ERG28 PE = 1 SV = 1
Protein YRO2 OS = Saccharomycescerevisiae GN = YRO2 PE = 1 SV = 1	YRO2_YEAST	38,721.30	26	0
Methylene-fatty-acyl-phospholid synthase OS = Saccharomyces	PEM2_YEAST	23,151.10	26	0
cerevisiae GN = PEM2 PE = 1 SV = 1
Protein MKT1 OS = Saccharomycescerevisiae GN = MKT1 PE = 1 SV = 2	MKT1_YEAST	94,499.40	25	0
Protein MRH1 OS = Saccharomycescerevisiae GN = MRH1 PE = 1 SV = 1	MRH1_YEAST	36,192.40	25	0
Eukaryotic translation initiation factor 2 subunit beta	IF2B_YEAST	31,575.70	25	0
OS = Saccharomycescerevisiae GN = SUI3 PE = 1 SV = 2
Peroxiredoxin TSA2 OS = Saccharomycescerevisiae GN = TSA2 PE = 1	TSA2_YEAST	21,615.40	24	0
SV = 3
Endoplasmic reticulum vesicle protein 25 OS = Saccharomyces	TMEDA_YEAST	24,106.40	24	0
cerevisiae GN = ERV25 PE = 1 SV = 1
PKHD-type hydroxylase TPA1 OS = Saccharomycescerevisiae	TPA1_YEAST	74,044.60	24	0
GN = TPA1 PE = 1 SV = 1
SED5-binding protein 3 OS = Saccharomycescerevisiae GN = SFB3	SFB3_YEAST	103,953.30	24	0
PE = 1 SV = 1
D-lactate dehydrogenase [cytochrome] 3 OS = Saccharomyces	DLD3_YEAST	55,226.80	24	0
cerevisiae GN = DLD3 PE = 1 SV = 1
Single-stranded nucleic acid-binding protein OS = Saccharomyces	SSBP1_YEAST	32,989.90	47	1
cerevisiae GN = SBP1 PE = 1 SV = 2
Protein CWH43 OS = Saccharomycescerevisiae GN = CWH43 PE = 1	CWH43_YEAST	107,887.70	23	0
SV = 2
T-complex protein 1 subunit eta OS = Saccharomycescerevisiae	TCPH_YEAST	59,737.10	23	0
GN = CCT7 PE = 1 SV = 1
26S protease regulatory subunit 6B homolog OS = Saccharomyces	PRS6B_YEAST	47,971.50	23	0
cerevisiae GN = RPT3 PR = 1 SV = 1
NADH-cytochrome b5 reductase 1 OS = Saccharomycescerevisiae	NCB5R_YEAST	31,494.80	23	0
GN = CBR1 PE = 1 SV = 2
Glycogen debranching enzyme OS = Saccharomycescerevisiae	GDE_YEAST	174,978.70	46	1
GN = GDB1 PE = 1 SV = 1
C-5 sterol desaturase OS = Saccharomycescerevisiae GN = ERG3	ERG3_YEAST	42,731.70	23	0
PE = 1 SV = 1
13 kDa ribonucleoprotein-associated protein OS = Saccharomyces	SNU13_YEAST	13,569.40	23	0
cerevisiae GN = SNU13 PE = 1 SV = 1
UPF0202 protein KRE33 OS = Saccharomycescerevisiae GN = KRE33	KRE33_YEAST	119,353.80	23	0
PE = 1 SV = 1
Protein phosphatase PP2A regulatory subunit A OS = Saccharomyces	2AAA_YEAST	70,954.70	23	0
cerevisiae GN = TPD3 PE = 1 SV = 2
Eukaryotic translation initiation factor 2 subunit gamma	IF2G_YEAST	57,867.20	23	0
OS = Saccharomycescerevisiae GN = GCD11 PE = 1 SV = 1
Midasin OS = Saccharomycescerevisiae GN = MDN1 PE = 1 SV = 1	MDN1_YEAST	559,323.50	23	0
Galactose-1-phosphate uridylyltransferase OS = Saccharomyces	GAL7_YEAST	42,386.00	459	10
cerevisiae GN = GAL7 PE = 1 SV = 4
UPF0121 membrane protein YLL023C OS = Saccharomycescerevisiae	YL023_YEAST	32,187.70	22	0
GN = YLL023C PE = 1 SV = 1
Phosphatidylinositol transfer protein PDR16 OS = Saccharomyces	PDR16_YEAST	40,715.80	22	0
cerevisiae GN = PDR16 PE = 1 SV = 1
60S ribosomal protein L43 OS = Saccharomycescerevisiae	RL43_YEAST	10,090.80	22	0
GN = RPL43A PE = 1 SV = 2
Arginine biosynthesis bifunctional protein ARG7, mitochondrial	ARGJ_YEAST	47,850.20	22	0
OS = Saccharomycescerevisiae GN = ARG7 PE = 1 SV = 1
Probable family 17 glucosidase SCW4 OS = Saccharomycescerevisiae	SCW4_YEAST	40,172.20	22	0
GN = SCW4 PE = 1 SV = 1
26S protease subunit RPT4 OS = Saccharomycescerevisiae	PRS10_YEAST	49,410.10	22	0
GN = RPT4 PE = 1 SV = 4
60S ribosomal protein L3 OS = Saccharomycescerevisiae GN = RPL3	RL3_YEAST	43,757.90	219	5
PE = 1 SV = 4
Phosphoglucomutase-2 OS = Saccharomycescerevisiae GN = PGM2	PGM2_YEAST	63,091.20	345	8
PE = 1 SV = 1
Uncharacterized phosphatase YNL010W OS = Saccharomyces	YNB0_YEAST	27,481.40	43	1
cerevisiae GN = YNL010W PE = 1 SV = 1
Elongation factor 3A OS = Saccharomycescerevisiae GN = YEF3 PE = 1	EF3A_YEAST	115,996.20	892	21
SV = 3
Casein kinase II subunit alpha' OS = Saccharomycescerevisiae	CSK22_YEAST	39,405.00	21	0
GN = CKA2 PE = 1 SV = 2
54S ribosomal protein L12, mitochondrial OS = Saccharomyces	MNP1_YEAST	20,650.80	21	0
cerevisiae GN = MNP1 PE = 1 SV = 1
Nuclear protein SNF4 OS = Saccharomycescerevisiae GN = SNF4	SNF4_YEAST	36,402.50	21	0
PE = 1 SV = 1
Eukaryotic initiation factor 4F subunit p150 OS = Saccharomyces	IF4F1_YEAST	107,103.80	21	0
cerevisiae GN = TIF4631 PE = 1 SV = 2
Medium-chain fatty acid ethyl ester synthase/esterase 2	MCFS2_YEAST	51,256.90	21	0
OS = Saccharomycescerevisiae GN = EHT1 PE = 1 SV = 1
ABC transporter ATP-binding protein ARB1 OS = Saccharomyces	ARB1_YEAST	68,379.50	21	0
cerevisiae GN = ARB1 PE = 1 SV = 1
Cysteinyl-tRNA synthetase OS = Saccharomycescerevisiae	SYC_YEAST	87,533.90	21	0
GN = YNL247W PE = 1 SV = 1
Protein TTP1 OS = Saccharomycescerevisiae GN = TTP1 PE = 1 SV = 1	TTP1_YEAST	67,777.60	21	0
26S proteasome regulatory subunit RPN8 OS = Saccharomyces	RPN8_YEAST	38,313.90	21	0
cerevisiae GN = RPN8 PE = 1 SV = 3
NADH-cytochrome b5 reductase 1 OS = Saccharomycescerevisiae	NCB5R_YEAS7	31,422.60	21	0
(strain YJM789) GN = CBR1 PE = 2 SV = 2
ER membrane protein complex subunit 1 OS = Saccharomyces	EMC1_YEAST	87,185.00	21	0
cerevisiae GN = EMC1 PE = 1 SV = 1
Heat shock protein 78, mitochondrial OS = Saccharomycescerevisiae	HSP78_YEAST	91,340.80	292	7
GN = HSP78 PE = 1 SV = 2
Nuclear protein STH1/NPS1 OS = Saccharomycescerevisiae	STH1_YEAST	156,750.60	20	0
GN = STH1 PE = 1 SV = 1
mRNA-binding protein PUF3 OS = Saccharomycescerevisiae	PUF3_YEAST	98,070.00	20	0
GN = PUF3 PE = 1 SV = 1
Actin-interacting protein 1 OS = Saccharomycescerevisiae GN = AIP1	AIP1_YEAST	67,326.00	20	0
PE = 1 SV = 1
Cytochrome c iso-1 OS = Saccharomycescerevisiae GN = CYC1 PE = 1	CYC1_YEAST	12,182.50	80	2
SV = 2
CTP synthase 1 OS = Saccharomycescerevisiae GN = URA7 PE = 1	URA7_YEAST	64,711.50	20	0
SV = 2
Squalene monooxygenase OS = Saccharomycescerevisiae GN = ERG1	ERG1_YEAST	55,127.20	20	0
PE = 1 SV = 2
Putative aldehyde dehydrogenase-like protein YHR039C	MSC7_YEAST	71,322.60	20	0
OS = Saccharomycescerevisiae GN = MSC7 PE = 1 SV = 1
Glucosamine--fructose-6-phosphate aminotransferase [isomerizing]	GFA1_YEAST	80,048.70	78	2
OS = Saccharomycescerevisiae GN = GFA1 PE = 1 SV = 4
Uncharacterized GTP-binding protein OLA1 OS = Saccharomyces	OLA1_YEAST	44,175.90	155	4
cerevisiae GN = OLA1 PE = 1 SV = 1
Probable 1-acyl-sn-glycerol-3-phosphate acyltransferase	PLSC_YEAST	33,887.80	19	0
OS = Saccharomycescerevisiae GN = SLC1 PE = 1 SV = 1
Sporulation-specific protein 21 OS = Saccharomycescerevisiae	MPC70_YEAST	69,881.80	19	0
GN = SPO21 PE = 1 SV = 1
Cell division control protein 42 OS = Saccharomycescerevisiae	CDC42_YEAST	21,322.60	19	0
GN = CDC42 PE = 1 SV = 2
Serine/threonine-protein phosphatase PP-Z2 OS = Saccharomyces	PPZ2_YEAST	78,494.20	19	0
cerevisiae GN = PPZ2 PE = 1 SV = 4
Putative mitochondrial carrier protein YHM1/SHM1	YHM1_YEAST	33,217.70	19	0
OS = Saccharomycescerevisiae GN = YHM1 PE = 1 SV = 1
60S ribosomal protein L24-A OS = Saccharomycescerevisiae	RL24A_YEAST	17,614.40	38	1
GN = RPL24A PE = 1 SV = 1
60S ribosomal protein L35 OS = Saccharomycescerevisiae	RL35_YEAST	13,910.20	38	1
GN = RPL35A PE = 1 SV = 1
Mitochondrial respiratory chain complexes assembly protein RCA1	RCA1_YEAST	93,280.10	19	0
OS = Saccharomycescerevisiae GN = RCA1 PE = 1 SV = 2
Prohibition-1 OS = Saccharomycescerevisiae GN = PHB1 PE = 1 SV = 2	PHB1_YEAST	31,427.90	38	1
T-complex protein 1 subunit epsilon OS = Saccharomycescerevisiae	TCPE_YEAST	61,916.50	19	0
GN = CCT5 PE = 1 SV = 3
Translation machinery-associated protein 22 OS = Saccharomyces	DENR_YEAS7	22,495.70	19	0
cerevisiae (strain YJM789) GN = TMA22 PE = 3 SV = 1	(+1)
DnaJ homolog 1, mitochondrial OS = Saccharomycescerevisiae	MDJ1_YEAST	55,562.00	19	0
GN = MDJ1 PE = 1 SV = 1
Alpha,alpha-trehalose-phosphate synthase [UDP-forming] 56 kDa	TPS1_YEAST	56,148.30	76	2
subunit OS = Saccharomycescerevisiae GN = TPS1 PE = 1 SV = 2
Acetyl-coenzyme A synthetase 2 OS = Saccharomycescerevisiae	ACS2_YEAST	75,492.20	228	6
GN = ACS2 PE = 1 SV = 1
60S ribosomal protein L24-B OS = Saccharomycescerevisiae	RL24B_YEAST	17,548.10	38	1
GN = RPL24B PE = 1 SV = 1
Protein YGP1 OS = Saccharomycescerevisiae GN = YGP1 PE = 1 SV = 2	YGP1_YEAST	37,328.10	19	0
Actin-related protein 2/3 complex subunit 3 OS = Saccharomyces	ARPC3_YEAST	20,579.60	19	0
cerevisiae GN = ARC18 PE = 1 SV = 1
Isoleucyl-tRNA synthetase, cytoplasmic OS = Saccharomyces	SYIC_YEAST	122,988.30	262	7
cerevisiae GN = ILS1 PE = 1 SV = 1
Eukaryotic translation initiation factor 3 subunit I OS = Saccharomyces	EIF3I_YEAS7	38,756.20	37	1
cerevisiae (strain YJM789) GN = TIF34 PE = 3 SV = 1	(+1)
Dolichol-phosphate mannosyltransferase OS = Saccharomyces	DPM1_YEAST	30,363.40	73	2
cerevisiae GN = DPM1 PE = 1 SV = 3
40S ribosomal protein S29-B OS = Saccharomycescerevisiae	RS29B_YEAST	6,727.60	18	0
GN = RPS29B PE = 1 SV = 3
Pre-mRNA-splicing factor ATP-dependent RNA helicase PRP43	PRP43_YEAST	87,564.80	18	0
OS = Saccharomycescerevisiae GN = PRP43 PE = 1 SV = 1
Translocation protein SEC72 OS = Saccharomycescerevisiae	SEC72_YEAST	21,608.40	18	0
GN = SEC72 PE = 1 SV = 3
Transcription elongation factor SPT5 OS = Saccharomycescerevisiae	SPT5_YEAST	115,651.40	36	1
GN = SPT5 PE = 1 SV = 1
Endoplasmic reticulum transmembrane protein 1 OS = Saccharomyces	YET1_YEAST	23,428.60	18	0
cerevisiae GN = YET1 PE = 1 SV = 1
Ferrochelatase, mitochondrial OS = Saccharomycescerevisiae	HEMH_YEAST	44,597.70	18	0
GN = HEM15 PE = 1 SV = 1
Protein CBP3, mitochondrial OS = Saccharomycescerevisiae	CBP3_YEAST	39,085.40	18	0
GN = CBP3 PE = 1 SV = 1
Putative protein disulfide-isomerase YIL005W OS = Saccharomyces	YIA5_YEAST	81,223.80	18	0
cerevisiae GN = YIL005W PE = 1 SV = 1
Mitochondrial protein import protein MAS5 OS = Saccharomyces	MAS5_YEAST	44,671.70	72	2
cerevisiae GN = YDJ1 PE = 1 SV = 1
Peroxisomal-coenzyme A synthetase OS = Saccharomycescerevisiae	FAT2_YEAST	60,489.90	18	0
GN = FAT2 PE = 1 SV = 1
Nuclear cap-binding protein complex subunit 1 OS = Saccharomyces	NCBP1_YEAST	100,023.30	36	1
cerevisiae GN = STO1 PE = 1 SV = 2
Proteasome component Y13 OS = Saccharomycescerevisiae	PSA4_YEAST	28,715.80	18	0
GN = PRE9 PE = 1 SV = 1
Trehalose synthase complex regulatory subunit TSL1	TSL1_YEAST	123,021.70	70	2
OS = Saccharomycescerevisiae GN = TSL1 PE = 1 SV = 1
Ribosomal RNA-processing protein 12 OS = Saccharomycescerevisiae	RRP12_YEAST	137,515.10	17	0
GN = RRP12 PE = 1 SV = 1
U3 small nucleolar RNA-associated protein 22 OS = Saccharomyces	UTP22_YEAST	140,492.90	17	0
cerevisiae GN = UTP22 PE = 1 SV = 1
40S ribosomal protein S26-B OS = Saccharomycescerevisiae	RS26B_YEAST	13,447.00	34	1
GN = RPS26B PE = 1 SV = 1
Elongator complex protein 1 OS = Saccharomycescerevisiae	ELP1_YEAST	152,994.20	17	0
GN = IKI3 PE = 1 SV = 1
Probable 1,3-beta-glucanosyltransferase GAS3 OS = Saccharomyces	GAS3_YEAST	56,796.00	17	0
cerevisiae GN = GAS3 PE = 1 SV = 1
Dynamin-related protein DNM1 OS = Saccharomycescerevisiae	DNM1_YEAST	84,976.60	68	2
GN = DNM1 PE = 1 SV = 1
Pyruvate dehydrogenase complex protein X component, mitochondrial	ODPX_YEAST	45,363.80	34	1
OS = Saccharomycescerevisiae GN = PDX1 PE = 1 SV = 1
GTP-binding protein RHO3 OS = Saccharomycescerevisiae GN = RHO3	RHO3_YEAST	25,312.80	17	0
PE = 1 SV = 2
DNA-directed RNA polymerase I subunit RPA2 OS = Saccharomyces	RPA2_YEAST	135,745.40	33	1
cerevisiae GN = RPA2 PE = 1 SV = 1
54S ribosomal protein YmL6, mitochondrial OS = Saccharomyces	RL4P_YEAST	31,970.50	16	0
cerevisiae GN = YML6 PE = 1 SV = 1
ER-derived vesicles protein ERV29 OS = Saccharomycescerevisiae	ERV29_YEAST	35,014.90	16	0
GN = ERV29 PE = 1 SV = 1
54S ribosomal protein L3, mitochondrial OS = Saccharomyces	RM03_YEAST	44,001.20	16	0
cerevisiae GN = MRPL3 PE = 1 SV = 2
Pyrroline-5-carboxylate reductase OS = Saccharomycescerevisiae	P5CR_YEAST	30,131.40	16	0
GN = PRO3 PE = 1 SV = 1
60S ribosomal protein L34-A OS = Saccharomycescerevisiae	RL34A_YEAST	13,639.20	16	0
GN = RPL34A PE = 1 SV = 1	(+1)
Serine/threonine-protein kinase YPK1 OS = Saccharomycescerevisiae	YPK1_YEAST	76,483.80	16	0
GN = YPK1 PE = 1 SV = 2
60S ribosomal protein L19 OS = Saccharomycescerevisiae	RL19_YEAST	21,704.60	32	1
GN = RPL19A PE = 1 SV = 5
CDP-diacyclglycerol--inositol 3-phosphatidyltransferase	PIS_YEAST	24,824.30	16	0
OS = Saccharomycescerevisiae GN = PIS1 PE = 1 SV = 1
60S ribosome subunit biogenesis protein NIP7 OS = Saccharomyces	NIP7_YEAST	20,381.10	16	0
cerevisiae GN = NIP7 PE = 1 SV = 1
Cell division control protein 10 SO = Saccharomycescerevisiae	CDC10_YEAST	37,026.30	16	0
GN = CDC10 PE = 1 SV = 1
E3 ubiquitin-protein ligase RSP5 OS = Saccharomycescerevisiae	RSP5_YEAST	91,817.40	16	0
GN = RSP5 PE = 1 SV = 1
Glucan 1,3-beta-glucosidase I/II OS = Saccharomycescerevisiae	EXG1_YEAST	51,312.30	16	0
GN = EXG1 PE = 1 SV = 1
Eukaryotic translation initiation factor 5A-2 OS = Saccharomyces	IF5A2_YEAST	17,114.60	346	11
cerevisiae GN = HYP2 PE = 1 SV = 3
1,4-alpha-glucan-branching enzyme OS = Saccharomycescerevisiae	GLGB_YEAST	81,118.50	31	1
GN = GLC3 PE = 1 SV = 2
Polyadenylate-binding protein, cytoplasmic and nuclear	PABP_YEAST	64,345.40	183	6
OS = Saccharomycescerevisiae GN = PAB1 PE = 1 SV = 4
Protein GCY OS = Saccharomycescerevisiae GN = GCY1 PE = 1 SV = 1	GCY_YEAST	35,079.90	272	9
Putative thiosulfate sulfurtransferase YOR285W OS = Saccharomyces	YO285_YEAST	15,413.30	30	1
cerevisiae GN = YOR285W PE = 1 SV = 1
DNA topoisomerase 2-associate protein PAT1 OS = Saccharomyces	PAT1_YEAST	88,499.40	15	0
cerevisiae GN = PAT1 PE = 1 SV = 3
CAAX prenyl protease 1 OS = Saccharomycescerevisiae GN = STE24	STE24_YEAST	52,327.50	15	0
PE = 1 SV = 1
Endoplasmic reticulum transmembrane protein 3 OS = Saccharomyces	YET3_YEAST	22,904.20	15	0
cerevisiae GN = YET3 PE = 1 SV = 1
ATP-dependent RNA helicase DOB1 OS = Saccharomycescerevisiae	MTR4_YEAST	122,058.70	15	0
GN = MTR4 PE = 1 SV = 1
Translation machinery-associated protein 17 OS = Saccharomyces	TMA17_YEAST	16,771.90	15	0
cerevisiae GN = TMA17 PE = 1 SV = 1
Carbon catabolite-derepressing protein kinase OS = Saccharomyces	SNF1_YEAST	72,047.90	15	0
cerevisiae GN = SNF1 PE = 1 SV = 1
tRNA (cytosine-5-)-methyltransferase NCL1 OS = Saccharomyces	NCL1_YEAST	77,879.60	15	0
cerevisiae GN = NCL1 PE = 1 SV = 1
Protein transport protein SEC61 OS = Saccharomycescerevisiae	SC61A_YEAST	52,940.20	15	0
GN = SEC61 PE = 1 SV = 1
Calcineurin subunit B OS = Saccharomycescerevisiae GN = CNB1	CANB_YEAST	19,640.10	15	0
PE = 1 SV = 3
Lysophospholipase 1 OS = Saccharomycescerevisiae GN = PLB1 PE = 1	PLB1_YEAST	71,670.00	15	0
SV = 2
Proteasome component Y7 OS = Saccharomycescerevisiae GN = PRE8	PSA2_YEAST	27,163.10	15	0
PE = 1 SV = 1
Metal resistance protein YCF1 OS = Saccharomycescerevisiae	YCFI_YEAST	171,129.30	15	0
GN = YCF1 PE = 1 SV = 2
Ran GTPase-activating protein 1 OS = Saccharomycescerevisiae	RNA1_YEAST	45,817.80	15	0
GN = RNA1 PE = 1 SV = 2
L-aminoadipate-semialdehyde dehydrogenase OS = Saccharomyces	LYS2_YEAST	155,350.80	30	1
cerevisiae GN = LYS2 PE = 1 SV = 2
Serine hydroxymethyltransferase, mitochondrial OS = Saccharomyces	GLYM_YEAST	53,688.00	30	1
cerevisiae GN = SHM1 PE = 1 SV = 2
Coatomer subunit alpha OS = Saccharomycescerevisiae GN = RET1	COPA_YEAST	135,611.20	89	3
PE = 1 SV = 2
40S ribosomal protein S10-B OS = Saccharomycescerevisiae	RS10B_YEAST	12,738.70	89	3
GN = RPS10B PE = 1 SV = 1
40S ribosomal protein S10-A OS = Saccharomycescerevisiae	RS10A_YEAST	12,739.70	89	3
GN = RPS10A PE = 1 SV = 1
Tryptophan synthase OS = Saccharomycescerevisiae GN = TRP5 PE = 1	TRP_YEAST	76,626.60	59	2
SV = 1
Serine/threonine-protein phosphatase PP1-2 OS = Saccharomyces	PP12_YEAST	35,909.00	58	2
cerevisiae GN = GLC7 PE = 1 SV = 1
Aminopeptidase Y OS Saccharomycescerevisiae GN = APE3 PE = 1	APE3_YEAST	60,139.20	29	1
SV = 1
Glycerol-3-phosphate dehydrogenase [NAD+] 1 OS = Saccharomyces	GPD1_YEAST	42,868.60	115	4
cerevisiae GN = GPD1 PE = 1 SV = 4
Valyl-tRNA synthetase, mitochondrial OS = Saccharomycescerevisiae	SYV_YEAST	125,774.70	172	6
GN = VAS1 PE = 1 SV = 2
Aconitate hydratase, mitochondrial OS = Saccharomycescerevisiae	ACON_YEAST	85,371.60	688	24
GN = ACO1 PE = 1 SV = 2
Elongation factor Tu, mitochondrial OS = Saccharomycescerevisiae	EFTU_YEAST	47,972.90	57	2
GN = TUF1 PE = 1 SV = 1
Glycerol-3-phosphate O-acyltransferase 2 OS = Saccharomyces	GPT2_YEAST	83,648.60	14	0
cerevisiae GN = GPT2 PE = 1 SV = 1
Putative ribosomal RNA methyltransferase Nop2 OS = Saccharomyces	NOP2_YEAST	69,814.30	14	0
cerevisiae GN = NOP2 PE = 1 SV = 1
Serine/threonine-protein kinase YPK2/YKR2 OS = Saccharomyces	YPK2_YEAST	76,669.00	14	0
cerevisiae GN = YPK2 PE = 1 SV = 1
Xanthine phosphoribosyltransferase 1 OS = Saccharomycescerevisiae	XPT1_YEAST	23,672.00	14	0
GN = XPT1 PE = 1 SV = 1
3-hydroxy-3-methylglutaryl-coenzyme A reductase 2	HMDH2_YEAST	115,696.90	14	0
OS = Saccharomycescerevisiae GN = HMG2 PE = 1 SV = 1
3-keto-steroid reductase OS = Saccharomycescerevisiae GN = ERG27	ERG27_YEAST	39,726.60	14	0
PE = 1 SV = 1
Ras-like protein 2 OS = Saccharomycescerevisiae GN = RAS2 PE = 1	RAS2_YEAST	34,705.00	14	0
SV = 4
Protein phosphatase 1 regulatory subunit SDS22 OS = Saccharomyces	SDS22_YEAST	38,890.20	14	0
cerevisiae GN = SDS22 PE = 1 SV = 1
Ubiquitin-like protein SMT3 OS = Saccharomycescerevisiae GN = SMT3	SMT3_YEAST	11,597.50	28	1
PE = 1 SV = 1
Sphingosine-1-phosphate lyase OS = Saccharomycescerevisiae	SGPL_YEAST	65,567.50	14	0
GN = DPL1 PE = 1 SV = 1
Protein transport protein SSS1 OS = Saccharomycescerevisiae	SC61G_YEAST	8,943.80	14	0
GN = SSS1 PE = 1 SV = 2
UPF0674 endoplasmic reticulum membrane protein YNR021W	YN8B_YEAST	47,095.10	14	0
OS = Saccharomycescerevisiae GN = YNR021W PE = 1 SV = 3
Non-classical export protein 2 OS = Saccharomycescerevisiae	NCE2_YEAST	18,967.70	14	0
GN = NCE102 PE = 1 SV = 1
Reduced viability upon starvation protein 161 OS = Saccharomyces	RV161_YEAST	30,251.90	14	0
cerevisiae GN = RVS161 PE = 1 SV = 1
Cytochrome b5 OS = Saccharomycescerevisiae GN = CYB5 PE = 1	CYB5_YEAST	13,297.10	14	0
SV = 2
60S ribosomal protein L37-A OS = Saccharomycescerevisiae	RL37A_YEAST	9,850.40	14	0
GN = RPL37A PE = 1 SV = 2
Calmodulin OS = Saccharomycescerevisiae GN = CMD1 PE = 1 SV = 1	CALM_YEAST	16,135.50	14	0
Actin-related protein 2/3 complex subunit 5 OS = Saccharomyces	ARPC5_YEAST	17,134.60	14	0
cerevisiae GN = ARC15 PE = 1 SV = 1
Mitochondrial outer membrane protein SCY_3392	YKR18_YEAS7	81,773.40	14	0
OS = Saccharomycescerevisiae (strain YJM789) GN = SCY_3392 PE = 3	(+1)
SV = 1
tRNA pseudouridine synthase 1 OS = Saccharomycescerevisiae	PUS1_YEAST	62,145.30	14	0
GN = PUS1 PE = 1 SV = 1
Heterotrimeric G protein gamma subunit GPG1 OS = Saccharomyces	GPG1_YEAST	14,922.30	14	0
cerevisiae GN = GPG1 PE = 1 SV = 1
Anthranilate synthase component 1 OS = Saccharomycescerevisiae	TRPE_YEAST	56,769.50	14	0
GN = TRP2 PE = 1 SV = 4
UPF0662 protein YPL260W OS = Saccharomycescerevisiae	YP260_YEAST	62,782.70	27	1
GN = YPL260W PE = 1 SV = 1
NADPH-dependent 1-acyldihydroxyacetone phosphate reductase	AYR1_YEAST	32,815.30	27	1
OS = Saccharomycescerevisiae GN = AYR1 PE = 1 SV = 1
Long-chain-fatty-acid--CoA ligase 1 OS = Saccharomycescerevisiae	LCF1_YEAST	77,868.10	81	3
GN = FAA1 PE = 1 SV = 1
Small COPII coat GTPase SAR1 OS = Saccharomycescerevisiae	SAR1_YEAST	21,451.50	53	2
GN = SAR1 PE = 1 SV = 1
GMP synthase [glutamine-hydrolyzing] OS = Saccharomycescerevisiae	GUAA_YEAST	58,483.40	53	2
GN = GUA1 PE = 1 SV = 4
Mitochondrial outer membrane protein porin 1 OS = Saccharomyces	VDAC1_YEAST	30,429.50	185	7
cerevisiae GN = POR1 PE = 1 SV = 4
ATP-dependent helicase NAM7 OS = Saccharomycescerevisiae	NAM7_YEAST	109,432.60	13	0
GN = NAM7 PE = 1 SV = 1
Proteasome component PRE2 OS = Saccharomycescerevisiae	PSB5_YEAST	31,636.90	13	0
GN = PRE2 PE = 1 SV = 3
Homocitrate synthase, mitochondrial OS = Saccharomycescerevisiae	HOSM_YEAST	48,595.50	78	3
GN = LYS21 PE = 1 SV = 1
Nucleolar complex protein 2 OS = Saccharomycescerevisiae	NOC2_YEAST	81,605.10	13	0
GN = NOC2 PE = 1 SV = 2
Transcriptional regulatory protein SIN3 OS = Saccharomycescerevisiae	SIN3_YEAST	174,843.10	13	0
GN = SIN3 PE = 1 SV = 2
Ribosome biogenesis protein ERB1 OS = Saccharomycescerevisiae	ERB1_YEAS7	91,706.30	13	0
(strain YJM789) GN = ERB1 PE = 3 SV = 1	(+1)
Dihydroxy-acid dehydratase, mitochondrial OS = Saccharomyces	ILV3_YEAST	62,862.80	78	3
cerevisiae GN = ILV3 PE = 1 SV = 2
Uncharacterized protein YKL054C OS = Saccharomycescerevisiae	YKF4_YEAST	83,968.30	13	0
GN = YKL054C PE = 1 SV = 1
DNA-directed RNA polymerases I, II, and III subunit RPABC5	RPAB5_YEAST	8,278.00	13	0
OS = Saccharomycescerevisiae GN = RPB10 PE = 1 SV = 2
Mitochondrial presequence protease OS = Saccharomycescerevisiae	CYM1_YEAST	112,185.50	26	1
GN = CYM1 PE = 1 SV = 2
Amidophosphoribosyltransferase OS = Saccharomycescerevisiae	PUR1_YEAST	56,720.30	13	0
GN = ADE4 PE = 1 SV = 2
Protein ERP1 OS = Saccharomycescerevisiae GN = ERP1 PE = 1 SV = 1	ERP1_YEAST	24,724.00	13	0
Hsp90 co-chaperone HCH1 OS = Saccharomycescerevisiae	HCH1_YEAST	17,246.80	13	0
GN = HCH1 PE = 1 SV = 1
Acetyl-CoA carboxylase OS = Saccharomycescerevisiae GN = FAS3	ACAC_YEAST	250,359.50	572	22
PE = 1 SV = 2
Mitochondrial outer membrane protein IML2 OS = Saccharomyces	IML2_YEAS7	82,553.00	13	0
cerevisiae (strain YJM789) GN = IML2 PE = 3 SV = 1	(+1)
Choline-phosphate cytidylyltransferase OS = Saccharomycescerevisiae	PCY1_YEAST	49,408.40	13	0
GN = PCT1 PE = 1 SV = 2
Nucleosome assembly protein OS = Saccharomycescerevisiae	NAP1_YEAST	47,886.10	13	0
GN = NAP1 PE = 1 SV =2
THO complex subunit 2 OS = Saccharomycescerevisiae GN = THO2	THO2_YEAST	183,940.50	13	0
PE = 1 SV = 1
Sec sixty-one protein homolog OS = Saccharomycescerevisiae	SSH1_YEAST	53,314.50	13	0
GN = SSH1 PE = 1 SV = 1
Cytochrome c heme lyase OS = Saccharomycescerevisiae GN = CYC3	CCHL_YEAST	30,080.70	13	0
PE = 1 SV = 1
Prefoldin subunit 4 OS = Saccharomycescerevisiae GN = GIM3 PE = 1	PFD4_YEAST	15,181.00	13	0
SV = 1
Gamma-glutamyl phosphate reductase OS = Saccharomycescerevisiae	PROA_YEAST	49,742.20	13	0
GN = PRO2 PE = 1 SV = 1
60S ribosomal protein L37-B OS = Saccharomycescerevisiae	RL37B_YEAST	9,868.30	13	0
GN = RPL37B PE = 1 SV = 2
UPF0368 protein YPL225W OS = Saccharomycescerevisiae	YP225_YEAST	17,445.20	26	1
GN = YPL225W PE = 1 SV = 1
Dolichyl-phosphate-mannose--protein mannosyltransferase 4	PMT4_YEAST	87,968.60	13	0
OS = Saccharomycescerevisiae GN = PMT4 PE = 1 SV = 1
Increased sodium tolerance protein 2 OS = Saccharomycescerevisiae	IST2_YEAST	105,908.10	13	0
GN = IST2 PE = 1 SV = 1
Glucokinase-1 OS = Saccharomycescerevisiae GN = GLK1 PE = 1 SV = 1	HXKG_YEAST	55,379.10	231	9
Suppressor protein STM1 OS = Saccharomycescerevisiae GN = STM1	STM1_YEAST	29,995.40	202	8
PE = 1 SV = 3
Uridylate kinase OS = Saccharomycescerevisiae GN = URA6 PE = 1	UMPK_YEAST	22,933.90	12	0
SV = 1
Myosin light chain 1 OS = Saccharomycescerevisiae GN = MLC1 PE = 1	MLC1_YEAST	16,445.30	24	1
SV = 1
Glucose-repressible alcohol dehydrogenase transcriptional effector	CCR4_YEAST	94,702.70	12	0
OS = Saccharomycescerevisiae GN = CCR4 PE = 1 SV = 1
54S ribosomal protein L1, mitochondrial OS = Saccharomycescerevisiae	RM01_YEAST	30,997.30	12	0
GN = MRPL1 PE = 1 SV = 1
Nuclear polyadenylated RNA-binding protein 3 OS = Saccharomyces	NAB3_YEAST	90,438.50	12	0
cerevisiae GN = NAB3 PE = 1 SV = 1
Phosphoglycerate mutase 2 OS = Saccharomycescerevisiae	PMG2_YEAST	36,074.50	12	0
GN = GPM2 PE = 1 SV = 1
3′(2′),5′-bisphosphate nucleotidase OS = Saccharomycescerevisiae	HAL2_YEAST	39,150.30	12	0
GN = HAL2 PE = 1 SV = 1
Protein SEY1 OS = Saccharomycescerevisiae (strain AWRI1631)	SEY1_YEAS6	89,425.20	12	0
GN = SEY1 PE = 3 SV = 1	(+2)
Thiamine metabolism regulatory protein THI3 OS = Saccharomyces	THI3_YEAST	68,367.90	12	0
cerevisiae GN = THI3 PE = 1 SV = 1
Alpha-mannosidase OS = Saccharomycescerevisiae GN = AMS1 PE = 1	MAN1_YEAST	124,503.20	24	1
SV = 2
[NU+] prion formation protein 1 OS = Saccharomycescerevisiae	NEW1_YEAST	134,335.50	12	0
GN = NEW1 PE = 1 SV = 1
T-complex protein 1 subunit beta OS = Saccharomycescerevisiae	TCPB_YEAST	57,205.70	12	0
GN = CCT2 PE = 1 SV = 1
Putative zinc metalloproteinase YIL108W OS = Saccharomycescerevisiae	YIK8_YEAST	77,416.50	12	0
GN = YIL108W PE = 1 SV = 1
Prefoldin subunit 5 OS = Saccharomycescerevisiae GN = GIM5 PE = 1	PFD5_YEAST	18,356.30	12	0
SV = 1
Probable glycosidase CRH2 OS = Saccharomycescerevisiae	CRH2_YEAST	49,906.20	12	0
GN = UTR2 PE = 1 SV = 3
Coatomer subunit epsilon OS = Saccharomycescerevisiae GN = SEC28	COPE_YEAST	33,830.60	12	0
PE = 1 SV = 2
26S proteasome regulatory subunit RPN13 OS = Saccharomycescerevisiae	RPN13_YEAST	17,902.50	12	0
GN = RPN13 PE = 1 SV = 1
40S ribosomal protein S28-A OS = Saccharomycescerevisiae	RS28A_YEAST	7,591.70	24	1
GN = RPS28A PE = 1 SV = 1
D-3-phosphoglycerate dehydrogenase 1 OS = Saccharomycescerevisiae	SERA_YEAST	51,194.10	12	0
GN = SER3 PE = 1 SV = 1
Adenylosuccinate synthetase OS = Saccharomycescerevisiae	PURA_YEAST	48,280.40	12	0
GN = ADE12 PE = 1 SV = 3
CTP synthase 2 OS = Saccharomycescerevisiae (strain YJM789)	URA8_YEAS7	64,497.40	12	0
GN = URA8 PE = 3 SV = 1	(+1)
ATP-dependent RNA helicase HAS1 OS = Saccharomycescerevisiae	HAS1_YEAST	56,720.20	12	0
GN = HAS1 PE = 1 SV = 1
Zinc finger protein ZPR1 OS = Saccharomycescerevisiae GN = ZPR1	ZPR1_YEAST	55,072.70	12	0
PE = 1 SV = 1
26S proteasome regulatory subunit RPN3 OS = Saccharomycescerevisiae	RPN3_YEAST	60,426.30	12	0
GN = RPN3 PE = 1 SV = 4
Peroxisomal membrane protein PMP27 OS = Saccharomycescerevisiae	PEX11_YEAST	26,876.20	12	0
GN = PEX11 PE = 1 SV = 2
Ribose-phosphate pyrophosphokinase 5 OS = Saccharomycescerevisiae	KPR5_YEAST	53,506.20	12	0
GN = PRS5 PE = 1 SV = 1
U6 snRNA-associated Sm-like protein LSm6 OS = Saccharomyces	LSM6_YEAS7	9,398.00	12	0
cerevisiae (strain YJM789) GN = LSM6 PE = 3 SV = 1	(+1)
Protein HMF1 OS = Saccharomycescerevisiae GN = HMF1 PE = 1 SV = 1	HMF1_YEAST	13,905.90	12	0
General negative regulator of transcription subunit 1	NOT1_YEAST	240,344.80	12	0
OS = Saccharomycescerevisiae GN = NOT1 PE = 1 SV = 2
Putative glucokinase-2 OS = Saccharomycescerevisiae GN = EMI2	EMI2_YEAST	55,923.00	92	4
PE = 1 SV = 1
26S protease regulatory subunit 4 homolog OS = Saccharomycescerevisiae	PRS4_YEAST	48,830.50	23	1
GN = RPT2 PE = 1 SV = 3
Sphingolipid long chain base-responsive protein LSP1	LSP1_YEAST	38,071.60	113	5
OS = Saccharomycescerevisiae GN = LSP1 PE = 1 SV = 1
UPF0001 protein YBL036C OS = Saccharomycescerevisiae	YBD6_YEAST	29,124.20	11	0
GN = YBL036C PE = 1 SV = 1
Galactose/lactose metabolism regulatory protein GAL80	GAL80_YEAST	48,325.40	11	0
OS = Saccharomycescerevisiae GN = GAL80 PE = 1 SV = 2
U3 small nucleolar ribonucleoprotein protein IMP3	IMP3_YEAST	21,886.10	11	0
OS = Saccharomycescerevisiae GN = IMP3 PE = 1 SV = 1
U3 small nucleolar RNA-associated protein 21 OS = Saccharomyces	UTP21_YEAST	104,794.60	11	0
cerevisiae GN = UTP21 PE = 1 SV = 1
DNA polymerase alpha catalytic subunit A OS = Saccharomyces	DPOA_YEAST	166,815.30	11	0
cerevisiae GN = POL1 PE = 1 SV = 2
Probable glycerophosphodiester phosphodiesterase YPL206C	YP206_YEAST	37,071.30	11	0
OS = Saccharomycescerevisiae GN = YPL206C PE = 1 SV = 1
Cytochrome c oxidase assembly protein COX15 OS = Saccharomyces	COX15_YEAST	54,660.50	11	0
cerevisiae GN = COX15 PE = 1 SV = 1
U6 snRNA-associated Sm-like protein LSm5 OS = Saccharomyces	LSM5_YEAST	10,423.20	11	0
cerevisiae GN = LSM5 PE = 1 SV = 1
60S ribosomal protein L29 OS = Saccharomycescerevisiae GN = RPL29	RL29_YEAST	6,669.10	11	0
PE = 1 SV = 3
Tricalbin-3 OS = Saccharomycescerevisiae GN = TCB3 PE = 1 SV = 1	TCB3_YEAST	171,081.40	22	1
Peroxiredoxin HYR1 OS = Saccharomycescerevisiae GN = HYR1 PE = 1	GPX3_YEAST	18,642.20	22	1
SV = 1
Glucose-6-phosphate 1-dehydrogenase OS = Saccharomycescerevisiae	G6PD_YEAST	57,523.60	44	2
GN = ZWF1 PE = 1 SV = 4
Endosomal protein P24B OS = Saccharomycescerevisiae GN = EMP24	EMP24_YEAST	23,332.70	11	0
PE = 1 SV = 1
Proteasome component C1 OS = Saccharomycescerevisiae	PSA3_YEAST	31,536.40	11	0
GN = PRE10 PE = 1 SV = 2
26S proteasome regulatory subunit RPN6 OS = Saccharomycescerevisiae	RPN6_YEAST	49,776.20	11	0
GN = RPN6 PE = 1 SV = 3
Monothiol glutaredoxin-3 OS = Saccharomycescerevisiae GN = GRX3	GLRX3_YEAST	32,481.70	11	0
PE = 1 SV = 1
C-8 sterol isomerase OS = Saccharomycescerevisiae GN = ERG2 PE = 1	ERG2_YEAST	24,896.60	11	0
SV = 1
Uncharacterized membrane glycoprotein YNR065C	YN94_YEAST	125,204.80	11	0
OS = Saccharomycescerevisiae GN = YNR065C PE = 1 SV = 1
Ubiquitin carboxyl-terminal hydrolase 6 OS = Saccharomycescerevisiae	UBP6_YEAST	57,112.50	11	0
