The present invention relates to a new method for the detection of target nucleic acids, and to a related kit.
The detection of DNA and RNA target sequences is of the utmost importance in molecular diagnostics and, in this sector the amplification of nucleic acid sequences, which is necessary in order to identify the target, which usually is diluted in a mixture of interfering genetic material, is a general issue.
In standard laboratory tests, the amplification of nucleic acids is generally carried out by means of the polymerase chain reaction (PCR) or through other PCR-based techniques, such as for example real-time PCR (RT-PCR) or digital PCR. These techniques require cyclic variation of the reaction temperature, the use of dedicated equipment, the use of trained staff and, in some cases, the use of expensive reagents.
The need to allow molecular assays based on the detection of nucleic acids to be used outside of specialized laboratories, in order to provide for diagnostic assays that can be carried out in the vicinity of the patient's point of care and assistance (point-of-care diagnostic tests), has led to the development of numerous isothermal amplification techniques, which do not require cyclic variation of the temperature and which, therefore, allow for the use of more simple equipment. However, many of these isothermal techniques have technical drawbacks that so far have not allowed them to be actually applied extensively in commercial molecular assays. A non-exhaustive list of such drawbacks is provided below:
Some of the more simple isothermal procedures still require the use of two enzymes. For instance, the Strand Displacement Amplification (SDA) (Walker, G. T., et al., Isothermal in vitro amplification of DNA by a restriction enzyme/DNA polymerase system. Proc Natl Acad Sci USA, 1992. 89(1): p. 392-6) and the Nicking and Extension Amplification Reaction (NEAR) (US 2009/0081670 A1) both require a polymerase as well as a nicking endonuclease, while the Ramification Amplification (RAM) requires a ligase and a polymerase (Yao, B., et al., Quantitative analysis of zeptomole microRNAs based on isothermal ramification amplification. RNA, 2009. 15(9): p. 1787-94).
In order to overcome these and other drawbacks of the prior art, the present invention provides a new technique for the detection of nucleic acids, designated as “Cooperative Hybridization Mediated Isothermal Amplification of Nucleic Acids” (CHAMP). This is a simple procedure that can be carried out in a single test tube and that allows for the amplification of a nucleic acid sequence, for example a target DNA or a reporter sequence, by using a single enzyme, in particular an endonuclease designed to cut a single strand (nicking). This is obtained by means of a smart design of probes that exploit the cooperative hybridization of oligonucleotides (also designated as “base-stacking stabilization”). This phenomenon refers to the stabilization of the hybridization of a short oligonucleotide to a DNA template strand, due to base-stacking interactions of the terminal base of the first oligonucleotide with that of a second adjacent oligonucleotide that hybridizes in tandem with the same template strand (Khrapko, K. R., et al., A method for DNA sequencing by hybridization with oligonucleotide matrix. DNA Seq, 1991. 1(6): p. 375-88; Zhang, D. Y., Cooperative hybridization of oligonucleotides. J Am Chem Soc, 2011. 133(4): p. 1077-86; Lane, M. J., et al., The thermodynamic advantage of DNA oligonucleotide ‘stacking hybridization’ reactions: energetics of a DNA nick. Nucleic Acids Res, 1997. 25(3): p. 611-7; Broude, N. E., et al., Enhanced DNA sequencing by hybridization. Proc Natl Acad Sci USA, 1994. 91(8): p. 3072-6; Fu, D. J., et al., A DNA sequencing strategy that requires only five bases of known terminal sequence for priming. Proc Natl Acad Sci USA, 1995. 92(22): p. 10162-6; Valentini, P., et al., Gold-Nanoparticle-Based Colorimetric Discrimination of Cancer-Related Point Mutations with Picomolar Sensitivity. ACS Nano, 2013. 7 (6): p. 5530-8).
The amplification technique which forms the object of the present invention has the advantage of being extremely simple and universal. The nicking site is provided by the probe, which determines the absence of any limitation with respect to the choice of the target, which may have any sequence. In addition, CHAMP is not affected by any of the aforementioned problems of the prior art. A unique and distinctive feature of CHAMP is that of being a polymerase-free reaction.