GN = UBP6 PE = 1 SV = 1
Histone chaperone ASF1 OS = Saccharomycescerevisiae GN = ASF1	ASF1_YEAST	31,603.10	11	0
PE = 1 SV = 1
Pumilio homology domain family member 6 OS = Saccharomyces	PUF6_YEAST	75,109.00	22	1
cerevisiae GN = PUF6 PE = 1 SV = 1
Mitochondrial outer membrane protein OM14 OS = Saccharomyces	OM14_YEAS7	14,609.90	11	0
cerevisiae (strain YJM789) GM = OM14 PE = 3 SV = 1	(+1)
AP-1 complex subunit gamma-1 OS = Saccharomycescerevisiae	AP1G1_YEAST	93,631.50	11	0
GN = APL4 PE = 1 SV = 1
Signal recognition particle subunit SRP72 OS = Saccharomycescerevisiae	SRP72_YEAST	73,544.80	11	0
GN = SRP72 PE = 1 SV = 2
Protein transport protein SEC31 OS = Saccharomycescerevisiae	SEC31_YEAST	138,706.80	11	0
GN = SEC31 PE = 1 SV = 2
Phosphatidylethanolamine N-methyltransferase OS = Saccharomyces	PEM1_YEAST	101,208.50	11	0
cerevisiae GN = PEM1 PE = 1 SV = 1
Mitochondrial import inner membrane translocase subunit TIM16	TIM16_YEAST	16,216.50	11	0
OS = Saccharomycescerevisiae GN = PAM16 PE = 1 SV = 1
Phosphatidate cytidylyltransferase OS = Saccharomycescerevisiae	CDS1_YEAST	51,825.70	11	0
GN = CDS1 PE = 1 SV = 1
26S proteasome regulatory subunit RPN12 OS = Saccharomyces	RPN12_YEAST	31,922.00	11	0
cerevisiae GN = RPN12 PE = 1 SV = 3
N-terminal acetyltransferase A complex subunit NAT1	NAT1_YEAST	98,912.00	11	0
OS = Saccharomycescerevisiae GN = NAT1 PE = 1 SV = 2
Nucleolar pre-ribosomal-associated protein 1 OS = Saccharomyces	URB1_YEAST	203,299.10	11	0
cerevisiae GN = URB1 PE = 1 SV = 2
GU4 nucleic-binding protein 1 OS = Saccharomycescerevisiae	G4P1_YEAST	42,084.50	87	4
GN = ARC1 PE = 1 SV = 2
Mitochondrial peculiar membrane protein 1 OS = Saccharomycescerevisiae	MPM1_YEAST	28,471.40	43	2
GN = MPM1 PE = 1 SV = 1
6-phosphogluconate dehydrogenase, decarboxylating 1	6PGD1_YEAST	53,545.30	494	23
OS = Saccharomycescerevisiae GN = GND1 PE = 1 SV = 1
Transcription-associated protein 1 OS = Saccharomycescerevisiae	TRA1_YEAST	433,195.70	21	1
GN = TRA1 PE = 1 SV = 1
RNA polymerase-associated protein CTR9 OS = Saccharomycescerevisiae	CTR9_YEAST	124,663.10	42	2
GN = CTR9 PE = 1 SV = 2
DNA-directed RNA polymerases I, II, and III subunit RPABC3	RPAB3_YEAST	16,512.10	21	1
OS = Saccharomycescerevisiae GN = RPB8 PE = 1 SV = 1
Ribonucleoside-diphosphate reductase large chain 1	RIR1_YEAST	99,564.50	21	1
OS = Saccharomycescerevisiae GN = RNR1 PE = 1 SV = 2
60S ribosomal protein L10 OS = Saccharomycescerevisiae GN = RPL10	RL10_YEAST	25,362.10	168	8
PE = 1 SV = 1
Sphingolipid long chain base-responsive protein PIL1	PIL1_YEAST	38,350.30	166	8
OS = Saccharomycescerevisiae GN = PIL1 PE = 1 SV = 1
Ribosome-associated complex subunit SSZ1 OS = Saccharomyces	SSZ1_YEAST	58,239.50	145	7
cerevisiae GN = SSZ1 PE = 1 SV = 2
Golgin IMH1 OS = Saccharomycescerevisiae GN = IMH1 PE = 1 SV = 1	IMH1_YEAST	105,231.40	10	0
Protein SCO2, mitochondrial OS = Saccharomycescerevisiae	SCO2_YEAST	34,890.60	10	0
GN = SCO2 PE = 1 SV = 1
3-ketoacyl-CoA reductase OS = Saccharomycescerevisiae GN = IFA38	MKAR_YEAST	38,709.70	10	0
PE = 1 SV = 1
Iron transport multicopper oxidase FET5 OS = Saccharomycescerevisiae	FET5_YEAST	70,880.90	10	0
GN = FET5 PE = 1 SV = 1
Protein ISD11 OS = Saccharomycescerevisiae GN = ISD11 PE = 1 SV = 1	ISD11_YEAST	11,266.40	10	0
Mitochondrial distribution and morphology protein 38	MDM38_YEAST	65,008.10	10	0
OS = Saccharomycescerevisiae GN = MDM38 PE = 1 SV = 1
Elongation of fatty acids protein 3 OS = Saccharomycescerevisiae	ELO3_YEAST	39,467.00	10	0
GN = ELO3 PE = 1 SV = 1
Nucleolar GTP-binding protein 1 OS = Saccharomycescerevisiae	NOG1_YEAST	74,412.80	10	0
GN = NOG1 PE = 1 SV = 1
Peptidyl-prolyl cis-trans isomerase ESS1 OS = Saccharomycescerevisiae	ESS1_YEAST	19,404.90	10	0
GN = ESS1 PE = 1 SV = 3
ATPase GET3 OS = Saccharomycescerevisiae (strain RM11-1a)	GET3_YEAS1	39,355.10	10	0
GN = GET3 PE = 3 SV = 1	(+2)
Protein APA1 OS = Saccharomycescerevisiae GN = APA1 PE = 1 SV = 4	APA1_YEAST	36,494.20	10	0
Mitochondrial respiratory chain complexes assembly protein AFG3	AFG3_YEAST	84,547.40	10	0
OS = Saccharomycescerevisiae GN = AFG3 PE = 1 SV = 1
Calcium-transporting ATPase 2 OS = Saccharomycescerevisiae	ATC2_YEAST	130,866.40	10	0
GN = PMC1 PE = 1 SV = 1
Probable intramembrane protease YKL100C OS = Saccharomyces	YKK0_YEAST	67,528.20	10	0
cerevisiae GN = YKL100C PE = 1 SV = 1
KH domain-containing protein YBL032W OS = Saccharomycescerevisiae	YBD2_YEAST	41,684.60	10	0
GN = YBL032W PE = 1 SV = 1
Mitochondrial import receptor subunit TOM22 OS = Saccharomyces	TOM22_YEAST	16,790.90	10	0
cerevisiae GN = TOM22 PE = 1 SV = 3
Protein MSP1 OS = Saccharomycescerevisiae GN = MSP1 PE = 1 SV = 2	MSP1_YEAST	40,346.50	10	0
UPF0364 protein YMR027W OS = Saccharomycescerevisiae	YMR7_YEAST	54,130.90	10	0
GN = YMR027W PE = 1 SV = 1
Uncharacterized protein YJL217W OS = Saccharomycescerevisiae	YJV7_YEAST	21,966.80	10	0
GN = YJL217W PE = 1 SV = 1
ER membrane protein complex subunit 4 OS = Saccharomycescerevisiae	EMC4_YEAST	21,460.70	10	0
GN = EMC4 PE = 1 SV = 1
Sm-like protein LSm1 OS = Saccharomycescerevisiae GN = LSM1	LSM1_YEAST	20,307.60	10	0
PE = 1 SV = 1
Probable alpha-1,6-mannosyltransferase MNN10 OS = Saccharomyces	MNN10_YEAST	46,750.50	10	0
cerevisiae GN = MNN10 PE = 1 SV = 1
Protein HAM1 OS = Saccharomycescerevisiae GN = HAM1 PE = 1 SV = 1	HAM1_YEAST	22,093.90	10	0
NADPH-dependent methylglyoxal reductase GRE2	GRE2_YEAST	38,170.30	10	0
OS = Saccharomycescerevisiae GN = GRE2 PE = 1 SV = 1
Alpha-1,2 mannosyltransferase KTR1 OS = Saccharomycescerevisiae	KTR1_YEAST	46,023.70	10	0
GN = KTR1 PE = 1 SV = 1
Protein VTH1 OS = Saccharomycescerevisiae GN = VTH1 PE = 1 SV = 1	VTH1_YEAST	174,434.90	10	0
	(+1)
Trehalose synthase complex regulatory subunit TPS3	TPS3_YEAST	118,837.50	10	0
OS = Saccharomycescerevisiae GN = TPS3 PE = 1 SV = 3
Heat shock protein 60, mitochondrial OS = Saccharomycescerevisiae	HSP60_YEAST	60,753.00	743	38
GN = HSP60 PE = 1 SV = 1
Pyruvate dehydrogenase E1 component subunit beta, mitochondrial	ODPB_YEAST	40,054.20	77	4
OS = Saccharomycescerevisiae GN = PDB1 PE = 1 SV = 2
Pyruvate dehydrogenase E1 component subunit alpha, mitochondrial	ODPA_YEAST	46,344.40	96	5
OS = Saccharomycescerevisiae GN = PDA1 PE = 1 SV = 2
Actin-related protein 3 OS = Saccharomycescerevisiae GN = ARP3	ARP3_YEAST	49,542.70	19	1
PE = 1 SV = 1
AMP deaminase OS = Saccharomycescerevisiae GN = AMD1 PE = 1	AMPD_YEAST	93,304.30	19	1
SV = 2
Lon protease homolog, mitochondrial OS = Saccharomycescerevisiae	LONM_YEAST	127,116.80	56	3
GN = PIM1 PE = 1 SV = 2
Isocitrate dehydrogenase [NAD] subunit 1, mitochondrial	IDH1_YEAST	39,325.30	223	12
OS = Saccharomycescerevisiae GN = IDH1 PE = 1 SV = 2
Serine hydroxymethyltransferase, cytosolic OS = Saccharomycescerevisiae	GLYC_YEAST	52,219.70	110	6
GN = SHM2 PE = 1 SV = 2
Rab protein geranylgeranyltransferase component A	RAEP_YEAST	67,374.90	9	0
OS = Saccharomycescerevisiae GN = MRS6 PE = 1 SV = 2
37S ribosomal protein MRP1, mitochondrial OS = Saccharomyces	RT01_YEAST	36,730.90	9	0
cerevisiae GN = MRP1 PE = 1 SV = 2
Carboxypeptidase S OS = Saccharomycescerevisiae GN = CPS1 PE = 1	CBPS_YEAST	64,599.30	9	0
SV = 2
Probable glucose transporter HXT5 OS Saccharomycescerevisiae	HXT5_YEAST	66,252.90	9	0
GN = HXT5 PE = 1 SV = 1
Glycerol-3-phosphate dehydrogenase, mitochondrial	GPDM_YEAST	72,390.60	90	5
OS = Saccharomycescerevisiae GN = GUT2 PE = 1 SV = 2
Cytochrome b2, mitochondrial OS = Saccharomycescerevisiae	CYB2_YEAST	65,541.20	9	0
GN = CYB2 PE = 1 SV = 1
Translation machinery-associated protein 20 OS = Saccharomyces	TMA20_YEAST	20,278.30	9	0
cerevisiae GN = TMA20 PE = 1 SV = 1
D-arabinono-1,4-lactone oxidase OS = Saccharomycescerevisiae	ALO_YEAST	59,494.80	9	0
GN = ALO1 PE = 1 SV = 1
Protein phosphatase 2C homolog 3 OS = Saccharomycescerevisiae	PP2C3_YEAST	51,391.60	9	0
GN = PTC3 PE = 1 SV = 3
DNA-directed RNA polymerase II subunit RPB9 OS = Saccharomyces	RPB9_YEAST	14,288.00	9	0
cerevisiae GN = RPB9 PE = 1 SV = 1
Casein kinase II subunit alpha OS = Saccharomycescerevisiae	CSK21_YEAST	44,669.80	9	0
GN = CKA1 PE = 1 SV = 1
26S protease regulatory subunit 6A OS = Saccharomycescerevisiae	PRS6A_YEAST	48,257.20	9	0
GN = RPT5 PE = 1 SV = 3
Enoyl reductase TSC13 OS = Saccharomycescerevisiae GN = TSC13	TSC13_YEAST	36,770.00	9	0
PE = 1 SV = 1
H/ACA ribonucleoprotein complex subunit 2 OS = Saccharomyces	NHP2_YEAST	17,122.10	9	0
cerevisiae GN = NHP2 PE = 1 SV = 2
Retrograde regulation protein 2 OS = Saccharomycescerevisiae	RTG2_YEAST	65,573.60	9	0
GN = RTG2 PE = 1 SV = 2
Uncharacterized protein YDR476 OS = Saccharomycescerevisiae	YD476_YEAST	25,266.70	9	0
GN = YDR476C PE = 1 SV = 1
DNA-directed RNA polymerases I and III subunit RPAC2	RPAC2_YEAST	16,150.90	9	0
OS = Saccharomycescerevisiae GN = RPC19 PE = 1 SV = 1
GPI transamidase component GPI16 OS = Saccharomycescerevisiae	GPI16_YEAST	68,775.10	9	0
GN = GPI16 PE = 1 SV = 2
V-type proton ATPase subunit e OS = Saccharomycescerevisiae	VA0E_YEAST	8,381.10	9	0
GN = VMA9 PE = 1 SV = 1
Cell division control protein 28 OS = Saccharomycescerevisiae	CDC28_YEAST	34,063.40	18	1
GN = CDC28 PE = 1 SV = 1
Serine/threonine-protein phosphatase 2B catalytic subunit A2	PP2B2_YEAST	68,529.90	9	0
OS = Saccharomycescerevisiae GN = CNA2 PE = 1 SV = 2
GTP-binding protein YPT31/YPT8 OS = Saccharomycescerevisiae	YPT31_YEAST	24,469.90	9	0
GN = YPT31 PE = 1 SV = 3	(+1)
FK506-binding nuclear protein OS = Saccharomycescerevisiae	FKBP3_YEAST	46,554.20	9	0
GN = FPR3 PE = 1 SV = 2
D-3-phosphoglycerate dehydrogenase 2 OS = Saccharomycescerevisiae	SER33_YEAST	51,189.50	9	0
GN = SER33 PE = 1 SV = 1
Coatomer subunit beta OS = Saccharomycescerevisiae GN = SEC26	COPB_YEAST	109,023.60	9	0
PE = 1 SV = 2
Dipeptidyl aminopeptidase B OS = Saccharomycescerevisiae	DAP2_YEAST	93,406.70	9	0
GN = DAP2 PE = 2 SV = 2
Protein UTH1 OS = Saccharomycescerevisiae (strain RM11-1a)	UTH1_YEAS1	36,735.90	9	0
GN = UTH1 PE = 3 SV = 1	(+3)
Uncharacterized oxidoreductase YML125C OS = Saccharomycescerevisiae	YMM5_YEAST	35,288.60	9	0
GN = YML125C PE = 1 SV = 1
Long-chain-fatty-acid--CoA ligase 3 OS = Saccharomycescerevisiae	LCF3_YEAST	77,948.60	9	0
GN = FAA3 PE = 1 SV = 1
Actin-related protein 2/3 complex subunit 2 OS = Saccharomycescerevisiae	ARPC2_YEAST	39,567.70	18	1
GN = ARC35 PE = 1 SV = 1
Ceramide very long chain fatty acid hydroxylase SCS7	SCS7_YEAST	44,882.80	9	0
OS = Saccharomycescerevisiae GN = SCS7 PE = 1 SV = 1
Protein SDS24 OS = Saccharomycescerevisiae (strain YJM789)	SCS24_YEAS7	57,188.20	9	0
GN = SDS24 PE = 3 SV = 1	(+1)
Cytochrome c oxidase assembly protein COX14 OS = Saccharomyces	COX14_YEAST	7,959.10	9	0
cerevisiae GN = COX14 PE = 1 SV = 1
Signal recognition particle subunit SRP14 OS = Saccharomycescerevisiae	SRP14_YEAST	16,430.30	9	0
GN = SRP14 PE = 1 SV = 1
Putative guanine nucleotide-exchange factor SED4	SED4_YEAST	114,081.60	9	0
OS = Saccharomycescerevisiae GN = SED4 PE = 1 SV = 1
Cytochrome b-c1 complex subunit 1, mitochondrial	QCR1_YEAST	50,229.00	71	4
OS = Saccharomycescerevisiae GN = COR1 PE = 1 SV = 1
Lysyl-tRNA synthetase, cytoplasmic OS = Saccharomycescerevisiae	SYKC_YEAST	67,960.50	88	5
GN = KRS1 PE = 1 SV = 2
Glutamyl-tRNA synthetase, cytoplasmic OS = Saccharomycescerevisiae	SYEC_YEAST	80,846.20	246	14
GN = GUS1 PE = 1 SV = 3
Protein transport protein SEC13 OS = Saccharomycescerevisiae	SEC13_YEAST	33,042.60	35	2
GN = SEC13 PE = 1 SV = 1
Threonyl-tRNA synthetase, cytoplasmic OS = Saccharomycescerevisiae	SYTC_YEAST	84,522.60	121	7
GN = THS1 PE = 1 SV = 2
Uncharacterized protein YMR178W OS = Saccharomycescerevisiae	YM44_YEAST	31,145.60	51	3
GN = YMR178W PE = 1 SV = 1
40S ribosomal protein S25-A OS = Saccharomycescerevisiae	RS25A_YEAST	12,039.90	68	4
GN = RPS25A PE = 1 SV = 1	(+1)
Transposon Ty2-LR1 Gag-Pol polyprotein OS = Saccharomycescerevisiae	YL21B_YEAST	202,130.30	17	1
GN = TY2B-LR1 PE = 3 SV = 1
Farnesyl pyrophosphate synthase OS = Saccharomycescerevisiae	FPP2_YEAST	40,485.30	135	8
GN = FPP1 PE = 1 SV = 2
Isocitrate dehydrogenase [NAD] subunit 2, mitochondrial	IDH2_YEAST	39,740.60	151	9
OS = Saccharomycescerevisiae GN = IDH2 PE = 1 SV = 1
Nascent polypeptide-associated complex subunit beta-1	NACB1_YEAS7	17,020.50	33	2
OS = Saccharomycescerevisiae (strain YJM789) GN = EGD1 PE = 3	(+1)
SV = 1
40S ribosomal protein S3 OS = Saccharomycescerevisiae GN = RPS3	RS3_YEAST	26,503.00	296	18
PE = 1 SV = 5
ATP-dependent RNA helicase SUB2 OS = Saccharomycescerevisiae	SUB2_YEAS7	50,280.10	49	3
(strain YJM789) GN = SUB2 PE = 3 SV = 1	(+1)
Elongation factor 1-gamma 2 OS = Saccharomycescerevisiae	EF1G2_YEAST	46,521.90	98	6
GN = TEF4 PE = 1 SV = 1
			Fold
	NSAF	NSAF	enriched
Protein	TAL-PrA	Wild type	TAL-PrA/WT	Rank	Rank/N
Plasma membrane ATPase 1 OS = Saccharomyces	0.00300044	2.19206E−05	136.8778684	1	0.001956947
cerevisiae GN = PMA1 PE = 1 SV = 2
Transposon Ty1-H Gag-Pol polyprotein OS =	0.000721016	1.07667E−05	66.96712916	2	0.003913894
Saccharomyces cerevisiae GN = TY1B-H PE = 1 SV = 1
ATP-dependent RNA helicase DED1 OS =	0.002132761	3.33122E−05	64.02351908	3	0.005870841
Saccharomyces cerevisiae (strain YJM789)
GN = DED1 PE = 3 SV = 1
Protein TIF31 OS = Saccharomycescerevisiae	0.000833936	1.50427E−05	55.43798971	4	0.007827789
GN = TIF31 PE = 1 SV = 1
Protein URA1 OS = Saccharomycescerevisiae	0.002963245	5.34515E−05	55.43798971	5	0.009784736
GN = URA2 PE = 1 SV = 4
Elongation factor 3B OS = Saccharomycescerevisiae	0.001017068	1.88464E−05	53.96618467	6	0.011741683
GN = HEF3 PE = 1 SV = 2
Transposon Ty1-OL Gag polyprotein OS =	0.002361064	4.4561E−05	52.98498131	7	0.01369863
Saccharomyces cerevisiae GN = TY1A-OL PE = 1 SV = 1
40S ribosomal protein S1-B OS = Saccharomyces	0.003792691	7.57911E−05	50.04137124	8	0.015655577
cerevisiae (strain RM11-1a) GN = RPS1B PE = 3 SV = 1
40S ribosomal protein S1-A OS = Saccharomyces	0.003522263	7.59733E−05	46.36185865	9	0.017612524
cerevisiae (strain RM11-1a) GN = RPS1A PE = 3 SV = 1
Transposon Ty1-DR3 Gag polyprotein OS =	0.002047426	4.43968E−05	46.11655781	10	0.019569472
Saccharomyces cerevisiae GN = TY1A-DR3 PE = 1 SV = 1
Galactose transporter OS = Saccharomycescerevisiae	0.001540685	3.43213E−05	44.89005361	11	0.021526419
GN = GAL2 PE = 1 SV = 3
Argininosuccinate synthase OS = Saccharomyces	0.002019878	4.65214E−05	43.41824857	12	0.023483366
cerevisiae GN = ARG1 PE = 1 SV = 2
Pleiotropic ABC efflux transporter of multiple drugs	0.000477712	1.28122E−05	37.28572759	13	0.025440313
OS = Saccharomycescerevisiae GN = PDR5 PE = 1 SV = 1
1,3-beta-glucan synthase component FKS1	0.000376467	1.01637E−05	37.04042675	14	0.02739726
OS = Saccharomycescerevisiae GN = FKS1 PE = 1 SV = 2
Heat shock protein SSC3, mitochondrial
OS = Saccharomycescerevisiae GN = ECM10 PE = 1	0.001146459	3.11579E−05	36.79512591	15	0.029354207
SV = 1
Pyruvate decarboxylase isozyme 3 OS = Saccharomyces	0.001304785	3.54608E−05	36.79512591	16	0.031311155
cerevisiae GN = PDC6 PE = 1 SV = 3
Nuclear segregation protein BFR1 OS = Saccharomyces	0.00134076	3.99651E−05	33.606215	17	0.033268102
cerevisiae GN = BFR1 PE = 1 SV = 1
60S ribosomal protein L18 OS = Saccharomyces	0.003360413	0.000106195	31.64380828	18	0.035225049
cerevisiae GN = RPL18A PE = 1 SV = 1
40S ribosomal protein S2 OS = Saccharomyces	0.002458834	7.95536E−05	30.90790577	19	0.037181996
cerevisiae GN = RPS2 PE = 1 SV = 3
1,3-beta-glucan synthase component GSC2	0.000311042	1.00635E−05	30.90790577	20	0.039138943
OS = Saccharomycescerevisiae GN = GSC2 PE = 1 SV = 2
6-phosphogluconate dehydrogenase, decarboxylating 2	0.001172178	4.0496E−05	28.94549905	21	0.04109589
OS = Saccharomycescerevisiae GN = GND2 PE = 1 SV = 1
High-affinity hexose transporter HXT6	0.00092217	3.48087E−05	26.49249066	22	0.043052838
OS = Saccharomycescerevisiae GN = HXT7 PE = 1 SV = 1
Protein GAL3 OS = Saccharomycescerevisiae GN = GAL3	0.000986018	3.75666E−05	26.24718982	23	0.045009785
PE = 1 SV = 2
ATP-dependent RNA helicase MSS116, mitochondrial OS =	0.000737438	2.8631E−05	25.75658814	24	0.046966732
Saccharomyces cerevisiae GN = MSS116 PE = 1 SV = 1
Probable cation-transporting ATPase 1	0.000388073	1.61431E−05	24.03948226	25	0.048923679
OS = Saccharomycescerevisiae GN = SPF1 PE = 1 SV = 1
High-affinity hexose transporter HXT6	0.000837185	3.48254E−05	24.03948226	26	0.050880626
OS = Saccharomycescerevisiae GN = HXT6 PE = 1 SV = 2
Eukaryotic translation initiation factor 5B OS =	0.000467585	1.94507E−05	24.03948226	26	0.050880626
Saccharomyces cerevisiae GN = FUN12 PE = 1 SV = 2
DNA-directed RNA polymerase II subunit RPB1	0.000268377	1.13966E−05	23.54888058	28	0.054794521
OS = Saccharomycescerevisiae GN = RPB1 PE = 1 SV = 2
1,3-beta-glucanosyltransferase GAS1 OS =	0.0008451	3.66506E−05	23.0582789	29	0.056751468
Saccharomyces cerevisiae GN = GAS1 PE = 1 SV = 2
Eukaryotic translation initiation factor 3 subunit B	0.00056527	2.47784E−05	22.81297806	30	0.058708415
OS = Saccharomycescerevisiae (strain YJM789)
Phosphoglucomutase-1 OS = Saccharomycescerevisiae	0.000772352	3.45999E−05	22.32237639	31	0.060665362
GN = PGM1 PE = 1 SV = 1
T-complex protein 1 subunit gamma	0.000819711	3.71295E−05	22.07707555	32	0.062622309
OS = Saccharomycescerevisiae GN = CCT3 PE = 1 SV = 2
FACT complex subunit SPT16 OS = Saccharomyces	0.000397347	1.84072E−05	21.58647387	33	0.064579256
cerevisiae GN = SPT16 PE = 1 SV = 1
ATP-dependent RNA helicase DBP1	0.000685433	3.21179E−05	21.34117303	34	0.066536204
OS = Saccharomycescerevisiae (strain YJM789)
GN = DBP1 PE = 3 SV = 1
Dihydrolipoyllysine-residue acetyltransferase component	0.00089935	4.21415E−05	21.34117303	34	0.066536204
of pyruvate dehydrogenase complex, mitochondrial
OS = Saccharomycescerevisiae GN = PDA2 PE = 1 SV = 1
Clathrin heavy chain OS = Saccharomycescerevisiae	0.000494931	2.33254E−05	21.21852261	36	0.070450098
GN = CHC1 PE = 1 SV = 1
40S ribosomal protein S8 OS = Saccharomyces	0.002048356	9.70975E−05	21.09587219	37	0.072407045
cerevisiae GN = RPS8A PE = 1 SV = 3
DNA-directed RNA polymerase II subunit RPB2	0.000328146	1.5738E−05	20.85057135	38	0.074363992
OS = Saccharomycescerevisiae GN = RPB2 PE = 1 SV = 2
Glutamine synthetase OS = Saccharomycescerevisiae	0.00102603	5.22842E−05	19.62406715	39	0.076320939
GN = GLN1 PE = 1 SV = 2
Mitochondrial import receptor subunit TOM40 OS =	0.001006641	5.19456E−05	19.37876631	40	0.078277886
Saccharomyces cerevisiae GN = TOM40 PE = 1 SV = 1
C-1-tetrahydrofolate synthase, cytoplasmic	0.000398323	2.1366E−05	18.64286379	41	0.080234834
OS = Saccharomycescerevisiae GN = ADE3 PE = 1 SV = 1
rRNA 2′-O-methyltransferase fibrillarin	0.001165684	6.33608E−05	18.39756296	42	0.082191781
OS = Saccharomycescerevisiae GN = NOP1 PE = 1 SV = 1
Protein SCP160 OS = Saccharomycescerevisiae	0.001192042	6.47935E−05	18.39756296	42	0.082191781
GN = SCP160 PE = 1 SV = 3
Protein transport protein SEC23 OS = Saccharomyces	0.000457965	2.55747E−05	17.90696128	44	0.086105675
cerevisiae GN = SEC23 PE = 1 SV = 1
Nucleolar protein 56 OS = Saccharomycescerevisiae	0.000687645	3.8401E−05	17.90696128	45	0.088062622
GN = NOP56 PE = 1 SV = 1
Orotidine 5′-phosphate decarboxylase	0.001300706	7.4683E−05	17.4163596	46	0.090019569
OS = Saccharomycescerevisiae GN = URA3 PE = 1 SV = 2
Homocitrate synthase, cytosolic isozyme OS =	0.000773374	4.63641E−05	16.68045708	47	0.091976517
Saccharomyces cerevisiae GN = LYS20 PE = 1 SV = 2
External NADH-ubiquinone oxidoreductase 1,	0.000571718	3.47863E−05	16.43515624	48	0.093933464
mitochondrial OS = Saccharomycescerevisiae GN = NDE1
PE = 1 SV = 1
Eukaryotic translation initiation factor 3 subunit C	0.000384987	2.34246E−05	16.43515624	49	0.095890411
OS = Saccharomycescerevisiae (strain YJM789)
GN = NIP1 PE = 3 SV = 1
Zuotin OS = Saccharomycescerevisiae GN = ZUO1 PE = 1	0.00072121	4.4547E−05	16.1898554	50	0.097847358
SV = 1
Trehalose-phosphatase OS = Saccharomycescerevisiae	0.000327715	2.12059E−05	15.45395288	51	0.099804305
GN = TPS2 PE = 1 SV = 3
Saccharopepsin OS = Saccharomycescerevisiae	0.000758359	4.90722E−05	15.45395288	51	0.099804305
GN = PEP4 PE = 1 SV = 1
rRNA biogenesis protein RRP5 OS = Saccharomyces	0.000174731	1.13065E−05	15.45395288	53	0.1037182
cerevisiae GN = RRP5 PE = 1 SV = 1
cAMP-dependent protein kinase regulatory subunit	0.000703343	4.62462E−05	15.20865204	54	0.105675147
OS = Saccharomycescerevisiae GN = BCY1 PE = 1 SV = 4
Galactokinase OS = Saccharomycescerevisiae	0.012480213	0.000829109	15.05255151	55	0.107632094
GN = GAL1 PE = 1 SV = 4
Probable 2-methylcitrate dehydratase	0.000566456	3.78562E−05	14.9633512	56	0.109589041
OS = Saccharomycescerevisiae GN = PDH1 PE = 1 SV = 1
2-isopropylmalate synthase 2, mitochondrial	0.000486249	3.2496E−05	14.9633512	57	0.111545988
OS = Saccharomycescerevisiae GN = LEU9 PE = 1 SV = 1
NADH-cytochrome b5 reductase 2 OS = Saccharomyces	0.000957996	6.40228E−05	14.9633512	58	0.113502935
cerevisiae (strain YJM789) GN = MCR1 PE = 2 SV = 1
6,7-dimethyl-8-ribityllumazine synthase	0.001732121	0.000117687	14.71805036	59	0.115459883
OS = Saccharomycescerevisiae GN = RIB4 PE = 1 SV = 2
N-(5′-phosphoribosyl)anthranilate isomerase	0.001331159	9.0444E−05	14.71805036	59	0.115459883
OS = Saccharomycescerevisiae GN = TRP1 PE = 1 SV = 2
Glutamate synthase [NADH] OS = Saccharomyces	0.000130484	9.17129E−06	14.22744869	61	0.119373777
cerevisiae GN = GLT1 PE = 1 SV = 2
Nuclear localization sequence-binding protein	0.000661538	4.90335E−05	13.49154617	62	0.121330724
OS = Saccharomycescerevisiae GN = NSR1 PE = 1 SV = 1
V-type proton ATPase subunit a, vacuolar isoform	0.000308399	2.28587E−05	13.49154617	62	0.121330724
OS = Saccharomycescerevisiae GN = VPH1 PE = 1 SV = 3
4-aminobutyrate aminotransferase OS = Saccharomyces	0.000556432	4.1243E−05	13.49154617	64	0.125244618
cerevisiae GN = UGA1 PE = 1 SV = 2
Dihydroorotate dehydrogenase OS = Saccharomyces	0.000831161	6.27469E−05	13.24624533	65	0.127201566
cerevisiae GN = URA1 PE = 1 SV = 1
Eukaryotic translation initiation factor 2A OS =	0.000405663	3.06247E−05	13.24624533	66	0.129158513
Saccharomyces cerevisiae GN = YGR054W PE = 1 SV = 1
60S ribosomal protein L32 OS = Saccharomyces	0.00192197	0.000147833	13.00094449	67	0.13111546
cerevisiae GN = RPL32 PE = 1 SV = 1
60S ribosomal protein L15-A OS = Saccharomyces	0.002303041	0.000178831	12.87829407	68	0.133072407
cerevisiae GN = RPL15A PE = 1 SV = 3
Mitochondrial import receptor subunit TOM70	0.000389569	3.11398E−05	12.51034281	69	0.135029354
OS = Saccharomycescerevisiae (strain YJM789)
GN = TOM70 PE = 3 SV = 1
Mitochondrial acidic protein MAM33 OS =	0.000906643	7.24715E−05	12.51034281	70	0.136986301
Saccharomyces cerevisiae GN = MAM33 PE = 1 SV = 1
H/ACA ribonucleoprotein complex subunit 4	0.000499387	3.99179E−05	12.51034281	70	0.136986301
OS = Saccharomycescerevisiae GN = CBF5 PE = 1 SV = 1
60S ribosomal protein L8-A OS = Saccharomyces	0.003828248	0.000310574	12.32636718	72	0.140900196
cerevisiae GN = RPL8A PE = 1 SV = 4
Eukaryotic translation initiation factor 2 subunit alpha	0.000771455	6.28987E−05	12.26504197	73	0.142857143
OS = Saccharomycescerevisiae GN = SUI2 PE = 1 SV = 1
NADPH--cytochrome P450 reductase	0.000348866	2.84439E−05	12.26504197	74	0.14481409
OS = Saccharomycescerevisiae GN = NCP1 PE = 1 SV = 3
Nucleolar protein 58 OS = Saccharomycescerevisiae	0.000921641	7.66773E−05	12.01974113	75	0.146771037
(strain YJM789) GN = NOP58 PE = 3 SV = 1
60S ribosomal protein L14-B OS = Saccharomyces	0.003429032	0.000288224	11.89709071	76	0.148727984
cerevisiae GN = RPL14B PE = 1 SV = 1
Pentafunctional AROM polypeptide OS = Saccharomyces	0.00029733	2.49918E−05	11.89709071	76	0.148727984
cerevisiae GN = ARO1 PE = 1 SV = 1
60S ribosomal protein L8-B OS = Saccharomyces	0.00367754	0.000310714	11.8357655	78	0.152641879
cerevisiae GN = RPL8B PE = 1 SV = 3
GTP-binding protein RHO1 OS = Saccharomyces	0.001110598	9.43228E−05	11.77444029	79	0.154598826
cerevisiae GN = RHO1 PE = 1 SV = 3
Invertase 2 OS = Saccharomycescerevisiae GN = SUC2	0.000424013	3.60113E−05	11.77444029	80	0.156555773
PE = 1 SV = 1
Squalene synthase OS = Saccharomycescerevisiae	0.000497125	4.22207E−05	11.77444029	80	0.156555773
GN = ERG9 PE = 1 SV = 2
Eukaryotic translation initiation factor 3 subunit B	0.000577426	4.95569E−05	11.65178987	82	0.160469667
OS = Saccharomycescerevisiae GN = PRT1 PE = 1 SV = 1
Cytochrome c iso-2 OS = Saccharomycescerevisiae	0.00200888	0.000174244	11.52913945	83	0.162426614
GN = CYC7 PE = 1 SV = 1
ATP-dependent permease PDR15 OS = Saccharomyces	0.000146155	1.2677E−05	11.52913945	84	0.164383562
cerevisiae GN = PDR15 PE = 1 SV = 1
60S ribosomal protein L28 OS = Saccharomyces	0.001473501	0.000130585	11.28383861	85	0.166340509
cerevisiae GN = RPL28 PE = 1 SV = 2
Methionyl-tRNA synthetase, cytoplasmic	0.000287593	2.54871E−05	11.28383861	86	0.168297456
OS = Saccharomycescerevisiae GN = MES1 PE = 1 SV = 4
Eukaryotic translation initiation factor 3 subunit G	0.000790304	7.1595E−05	11.03853777	87	0.170254403
OS = Saccharomycescerevisiae GN = TIF35 PE = 1 SV = 1
General transcriptional corepressor TUP1	0.000307833	2.78871E−05	11.03853777	88	0.17221135
OS = Saccharomycescerevisiae GN = TUP1 PE = 1 SV = 2
Heat shock protein 42 OS = Saccharomycescerevisiae	0.000550472	5.10016E−05	10.79323693	89	0.174168297
GN = HSP42 PE = 1 SV = 1
60S ribosomal protein L15-B OS = Saccharomyces	0.001842433	0.000178831	10.30263526	90	0.176125245
cerevisiae GN = RPL15B PE = 1 SV = 2
40S ribosomal protein S23 OS = Saccharomyces	0.001402798	0.000136159	10.30263526	90	0.176125245
cerevisiae GN = RPS23A PE = 1 SV = 1
T-complex protein 1 subunit theta OS = Saccharomyces	0.000364859	3.54141E−05	10.30263526	92	0.180039139
cerevisiae GN = CCT8 PE = 1 SV = 1
26S protease regulatory subunit 8 homolog	0.000485124	4.82358E−05	10.05733442	93	0.181996086
OS = Saccharomycescerevisiae GN = RPT6 PE = 1 SV = 4
SDO1-like protein YHR087W OS = Saccharomyces	0.001828741	0.000181832	10.05733442	94	0.183953033
cerevisiae GN = YHR087W PE = 1 SV = 1
Mitochondrial escape protein 2 OS = Saccharomyces	0.000221602	2.25847E−05	9.812033576	95	0.18590998
cerevisiae GN = YME2 PE = 1 SV = 1
Alpha-soluble NSF attachment protein OS =	0.000653179	6.65692E−05	9.812033576	95	0.18590998
Saccharomyces cerevisiae GN = SEC17 PE = 1 SV = 4
Protein translocation protein SEC63 OS =	0.000284375	2.89823E−05	9.812033576	95	0.18590998
Saccharomyces cerevisiae GN = SEC63 PE = 1 SV = 2
Delta-1-pyrroline-5-carboxylate dehydrogenase,	0.000332526	3.38896E−05	9.812033576	98	0.191780822
mitochondrial OS = Saccharomycescerevisiae GN = PUT2
PE = 1 SV = 2
Polyamine N-acetyltransferase 1 OS = Saccharomyces	0.001928069	0.000198988	9.689383157	99	0.193737769
cerevisiae GN = PAA1 PE = 1 SV = 1
40S ribosomal protein S22-B OS = Saccharomyces	0.002893283	0.000298603	9.689383157	99	0.193737769
cerevisiae GN = RPS22B PE = 1 SV = 3
Phosphoinositide phosphatase SAC1	0.000286194	3.07028E−05	9.321431897	101	0.197651663
OS = Saccharomycescerevisiae GN = SAC1 PE = 1 SV = 1
40S ribosomal protein S26-A OS = Saccharomyces	0.001507278	0.0001617	9.321431897	101	0.197651663
cerevisiae GN = RPS26A PE = 1 SV = 1
26S proteasome regulatory subunit RPN2	0.000390567	4.18999E−05	9.321431897	101	0.197651663
OS = Saccharomycescerevisiae GN = RPN2 PE = 1 SV = 4
Translational activator GCN1 OS = Saccharomyces	6.86049E−05	7.35991E−06	9.321431897	101	0.197651663
cerevisiae GN = GCN1 PE = 1 SV = 1
Dolichyl-diphosphooligosaccharide--protein	0.000249663	2.67838E−05	9.321431897	105	0.205479452
glycosyltransferase subunit STT3 OS = Saccharomyces
cerevisiae GN = STT3 PE = 1 SV = 2
1,3-beta-glucanosyltransferase GAS5	0.000392433	4.21001E−05	9.321431897	105	0.205479452
OS = Saccharomycescerevisiae GN = GAS5 PE = 1 SV = 1
Acyl-CoA-binding protein OS = Saccharomyces	0.002023076	0.000217035	9.321431897	107	0.209393346
cerevisiae GN = ACB1 PE = 1 SV = 3
Tricalbin-1 OS = Saccharomycescerevisiae GN = TCB1	0.000148375	1.63478E−05	9.076131058	108	0.211350294
PE = 1 SV = 1
NADP-specific glutamate dehydrogenase 2	0.000399377	4.4003E−05	9.076131058	108	0.211350294
OS = Saccharomycescerevisiae GN = GDH3 PE = 1 SV = 1
Dolichyl-phosphate-mannose--protein	0.00021386	2.35629E−05	9.076131058	110	0.215264188
mannosyltransferase 1 OS = Saccharomycescerevisiae
GN = PMT1 PE = 1 SV = 1
Mitochondrial import inner membrane translocase	0.001923423	0.000211921	9.076131058	110	0.215264188
subunit TIM10 OS = Saccharomycescerevisiae
GN = MRS11 PE = 1 SV = 1
Ornithine carbamoyltransferase OS = Saccharomyces	0.000523699	5.77006E−05	9.076131058	110	0.215264188
cerevisiae GN = ARG3 PE = 1 SV = 1
Putative magnesium-dependent phosphatase YER134C	0.000943354	0.000106825	8.830830219	113	0.221135029
OS = Saccharomycescerevisiae GN = YER134C PE = 1
SV = 1
Eukaryotic translation initiation factor 4B	0.000397433	4.50051E−05	8.830830219	113	0.221135029
OS = Saccharomycescerevisiae GN = TIF3 PE = 1 SV = 1
Mitochondrial escape protein 2 OS = Saccharomyces	0.000199503	2.25917E−05	8.830830219	115	0.225048924
cerevisiae (strain YJM789) GN = YME2 PE = 3 SV = 1
Vesicle-associated membrane protein-associated protein	0.000716233	8.11059E−05	8.830830219	115	0.225048924
SCS2 OS = Saccharomycescerevisiae GN = SCS2 PE = 1
SV = 3
Importin beta SMX1 OS = Saccharomycescerevisiae	0.000177883	2.01434E−05	8.830830219	115	0.225048924
GN = SXM1 PE = 1 SV = 1
Inorganic phosphate transport protein PHO88 OS =	0.000912311	0.00010331	8.830830219	115	0.225048924
Saccharomyces cerevisiae GN = PHO88 PE = 1 SV = 1
Transcription elongation factor SPT6	0.000225986	2.5951E−05	8.708179799	119	0.232876712
OS = Saccharomycescerevisiae GN = SPT6 PE = 1 SV = 1
T-complex protein 1 subunit delta OS = Saccharomyces	0.000325467	3.79088E−05	8.585529379	120	0.234833659
cerevisiae GN = CCT4 PE = 1 SV = 2
5′-3′ exoribonuclease 1 OS = Saccharomycescerevisiae	0.0002137	2.48907E−05	8.585529379	120	0.234833659
GN = KEM1 PE = 1 SV = 1
Fumarate reductase OS = Saccharomycescerevisiae	0.000368743	4.29494E−05	8.585529379	122	0.238747554
GN = YEL047C PE = 1 SV = 1
3-hydroxy-3-methylglutaryl-coenzyme A reductase 1 OS =	0.000157513	1.88859E−05	8.34022854	123	0.240704501
Saccharomyces cerevisiae GN = HMG1 PE = 1SV = 1
26S proteasome regulatory subunit RPN9 OS =	0.000397789	4.76952E−05	8.34022854	123	0.240704501
Saccharomyces cerevisiae GN = RPN9 PE = 1 SV = 1
Dolichyl-phosphate-mannose--protein	0.000209652	2.51375E−05	8.34022854	123	0.240704501
mannosyltransferase 2 OS = Saccharomycescerevisiae
GN = PMT2 PE = 1 SV = 2
Bifunctional protein GAL10 OS = Saccharomyces	0.006432474	0.000781936	8.226338864	126	0.246575342
cerevisiae GN = GAL10 PE = 1 SV = 2
ATP-dependent bile acid permease OS = Saccharomyces	9.3446E−05	1.15438E−05	8.0949277	127	0.24853229
cerevisiae GN = YBT1 PE = 1 SV = 2
Saccharopine dehydrogenase [NAD+, L-lysine-forming]	0.000426308	5.26636E−05	8.0949277	127	0.24853229
OS = Saccharomycescerevisiae GN = LYS1 PE = 1 SV = 3
Coatomer subunit gamma OS = Saccharomyces	0.000163509	2.08302E−05	7.849626861	129	0.252446184
cerevisiae GN = SEC21 PE = 1 SV = 2
Cell division control protein 53 OS = Saccharomyces	0.000182456	2.3244E−05	7.849626861	129	0.252446184
cerevisiae GN = CDC53 PE = 1 SV = 1
Rotenone-insensitive NADH-ubiquinone oxidoreductase,	0.000299404	3.81424E−05	7.849626861	131	0.256360078
mitochondrial OS = Saccharomycescerevisiae GN = NDI1
PE = 1 SV = 1
Argininosuccinate lyase OS = Saccharomycescerevisiae	0.000329703	4.20024E−05	7.84962681	131	0.256360078
GN = ARG4 PE = 1 SV = 2
Zinc finger protein GIS2 OS = Saccharomycescerevisiae	0.000970965	0.000127686	7.604326022	133	0.260273973
GN = GIS2 PE = 1 SV = 1
Protein kinase MCK1 OS = Saccharomycescerevisiae	0.000384952	5.06228E−05	7.604326022	133	0.260273973
GN = MCK1 PE = 1 SV = 1
Malate dehydrogenase, peroxisomal OS =	0.000446552	5.87235E−05	7.604326022	135	0.264187867
Saccharomyces cerevisiae GN = MDH3 PE = 1 SV = 3
T-complex protein 1 subunit zeta OS = Saccharomyces	0.000277109	3.6441E−05	7.604326022	136	0.266144814
cerevisiae GN = CCT6 PE = 1 SV = 1
ATP-dependent RNA helicase DBP2 OS =	0.000263443	3.57987E−05	7.359025182	137	0.268101761
Saccharomyces cerevisiae GN = DBP2 PE = 1 SV = 1
Cytochrome B pre-mRNA-processing protein 6 OS =	0.000860311	0.000116906	7.359025182	138	0.270058708
Saccharomyces cerevisiae GN = CBP6 PE = 1 SV = 1
Protein DCS2 OS = Saccharomycescerevisiae	0.000392517	5.33382E−05	7.359025182	138	0.270058708
GN = DCS2 PE = 1 SV = 3
Eukaryotic translation initiation factor 3 subunit A OS =	0.000854379	0.000118738	7.195491289	140	0.273972603
Saccharomyces cerevisiae GN = TIF32 PE = 1 SV = 1
Glucose-signaling factor 2 OS = Saccharomyces	0.000677298	9.521E−05	7.113724343	141	0.27592955
cerevisiae GN = GSF2 PE = 1 SV = 1
Glycerol-3-phoshate dehydrogenase [NAD+] 2,	0.000314327	4.41859E−05	7.113724343	142	0.277886497
mitochondrial OS = Saccharomycescerevisiae
GN = GPD2 PE = 1 SV = 2
Prohibitin-2 OS = Saccharomycescerevisiae GN = PHB2	0.000451495	6.34682E−05	7.113724343	142	0.277886497
PE = 1 SV = 2
40S ribosomal protein S29-A OS = Saccharomyces	0.002332289	0.000327858	7.113724343	142	0.277886497
cerevisiae GN = RPS29A PE = 1 SV = 3
DNA-directed RNA polymerase I subunit RPA1 OS =	8.33248E−05	1.17132E−05	7.113724343	145	0.283757339
Saccharomyces cerevisiae GN = RPA1 PE = 1 SV = 2
Protein transport protein SEC24 OS = Saccharomyces	0.000149893	2.10709E−05	7.113724343	145	0.283757339
cerevisiae GN = SEC24 PE = 1 SV = 1
Carboxypeptidase Y OS = Saccharomycescerevisiae	0.000250804	3.65156E−05	6.868423503	147	0.287671233
GN = PRC1 PE = 1 SV = 1
V-type proton ATPase subunit d OS = Saccharomyces	0.000376931	5.48789E−05	6.868423503	148	0.28962818
cerevisiae GN = VMA6 PE = 1 SV = 2
Uncharacterized protein YJL171C OS = Saccharomyces	0.000348696	5.0768E−05	6.868423503	148	0.28962818
cerevisiae GN = YJL171C PE = 1 SV = 1
Vacuolar protein sorting/targeting protein PEP1	8.43666E−05	1.22833−E05	6.868423503	148	0.28962818
OS = Saccharomycescerevisiae GN = PEP1 PE = 1 SV = 1
FACT complex subunit POB3 OS = Saccharomyces	0.000238097	3.46655E−05	6.868423503	151	0.295499022
cerevisiae GN = POB3 PE = 1 SV = 1
Uncharacterized mitochondrial membrane protein	0.000541502	7.88393E−05	6.868423503	151	0.295499022
FMP10 OS = Saccharomycescerevisiae GN = FMP10
PE = 1 SV = 1
RNA annealing protein YRA1 OS = Saccharomyces	0.000579546	8.75034E−05	6.623122664	153	0.299412916
cerevisiae GN = YRA1 PE = 1 SV = 2
Mitochondrial outer membrane protein OM45 OS =	0.000324421	4.8983E−05	6.623122664	154	0.301369863
Saccharomyces cerevisiae GN = OM45 PE = 1 SV = 2
Mitochondrial import receptor subunit TOM5	0.002416716	0.000364891	6.623122664	154	0.301369863
OS = Saccharomycescerevisiae GN = TOM5 PE = 1 SV = 1
T-complex protein 1 subunit alpha OS = Saccharomyces	0.000239133	3.61058E−05	6.623122664	156	0.305283757
cerevisiae GN = TCP1 PE = 1 SV = 2
Eukaryotic translation initiation factor 1A	0.0007988	0.000125247	6.377821825	157	0.307240705
OS = Saccharomycescerevisiae GN = TIF11 PE = 1 SV = 1
Protein MSN5 OS = Saccharomycescerevisiae	9.79948E−05	1.53649E−05	6.377821825	158	0.309197652
GN = MSN5 PE = 1 SV = 1
Putative fatty aldehyde dehydrogenase HFD1	0.000232197	3.6407E−05	6.377821825	158	0.309197652
OS = Saccharomycescerevisiae GN = HFD1 PE = 1 SV = 1
Ergosterol biosynthetic protein 28 OS = Saccharomyces	0.00081278	0.000127439	6.377821825	158	0.309197652
cerevisiae GN = ERG28 PE = 1 SV = 1
Protein YRO2 OS = Saccharomycescerevisiae	0.000359689	5.63969E−05	6.377821825	158	0.309197652
GN = YRO2 PE = 1 SV = 1
Methylene-fatty-acyl-phospholid synthase	0.000601597	9.43265E−05	6.377821825	162	0.310702544
OS = Saccharomycescerevisiae GN = PEM2 PE = 1 SV = 1
Protein MKT1 OS = Saccharomycescerevisiae	0.000141715	2.31087E−05	6.132520985	163	0.318982387
GN = MKT1 PE = 1 SV = 2
Protein MRH1 OS = Saccharomycescerevisiae	0.000370021	6.03376E−05	6.132520985	163	0.318982387
GN = MRH1 PE = 1 SV = 1
Eukaryotic translation initiation factor 2 subunit beta	0.000424122	6.91596E−05	6.132520985	165	0.322896282
OS = Saccharomycescerevisiae GN = SUI3 PE = 1 SV = 2
Peroxiredoxin TSA2 OS = Saccharomycescerevisiae	0.000594774	0.000101028	5.887220146	166	0.324853229
GN = TSA2 PE = 1 SV = 3
Endoplasmic reticulum vesicle protein 25 OS =	0.000533314	9.05884E−05	5.887220146	166	0.324853229
Saccharomyces cerevisiae GN = ERV25 PE = 1 SV = 1
PKHD-type hydroxylase TPA1 OS = Saccharomyces	0.000173629	2.94925E−05	5.887220146	166	0.324853229
cerevisiae GN = TPA1 PE = 1 SV = 1
SED5-binding protein 3 OS = Saccharomycescerevisiae	0.000123674	2.10071E−05	5.887220146	169	0.33072407
GN = SFB3 PE = 1 SV = 1
D-lactate dehydrogenase [cytochrome] 3	0.000232791	3.95417E−05	5.887220146	169	0.33072407
OS = Saccharomycescerevisiae GN = DLD3 PE = 1 SV = 1
Single-stranded nucleic acid-binding protein	0.00076317	0.00013239	5.764569726	171	0.334637965
OS = Saccharomycescerevisiae GN = SBP1 PE = 1 SV = 2
Protein CWH43 OS = Saccharomycescerevisiae	0.000114198	2.02411E−05	5.641919306	172	0.336594912
GN = CWH43 PE = 1 SV = 2
T-complex protein 1 subunit eta OS = Saccharomyces	0.000206247	3.65562E−05	5.641919306	172	0.336594912
cerevisiae GN = CCT7 PE = 1 SV = 1
26S protease regulatory subunit 6B homolog	0.000256832	4.55221E−05	5.641919306	172	0.336594912
OS = Saccharomycescerevisiae GN = RPT3 PE = 1 SV = 1
NADH-cytochrome b5 reductase 1 OS = Saccharomyces	0.000391195	6.93372E−05	5.641919306	172	0.336594912
cerevisiae GN = CBR1 PE = 1 SV = 2
Glycogen debranching enzyme OS = Saccharomyces	0.000140824	2.49603E−05	5.641919306	176	0.344422701
cerevisiae GN = GDB1 PE = 1 SV = 1
C-5 sterol desaturase OS = Saccharomycescerevisiae	0.000288325	5.1104E−05	5.641919306	176	0.344422701
GN = ERG3 PE = 1 SV = 1
13 kDa ribonucleoprotein-associated protein OS =	0.00090797	0.000160933	5.641919306	176	0.344422701
Saccharomyces cerevisiae GN = SNU13 PE = 1 SV = 1
UPF0202 protein KRE33 OS = Saccharomyces	0.000103228	1.82965E−05	5.641919306	176	0.344422701
cerevisiae GN = KRE33 PE = 1 SV = 1
Protein phosphatase PP2A regulatory subunit A	0.00017364	3.07768E−05	5.641919306	176	0.344422701
OS = Saccharomycescerevisiae GN = TPD3 PE = 1 SV = 2
Eukaryotic translation initiation factor 2 subunit gamma	0.000212912	3.77375E−05	5.641919306	176	0.344422701
OS = Saccharomycescerevisiae GN = GCD11 PE = 1
SV = 1
Midasin OS = Saccharomycescerevisiae GN = MDN1	2.20277E−05	3.90429E−06	5.641919306	182	0.356164384
PE = 1 SV = 1
Galactose-1-phosphate uridylyltransferase OS =	0.005800888	0.001030416	5.629654264	183	0.358121331
Saccharomyces cerevisiae GN = GAL7 PE = 1 SV = 4
UPF0121 membrane protein YLL023C OS =	0.000366131	6.78446E−05	5.396618467	184	0.360078278
Saccharomyces cerevisiae GN = YLL023C PE = 1 SV = 1
Phosphatidylinositol transfer protein PDR16 OS =	0.000289444	5.36342E−05	5.396618467	184	0.360078278
Saccharomyces cerevisiae GN = PDR16 PE = 1 SV = 1
60S ribosomal protein L43 OS = Saccharomyces	0.001167888	0.000216411	5.396618467	186	0.363992172
cerevisiae GN = RPL43A PE = 1 SV = 2
Arginine biosynthesis bifunctional protein ARG7,	0.000246288	4.56375E−05	5.396618467	186	0.363992172
mitochondrial OS = Saccharomycescerevisiae
GN = ARG7 PE = 1 SV = 1
Probable family 17 glucosidase SCW4 OS =	0.00029336	5.436E−05	5.396618467	186	0.363992172
Saccharomyces cerevisiae GN = SCW4 PE = 1 SV = 1
26S protease subunit RPT4 OS = Saccharomyces	0.000238513	4.41967E−05	5.396618467	189	0.369863014
cerevisiae GN = RPT4 PE = 1 SV = 4
60S ribosomal protein L3 OS = Saccharomyces	0.002680969	0.000499055	5.372088383	190	0.371819961
cerevisiae GN = RPL3 PE = 1 SV = 4
Phosphoglucamutase-2 OS = Saccharomycescerevisiae	0.002929237	0.000553804	5.28929935	191	0.373776908
GN = PGM2 PE = 1 SV = 1
Uncharacterized phosphatase YNL010W OS =	0.000838173	0.000158927	5.273968047	192	0.375733855
Saccharomyces cerevisiae GN = YNL010W PE = 1 SV = 1
Elongation factor 3A OS = Saccharomycescerevisiae	0.004119318	0.000790698	5.209722589	193	0.377690802
GN = YEF3 PE = 1 SV = 3
Casein kinase II subunit alpha’ OS = Saccharomyces	0.000285478	5.54184E−05	5.151317628	194	0.37964775
cerevisiae GN = CKA2 PE = 1 SV = 2
54S ribosomal protein L12, mitochondrial OS =	0.000544737	0.000105747	5.151317628	194	0.37964775
Saccharomyces cerevisiae GN = MNP1 PE = 1 SV = 1
Nuclear protein SNF4 OS = Saccharomycescerevisiae	0.000309024	5.99893E−05	5.151317628	194	0.37964775
GN = SNF4 PE = 1 SV = 1
Eukaryotic initiation factor 4F subunit p150 OS =	0.000105031	2.03892E−05	5.151317628	194	0.37964775
Saccharomyces cerevisiae GN = TIF4631 PE = 1 SV = 2
Medium-chain fatty acid ethyl ester synethase/esterase 2	0.000219468	4.26042E−05	5.151317628	194	0.37964775
OS = Saccharomycescerevisiae GN = EHT1 PE = 1 SV = 1
ABC transporter ATP-binding protein ARB1 OS =	0.000164512	3.19359E−05	5.151317628	194	0.37964775
Saccharomyces cerevisiae GN = ARB1 PE = 1 SV = 1
Cysteinyl-tRNA synthetase OS = Saccharomyces	0.000128513	2.49476E−05	5.151317628	194	0.37964775
cerevisiae GN = YNL247W PE = 1 SV = 1
Protein TTP1 OS = Saccharomycescerevisiae GN = TTP1	0.000165973	3.22195E−05	5.151317628	194	0.37964775
PE = 1 SV = 1
26S proteasome regulatory subunit RPN8 OS =	0.000293607	5.69966E−05	5.151317628	194	0.37964775
Saccharomyces cerevisiae GN = RPN8 PE = 1 SV = 3
NADH-cytochrome b5 reductase 1 OS = Saccharomyces	0.000357999	6.94965E−05	5.151317628	194	0.37964775
cerevisiae (strain YJM789) GN = CBR1 PE = 2 SV = 2
ER membrane protein complex subunit 1 OS =	0.000129027	2.50474E−05	5.151317628	204	0.399217221
Saccharomyces cerevisiae GN = EMC1 PE = 1 SV = 1
Heat shock protein 78, mitochondrial OS =	0.001712467	0.00033471	5.11627465	205	0.401174168
Saccharomyces cerevisiae GN = HSP78 PE = 1 SV = 2
Nuclear protein STH1/NPS1 OS = Saccharomyces	6.83479E−05	1.39314E−05	4.906016788	206	0.403131115
cerevisiae GN = STH1 PE = 1 SV = 1
mRNA-binding protein PUF3 OS = Saccharomyces	0.000109244	2.22674E−05	4.906016788	206	0.403131115
cerevisiae GN = PUF3 PE = 1 SV = 1
Actin-interacting protein 1 OS = Saccharomyces	0.00015913	3.24356E−05	4.906016788	206	0.403131115
cerevisiae GN = AIP1 PE = 1 SV = 1
Cytochrome c iso-1 OS = Saccharomycescerevisiae	0.003517692	0.000717016	4.906016788	206	0.403131115
GN = CYC1 PE = 1 SV = 2
CTP synthase 1 OS = Saccharomycescerevisiae	0.000165559	3.37461E−05	4.906016788	206	0.403131115
GN = URA7 PE = 1 SV = 2
Squalene monooxygenase OS = Saccharomyces	0.000194343	3.96131E−05	4.906016788	206	0.403131115
cerevisiae GN = ERG1 PE = 1 SV = 2
Putative aldehyde dehydrogenase-like protein YHR039C	0.000150213	3.06181E−05	4.906016788	212	0.414872798
OS = Saccharomycescerevisiae GN = MSC7 PE = 1 SV = 1
Glucosamine--fructose-6-phosphate aminotransferase	0.000521969	0.000109122	4.783366368	213	0.416829746
[isomerizing] OS = Saccharomycescerevisiae GN = GFA1
PE = 1 SV = 4
Uncharacterized GTP-binding protein OLA1 OS =	0.001879535	0.000395467	4.752703763	214	0.418786693
Saccharomyces cerevisiae GN = OLA1 PE = 1 SV = 1
Probable 1-acyl-sn-glycerol-3-phosphate acyltransferase	0.000300341	6.44409E−05	4.660715949	215	0.42074364
OS = Saccharomycescerevisiae GN = SLC1 PE = 1 SV = 1
Sporulation-specific protein 21 OS = Saccharomyces	0.000145644	3.12494E−05	4.660715949	216	0.422700587
cerevisiae GN = SPO21 PE = 1 SV = 1
Cell division control protein 42 OS = Saccharomyces	0.000477329	0.000102415	4.660715949	216	0.422700587
cerevisiae GN = CDC42 PE = 1 SV = 2
Serine/threonine-protein phosphatase PP-Z2 OS =	0.000129664	2.78207E−05	4.660715949	216	0.422700587
Saccharomyces cerevisiae GN = PPZ2 PE = 1 SV = 4
Putative mitochondrial carrier protein YHM1/SHM1 OS =
Saccharomyces cerevisiae GN = YHM1 PE = 1 SV = 1	0.0003064	6.57409E−05	4.660715949	216	0.422700587
60S ribosomal protein L24-A OS = Saccharomyces	0.001155633	0.000247952	4.660715949	216	0.422700587
cerevisiae GN = RPL24A PE = 1 SV = 1
60S ribosomal protein L35 OS = Saccharomyces	0.001463371	0.00031398	4.660715949	216	0.422700587
cerevisiae GN = RPL35A PE = 1 SV = 1
Mitochondrial respiratory chain complexes assembly	0.000109111	2.34108E−05	4.660715949	222	0.43444227
protein RCA1 OS = Saccharomycescerevisiae
GN = RCA1 PE = 1 SV = 2
Prohibitin-1 OS = Saccharomycescerevisiae GN = PHB1	0.000647698	0.00013897	4.660715949	222	0.43444227
PE = 1 SV = 2
T-complex protein 1 subunit epsilon OS =	0.000164381	3.52695E−05	4.660715949	222	0.43444227
Saccharomyces cerevisiae GN = CCT5 PE = 1 SV = 3
Translation machinery-associated protein 22 OS =	0.000452437	9.70746E−05	4.660715949	222	0.43444227
Saccharomyces cerevisiae (strain YJM789) GN =
TMA22 PE = 3 SV = 1
DnaJ homolog 1, mitochondrial OS = Saccharomyces	0.000183181	3.93031E−05	4.660715949	222	0.43444227
cerevisiae GN = MDJ1 PE = 1 SV = 1
Alpha,alpha-trehalose-phosphate synthase [UDP-	0.000725072	0.000155571	4.660715949	222	0.43444227
forming] 56 kDa subunit OS = Saccharomycescerevisiae
GN = TPS1 PE = 1 SV = 2
Acetyl-coenzyme A synthetase 2 OS = Saccharomyces	0.001617845	0.000347124	4.660715949	222	0.43444227
cerevisiae GN = ACS2 PE = 1 SV = 1
60S ribosomal protein L24-B OS = Saccharomyces	0.001159999	0.000248889	4.660715949	222	0.43444227
cerevisiae GN = RPL24B PE = 1 SV = 1
Protein YGP1 OS = Saccharomycescerevisiae	0.00027266	5.85018E−05	4.660715949	222	0.43444227
GN = YGP1 PE = 1 SV = 2
Actin-related protein 2/3 complex subunit 3 OS =	0.000494562	0.000106113	4.660715949	231	0.452054795
Saccharomyces cerevisiae GN = ARC18 PE = 1 SV = 1
Isoleucyl-tRNA synthetase, cytoplasmic OS =	0.001141147	0.000248582	4.590629995	232	0.454011742
Saccharomyces cerevisiae GN = ILS1 PE = 1 SV = 1
Eukaryotic translation initiation factor 3 subunit I	0.000511405	0.000112692	4.538065529	233	0.455968689
OS = Saccharomycescerevisiae (strain YJM789)
GN = TIF34 PE = 3 SV = 1
Dolichol-phosphate mannosyltransferase OS =	0.001287884	0.000287683	4.476740319	234	0.457925636
Saccharomyces cerevisiae GN = DPM1 PE = 1 SV = 3
40S ribosomal protein S29-B OS = Saccharomyces	0.001433232	0.000324597	4.415415109	235	0.459882583
cerevisiae GN = RPS29B PE = 1 SV = 3
Pre-mRNA-splicing factor ATP-dependent RNA helicase	0.000110115	2.49388E−05	4.415415109	236	0.46183953
PRP43 OS = Saccharomycescerevisiae GN = PRP43
PE = 1 SV = 1
Translocation protein SEC72 OS = Saccharomyces	0.000446225	0.000101061	4.415415109	236	0.46183953
cerevisiae GN = SEC72 PE = 1 SV = 3
Transcription elongation factor SPT5 OS = Saccharomyces	0.000166746	3.77645E−05	4.415415109	236	0.46183953
cerevisiae GN = SPT5 PE = 1 SV = 1
Endoplasmic reticulum transmembrane protein 1 OS =	0.000411557	9.32092E−05	4.415415109	236	0.46183953
Saccharomyces cerevisiae GN = YET1 PE = 1 SV = 1
Ferrochelatase,mitochondrial OS = Saccharomyces	0.000216204	4.89658E−05	4.415415109	236	0.46183953
cerevisiae GN = HEM15 PE = 1 SV = 1
Protein CBP3, mitochondrial OS = Saccharomyces	0.000246696	5.58715E−05	4.415415109	236	0.46183953
cerevisiae GN = CBP3 PE = 1 SV = 1
Putative protein disulfide-isomerase YIL005W OS =
Saccharomyces cerevisiae GN = YIL005W PE = 1 SV = 1	0.000118712	2.68857E−05	4.415415109	236	0.46183953
Mitochondrial protein import protein MAS5 OS =	0.000863384	0.000195539	4.415415109	236	0.46183953
Saccharomyces cerevisiae GN = YDJ1 PE = 1 SV = 1
Peroxisomal-coenzyme A synthetase	0.000159402	3.61013E−05	4.415415109	236	0.46183953
OS = Saccharomycescerevisiae GN = FAT2 PE = 1 SV = 1
Nuclear cap-binding protein complex subunit 1 OS =	0.000192799	4.36651E−05	4.415415109	245	0.479452055
Saccharomyces cerevisiae GN = STO1 PE = 1 SV = 2
Proteasome component Y13 OS = Saccharomyces	0.000335781	7.60474E−05	4.415415109	245	0.479452055
cerevisiae GN = PRE9 PE = 1 SV = 1
Trehalose synthase complex regulatory subunit TSL 1 OS =	0.000304804	7.10041E−05	4.29276469	247	0.483365949
Saccharomyces cerevisiae GN = TSL1 PE = 1 SV = 1
Ribosomal RNA-processing protein 12 OS =	6.62221E−05	1.58802E−05	4.17011427	248	0.485322896
Saccharomyces cerevisiae GN = RRP12 PE = 1 SV = 1
U3 small nucleolar RNA-associated protein 22 OS =	6.48185E−05	1.55436E−05	4.17011427	248	0.485322896
Saccharomyces cerevisiae GN = UTP22 PE = 1 SV = 1
40S ribosomal protein S26-B OS = Saccharomyces	0.001354434	0.000324795	4.17011427	248	0.485322896
cerevisiae GN = RPS26B PE = 1 SV = 1
Elongator complex protein OS = Saccharomyces	5.95221E−05	1.42735E−05	4.17011427	248	0.485322896
cerevisiae GN = IKI3 PE = 1 SV = 1
Probable 1,3-beta-glucanosyltransferase GAS3 OS =	0.000160338	3.84492E−05	4.17011427	252	0.493150685
Saccharomyces cerevisiae GN = GAS3 PE = 1 SV = 1
Dynamin-related protein DNM1 OS = Saccharomyces	0.000428661	0.000102794	4.17011427	252	0.493150685
cerevisiae GN = DNM1 PE = 1 SV = 1
Pyruvate dehydrogenase complex protein X component,	0.000401489	9.62777E−05	4.17011427	252	0.493150685
mitochondrial OS = Saccharomycescerevisiae GN = PDX1
PE = 1 SV = 1
GTP-binding protein RHO3 OS = Saccharomyces	0.00035976	8.6271E−05	4.17011427	252	0.493150685
cerevisiae GN = RHO3 PE = 1 SV = 2
DNA-directed RNA polymerase I subunit RPA2 OS =	0.000130225	3.21744E−05	4.04746385	256	0.500978474
Saccharomyces cerevisiae GN = RPA2 PE = 1 SV = 1
54S ribosomal protein YmL6, mitochondrial OS =	0.000268086	6.83055E−05	3.92481343	257	0.502935421
Saccharomyces cerevisiae GN = YML6 PE = 1 SV = 1
ER-derived versicles protein ERV29 OS = Saccharomyces	0.000244777	6.23666E−05	3.92481343	257	0.502935421
cerevisiae GN = ERV29 PE = 1 SV = 1
54S ribosomal protein L3, mitochondrial OS =	0.000194787	4.96296E−05	3.92481343	257	0.502935421
Saccharomyces cerevisiae GN = MRPL3 PE = 1 SV = 2
Pyrroline-5-carboxylate reductase OS = Saccharomyces	0.000284449	7.24746E−05	3.92481343	257	0.502935421
cerevisiae GN = PRO3 PE = 1 SV = 1
60S ribosomal protein L34-A OS = Saccharomyces	0.000628399	0.000160109	3.92481343	257	0.502935421
cerevisiae GN = RPL34A PE = 1 SV = 1
Serine/threonine-protein kinase YPK1 OS =	0.000112061	2.85519E−05	3.92481343	257	0.502935421
Saccharomyces cerevisiae GN = YPK1 PE = 1 SV = 2
60S ribosomal protein L19 OS = Saccharomyces	0.000789773	0.000201226	3.92481343	257	0.502935421
cerevisiae GN = RPL19A PE = 1 SV = 5
CDP-diacylglycerol--inositol 3-phosphatidyltransferase	0.000345261	8.79687E−05	3.92481343	264	0.516634051
OS = Saccharomycescerevisiae GN = PIS1 PE = 1 SV = 1
60S ribosome subunit biogenesis protein NIP7 OS =	0.00042053	0.000107146	3.92481343	264	0.516634051
Saccharomyces cerevisiae GN = NIP7 PE = 1 SV = 1
Cell division control protein 10 OS = Saccharomyces	0.00023148	5.89787E−05	3.92481343	264	0.516634051
cerevisiae GN = CDC10 PE = 1 SV = 1
E3 ubiquitin-protein ligase RSP5 OS = Saccharomyces	9.33468E−05	2.37837E−05	3.92481343	264	0.516634051
cerevisiae GN = RSP5 PE = 1 SV = 1
Glucan 1,3-beta-glucosidase I/II OS = Saccharomyces	0.000167033	4.25582E−05	3.92481343	264	0.516634051
cerevisiae GN = EXG1 PE = 1 SV = 1
Eukaryotic translation initiation factor 5A-2 OS =	0.010829628	0.002807121	3.857913202	269	0.526418787
Saccharomyces cerevisiae GN = HYP2 PE = 1 SV = 3
1,4-alpha-glucan-branching enzyme OS = Saccharomyces	0.000204713	5.38413E−05	3.802163011	270	0.528375734
cerevisiae GN = GLC3 PE = 1 SV = 2
Polyadenylate-binding protein, cytoplasmic and nuclear	0.001523484	0.000407257	3.740837801	271	0.530332681
OS = Saccharomycescerevisiae GN = PAB1 PE = 1 SV = 4
Protein GCY OS = Saccharomycescerevisiae GN = GCY1	0.004153505	0.001120519	3.70676824	272	0.532289628
PE = 1 SV = 1
Putative thiosulfate sulfurtransferase YOR285W OS =	0.001042629	0.000283361	3.679512591	273	0.534246575
Saccharomyces cerevisiae GN = YOR285W PE = 1 SV = 1
DNA topoisomerase 2-associated protein PAT1 OS =	9.07936E−05	2.46754E−05	3.679512591	274	0.536203523
Saccharomyces cerevisiae GN = PAT1 PE = 1 SV = 3
CAAX prenyl protease 1 OS = Saccharomycescerevisiae	0.000153556	4.17326E−05	3.679512591	274	0.536203523
GN = STE24 PE = 1 SV = 1
Endoplasmic reticulum transmembrane protein 3 OS =	0.000350817	9.53433E−05	3.679512591	274	0.536203523
Saccharomyces cerevisiae GN = YET3 PE = 1 SV = 1
ATP-dependent RNA helicase DOB1 OS =	6.58304E−05	1.78911E−05	3.679512591	277	0.542074364
Saccharomyces cerevisiae GN = MTR4 PE = 1 SV = 1
Translation machinery-associated protein 17 OS =	0.000479086	0.000130204	3.679512591	277	0.542074364
Saccharomyces cerevisiae GN = TMA17 PE = 1 SV = 1
Carbon catabolite-derepressing protein kinase OS =	0.000111525	3.03099E−05	3.679512591	277	0.542074364
Saccharomyces cerevisiae GN = SNF1 PE = 1 SV = 1
tRNA (cytosine-5-)-methyltransferase NCL1 OS =	0.000103174	2.80402E−05	3.679512591	277	0.542074364
Saccharomyces cerevisiae GN = NCL1 PE = 1 SV = 1
Protein transport protein SEC61 OS = Saccharomyces	0.000151778	4.12496E−05	3.679512591	277	0.542074364
cerevisiae GN = SEC61 PE = 1 SV = 1
Calcineurin subunit B OS = Saccharomycescerevisiae	0.000409121	0.000111189	3.679512591	277	0.542074364
GN = CNB1 PE = 1 SV = 3
Lysophospholipase 1 OS = Saccharomycescerevisiae	0.000112114	3.04697E−05	3.679512591	277	0.542074364
GN = PLB1 PE = 1 SV = 2
Proteasome component Y7 OS = Saccharomyces	0.000295812	8.03944E−05	3.679512591	277	0.542074364
cerevisiae GN = PRE8 PE = 1 SV = 1
Metal resistance protein YCF1 OS = Saccharomyces	4.69538E−05	1.27609E−05	3.679512591	277	0.542074364
cerevisiae GN = YCF1 PE = 1 SV = 2
Ran GTPase-activating protein 1 OS = Saccharomyces	0.000175372	4.76619E−05	3.679512591	277	0.542074364
cerevisiae GN = RNA1 PE = 1 SV = 2
L-aminoadipate-semialdehyde dehydrogenase OS =	0.000103446	2.81139E−05	3.679512591	277	0.542074364
Saccharomyces cerevisiae GN = LYS2 PE = 1 SV = 2
Serine hydroxymethyltransferase, mitochondrial OS =	0.000299329	8.13501E−05	3.679512591	288	0.563600783
Saccharomyces cerevisiae GN = SHM1 PE = 1 SV = 2
Coatomer subunit alpha OS = Saccharomycescerevisiae	0.000351559	9.66186E−05	3.638629118	289	0.56555773
GN = RET1 PE = 1 SV = 2
40S ribosomal protein S10-B OS = Saccharomyces	0.003742563	0.001028564	3.638629118	289	0.56555773
cerevisiae GN = RPS10B PE = 1 SV = 1
40S ribosomal protein S10-A OS = Saccharomyces	0.003742269	0.001028483	3.638629118	289	0.56555773
cerevisiae GN = RPS10A PE = 1 SV = 1
Tryptophan synthase OS = Saccharomycescerevisiae	0.000412455	0.000113995	3.618187381	292	0.571428571
GN = TRP5 PE = 1 SV = 1
Serine/threonine-protein phosphatase PP1-2 OS =	0.000865225	0.000243255	3.556862171	293	0.573385519
Saccharomyces cerevisiae GN = GLC7 PE = 1 SV = 1
Aminopeptidase Y OS = Saccharomycescerevisiae	0.000258312	7.26236E−05	3.556862171	293	0.573385519
GN = APE3 PE = 1 SV = 1
Glycerol-3-phosphate dehydrogenase [NAD+] 1 OS =	0.00143702	0.000407527	3.526199566	295	0.577299413
Saccharomyces cerevisiae GN = GPD1 PE = 1 SV = 4
Valyl-tRNA synthetase, mitochondrial OS =	0.000732554	0.00020835	3.515978698	296	0.57925636
Saccharomyces cerevisiae GN = VAS1 PE = 1 SV = 2
Aconitate hydratase, mitochondrial OS = Saccharomyces	0.004316972	0.001227815	3.515978698	297	0.581213307
cerevisiae GN = ACO1 PE = 1 SV = 2
Elongation factor Tu, mitochondrial OS = Saccharomyces	0.000636478	0.000182083	3.495536962	298	0.583170254
cerevisiae GN = TUF1 PE = 1 SV = 1
Glycerol-3-phosphate O-acyltransferase 2 OS =	8.96548E−05	2.61064E−05	3.434211752	299	0.585127202
Saccharomyces cerevisiae GN = GPT2 PE = 1 SV = 1
Putative ribosomal RNA methyltransferase Nop2 OS =	0.000107421	3.12796E−05	3.434211752	299	0.585127202
Saccharomyces cerevisiae GN = NOP2 PE = 1 SV = 1
Serine/threonine-protein kinase YPK2/YKR2 OS =	9.78166E−05	2.8483E−05	3.434211752	299	0.585127202
Saccharomyces cerevisiae GN = YPK2 PE = 1 SV = 1
Xanthine phosphoribosyltransferase 1 OS =	0.000316809	9.22508E−05	3.434211752	302	0.590998043
Saccharomyces cerevisiae GN = XPT1 PE = 1 SV = 1
3-hydroxy-3-methylglutaryl-coenzyme A reductase 2 OS =	6.48202E−05	1.88748E−05	3.434211752	302	0.590998043
Saccharomyces cerevisiae GN = HMG2 PE = 1 SV = 1
3-keto-steroid reductase OS = Saccharomycescerevisiae	0.000188778	5.49698E−05	3.434211752	302	0.590998043
GN = ERG27 PE = 1 SV = 1
Ras-like protein 2 OS = Saccharomycescerevisiae	0.000216093	6.29235E−05	3.434211752	302	0.590998043
GN = RAS2 PE = 1 SV = 4
Protein phosphatase 1 regulatory subunit SDS22 OS =	0.000192838	5.6152E−05	3.434211752	302	0.590998043
Saccharomyces cerevisiae GN = SDS22 PE = 1 SV = 1
Ubiquitin-like protein SMT3 OS = Saccharomyces	0.001293296	0.000376592	3.434211752	302	0.590998043
cerevisiae GN = SMT3 PE = 1 SV = 1
Sphingosine-1-phosphate lyase OS = Saccharomyces	0.000114378	3.33055E−05	3.434211752	302	0.590998043
cerevisiae GN = DPL1 PE = 1 SV = 1
Protein transport protein SSS1 OS = Saccharomyces	0.000838514	0.000244165	3.434211752	302	0.590998043
cerevisiae GN = SSS1 PE = 1 SV = 2
UPF0674 endoplasmic reticulum membrane protein	0.000159242	4.63692E−05	3.434211752	302	0.590998043
YNR021 OS = Saccharomycescerevisiae
GN = YNR021W PE = 1 SV = 3
Non-classical export protein 2 OS = Saccharomyces	0.000395383	0.000115131	3.434211752	302	0.590998043
cerevisiae GN = NCE102 PE = 1 SV = 1
Reduced viability upon starvation protein 161 OS =	0.000247902	7.21859E−05	3.434211752	302	0.590998043