The nucleic acid detection technique which forms the object of the present invention is provided in two alternative embodiments. The first provides a linear amplification of a DNA reporter sequence. This first embodiment is designated as “linear CHAMP”. The second embodiment provides an exponential amplification of the target sequence. It is designated as “exponential CHAMP”.
Both embodiments can be coupled with various subsequent detection techniques; for example, in a non-limiting example, with a fluorescence detection for a real-time reading of the outcome (“real-time readout”) or with a colorimetric detection, for example based on gold nanoparticles.
Therefore, a first object of the present invention is a method of detecting a target nucleic acid sequence (T) in a nucleic acid sample, the method comprising the steps of:
a) adding to the nucleic acid sample a reaction mixture comprising:
The detection method described above corresponds to the nucleic acid detection technique designated as “linear CHAMP”.
A second object of the present invention is a kit for carrying out the linear CHAMP, the kit comprising:
A third object of the present invention is a method of detecting a target nucleic acid sequence (T) in a nucleic acid sample, the method comprising the steps of:
a) adding to the nucleic acid sample a reaction mixture comprising:
The detection method described above corresponds to the nucleic acid detection technique designated as “exponential CHAMP”.
A fourth object of the present invention is a kit for carrying out the exponential CHAMP, the kit comprising:
Further features and advantages of the invention will be apparent from the detailed description which follows, given purely by way of non-limiting example, with reference to the accompanying drawings, in which:
Preferably, the 5′ ΔcT sequence has a length comprised between 10 and 20 nucleotides.
Preferably, the 5′ ΔcR sequence has a length comprised between 0 and 10 nucleotides. In fact, in the case where an endonuclease having a low operating temperature, such as for example 37° C., were selected, the length of the short probe should be reduced to a minimum to avoid hybridization in the absence of the target. The shortest usable sequence for the long probe must include the entire endonuclease recognition site, but not necessarily part of the reporter sequence, and so, in this case, ΔcR may not be present.
In addition to the short probe and the long probe, the reaction mixture also comprises a nicking endonuclease enzyme, which nicks a single strand. The preferred nicking endonuclease is Nt.BstNBI. The reaction mixture also contains a buffer that provides the appropriate conditions required for the enzymatic activity.
The reaction is carried out at a constant temperature at which the enzyme used is active, for example comprised between 50° C. and 70° C., preferably at about 55° C. The reaction temperature is selected based on the optimum temperature for the specific enzyme used. At this temperature, the short probe is not able to hybridize to the long probe, whereby the two single-stranded probes are in solution as two separate strands. However, in the presence of the target (T), the hybridization of the short probe and the target with the complementary portion of the long probe becomes possible, thanks to the base-stacking interactions between the 3′-terminus base of the short probe and the 5′-terminus base of the target.
The cooperative hybridization of the three sequences (short probe, long probe and target) re-forms the functional double-stranded endonuclease recognition site, and therefore allows a strand of the long probe to be nicked by the endonuclease. In the presence of a nick, the reporter sequence R of the long probe spontaneously de-hybridizes from the short probe, because the complementary ΔcR portion is too short to maintain hybridization at the reaction temperature. As a result of the de-hybridization, the short probe also de-hybridizes, and this in turn destabilizes the hybridization of the target, leading to the release of the target in solution. The target molecule will thus be free to begin a new round of cooperative hybridization, nicking and release. Each round will release a reporter sequence in the solution. It should be noted that, because of the recycling, each target will release several copies of the reporter sequence, leading to signal amplification. This reporter sequence can be detected with any downstream detection methodology, for example through colorimetric detection strategies based on gold nanoparticles or in real time using a fluorescence de-quenching strategy, as shown in
In an alternative embodiment, the endonuclease may be a restriction endonuclease (which cuts the double strand) rather than a nicking endonuclease. In this case, the restriction endonuclease recognition site replaces the NE site shown in
Preferably, the Δ1cT sequence has a length comprised between 10 and 20 nucleotides.