Saccharomyces cerevisiae GN = RVS161 PE = 1 SV = 1
Cytochrome b5 OS = Saccharomycescerevisiae GN =	0.000563995	0.000164228	3.434211752	302	0.590998043
CYB5 PE = 1 SV = 2
60S ribosomal protein L37-A OS = Saccharomyces	0.00076134	0.000221693	3.434211752	302	0.590998043
cerevisiae GN = RPL37A PE = 1 SV = 2
Calmodulin OS = Saccharomycescerevisiae GN = CMD1	0.000464783	0.000135339	3.434211752	302	0.590998043
PE = 1 SV = 1
Actin-related protein 2/3 complex subunit 5 OS =	0.000437682	0.000127447	3.434211752	302	0.590998043
Saccharomyces cerevisiae GN = ARC15 PE = 1 SV = 1
Mitochondrial outer membrane protein SCY_3392 OS =	9.17107E−05	2.6705E−05	3.434211752	317	0.62035225
Saccharomyces cerevisiae (strain YJM789) GN =
SCY_3392 PE = 3 SV = 1
tRNA pseudouridine synthase 1 OS = Saccharomyces	0.000120677	3.51396E−05	3.434211752	317	0.62035225
cerevisiae GN = PUS1 PE = 1 SV = 1
Heterotrimeric G protein gamma subunit GPG1 OS =	0.00050257	0.000146342	3.434211752	317	0.62035225
Saccharomyces cerevisiae GN = GPG1 PE = 1 SV = 1
Anthranilate synthase component 1 OS = Saccharomyces	0.000132104	3.84672E−05	3.434211752	320	0.626223092
cerevisiae GN = TRP2 PE = 1 SV = 4
UPF0662 protein YPL260W OS = Saccharomyces	0.000230371	6.95657E−05	3.311561332	321	0.628180039
cerevisiae GN = YPL260W PE = 1 SV = 1
NADPH-dependent 1-acyldihydroxyacetone phosphate	0.000440749	0.000133094	3.311561332	321	0.628180039
reductase OS = Saccharomycescerevisiae GN = AYR1
PE = 1 SV = 1
Long-chain-fatty-acid--CoA ligase 1 OS = Saccharomyces	0.000557224	0.000168266	3.311561332	323	0.632093933
cerevisiae GN = FAA1 PE = 1 SV = 1
Small COPII coat GTPase SAR1 OS = Saccharomyces	0.001323495	0.0004072	3.250236122	324	0.634050881
cerevisiae GN = SAR1 PE = 1 SV = 1
GMP synthase [glutamine-hydrolyzing] OS =	0.000485453	0.000149359	3.250236122	325	0.636007828
Saccharomyces cerevisiae GN = GUA1 PE = 1 SV = 4
Mitochondrial outer membrane protein porin 1 OS =	0.003256725	0.001004705	3.241475378	326	0.637964775
Saccharomyces cerevisiae GN = POR1 PE = 1 SV = 4
ATP-dependent helicase NAM7 OS = Saccharomyces	6.36357E−05	1.99553E−05	3.188910912	327	0.639921722
cerevisiae GN = NAM7 PE = 1 SV = 1
Proteasome component PRE2 OS = Saccharomyces	0.000220117	6.90258E−05	3.188910912	327	0.639921722
cerevisiae GN = PRE2 PE = 1 SV = 3
Homocitrate synthase, mitochondrial OS =	0.000859811	0.000269625	3.188910912	327	0.639921722
Saccharomyces cerevisiae GN = LYS21 PE = 1 SV = 1
Nucleolar complex protein 2 OS = Saccharomyces	8.53356E−05	2.67601E−05	3.188910912	330	0.645792564
cerevisiae GN = NOC2 PE = 1 SV = 2
Transcriptional regulatory protein SIN3 OS =	3.9829E−05	1.24898E−05	3.188910912	330	0.645792564
Saccharomyces cerevisiae GN = SIN3 PE = 1 SV = 2
Ribosome biogenesis protein ERB1 OS =	7.59361E−05	2.38126E−05	3.188910912	330	0.645792564
Saccharomyces cerevisiae (strain YJM789)
GN = ERB1 PE = 3 SV = 1
Dihydroxy-acid dehydratase, mitochondrial OS =	0.000664668	0.000208431	3.188910912	330	0.645792564
Saccharomyces cerevisiae GN = ILV3 PE = 1 SV = 2
Uncharacterized protein YKL054C OS = Saccharomyces	8.29339E−05	2.6007E−05	3.188910912	330	0.645792564
cerevisiae GN = YKL054C PE = 1 SV = 1
DNA-directed RNA polymerases I, II, and III subunit	0.000841244	0.000263803	3.188910912	330	0.645792564
RPABC5 OS = Saccharomycescerevisiae GN = RPB10
PE = 1 SV = 2
Mitochondrial presequence protease OS =	0.000124148	3.89313E−05	3.188910912	330	0.645792564
Saccharomyces cerevisiae GN = CYM1 PE = 1 SV = 2
Amidophosphoribosyltransferase OS = Saccharomyces	0.000122775	3.85005E−05	3.188910912	330	0.645792564
cerevisiae GN = ADE4 PE = 1 SV = 2
Protein ERP1 OS = Saccharomycescerevisiae	0.000281662	8.83256E−05	3.188910912	330	0.645792564
GN = ERP1 PE = 1 SV = 1
Hsp90 co-chaperone HCH1 OS = Saccharomyces	0.000403775	0.000126618	3.188910912	330	0.645792564
cerevisiae GN = HCH1 PE = 1 SV = 1
Acetyl-CoA carboxylase OS = Saccharomycescerevisiae	0.001223872	0.00038379	3.188910912	330	0.645792564
GN = FAS3 PE = 1 SV = 2
Mitochondrial outer membrane protein IML2 OS =	8.43558E−05	2.64528E−05	3.188910912	330	0.645792564
Saccharomyces cerevisiae (strain YJM789)
GN = IML2 PE = 3 SV = 1
Choline-phosphate cytidylyltransferase OS =	0.000140944	4.41982E−05	3.188910912	342	0.66927593
Saccharomyces cerevisiae GN = PCT1 PE = 1 SV = 2
Nucleosome assembly protein OS = Saccharomyces	0.000145425	4.56032E−05	3.188910912	342	0.66927593
cerevisiae GN = NAP1 PE = 1 SV = 2
THO complex subunit 2 OS = Saccharomycescerevisiae	3.78591E−05	1.18721E−05	3.188910912	342	0.66927593
GN = THO2 PE = 1 SV = 1
Sec sixty-one protein homolog OS = Saccharomyces	0.000130618	4.096E−05	3.188910812	342	0.66927593
cerevisiae GN = SSH1 PE = 1 SV = 1
Cytochrome c heme lyase OS = Saccharomyces	0.000231505	7.25968E−05	3.188910912	342	0.66927593
cerevisiae GN = CYC3 PE = 1 SV = 1
Prefolding subunit 4 OS = Saccharomycescerevisiae	0.000458719	0.000143848	3.188910912	342	0.66927593
GN = GIM3 PE = 1 SV = 1
Gamma-glutamyl phosphate reductase OS =	0.000139998	4.39016E−05	3.188910912	342	0.66927593
Saccharomyces cerevisiae GN = PRO2 PE = 1 SV = 1
60S ribosomal protein L37-B OS = Saccharomyces	0.000705676	0.000221291	3.188910912	342	0.66927593
cerevisiae GN = RPL37B PE = 1 SV = 2
UPF0368 protein YPL225W OS = Saccharomyces	0.000798365	0.000250357	3.188910912	342	0.66927593
cerevisiae GN = YPL225W PE = 1 SV = 1
Dolichyl-phosphate-mannose--protein	7.91626E−05	2.48243E−05	3.188910912	351	0.686888454
mannosyltransferase 4 OS = Saccharomycescerevisiae
GN = PMT4 PE = 1 SV = 1
Increased sodium tolerance protein 2 OS = Saccharomyces	6.57534E−05	2.06194E−05	3.188910912	351	0.686888454
cerevisiae GN = IST2 PE = 1 SV = 1
Glucokinase-1 OS = Saccharomycescerevisiae	0.002234448	0.000709793	3.148027439	353	0.690802348
GN = GLK1 PE = 1 SV = 1
Suppressor protein STM1 OS = Saccharomyces	0.003607455	0.001164851	3.096923097	354	0.692759295
cerevisiae GN = STM1 PE = 1 SV = 3
Uridylate kinase OS = Saccharomycescerevisiae	0.00028029	9.52198E−05	2.943610073	355	0.694716243
GN = URA6 PE = 1 SV = 1
Myosin light chain OS = Saccharomycescerevisiae	0.00078176	0.000265579	2.943610073	355	0.694716243
GN = MLC1 PE = 1 SV = 1
Glucose-repressible alcohol dehydrogenase	6.78771E−05	2.30591E−05	2.943610073	357	0.698630137
transcriptional effector OS = Saccharomycescerevisiae
GN = CCR4 PE = 1 SV = 1
54S ribosomal protein L1, mitochondrial OS =	0.000207377	7.04501E−05	2.943610073	357	0.698630137
Saccharomyces cerevisiae GN = MRPL1 PE = 1 SV = 1
Nuclear polyadenylated RNA-binding protein 3 OS =	7.10775E−05	2.41464E−05	2.943610073	357	0.698630137
Saccharomyces cerevisiae GN = NAB3 PE = 1 SV = 1
Phosphoglycerate mutase 2 OS = Saccharomyces	0.000178191	6.05348E−05	2.943610073	357	0.698630137
cerevisiae GN = GPM2 PE = 1 SV = 1
3′(2′),5′-bisphosphate nucleotidase OS = Saccharomyces	0.000164191	5.57789E−05	2.943610073	357	0.698630137
cerevisiae GN = HAL2 PE = 1 SV = 1
Protein SEY1 OS = Saccharomycescerevisiae (strain	7.18829E−05	2.442E−05	2.943610073	357	0.698630137
AWRI1631) GN = SEY1 PE = 3 SV = 1
Thiamine metabolism regulatory protein THI3 OS =	9.40228E−05	3.19413E−05	2.943610073	357	0.698630137
Saccharomyces cerevisiae GN = THI3 PE = 1 SV = 1
Alpha-mannosidase OS = Saccharomycescerevisiae	0.000103261	3.50796E−05	2.943610073	357	0.698630137
GN = AMS1 PE = 1 SV = 2
[NU+] prion formation protein 1 OS = Saccharomyces	4.78514E−05	1.6256E−05	2.943610073	357	0.698630137
cerevisiae GN = NEW1 PE = 1 SV = 1
T-complex protein 1 subunit beta OS = Saccharomyces	0.000112369	3.81738E−05	2.943610073	357	0.698630137
cerevisiae GN = CCT2 PE = 1 SV = 1
Putative zinc metalloproteinase YIL108W OS =	8.30332E−05	2.8208E−05	2.943610073	357	0.698630137
Saccharomyces cerevisiae GN = YIL108W PE = 1 SV = 1
Prefoldin subunit 5 OS = Saccharomycescerevisiae	0.000350187	0.000118965	2.943610073	357	0.698630137
GN = GIM5 PE = 1 SV = 1
Probable glycosidase CRH2 OS = Saccharomyces	0.000128804	4.37573E−05	2.943610073	357	0.698630137
cerevisiae GN = UTR2 PE = 1 SV = 3
Coatomer subunit epsilon OS = Saccharomyces	0.00019001	6.45499E−05	2.943610073	357	0.698630137
cerevisiae GN = SEC28 PE = 1 SV = 2
26S proteasome regulatory subunit RPN13 OS =	0.000359064	0.000121981	2.943610073	357	0.698630137
Saccharomyces cerevisiae GN = RPN13 PE = 1 SV = 1
40S ribosomal protein S28-A OS = Saccharomyces	0.001693466	0.000575302	2.943610073	357	0.698630137
cerevisiae GN = RPS28A PE = 1 SV = 1
D-3-phosphoglycerate dehydrogenase 1 OS =	0.000125564	4.26565E−05	2.943610073	357	0.698630137
Saccharomyces cerevisiae GN = SER3 PE = 1 SV = 1
Adenylosuccinate synthetase OS = Saccharomyces	0.000133142	4.52308E−05	2.943610073	357	0.698630137
cerevisiae GN = ADE12 PE = 1 SV = 3
CTP synthase 2 OS = Saccharomycescerevisiae (strain	9.96651E−05	3.38581E−05	2.943610073	375	0.733855186
YJM789) GN = URA8 PE = 3 SV = 1
ATP-dependent RNA helicase HAS1 OS =	0.000113331	3.85006E−05	2.943610073	375	0.733855186
Saccharomyces cerevisiae GN = HAS1 PE = 1 SV = 1
Zinc finger protein ZPR1 OS = Saccharomycescerevisiae	0.000116721	3.96523E−05	2.943610073	375	0.733855186
GN = ZPR1 PE = 1 SV = 1
26S proteasome regulatory subunit RPN3 OS =	0.00010638	3.61393E−05	2.943610073	375	0.733855186
Saccharomyces cerevisiae GN = RPN3 PE = 1 SV = 4
Peroxisomal membrane protein PMP27 OS =	0.000239176	8.12526E−05	2.943610073	375	0.733855186
Saccharomyces cerevisiae GN = PEX11 PE = 1 SV = 2
Ribose-phosphate pyrophosphokinase 5 OS =	0.000120138	4.08132E−05	2.943610073	375	0.733855186
Saccharomyces cerevisiae GN = PRS5 PE = 1 SV = 1
U6 snRNA-associated Sm-like protein LSm6 OS =	0.00068399	0.000232364	2.943610073	375	0.733855186
Saccharomyces cerevisiae (strain YJM789)
GN = LSM6 PE = 3 SV = 1
Protein HMF1 OS = Saccharomycescerevisiae	0.00046226	0.000157038	2.943610073	375	0.733855186
GN = HMF1 PE = 1 SV = 1
General negative regulator of transcription subunit 1 OS =	2.67455E−05	9.08595E−06	2.943610073	375	0.733855186
Saccharomyces cerevisiae GN = NOT1 PE = 1 SV = 2
Putative glucokinase-2 OS = Saccharomycescerevisiae	0.000881255	0.000312395	2.820959653	384	0.75146771
GN = EMI2 PE = 1 SV = 1
26S protease regulatory subunit 4 homolog OS =	0.000252314	8.94425E−05	2.820959653	385	0.753424658
Saccharomyces cerevisiae GN = RPT2 PE = 1 SV = 3
Sphingolipid long chain base-responsive protein LSP1	0.001589943	0.000573593	2.771899485	386	0.755381605
OS = Saccharomycescerevisiae GN = LSP1 PE = 1 SV = 1
UPF0001 protein YBL036C OS = Saccharomyces	0.000202322	7.4981E−05	2.698309233	387	0.757338552
cerevisiae GN = YBL036C PE = 1 SV = 1
Galactose/lactose metabolism regulatory protein GAL80	0.000121933	4.51887E−05	2.698309233	388	0.759295499
OS = Saccharomycescerevisiae GN = GAL80 PE = 1
SV = 2
U3 small nucleolar ribonucleoprotein protein IMP3 OS =	0.000269233	9.97785E−05	2.698309233	388	0.759295499
Saccharomyces cerevisiae GN = IMP3 PE = 1 SV = 1
U3 small nucleolar RNA-associated protein 21 OS =	5.62287E−05	2.08385E−05	2.698309233	388	0.759295499
Saccharomyces cerevisiae GN = UTP21 PE = 1 SV = 1
DNA polymerase alpha catalytic subunit A OS =	3.53233E−05	1.30909E−05	2.698309233	388	0.759295499
Saccharomyces cerevisiae GN = POL1 PE = 1 SV = 2
Probable glycerophosphodiester phosphodiesterase	0.000158949	5.89071E−05	2.68309233	388	0.759295499
YPL206C OS = Saccharomycescerevisiae GN = YPL206C
PE = 1 SV = 1
Cytochrome c oxidase assembly protein COX15 OS =	0.000107801	3.99514E−05	2.698309233	388	0.759295499
Saccharomyces cerevisiae GN = COX15 PE = 1 SV = 1
U6 snRNA-associated Sm-like protein LSm5 OS =	0.000565322	0.00020951	2.698309233	388	0.759295499
Saccharomyces cerevisiae GN = LSM5 PE = 1 SV = 1
60S ribosomal protein L29 OS = Saccharomyces	0.000883547	0.000327445	2.698309233	388	0.759295499
cerevisiae GN = RPL29 PE = 1 SV = 3
Tricalbin-3 OS = Saccharomycescerevisiae GN = TCB3	6.88849E−05	2.55289E−05	2.698309233	388	0.759295499
PE = 1 SV = 1
Peroxiredoxin HYR1 OS = Saccharomycescerevisiae	0.000632164	0.000234282	2.698309233	388	0.759295499
GN = HYR1 PE = 1 SV = 1
Glucose-6-phosphate 1-dehydrogenase OS =	0.000409742	0.000151852	2.698309233	388	0.759295499
Saccharomyces cerevisiae GN = ZWF1 PE = 1 SV = 4
Endosomal protein P24B OS = Saccharomyces	0.000252541	9.35923E−05	2.698309233	388	0.759295499
cerevisiae GN = EMP24 PE = 1 SV = 1
Proteasome component C1 OS = Saccharomyces	0.000186846	6.92457E−05	2.698309233	388	0.759295499
cerevisiae GN = PRE10 PE = 1 SV = 2
26S proteasome regulatory subunit RPN6 OS =	0.000118379	4.38716E−05	2.698309233	388	0.759295499
Saccharomyces cerevisiae GN = RPN6 PE = 1 SV = 3
Monothiol glutaredoxin-3 OS = Saccharomycescerevisiae	0.000181409	6.72305E−05	2.698309233	388	0.759295499
GN = GRX3 PE = 1 SV = 1
C-8 sterol isomerase OS = Saccharomycescerevisiae	0.000236677	8.77132E−05	2.698309233	388	0.759295499
GN = ERG2 PE = 1 SV = 1
Uncharacterized membrane glycoprotein YNR065C OS =	4.70626E−05	1.74415E−05	2.698309233	388	0.759295499
Saccharomyces cerevisiae GN = YNR065C PE = 1 SV = 1
Ubiquitin carboxyl-terminal hydrolase 6 OS =	0.000103173	3.82361E−05	2.698309233	405	0.792563601
Saccharomyces cerevisiae GN = UBP6 PE = 1 SV = 1
Histone chaperone ASF1 OS = Saccharomyces	0.000186452	6.90996E−05	2.698309233	405	0.792563601
cerevisiae GN = ASF1 PE = 1 SV = 1
Pumilio homology domain family member 6 OS =	0.000156904	5.81491E−05	2.698309233	405	0.792563601
Saccharomyces cerevisiae GN = PUF6 PE = 1 SV = 1
Mitochondrial outer membrane protein OM14	0.00040332	0.000149471	2.698309233	405	0.792563601
OS = Saccharomycescerevisiae (strain YJM789)
GN = OM14 PE = 3 SV = 1
AP-1 complex subunit gamma-1 OS = Saccharomyces	6.29325E−05	2.33229E−05	2.698309233	405	0.792563601
cerevisiae GN = APL4 PE = 1 SV = 1
Signal recognition particle subunit SRP72 OS =	8.01207E−05	2.96929E−05	2.698309233	405	0.792563601
Saccharomyces cerevisiae GN = SRP72 PE = 1 SV = 2
Protein transport protein SEC31 OS = Saccharomyces	4.24814E−05	1.57437E−05	2.698309233	405	0.792563601
cerevisiae GN = SEC31 PE = 1 SV = 2
Phosphatidylethanolamine N-methyltransferase OS =	5.8221E−05	2.15769E−05	2.698309233	405	0.792563601
Saccharomyces cerevisiae GN = PEM1 PE = 1 SV = 1
Mitochondrial import inner membrane translocase	0.000363362	0.000134663	2.698309233	405	0.792563601
subunit TIM16 OS = Saccharomycescerevisiae
GN = PAM16 PE = 1 SV = 1
Phosphatidate cytidylyltransferase OS = Saccharomyces	0.000113698	4.21366E−05	2.698309233	405	0.792563601
cerevisiae GN = CDS1 PE = 1 SV = 1
26S proteasome regulatory subunit RPN12 OS =	0.000184589	6.84093E−05	2.698309233	405	0.792563601
Saccharomyces cerevisiae GN = RPN12 PE = 1 SV = 3
N-terminal acetyltransferase A complex subunit NAT1	5.95728E−05	2.20778E−05	2.698309233	405	0.792563601
OS = Saccharomycescerevisiae GN = NAT1 PE = 1 SV = 2
Nucleolar pre-ribosomal-associated protein 1 OS =	2.89842E−05	1.07416E−05	2.698309233	405	0.792563601
Saccharomyces cerevisiae GN = URB1 PE = 1 SV = 2
GU4 nucleic-binding protein 1 OS = Saccharomyces	0.001107392	0.000415119	2.667646629	418	0.818003914
cerevisiae GN = ARC1 PE = 1 SV = 2
Mitochondrial peculiar membrane protein 1 OS =	0.000809029	0.000306801	2.636984024	419	0.819960861
Saccharomyces cerevisiae GN = MPM1 PE = 1 SV = 1
6-phosphogluconate dehydrogenase, decarboxylating 1 OS =	0.00494208	0.001876038	2.63431771	420	0.821917808
Saccharomyces cerevisiae GN = GND1 PE = 1 SV = 1
Transcription-associated protein 1 OS = Saccharomyces	2.59681E−05	1.00821E−05	2.575658814	421	0.823874755
cerevisiae GN = TRA1 PE = 1 SV = 1
RNA polymerase-associated protein CTR9 OS =	0.000180474	7.00692E−05	2.575658814	421	0.823874755
Saccharomyces cerevisiae GN = CTR9 PE = 1 SV = 2
DNA-directed RNA polymerases I, II, and III subunit	0.000681273	0.000264504	2.575658814	423	0.82778865
RPABC3 OS = Saccharomycescerevisiae GN = RPB8
PE = 1 SV = 1
Ribonucleoside-diphosphate reductase large chain 1 OS =	0.000112985	4.38663E−05	2.575658814	423	0.82778865
Saccharomyces cerevisiae GN = RNR1 PE = 1 SV = 2
60S ribosomal protein L10 OS = Saccharomyces	0.003548365	0.001377653	2.575658814	423	0.82778865
cerevisiae GN = RPL10 PE = 1 SV = 1
Sphingolipid long chain base-responsive protein PIL1	0.002318695	0.00091108	2.544996209	426	0.833659491
OS = Saccharomycescerevisiae GN = PIL1 PE = 1 SV = 1
Ribosome-associated complex subunit SSZ1 OS =	0.001333689	0.000524947	2.540615837	427	0.835616438
Saccharomyces cerevisiae GN = SSZ1 PE = 1 SV = 2
Golgin IMH1 OS = Saccharomycescerevisiae GN = IMH1	5.09048E−05	2.0752E−05	2.453008394	428	0.837573386
PE = 1 SV = 1
Protein SCO2, mitochondrial OS = Saccharomyces	0.000153531	6.25888E−05	2.453008394	428	0.837573386
cerevisiae GN = SCO2 PE = 1 SV = 1
3-ketoacyl-CoA reducatase OS = Saccharomyces	0.000138384	5.64138E−05	2.453008394	428	0.837573386
cerevisiae GN = IFA38 PE = 1 SV = 1
Iron transport multicopper oxidase FET5 OS =	7.55744E−05	3.08089E−05	2.453008394	428	0.837573386
Saccharomyces cerevisiae GN = FET5 PE = 1 SV = 1
Protein ISD11 OS = Saccharomycescerevisiae	0.000475466	0.00019383	2.453008394	428	0.837573386
GN = ISD11 PE = 1 SV = 1
Mitochondrial distribution and morphology protein 38	8.24018E−05	3.35921E−05	2.453008394	428	0.837573386
OS = Saccharomycescerevisiae GN = MDM38 PE = 1
SV = 1
Elongation of fatty acids protein 3 OS = Saccharomyces	0.000135728	5.53313E−05	2.453008394	428	0.837573386
cerevisiae GN = ELO3 PE = 1 SV = 1
Nucleolar GTP-binding protein 1 OS = Saccharomyces	7.19874E−05	2.93466E−05	2.453008394	428	0.837573386
cerevisiae GN = NOG1 PE = 1 SV = 1
Peptidyl-prolyl cis-trans isomerase ESS1 OS =	0.000276053	0.000112537	2.453008394	428	0.837573386
Saccharomyces cerevisiae GN = ESS1 PE = 1 SV = 3
ATPase GET3 OS = Saccharomycescerevisiae (strain	0.000136114	5.54886E−05	2.453008394	428	0.837573386
RM11-1a) GN = GET3 PE = 3 SV = 1
Protein APA1 OS = Saccharomycescerevisiae GN = APA1	0.000146785	5.98386E−05	2.453008394	428	0.837573386
PE = 1 SV = 4
Mitochondrial respiratory chain complexes assembly	6.33584E−05	2.58288E−05	2.453008394	439	0.859099804
protein AFG3 OS = Saccharomycescerevisiae GN =
AFG3 PE = 1 SV = 1
Calcium-transporting ATPase 2 OS = Saccharomyces	4.09332E−05	1.6687E−05	2.453008394	439	0.859099804
cerevisiae GN = PMC1 PE = 1 SV = 1
Probable intramembrane protease YKL100C OS =	7.93266E−05	3.23385E−05	2.453008394	439	0.859099804
Saccharomyces cerevisiae GN = YKL100C PE = 1 SV = 1
KH domain-containing protein YBL032W OS =	0.000128508	5.23877E−05	2.453008394	439	0.859099804
Saccharomyces cerevisiae GN = YBL032W PE = 1 SV = 1
Mitochondrial import receptor subunit TOM22 OS =	0.000319029	0.000130056	2.453008394	439	0.859099804
Saccharomyces cerevisiae GN = TOM22 PE = 1 SV = 3
Protein MSP1 OS = Saccharomycescerevisiae	0.00013277	5.41252E−05	2.453008394	439	0.859099804
GN = MSP1 PE = 1 SV = 2
UPF0364 protein YMR027W OS = Saccharomyces	9.89598E−05	4.03422E−05	2.453008394	439	0.859099804
cerevisiae GN = YMR027W PE = 1 SV = 1
Uncharacterized protein YJL217W OS = Saccharomyces	0.000243858	9.94119E−05	2.453008394	439	0.859099804
cerevisiae GN = YJL217W PE = 1 SV = 1
ER membrane protein complex subunit 4 OS =	0.000249609	0.000101756	2.453008394	439	0.859099804
Saccharomyces cerevisiae GN = EMC4 PE = 1 SV = 1
Sm-like protein LSm1 OS = Saccharomycescerevisiae	0.000263782	0.000107534	2.453008394	439	0.859099804
GN = LSM1 PE = 1 SV = 1
Probable alpha-1,6-mannosyltransferase MNN10 OS =	0.000114582	4.6711E−05	2.453008394	439	0.859099804
Saccharomyces cerevisiae GN = MNN10 PE = 1 SV = 1
Protein HAM1 OS = Saccharomycescerevisiae	0.000242455	9.884E−05	2.453008394	439	0.859099804
GN = HAM1 PE = 1 SV = 1
NADPH-dependent methylglyoxal reductase GRE2 OS =	0.000140339	5.7211E−05	2.453008394	439	0.859099804
Saccharomyces cerevisiae GN = GRE2 PE = 1 SV = 1
Alpha-1,2 mannosyltransferase KTR1 OS =	0.000116392	4.74486E−05	2.453008394	439	0.859099804
Saccharomyces cerevisiae GN = KTR1 PE = 1 SV = 1
Protein VTH1 OS = Saccharomycescerevisiae GN = VTH1	3.07094E−05	1.25191E−05	2.453008394	453	0.886497065
PE = 1 SV = 1
Trehalose synthase complex regulatory subunit TPS3 OS =	4.50766E−05	1.8376E−05	2.453008394	453	0.886497065
Saccharomyces cerevisiae GN = TPS3 PE = 1 SV = 3
Heat shock protein 60, mitochondrial OS =	0.006551267	0.002731813	2.398138469	455	0.890410959
Saccharomyces cerevisiae GN = HSP60 PE = 1 SV = 1
Pyruvate dehydrogenase E1 component subunit beta,	0.001029786	0.000436161	2.361020579	456	0.892367906
mitochondrial OS = Saccharomycescerevisiae GN =
PDB1 PE = 1 SV = 2
Pyruvate dehydrogenase E1 component subunit alpha,	0.00110963	0.000471203	2.354888058	457	0.894324853
mitochondrial OS = Saccharomycescerevisiae GN = PDA1
PE = 1 SV = 2
Actin-related protein 3 OS = Saccharomycescerevisiae	0.000205437	8.81567E−05	2.330357974	458	0.8962818
GN = ARP3 PE = 1 SV = 1
AMP deaminase OS = Saccharomycescerevisiae GN =	0.000109083	4.68094E−05	2.330357974	458	0.8962818
AMD1 PE = 1 SV = 2
Lon protease homolog, mitochondrial OS =	0.000235988	0.000103075	2.289474501	460	0.900195695
Saccharomyces cerevisiae GN = PIM1 PE = 1 SV = 2
Isocitrate dehydrogenase [NAD] subunit 1, mitochondrial	0.003037645	0.001332737	2.279253633	461	0.902152642
OS = Saccharomycescerevisiae GN = IDH1 PE = 1 SV = 2
Serine hydroxymethyltransferase, cytosolic OS =	0.001128399	0.000501825	2.248591028	462	0.904109589
Saccharomyces cerevisiae GN = SHM2 PE = 1 SV = 2
Rab proteins geranylgeranyltransferase component A	7.15564E−05	3.24121E−05	2.207707555	463	0.906066536
OS = Saccharomycescerevisiae GN = MRS6 PE = 1 SV = 2
37S ribosomal protein MRP1, mitochondrial OS =	0.000131255	5.9453E−05	2.207707555	463	0.906066536
Saccharomyces cerevisiae GN = MRP1 PE = 1 SV = 2
Carboxypeptidase S OS = Saccharomycescerevisiae	7.46309E−05	3.38047E−05	2.207707555	463	0.906066536
GN = CPS1 PE = 1 SV = 2
Probable glucose transporter HXT5 OS = Saccharomyces	7.27682E−05	3.2961E−05	2.207707555	466	0.911937378
cerevisiae GN = HXT5 PE = 1 SV = 1
Glycerol-3-phosphate dehydrogenase, mitochondrial OS =	0.000665985	0.000301664	2.207707555	466	0.911937378
Saccharomyces cerevisiae GN = GUT2 PE = 1 SV = 2
Cytochrome b2, mitochondrial OS = Saccharomyces	7.35584E−05	3.33189E−05	2.207707555	466	0.911937378
cerevisiae GN = CYB2 PE = 1 SV = 1
Translation machinery-associated protein 20 OS =	0.000237747	0.00010769	2.207707555	466	0.911937378
Saccharomyces cerevisiae GN = TMA20 PE = 1 SV = 1
D-arabinono-1,4-lactone oxidase OS = Saccharomyces	8.10341E−05	3.67051E−05	2.207707555	466	0.911937378
cerevisiae GN = ALO1 PE = 1 SV = 1
Protein phosphatase 2C homolog 3 OS = Saccharomyces	9.38112E−05	4.24926E−05	2.207707555	466	0.911937378
cerevisiae GN = PTC3 PE = 1 SV = 3
DNA-directed RNA polymerase II subunit RPB9 OS =	0.000337423	0.000152839	2.207707555	466	0.911937378
Saccharomyces cerevisiae GN = RPB9 PE = 1 SV = 1
Casein kinase II subunit alpha OS = Saccharomyces	0.000107928	4.88868E−05	2.207707555	466	0.911937378
cerevisiae GN = CKA1 PE = 1 SV = 1
26S protease regulatory subunit 6A OS = Saccharomyces	9.99044E−05	4.52526E−05	2.207707555	466	0.911937378
cerevisiae GN = RPT5 PE = 1 SV = 3
Enoyl reductase TSC13 OS = Saccharomycescerevisiae	0.000131115	5.93898E−05	2.207707555	466	0.911937378
GN = TSC13 PE = 1 SV = 1
H/ACA ribonucleoprotein complex subunit 2 OS =	0.000281572	0.000127541	2.207707555	466	0.911937378
Saccharomyces cerevisiae GN = NHP2 PE = 1 SV = 1
Retrograde regulation protein 2 OS = Saccharomyces	7.35221E−05	3.33024E−05	2.207707555	466	0.911937378
cerevisiae GN = RTG2 PE = 1 SV = 2
Uncharacterized protein YDR476C OS = Saccharomyces	0.000190809	8.64284E−05	2.207707555	466	0.911937378
cerevisiae GN = YDR476C PE = 1 SV = 1
DNA-directed RNA polymerases I and III subunit RPAC2	0.000298504	0.00013521	2.207707555	466	0.911937378
OS = Saccharomycescerevisiae GN = RPC19 PE = 1
SV = 1
GPI transamidase component GPI16 OS =	7.00996E−05	3.7522E−05	2.207707555	466	0.911937378
Saccharomyces cerevisiae GN = GPI16 PE = 1 SV = 2
V-type proton ATPase subunit e OS = Saccharomyces	0.000575236	0.000260558	2.207707555	466	0.911937378
cerevisiae GN = VMA9 PE = 1 SV = 1
Cell division control protein 28 OS = Saccharomyces	0.000283067	0.000128217	2.207707555	466	0.911937378
cerevisiae GN = CDC28 PE = 1 SV = 1
Serine/threonine-protein phosphatase 2B catalytic	7.03504E−05	3.18658E−05	2.207707555	466	0.911937378
subunit A2 OS = Saccharomycescerevisiae GN = CNA2
PE = 1 SV = 2
GTP-binding protein YPT31/YPT8 OS = Saccharomyces	0.000197022	8.92428E−05	2.207707555	466	0.911937378
cerevisiae GN = YPT31 PE = 1 SV = 3
FK506-binding nuclear protein OS = Saccharomyces	0.000103559	4.69079E−05	2.207707555	466	0.911937378
cerevisiae GN = FPR3 PE = 1 SV = 2
D-3-phosphoglycerate dehydrogenase 2 OS =	9.41815E−05	4.26603E−05	2.207707555	466	0.911937378
Saccharomyces cerevisiae GN = SER33 PE = 1 SV = 1
Coatomer subunit beta OS = Saccharomycescerevisiae	4.42208E−05	2.00302E−05	2.207707555	466	0.911937378
GN = SEC26 PE = 1 SV = 2
Dipeptidyl aminopeptidase B OS = Saccharomyces	5.16141E−05	2.33791E−05	2.207707555	466	0.911937378
cerevisiae GN = DAP2 PE = 2 SV = 2
Protein UTH1 OS = Saccharomycescerevisiae (strain	0.000131237	5.94449E−05	2.207707555	466	0.911937378
RM11-1a) GN = UTH1 PE = 2 SV = 1
Uncharacterized oxidoreductase YML125C OS =	0.000136619	6.18829E−05	2.207707555	490	0.95890411
Saccharomyces cerevisiae GN = YML125C PE = 1 SV = 1
Long-chain-fatty-acid--CoA ligase 3 OS = Saccharomyces	6.18498E−05	2.80154E−05	2.207707555	490	0.95890411
cerevisiae GN = FAA3 PE = 1 SV = 1
Actin-related protein 2/3 complex subunit 2 OS =	0.000243689	0.000110381	2.207707555	490	0.95890411
Saccharomyces cerevisiae GN = ARC35 PE = 1 SV = 1
Ceramide very long chain fatty acid hydroxylase SCS7	0.000107415	4.86547E−05	2.207707555	490	0.95890411
OS = Saccharomycescerevisiae GN = SCS7 PE = 1 SV = 1
Protein SDS24 OS = Saccharomycescerevisiae (strain	8.43025E−05	3.81855E−05	2.207707555	490	0.95890411
YJM789) GN = SDS24 PE = 3 SV = 1
Cytochrome c oxidase assembly protein COX14 OS =	0.000605735	0.000274373	2.207707555	490	0.95890411
Saccharomyces cerevisiae GN = COX14 PE = 1 SV = 1
Signal recognition particle subunit SRP14 OS =	0.000293428	0.000132911	2.207707555	490	0.95890411
Saccharomyces cerevisiae GN = SRP14 PE = 1 SV = 1
Putative guanine nucleotide-exchange factor SED4 OS =	4.22602E−05	1.91421E−05	2.207707555	497	0.97260274
Saccharomyces cerevisiae GN = SED4 PE = 1 SV = 1
Cytochrome b-c1 complex subunit 1, mitochondrial OS =	0.000757196	0.000347809	2.17704495	498	0.974559687
Saccharomyces cerevisiae GN = COR1 PE = 1 SV = 1
Lysyl-tRNA synthetase, cytoplasmic OS =	0.000693634	0.000321328	2.158647387	499	0.976516634
Saccharomyces cerevisiae GN = KRS1 PE = 1 SV = 2
Glutamyl-tRNA synthetase, cytoplasmic OS =	0.00162997	0.000756317	2.155143089	500	0.978473581
Saccharomyces cerevisiae GN = GUS1 PE = 1 SV = 3
Protein transport protein SEC13 OS = Saccharomyces	0.000567411	0.000264357	2.146382345	501	0.980430528
cerevisiae GN = SEC13 PE = 1 SV = 1
Threonyl-tRNA synthetase, cytoplasmic OS =	0.000766861	0.00036171	2.120100112	502	0.982387476
Saccharomyces cerevisiae GN = THS1 PE = 1 SV = 2
Uncharacterized protein YMR178W OS = Saccharomyces	0.000877158	0.000420688	2.085057135	503	0.984344423
cerevisiae GN = YMR178W PE = 1 SV = 1
40S ribosomal protein S25-A OS = Saccharomyces	0.003025452	0.001451016	2.085057135	503	0.984344423
cerevisiae GN = RPS25A PE = 1 SV = 1
Transposon Ty2-LR1 Gag-Pol polyprotein OS =	4.50528E−05	2.16075E−05	2.085087135	503	0.984344423
Saccharomyces cerevisiae GN = TY2B-LR1 PE = 3 SV = 1
Farnesyl pyrophosphate synthase OS = Saccharomyces	0.001786243	0.000863034	2.069725832	506	0.990215264
cerevisiae GN = FPP1 PE = 1 SV = 2
Isocitrate dehydrogenase [NAD] subunit 2, mitochondrial	0.002035386	0.000989107	2.057801486	507	0.992172211
OS = Saccharomycescerevisiae GN = IDH2 PE = 1 SV = 1
Nascent polypeptide-associated complex subunit beta-1	0.001038594	0.000513207	2.023731925	508	0.994129159
OS = Saccharomycescerevisiae (strain YJM789) GN =
EGD1 PE = 3 SV = 1
40S ribosomal protein S3 OS = Saccharomyces	0.00598275	0.002966283	2.016918013	509	0.996086106
cerevisiae GN = RPS3 PE = 1 SV = 5
ATP-dependent RNA helicase SUB2 OS =	0.00052204	0.000260592	2.003290188	510	0.998043053
Saccharomyces cerevisiae (strain YJM789)
GN = SUB2 PE = 3 SV = 1
Elongation factor 1-gamma 2 OS = Saccharomyces	0.001128425	0.000563286	2.003290188	510	0.998043053
cerevisiae GN = TEF4 PE = 1 SV = 1

TABLE 8
Histone PTMs identified from GAL1 promoter chromatin isolated from cells
grown in galactose-containing media.
Protein	Sequence	Modifications	PTM
Histone H3	(R)EIAQDFkTDLR(F)	Trimethyl (+42)	K79me3
	(R)EIAQDFkTDLR(F)	Dimethyl (+28)	K79me2
	(R)EIAQDFkTDLR(F)	Methyl (+14)	K79me
	(R)FQkSTELLIR(K)	Acetyl (+42)	K56ac
	(R)KQLASkAAR(K)	Acetyl (+42)	K23ac
	(R)kQLASkAAR(K)	Acetyl (+42),	K18ac K23ac
		Acetyl (+42)
	(R)KSTGGkAPR(K)	Acetyl (+42)	K14ac
	(R)kSTGGkAPR(K)	Acetyl (+42),	K9ac K14ac
		Acetyl (+42)
Histone H2B	(K)AEkKPASkAPAEK(K)	Acetyl (+42),	K6ac K11ac
		Acetyl (+42)
	(K)KPASkAPAEKkPAAK(K)	Acetyl (+42),	K11ac K17ac
		Acetyl (+42)
	(K)APAEKkPAAK(K)	Acetyl (+42)	K17ac
Histone H2A	(K)GGkAGSAAK(A)	Acetyl (+42)	K7ac
Histone H4	None
Histone H3
Sequence	Modifications	PTM	Spectrum ID
(R)EIAQDFkTDLR(F)	Trimethyl (+42)	K79me3	Tackett_051413_L1_21.3892.3892.3.dta
(R)EIAQDFkTDLR(F)	Trimethyl (+42)		Tackett_051413_L1_19.3763.3763.2.dta
(R)EIAQDFkTDLR(F)	Dimethyl (+28)	K79me2	Tackett_051413_L1_21.3948.3948.3.dta
(R)EIAQDFkTDLR(F)	Dimethyl (+28)		Tackett_051413_L1_19.3877.3877.3.dta
(R)EIAQDFkTDLR(F)	Methyl (+14)	K79me	Tackett_051413_L1_19.3827.3827.3.dta
(R)EIAQDFkTDLR(F)	Acetyl (+42)	K79ac	Tackett_051413_L1_19.3776.3776.3.dta
(R)EIAQDFkTDLR(F)	Methyl (+14)		Tackett_051413_L1_19.3815.3815.2.dta
(R)EIAQDFkTDLR(F)	Methyl (+14)		Tackett_051413_L1_19.3832.3832.2.dta
(R)FQkSTELLIR(K)	Acetyl (+42)	K56ac	Tackett_051413_L1_20.5345.5345.2.dta
(R)FQkSTELLIR(K)	Acetyl (+42)		Tackett_051413_L1_19.5128.5128.2.dta
(R)FQkSTELLIR(K)	Acetyl (+42)		Tackett_051413_L1_19.5114.5114.2.dta
(R)KQLASkAAR(K)	Acetyl (+42)	K23ac	Tackett_051413_L1_16.1239.1239.2.dta
(R)KQLASkAAR(K)	Acetyl (+42)		Tackett_051413_L1_01.1032.1032.2.dta
(R)KQLASkAAR(K)	Acetyl (+42)		Tackett_051413_L1_20.1311.1311.2.dta
(R)KQLASkAAR(K)	Acetyl (+42)		Tackett_051413_L1_20.1316.1316.2.dta
(R)kQLASkAAR(K)	Acetyl (+42),	K18ac	Tackett_051413_L1_19.2100.2100.2.dta
	Acetyl (+42)	K23ac
(R)KQLASkAAR(K)	Acetyl (+42)		Tackett_051413_L1_19.1327.1327.2.dta
(R)KQLASkAAR(K)	Acetyl (+42)		Tackett_051413_L1_19.1340.1340.2.dta
(R)kQLASkAAR(K)	Acetyl (+42),		Tackett_051413_L1_20.2166.2166.2.dta
	Acetyl (+42)
(R)kQLASkAAR(K)	Acetyl (+42),		Tackett_051413_L1_20.2178.2178.2.dta
	Acetyl (+42)
(R)KSTGGkAPR(K)	Acetyl (+42)	K14ac	Tackett_051413_L1_20.549.549.2.dta
(R)KSTGGkAPR(K)	Acetyl (+42)		Tackett_051413_L1_23.698.698.2.dta
(R)KSTGGkAPR(K)	Acetyl (+42)		Tackett_051413_L1_22.552.552.2.dta
(R)kSTGGkAPR(K)	Acetyl (+42),	K9ac	Tackett_051413_L1_12.1197.1197.2.dta
	Acetyl (+42)	K14ac
(R)KSTGGkAPR(K)	Acetyl (+42)		Tackett_051413_L1_19.506.506.2.dta
(R)kSTGGkAPR(K)	Acetyl (+42),		Tackett_051413_L1_13.1112.1112.2.dta
	Acetyl (+42)
(R)KSTGGkAPR(K)	Acetyl (+42)		Tackett_051413_L1_20.438.438.2.dta
(R)KSTGGkAPR(K)	Acetyl (+42)		Tackett_051413_L1_22.555.555.2.dta
(R)KSTGGkAPR(K)	Acetyl (+42)		Tackett_051413_L1_19.623.623.2.dta
(R)KSTGGkAPR(K)	Acetyl (+42)		Tackett_051413_L1_19.627.627.2.dta
(K)STGGkAPR(K)	Acetyl (+42)		Tackett_051413_L1_20.734.734.2.dta
(K)STGGkAPR(K)	Acetyl (+42)		Tackett_051413_L1_19.715.715.2.dta
(K)STGGkAPR(K)	Acetyl (+42)		Tackett_051413_L1_19.720.720.2.dta
(K)STGGkAPR(K)	Acetyl (+42)		Tackett_051413_L1_20.744.744.2.dta
(K)STELLIR(K)			Tackett_051413_L1_16.3348.3348.2.dta
(K)STELLIR(K)			Tackett_051413_L1_19.3325.3325.2.dta
(K)STELLIR(K)			Tackett_051413_L1_20.3349.3349.2.dta

TABLE 9
Proteins enriched with CRISPR-ChAP-MS analysis of GAL1 promoter chromatin in galactose-containing media.
	Gene	Accession		gRNA/No gRNA
	symbol	Number	MW	(Fold Change)
Identified Proteins (transcription)
REB1_YEAST DNA-binding protein REB1 OS = Saccharomyces cerevisiae	REB1	P21538	92 kDa	8.1
GN = REB1 PE = 1 SV = 2
SPT5_YEAST Transcription elongation factor SPT5 OS = Saccharomyces	SPT5	P27692	116 kDa	5.4
cerevisiae GN = SPT5 PE = 1 SV = 1
TOA2_YEAST Transcription initiation factor IIA small subunit	TOA2	P32774	13 kDa	5.1
OS = Saccharomyces cerevisiae GN = TOA2 PE = 1 SV = 1
BAF1_YEAST Transcription factor BAF1 OS = Saccharomyces cerevisiae	BAF1	P14164	82 kDa	4.7
GN = BAF1 PE = 1 SV = 3
SIN3_YEAST Transcriptional regulatory protein SIN3 OS = Saccharomyces	SIN3	P22579	175 kDa	4.2
cerevisiae GN = SIN3 PE = 1 SV = 2
H2B2_YEAST Histone H2B.2 OS = Saccharomyces cerevisiae GN = HTB2 PE = 1	H2B2	P02294	14 kDa	4.1
SV = 2
UME1_YEAST Transcriptional regulatory protein UME1 OS = Saccharomyces	UME1	Q03010	51 kDa	3.2
cerevisiae GN = UME1 PE = 1 SV = 1
POB3_YEAST FACT complex subunit POB3 OS = Saccharomyces cerevisiae	POB3	Q04636	63 kDa	3
GN = POB3 PE = 1 SV = 1
RSC6_YEAST Chromatin structure-remodeling complex protein RSC6	RSC6	P25632	54 kDa	2.8
OS = Saccharomyces cerevisiae GN = RSC6 PE = 1 SV = 1
RPA14_YEAST DNA-directed RNA polymerase I subunit RPA14	RPA14	P50106	15 kDa	2.4
OS = Saccharomyces cerevisiae GN = RPA14 PE = 1 SV = 1
RSC7_YEAST Chromatin structure-remodeling complex subunit RSC7	RSC7	P32832	50 kDa	2.1
OS = Saccharomyces cerevisiae GN = NPL6 PE = 1 SV = 1
Identified Proteins (metabolic, ribosomal, common contaminants)
PYRF_YEAST Orotidine 5′-phosphate decarboxylase OS = Saccharomyces	PYRF	P03962	29 kDa	15
cerevisiae GN = URA3 PE = 1 SV = 2
SCW4_YEAST Probable family 17 glucosidase SCW4 OS = Saccharomyces	SCW4	P53334	40 kDa	15
cerevisiae GN = SCW4 PE = 1 SV = 1
RAS2_YEAST Ras-like protein 2 OS = Saccharomyces cerevisiae GN = RAS2	RAS2	P01120	35 kDa	12
PE = 1 SV = 4
PWP1_YEAST Periodic tryptophan protein 1 OS = Saccharomyces cerevisiae	PWP1	P21304	64 kDa	11
GN = PWP1 PE = 1 SV = 1
ERG19_YEAST Diphosphomevalonate decarboxylase OS = Saccharomyces	ERG19	P32377	44 kDa	9.6
cerevisiae GN = ERG19 PE = 1 SV = 2
KEL1_YEAST Kelch repeat-containing protein 1 OS = Saccharomyces cerevisiae	KEL1	P38853	131 kDa	9.6
GN = KEL1 PE = 1 SV = 1
BGL2_YEAST Glucan 1,3-beta-glucosidase OS = Saccharomyces cerevisiae	BGL2	P15703	34 kDa	9.3
GN = BGL2 PE = 1 SV = 1
SCW10_YEAST Probable family 17 glucosidase SCW10 OS = Saccharomyces	SCW10	Q04951	40 kDa	7.2
cerevisiae GN = SCW10 PE = 1 SV = 1
FKBP2_YEAST FK506-binding protein 2 OS = Saccharomyces cerevisiae	FKBP2	P32472	14 kDa	6
GN = FKB2 PE = 1 SV = 1
YKH7_YEAST Uncharacterized protein YKL077W OS = Saccharomyces	YKH7	P36081	46 kDa	6
cerevisiae GN = YKL077W PE = 1 SV = 1
BRX1_YEAST Ribosome biogenesis protein BRX1 OS = Saccharomyces	BRX1	Q08235	34 kDa	5.8
cerevisiae GN = BRX1 PE = 1 SV = 1
PAL1_YEAST Uncharacterized protein YDR348C OS = Saccharomyces	PAL1	Q05518	55 kDa	5.8
cerevisiae GN = YDR348C PE = 1 SV = 1
KPR1_YEAST Ribose-phosphate pyrophosphokinase 1 OS = Saccharomyces	KPR1	P32895	47 kDa	5
cerevisiae GN = PRS1 PE = 1 SV = 1
YM11_YEAST Uncharacterized protein YMR124W OS = Saccharomyces	YM11	P39523	106 kDa	5
cerevisiae GN = YMR124W PE = 1 SV = 2
PRS7_YEAST 26S protease regulatory subunit 7 homolog OS = Saccharomyces	PRS7	P33299	52 kDa	5
cerevisiae GN = RPT1 PE = 1 SV = 1
RRP9_YEAST Ribosomal RNA-processing protein 9 OS = Saccharomyces	RRP9	Q06506	65 kDa	5
cerevisiae GN = RRP9 PE = 1 SV = 1
CIC1_YEAST Proteasome-interacting protein CIC1 OS = Saccharomyces	CIC1	P38779	43 kDa	4.7
cerevisiae GN = CIC1 PE = 1 SV = 1
MPM1_YEAST Mitochondrial peculiar membrane protein 1 OS = Saccharomyces	MPM1	P40364	28 kDa	4
cerevisiae GN = MPM1 PE = 1 SV = 1
IDI1_YEAST Isopentenyl-diphosphate Delta-isomerase OS = Saccharomyces	IDI1	P15496	33 kDa	3.9
cerevisiae GN = IDI1 PE = 1 SV = 2
PEX14_YEAST Peroxisomal membrane protein PEX14 OS = Saccharomyces	PEX14	P53112	38 kDa	3.6
cerevisiae GN = PEX14 PE = 1 SV = 1
YER0_YEAST Uncharacterized protein YER080W OS = Saccharomyces	YER0	P40053	72 kDa	3.5
cerevisiae GN = YER080W PE = 1 SV = 1
RT23_YEAST 37S ribosomal protein S23, mitochondrial OS = Saccharomyces	RT23	Q01163	56 kDa	3.3
cerevisiae GN = RSM23 PE = 1 SV = 2
BUD21_YEAST Bud site selection protein 21 OS = Saccharomyces cerevisiae	BUD21	Q08492	24 kDa	3.2
GN = BUD21 PE = 1 SV = 1
ELOC_YEAST Elongin-C OS = Saccharomyces cerevisiae GN = ELC1 PE = 1	ELOC	Q03071	11 kDa	3.2
SV = 1
CDC11_YEAST Cell division control protein 11 OS = Saccharomyces cerevisiae	CDC11	P32458	48 kDa	3.1
GN = CDC11 PE = 1 SV = 1
RFC2_YEAST Replication factor C subunit 2 OS = Saccharomyces cerevisiae	RFC2	P40348	40 kDa	3.1
GN = RFC2 PE = 1 SV = 1
EFTU_YEAST Elongation factor Tu, mitochondrial OS = Saccharomyces	EFTU	P02992	48 kDa	3
cerevisiae GN = TUF1 PE = 1 SV = 1
PPN1_YEAST Endopolyphosphatase OS = Saccharomyces cerevisiae	PPN1	Q04119	78 kDa	3
GN = PPN1 PE = 1 SV = 1
ETFA_YEAST Probable electron transfer flavoprotein subunit alpha,	ETFA	Q12480	37 kDa	3
mitochondrial OS = Saccharomyces cerevisiae GN = AIM45 PE = 1 SV = 1
GBG_YEAST Guanine nucleotide-binding protein subunit gamma	GBG	P18852	13 kDa	3
OS = Saccharomyces cerevisiae GN = STE18 PE = 1 SV = 1
PUR4_YEAST Phosphoribosylformylglycinamidine synthase	PUR4	P38972	149 kDa	3
OS = Saccharomyces cerevisiae GN = ADE6 PE = 1 SV = 2
SUCB_YEAST Succinyl-CoA ligase [ADP-forming] subunit beta, mitochondrial	SUCB	P53312	47 kDa	2.9
OS = Saccharomyces cerevisiae GN = LSC2 PE = 1 SV = 1
UTP15_YEAST U3 small nucleolar RNA-associated protein 15	UTP15	Q04305	58 kDa	2.9
OS = Saccharomyces cerevisiae GN = UTP15 PE = 1 SV = 1
SEC3_YEAST Exocyst complex component SEC3 OS = Saccharomyces	SEC3	P33332	155 kDa	2.9
cerevisiae GN = SEC3 PE = 1 SV = 1
AML1_YEAST N(6)-adenine-specific DNA methyltransferase-like 1	AML1	P53200	29 kDa	2.9
OS = Saccharomyces cerevisiae GN = AML1 PE = 1 SV = 2
RM10_YEAST 54S ribosomal protein L10, mitochondrial OS = Saccharomyces	RM10	P36520	36 kDa	2.9
cerevisiae GN = MRPL10 PE = 1 SV = 2
UCRI_YEAST Cytochrome b-c1 complex subunit Rieske, mitochondrial	UCRI	P08067	23 kDa	2.8
OS = Saccharomyces cerevisiae GN = RIP1 PE = 1 SV = 1
KHSE_YEAST Homoserine kinase OS = Saccharomyces cerevisiae GN = THR1	KHSE	P17423	39 kDa	2.8
PE = 1 SV = 4
SMD1_YEAST Small nuclear ribonucleoprotein Sm D1 OS = Saccharomyces	SMD1	Q02260	16 kDa	2.8
cerevisiae GN = SMD1 PE = 1 SV = 1
CYC1_YEAST Cytochrome c iso-1 OS = Saccharomyces cerevisiae GN = CYC1	CYC1	P00044	12 kDa	2.6
PE = 1 SV = 2
PET10_YEAST Protein PET10 OS = Saccharomyces cerevisiae GN = PET10	PET10	P36139	31 kDa	2.6
PE = 1 SV = 3
RT35_YEAST 37S ribosomal protein S35, mitochondrial OS = Saccharomyces	RT35	P53292	40 kDa	2.6
cerevisiae GN = MRPS35 PE = 1 SV = 1
PROF_YEAST Profilin OS = Saccharomyces cerevisiae GN = PFY1 PE = 1 SV = 2	PROF	P07274	14 kDa	2.6
NOP13_YEAST Nucleolar protein 13 OS = Saccharomyces cerevisiae	NOP13	P53883	46 kDa	2.6
GN = NOP13 PE = 1 SV = 1
RM27_YEAST 54S ribosomal protein L27, mitochondrial OS = Saccharomyces	RM27	P36526	16 kDa	2.6
cerevisiae GN = MRPL27 PE = 1 SV = 2
YHA8_YEAST Uncharacterized transporter YHL008C OS = Saccharomyces	YHA8	P38750	70 kDa	2.6
cerevisiae GN = YHL008C PE = 1 SV = 1
DYL1_YEAST Dynein light chain 1, cytoplasmic OS = Saccharomyces cerevisiae	DYL1	Q02647	10 kDa	2.5
GN = DYN2 PE = 1 SV = 1
CDC73_YEAST Cell division control protein 73 OS = Saccharomyces cerevisiae	CDC73	Q06697	44 kDa	2.5
GN = CDC73 PE = 1 SV = 1
HRB1_YEAST Protein HRB1 OS = Saccharomyces cerevisiae GN = HRB1 PE = 1	HRB1	P38922	52 kDa	2.5
SV = 2
SNZ1_YEAST Pyridoxine biosynthesis protein SNZ1 OS = Saccharomyces	SNZ1	Q03148	32 kDa	2.5
cerevisiae GN = SNZ1 PE = 1 SV = 1
RS9A_YEAST 40S ribosomal protein S9-A OS = Saccharomyces cerevisiae	RS9A	O13516	22 kDa	2.4
GN = RPS9A PE = 1 SV = 3
ARPC2_YEAST Actin-related protein 2/3 complex subunit 2	ARPC2	P53731	40 kDa	2.4
OS = Saccharomyces cerevisiae GN = ARC35 PE = 1 SV = 1
TRS31_YEAST Transport protein particle 31 kDa subunit OS = Saccharomyces	TRS31	Q03337	32 kDa	2.4
cerevisiae GN = TRS31 PE = 1 SV = 1
PUT2_YEAST Delta-1-pyrroline-5-carboxylate dehydrogenase, mitochondrial	PUT2	P07275	64 kDa	2.4
OS = Saccharomyces cerevisiae GN = PUT2 PE = 1 SV = 2
RM51_YEAST 54S ribosomal protein L51, mitochondrial OS = Saccharomyces	RM51	Q06090	16 kDa	2.4
cerevisiae GN = MRPL51 PE = 1 SV = 1
LGUL_YEAST Lactoylglutathione lyase OS = Saccharomyces cerevisiae	LGUL	P50107	37 kDa	2.4
GN = GLO1 PE = 1 SV = 1
HIS8_YEAST Histidinol-phosphate aminotransferase OS = Saccharomyces	HIS8	P07172	43 kDa	2.3
cerevisiae GN = HIS5 PE = 1 SV = 2
NPT1_YEAST Nicotinate phosphoribosyltransferase OS = Saccharomyces	NPT1	P39683	49 kDa	2.3
cerevisiae GN = NPT1 PE = 1 SV = 3
METK2_YEAST S-adenosylmethionine synthase 2 OS = Saccharomyces	METK2	P19358	42 kDa	2.2
cerevisiae GN = SAM2 PE = 1 SV = 3
FMP10_YEAST Uncharacterized mitochondrial membrane protein FMP10	FMP10	P40098	28 kDa	2.2
OS = Saccharomyces cerevisiae GN = FMP10 PE = 1 SV = 1
YPT31_YEAST GTP-binding protein YPT31/YPT8 OS = Saccharomyces	YPT31	P38555	24 kDa	2.2
cerevisiae GN = YPT31 PE = 1 SV = 3		(+1)
YMX6_YEAST Uncharacterized protein YMR086W OS = Saccharomyces	YMX6	Q04279	106 kDa	2.2
cerevisiae GN = YMR086W PE = 1 SV = 1
ACPM_YEAST Acyl carrier protein, mitochondrial OS = Saccharomyces	ACPM	P32463	14 kDa	2.2
cerevisiae GN = ACP1 PE = 1 SV = 1
RM33_YEAST 54S ribosomal protein L33, mitochondrial OS = Saccharomyces	RM33	P20084	10 kDa	2.2
cerevisiae GN = MRPL33 PE = 1 SV = 4
RL14A_YEAST 60S ribosomal protein L14-A OS = Saccharomyces cerevisiae	RL14A	P36105	15 kDa	2.1
GN = RPL14A PE = 1 SV = 1
PBP1_YEAST PAB1-binding protein 1 OS = Saccharomyces cerevisiae	PBP1	P53297	79 kDa	2.1
GN = PBP1 PE = 1 SV = 1
GPDM_YEAST Glycerol-3-phosphate dehydrogenase, mitochondrial	GPDM	P32191	72 kDa	2.1
OS = Saccharomyces cerevisiae GN = GUT2 PE = 1 SV = 2
RIB1_YEAST GTP cyclohydrolase-2 OS = Saccharomyces cerevisiae GN = RIB1	RIB1	P38066	38 kDa	2.1
PE = 1 SV = 2
OTC_YEAST Ornithine carbamoyltransferase OS = Saccharomyces cerevisiae	OTC	P05150	38 kDa	2.1
GN = ARG3 PE = 1 SV = 1
UBP6_YEAST Ubiquitin carboxyl-terminal hydrolase 6 OS = Saccharomyces	UBP6	P43593	57 kDa	2.1
cerevisiae GN = UBP6 PE = 1 SV = 1
SUR7_YEAST Protein SUR7 OS = Saccharomyces cerevisiae GN = SUR7 PE = 1	SUR7	P54003	34 kDa	2.1
SV = 1
TWF1_YEAST Twinfilin-1 OS = Saccharomyces cerevisiae GN = TWF1 PE = 1	TWF1	P53250	37 kDa	2.1
SV = 1
RN49_YEAST 54S ribosomal protein L49, mitochondrial OS = Saccharomyces	RN49	P40858	18 kDa	2.1
cerevisiae GN = MRPL49 PE = 1 SV = 2
RSM28_YEAST 37S ribosomal protein RSM28, mitochondrial	RSM28	Q03430	41 kDa	2.1
OS = Saccharomyces cerevisiae GN = RSM28 PE = 1 SV = 2
1832 protiens were identified and those enriched >2-fold (with at least 5 spectral counts) with Cas9-PrA/gRNA verses the no gRNA control are listed (86 proteins). Enrichment was calculated by normalized NSAF as detailed in Byrum et al., 2013.
Protiens are categorized as those involved in transcription (11 proteins) and those that are common contaminants (74 proteins) in affinity purifications (Byrum et al., 2013).

TABLE 10
Spectral counts and normalized NSAF values.
						gRNA/
				Spectral		no
				counts	Normalized	gRNA
	Gene	Accession			No	NSAF values	(Fold
Identified Proteins (318)	Symbol	Number	MW	gRNA	gRNA	gRNA	No gRNA	Change)
PYRF_YEAST Orotidine 5′-phosphate	PYRF	P03962	29	657	45	2.3034	0.15574	15
decarboxylase OS = Saccharomyces			kDa
cerevisiae GN = URA3 PE = 1 SV = 2
SCW4_YEAST Probable family 17	SCW4	P53334	40	43	3	0.11355	0.0076196	15
glucosidase SCW4 OS = Saccharomyces			kDa
cerevisiae GN = SCW4 PE = 1 SV = 1
RAS2_YEAST Ras-like protein 2	RAS2	P01120	35	10	1	0.030093	0.0025358	12
OS = Saccharomycescerevisiae			kDa
GN = RAS2 PE = 1 SV = 4
PWP1_YEAST Periodic tryptophan	PWP1	P21304	64	10	1	0.02054	0.0019358	11
protein 1 OS = Saccharomyces			kDa
cerevisiae GN = PWP1 PE = 1 SV = 1
ERG19_YEAST Diphosphomevalonate	ERG19	P32377	44	9	1	0.022174	0.0023133	9.6
decarboxylase OS = Saccharomyces			kDa
cerevisiae GN = ERG19 PE = 1 SV = 2
KEL1_YEAST Kelch repeat-containing	KEL1	P38853	131	6	1	0.005493	0.00057277	9.6
protein 1 OS = Saccharomyces			kDa
cerevisiae GN = KEL1 PE = 1 SV = 1
BGL2_YEAST Glucan 1,3-beta-	BGL2	P15703	34	78	10	0.23854	0.02567	9.3
glucosidase OS = Saccharomyces			kDa
cerevisiae GN = BGL2 PE = 1 SV = 1
REB1_YEAST DNA-binding protein	REB1	P21538	92	5	1	0.006768	0.00083919	8.1
REB1 OS = Saccharomycescerevisiae			kDa
GN = REB1 PE = 1 SV = 2
SCW10_YEAST Probable family 17	SCW10	Q04951	40	24	3	0.067308	0.0093606	7.2
glucosidase SCW10 OS = Saccharomyces			kDa
cerevisiae GN = SCW10 PE = 1 SV = 1
FKBP2_YEAST FK506-binding protein 2	FKBP2	P32472	14	5	1	0.028788	0.0047652	6
OS = Saccharomycescerevisiae			kDa
GN = FKB2 PE = 1 SV = 1
YKH7_YEAST Uncharacterized protein	YKH7	P36081	46	5	1	0.010224	0.0017008	6
YKL077W OS = Saccharomyces			kDa
cerevisiae GN = YKL077W PE = 1 SV = 1
BRX1_YEAST Ribosome biogenesis	BRX1	Q08235	34	10	2	0.032329	0.0055678	5.8
protein BRX1 OS = Saccharomyces			kDa
cerevisiae GN = BRX1 PE = 1 SV = 1
PAL1_YEAST Uncharacterized protein	PAL1	Q05518	55	5	1	0.010082	0.0017505	5.8
YDR348C OS = Saccharomyces			kDa
cerevisiae GN = YDR348C PE = 1 SV = 1
SPT5_YEAST Transcription elongation	SPT5	P27692	116	5	1	0.005671	0.001046	5.4
factor SPT5 OS = Saccharomyces			kDa
cerevisiae GN = SPT5 PE = 1 SV = 1
TOA2_YEAST Transcription initiation	TOA2	P32774	13	5	1	0.026691	0.005273	5.1
factor IIA small subunit			kDa
OS = Saccharomycescerevisiae
GN = TOA2 PE = 1 SV = 1
KPR1_YEAST Ribose-phosphate	KPR1	P32895	47	8	2	0.020962	0.004191	5
pyrophosphokinase 1			kDa
OS = Saccharomycescerevisiae
GN = PRS1 PE = 1 SV = 1
YM11_YEAST Uncharacterized protein	YM11	P39523	106	6	2	0.007074	0.001414	5
YMR124W OS = Saccharomyces			kDa
cerevisiae GN = YMR124W PE = 1
SV = 2
PRS7_YEAST 26S protease regulatory	PRS7	P33299	52	5	1	0.011132	0.0022086	5
subunit 7 homolog OS = Saccharomyces			kDa
cerevisiae GN = RPT1 PE = 1 SV = 1
RRP9_YEAST Ribosomal RNA-	RRP9	Q06506	65	5	1	0.01006	0.0020314	5
processing protein 9 OS = Saccharomyces			kDa
cerevisiae GN = RRP9 PE = 1 SV = 1
CIC1_YEAST Proteasome-interacting	CIC1	P38779	43	6	1	0.014793	0.0031713	4.7
protein CIC1 OS = Saccharomyces			kDa
cerevisiae GN = CIC1 PE = 1 SV = 1
BAF1_YEAST Transcription factor	BAF1	P14164	82	5	1	0.00721	0.0015254	4.7
BAF1 OS = Saccharomycescerevisiae			kDa
GN = BAF1 PE = 1 SV = 3
SIN3_YEAST Transcriptional	SIN3	P22579	175	5	1	0.003757	0.00088897	4.2
regulatory protein SIN3			kDa
OS = Saccharomycescerevisiae
GN = SIN3 PE = 1 SV = 2
H2B2_YEAST Histone H2B.2	H2B2	P02294	14	81	87	0.021748	0.0053125	4.1
OS = Saccharomycescerevisiae			kDa
GN = HTB2 PE = 1 SV = 2
MPM1_YEAST Mitochondrial peculiar	MPM1	P40364	28	10	3	0.03595	0.0090786	4
membrane protein 1 OS = Saccharomyces			kDa
cerevisiae GN = MPM1 PE = 1 SV = 1
IDI1_YEAST Isopentenyl-diphosphate	IDI1	P15496	33	18	5	0.054499	0.014115	3.9
Delta-isomerase OS = Saccharomyces			kDa
cerevisiae GN = IDI1 PE = 1 SV = 2
PEX14_YEAST Peroxisomal	PEX14	P53112	38	11	3	0.032705	0.0090831	3.6
membrane protein PEX14			kDa
OS = Saccharomycescerevisiae
GN = PEX14 PE = 1 SV = 1
YER0_YEAST Uncharacterized protein	YER0	P40053	72	11	3	0.018477	0.0052646	3.5
YER080W OS = Saccharomyces			kDa
cerevisiae GN = YER080W PE = 1 SV = 1
RT23_YEAST 37S ribosomal protein	RT23	Q01163	56	5	2	0.010978	0.0033269	3.3
S23, mitochondrial OS = Saccharomyces			kDa
cerevisiae GN = RSM23 PE = 1 SV = 2
BUD21_YEAST Bud site selection	BUD21	Q08492	24	6	2	0.023279	0.0073049	3.2
protein 21 OS = Saccharomyces			kDa
cerevisiae GN = BUD21 PE = 1 SV = 1
UME1_YEAST Transcriptional	UME1	Q03010	51	6	2	0.014875	0.0046531	3.2
regulatory protein UME1			kDa
OS = Saccharomycescerevisiae
GN = UME1 PE = 1 SV = 1
ELOC_YEAST Elongin-C	ELOC	Q03071	11	5	2	0.041449	0.012996	3.2
OS = Saccharomycescerevisiae			kDa
GN = ELC1 PE = 1 SV = 1
CDC11_YEAST Cell division control	CDC11	P32458	48	12	4	0.033015	0.010509	3.1
protein 11 OS = Saccharomyces			kDa
cerevisiae GN = CDC11 PE = 1 SV = 1
RFC2_YEAST Replication factor C	RFC2	P40348	40	6	2	0.014126	0.0046262	3.1
subunit 2 OS = Saccharomyces			kDa
cerevisiae GN = RFC2 PE = 1 SV = 1
EFTU_YEAST Elongation factor Tu,	EFTU	P02992	48	40	14	0.095198	0.0321	3
mitochondrial OS = Saccharomyces			kDa
cerevisiae GN = TUF1 PE = 1 SV = 1
PPN1_YEAST Endopolyphosphatase	PPN1	Q04119	78	14	5	0.017319	0.0058652	3
OS = Saccharomycescerevisiae			kDa
GN = PPN1 PE = 1 SV = 1
POB3_YEAST FACT complex subunit	POB3	Q04636	63	12	4	0.024482	0.0082034	3
POB3 OS = Saccharomycescerevisiae			kDa
GN = POB3 PE = 1 SV = 1
ETFA_YEAST Probable electron	ETFA	Q12480	37	11	4	0.027632	0.009349	3
transfer flavoprotein subunit alpha,			kDa
mitochondrial OS = Saccharomyces
cerevisiae GN = AIM45 PE = 1 SV = 1
GBG_YEAST Guanine nucleotide-	GBG	P18852	13	5	2	0.035393	0.011696	3
binding protein subunit gamma			kDa
OS = Saccharomycescerevisiae
GN = STE18 PE = 1 SV = 1
PUR4_YEAST	PUR4	P38972	149	5	2	0.004221	0.0014279	3
Phosphoribosylformylglycinamidine			kDa
synthase OS = Saccharomyces
cerevisiae GN = ADE6 PE = 1 SV = 2
SUCB_YEAST Succinyl-CoA ligase	SUCB	P53312	47	27	10	0.059446	0.020597	2.9
[ADP-forming] subunit beta,			kDa
mitochondrial OS = Saccharomyces
cerevisiae GN = LSC2 PE = 1 SV = 1
UTP15_YEAST U3 small nucleolar	UTP15	Q04305	58	8	3	0.01818	0.0063459	2.9
RNA-associated protein 15			kDa
OS = Saccharomycescerevisiae
GN = UTP15 PE = 1 SV = 1
SEC3_YEAST Exocyst complex	SEC3	P33332	155	7	3	0.006023	0.0020559	2.9
component SEC3 OS = Saccharomyces			kDa
cerevisiae GN = SEC3 PE = 1 SV = 1
AML1_YEAST N(6)-adenine-specific	AML1	P53200	29	5	2	0.017364	0.006086	2.9
DNA methyltransferase-like 1			kDa
OS = Saccharomycescerevisiae
GN = AML1 PE = 1 SV = 2
RM10_YEAST 54S ribosomal protein	RM10	P36520	36	5	2	0.013874	0.0047367	2.9
L10, mitochondrial OS = Saccharomyces			kDa
cerevisiae GN = MRPL10 PE = 1 SV = 2
UCRI_YEAST Cytochrome b-c1	UCRI	P08067	23	18	7	0.068993	0.024609	2.8
complex subunit Rieske, mitochondrial			kDa
OS = Saccharomycescerevisiae
GN = RIP1 PE = 1 SV = 1
KHSE_YEAST Homoserine kinase	KHSE	P17423	39	9	3	0.019995	0.0071271	2.8
OS = Saccharomycescerevisiae			kDa
GN = THR1 PE = 1 SV = 4
SMD1_YEAST Small nuclear	SMD1	Q02260	16	8	3	0.040301	0.0143	2.8
ribonucleoprotein Sm D1			kDa
OS = Saccharomycescerevisiae
GN = SMD1 PE = 1 SV = 1
RSC6_YEAST Chromatin structure-	RSC6	P25632	54	7	3	0.015875	0.00569	2.8
remodeling complex protein RSC6			kDa
OS = Saccharomycescerevisiae
GN = RSC6 PE = 1 SV = 1
CYC1_YEAST Cytochrome c iso-1	CYC1	P00044	12	117	68	0.61144	0.2352	2.6
OS = Saccharomycescerevisiae			kDa
GN = CYC1 PE = 1 SV = 2
PET10_YEAST Protein PET10	PET10	P36139	31	17	7	0.048927	0.019041	2.6
OS = Saccharomycescerevisiae			kDa
GN = PET10 PE = 1 SV = 3
RT35_YEAST 37S ribosomal protein	RT35	P53292	40	12	5	0.031711	0.011999	2.6
S35, mitochondrial OS = Saccharomyces			kDa
cerevisiae GN = MRPS35 PE = 1 SV = 1
PROF_YEAST Profilin	PROF	P07274	14	11	4	0.058874	0.023044	2.6
OS = Saccharomycescerevisiae			kDa
GN = PFY1 PE = 1 SV = 2
NOP13_YEAST Nucleolar protein 13	NOP13	P53883	46	6	3	0.017094	0.0065024	2.6
OS = Saccharomycescerevisiae			kDa
GN = NOP13 PE = 1 SV = 1
RM27_YEAST 54S ribosomal protein	RM27	P36526	16	5	2	0.024505	0.0095335	2.6
L27, mitochondrial OS = Saccharomyces			kDa
cerevisiae GN = MRPL27 PE = 1 SV = 2
YHA8_YEAST Uncharacterized	YHA8	P38750	70	5	2	0.009366	0.0036348	2.6
transporter YHL008C			kDa
OS = Saccharomycescerevisiae
GN = YHL008C PE = 1 SV = 1
DYL1_YEAST Dynein light chain 1,	DYL1	Q02647	10	10	4	0.073508	0.029371	2.5
cytoplasmic OS = Saccharomyces			kDa
cerevisiae GN = DYN2 PE = 1 SV = 1
CDC73_YEAST Cell division control	CDC73	Q06697	44	9	4	0.018285	0.0073158	2.5
protein 73 OS = Saccharomyces			kDa
cerevisiae GN = CDC73 PE = 1 SV = 1
HRB1_YEAST Protein HRB1	HRB1	P38922	52	9	4	0.020922	0.0084023	2.5
OS = Saccharomycescerevisiae			kDa
GN = HRB1 PE = 1 SV = 2
SNZ1_YEAST Pyridoxine biosynthesis	SNZ1	Q03148	32	5	3	0.006198	0.0025142	2.5
protein SNZ1 OS = Saccharomyces			kDa
cerevisiae GN = SNZ1 PE = 1 SV = 1
RS9A_YEAST 40S ribosomal protein	RS9A	O13516	22	151	156	0.009155	0.0037905	2.4
S9-A OS = Saccharomycescerevisiae			kDa
GN = RPS9A PE = 1 SV = 3
ARPC2_YEAST Actin-related protein	ARPC2	P53731	40	15	7	0.044768	0.018359	2.4
2/3 complex subunit 2			kDa
OS = Saccharomycescerevisiae
GN = ARC35 PE = 1 SV = 1
TRS31_YEAST Transport protein	TRS31	Q03337	32	8	4	0.026095	0.010779	2.4
particle 31 kDa subunit			kDa
OS = Saccharomycescerevisiae
GN = TRS31 PE = 1 SV = 1
RPA14_YEAST DNA-directed RNA	RPA14	P50106	15	7	3	0.036547	0.01524	2.4
polymerase I subunit RPA14			kDa
OS = Saccharomycescerevisiae
GN = RPA14 PE = 1 SV = 1
PUT2_YEAST Delta-1-pyrroline-5-	PUT2	P07275	64	6	3	0.012072	0.0051256	2.4
carboxylate dehydrogenase,			kDa
mitochondrial OS = Saccharomyces
cerevisiae GN = PUT2 PE = 1 SV = 2
RM51_YEAST 54S ribosomal protein	RM51	Q06090	16	6	3	0.035158	0.014913	2.4
L51, mitochondrial OS = Saccharomyces			kDa
cerevisiae GN = MRPL51 PE = 1 SV = 1
LGUL_YEAST Lactoylglutathione lyase	LGUL	P50107	37	5	2	0.012764	0.0053001	2.4
OS = Saccharomycescerevisiae			kDa
GN = GLO1 PE = 1 SV = 1
HIS8_YEAST Histidinol-phosphate	HIS8	P07172	43	9	5	0.024457	0.010784	2.3
aminotransferase OS = Saccharomyces			kDa
cerevisiae GN = HIS5 PE = 1 SV = 2
NPT1_YEAST Nicotinate	NPT1	P39683	49	5	2	0.010476	0.0046279	2.3
phosphoribosyltransferase			kDa
OS = Saccharomycescerevisiae
GN = NPT1 PE = 1 SV = 3
METK2_YEAST S-adenosylmethionine	METK2	P19358	42	79	75	0.038801	0.017378	2.2
synthase 2 OS = Saccharomyces			kDa
cerevisiae GN = SAM2 PE = 1 SV = 3
FMP10_YEAST Uncharacterized	FMP10	P40098	28	14	8	0.055633	0.0252	2.2
mitochondrial membrane protein			kDa
FMP10 OS = Saccharomycescerevisiae
GN = FMP10 PE = 1 SV = 1
YPT31_YEAST GTP-binding protein	YPT31	P38555	24	9	4	0.028763	0.012951	2.2
YPT31/YPT8 OS = Saccharomyces		(+1)	kDa
cerevisiae GN = YPT31 PE = 1 SV = 3
YMX6_YEAST Uncharacterized protein	YMX6	Q04279	106	8	5	0.007322	0.0033862	2.2
YMR086W OS = Saccharomyces			kDa
cerevisiae GN = YMR086W PE = 1
SV = 1
ACPM_YEAST Acyl carrier protein,	ACPM	P32463	14	8	4	0.046487	0.021428	2.2
mitochondrial OS = Saccharomyces			kDa
cerevisiae GN = ACP1 PE = 1 SV = 1
RM33_YEAST 54S ribosomal protein	RM33	P20084	10	7	3	0.054493	0.024282	2.2
L33, mitochondrial OS = Saccharomyces			kDa
cerevisiae GN = MRPL33 PE = 1 SV = 4
RL14A_YEAST 60S ribosomal protein	RL14A	P36105	15	111	121	0.010356	0.0050431	2.1
L14-A OS = Saccharomycescerevisiae			kDa
GN = RPL14A PE = 1 SV = 1
PBP1_YEAST PAB1-binding protein 1	PBP1	P53297	79	32	16	0.050084	0.024091	2.1
OS = Saccharomycescerevisiae			kDa
GN = PBP1 PE = 1 SV = 1
GPDM_YEAST Glycerol-3-phosphate	GPDM	P32191	72	17	8	0.026484	0.012419	2.1
dehydrogenase, mitochondrial			kDa
OS = Saccharomycescerevisiae
GN = GUT2 PE = 1 SV = 2
RIB1_YEAST GTP cyclohydrolase-2	RIB1	P38066	38	16	9	0.043642	0.020754	2.1
OS = Saccharomycescerevisiae			kDa
GN = RIB1 PE = 1 SV = 2
RSC7_YEAST Chromatin structure-	RSC7	P32832	50	13	7	0.029347	0.014198	2.1
remodeling complex subunit RSC7			kDa
OS = Saccharomycescerevisiae
GN = NPL6 PE = 1 SV = 1
OTC_YEAST Ornithine	OTC	P05150	38	13	6	0.031697	0.015373	2.1
carbamoyltransferase OS = Saccharomyces			kDa
cerevisiae GN = ARG3 PE = 1 SV = 1
UBP6_YEAST Ubiquitin carboxyl-	UBP6	P43593	57	9	5	0.019729	0.0094804	2.1
terminal hydrolase 6 OS = Saccharomyces			kDa
cerevisiae GN = UBP6 PE = 1 SV = 1
SUR7_YEAST Protein SUR7	SUR7	P54003	34	8	4	0.021538	0.010088	2.1
OS = Saccharomycescerevisiae			kDa
GN = SUR7 PE = 1 SV = 1
TWF1_YEAST Twinfilin-1	TWF1	P53250	37	8	4	0.020141	0.0093864	2.1
OS = Saccharomycescerevisiae			kDa
GN = TWF1 PE = 1 SV = 1
RN49_YEAST 54S ribosomal protein	RN49	P40858	18	6	3	0.026689	0.012968	2.1
L49, mitochondrial OS = Saccharomyces			kDa
cerevisiae GN = MRPL49 PE = 1 SV = 2
RSM28_YEAST 37S ribosomal protein	RSM28	Q03430	41	6	3	0.014043	0.0067459	2.1
RSM28, mitochondrial			kDa
OS = Saccharomycescerevisiae
GN = RSM28 PE = 1 SV = 2

Claims

1. A method of identifying proteins, including proteins comprising posttranslational modifications, specifically associated with a target chromatin in a cell, the method comprising: a) providing: i) a first cell sample wherein the target chromatin is tagged by contacting the target chromatin with a tag capable of specifically recognizing and binding one or more portions of the target chromatin and wherein the tag comprises two affinity handles and a nucleic acid capable of binding a nucleic acid sequence component of the target chromatin, wherein the nucleic acid sequence component of the chromatin is normally present in the cell, andii) a second cell sample wherein the target chromatin is not tagged,wherein the first cell sample and the second cell sample are lysed;b) performing affinity purification on each lysed cell sample in (a) using a substrate capable of binding the affinity handle, wherein affinity purification of the first cell sample results in isolation of affinity handle bound to tagged target chromatin and enrichment of the target chromatin relative to affinity purification of the second cell sample not contacted with the tag;c) identifying bound proteins from (b); andd) determining the amount of each bound protein in each cell sample from (b), wherein bound proteins that are enriched in the first cell sample as compared to the second cell sample are specifically associated with the tagged chromatin in the first cell sample.

2. The method of claim 1, wherein the nucleic acid capable of binding a nucleic acid sequence component of the target chromatin is a guide RNA (gRNA).

3. The method of claim 1, wherein one of the two affinity handles is a nuclease inactivated Cas9 protein, or derivative thereof.

4. The method of claim 1, wherein one of the two affinity handles is Protein A.

5. The method of claim 1, wherein the target chromatin in the first cell sample is tagged by expressing in a cell a tag comprising a nucleic acid capable of binding a nucleic acid sequence component of the target chromatin.

6. The method of claim 5, wherein the nucleic acid capable of binding a nucleic acid sequence component of the target chromatin is a guide RNA.

7. The method of claim 1, wherein the target chromatin is tagged by expressing in a cell a gRNA capable of binding a nucleic acid sequence component of the target chromatin, a nuclease inactivated Cas9 protein that associates with the gRNA, and Protein A.

8. The method of claim 1, wherein the second cell sample is not tagged by contacting the target chromatin with a non-functional tag that is not capable of binding a nucleic acid sequence component of the target chromatin and wherein the non-functional tag comprises two affinity handles.

9. The method of claim 8, wherein the second cell sample is contacted with a non-functional tag by expressing in a cell two affinity handles, wherein the nucleic acid capable of binding a nucleic acid sequence component of the target chromatin is not expressed in the cell.

10. The method of claim 1, wherein the chromatin is fragmented to comprise nucleic acid sections comprising 500 to 1500 base pairs.

11. The method of claim 1, wherein the target chromatin in the first cell sample is contacted with a tag during cell culture and the target chromatin in the second cell sample is contacted with a non-functional tag during cell culture.

12. The method of claim 1, wherein the target chromatin in the first cell sample is contacted with a tag following cell lysis and the target chromatin in the second cell sample is contacted with a non-functional tag following cell lysis.

13. The method of claim 1, wherein the first and second cell samples are biological samples.

14. The method of claim 1, wherein the first cell sample and the second cell sample are crosslinked and then lysed.

15. The method of claim 1, wherein the identifying of step (c) involves mass spectrometry.

16. The method of claim 1, wherein step (d) involves label-free proteomics

17. The method of claim 16, wherein the label-free proteomics technique is spectral counting.

18. The method of claim 1, wherein proteins enriched in the first cell sample compared to the second cell sample are enriched by at least 2 fold.