Preferably, the Δ2cT sequence has a length comprised between 10 and 20 nucleotides.
Preferably, the Δ2cNE sequence has a length comprised between 0 and 5 nucleotides. In the case where Δ2cNE is not present, Δ1cNE would be complementary to the entire NE sequence and the system would include a single short probe, similarly to that of the linear CHAMP.
In the absence of the target, LP-exp and SP1-exp are hybridized to form a structure that is stable at the reaction temperature (for example 55° C.), designated as “probe complex”. In contrast, SP2-exp is free in solution because it is designed to be too short to hybridize at the reaction temperature. Hybridization of SP2-exp and the target to the corresponding part of LP-exp becomes possible, thanks to the cooperative hybridization, similarly to what has been described above with reference to the linear CHAMP.
It should be noted that hybridization of the target alone, in the absence of SP2-exp, cannot occur.
Therefore, similarly to the linear version of CHAMP, the cooperative hybridization of the target and SP2-exp to the probe complex re-forms the intact endonuclease enzyme recognition site, allowing LP-exp to be enzymatically cleaved. The cleavage releases the T portion of LP-exp, which in turn destabilizes the binding of SP1-exp, causing its release.
This in turn causes de-hybridization of both SP2-exp and the target.
Both the T portion of LP-exp and the target, which have identical sequences, are free to begin a new round of cooperative hybridization, nicking and release. Therefore, in each round, two copies of the target are made available for the subsequent round. This results in an exponential amplification of the target.
As for the linear version of CHAMP, also the exponential version can be coupled to a real-time fluorescence detection for quantitative analyses. In one embodiment provided by way of illustration, the fluorophore is linked to an internal base near the 3′ end of the T portion of LP-exp, while the quencher is linked to the 5′ end of SP1-exp. Thus, in the initial probe complex, the fluorophore and the quencher are very close to one another, as shown in
In an alternative embodiment, the endonuclease may be a restriction endonuclease (which cuts the double strand) rather than a nicking endonuclease. In this case, the restriction endonuclease recognition site replaces the NE site shown in
In all the embodiments described, both with reference to the linear CHAMP and with reference to the exponential CHAMP, a displacing probe can be added to the reaction mixture, to promote the recycling of the target and accelerate the reaction rate. The displacing probe competes with the target for binding to the long probe, after cleavage or nicking by the endonuclease.
As illustrated in
The displacing probe has a higher affinity for the fragment of the long probe than for the target, and displaces the target by toehold-mediated strand displacement. The displacing probe is present in the reaction mixture together with the target, even before the enzymatic cleavage or nicking. However, it does not prevent the target from binding to the intact long probe, since, when the intact long probe is present, the short probe and the target together compete with the displacing probe for binding to two regions on the long probe, which partially overlap the displacing probe binding site, preventing the binding of the displacing probe. It should be noted that in the absence of the target, the displacing probe also prevents the binding of the short probe alone (an unstable binding can occur in the absence of cooperative stabilization), thus preventing non-specific cleavage (independent from the target) of the long probe (
In an embodiment not shown, related to exponential CHAMP, the displacing probe is a single-stranded oligonucleotide which comprises:
Both techniques for detection of nucleic acids which form the object of the present invention (linear CHAMP and exponential CHAMP) have the following advantages:
The examples that follow are provided for illustration purposes and should not be construed as limiting the scope of the present invention as defined in the appended claims.
miRNA21 is overexpressed in many types of tumours, therefore the quantification of its expression level is relevant in tumour diagnostics.
miRNA21 was chosen as the target model for both the linear CHAMP and the exponential CHAMP.
For the linear version of CHAMP, the following synthetic sequences were used:
The target sequence corresponds to the miRNA21 cDNA, as would be obtained by standard reverse transcription; however, the miRNA sequence can be used directly in the assay.
LP and SP, each at a final concentration of 500 nM, were mixed in solution with 15 U of the nicking enzyme Nt.BstNBI and with the enzyme reaction buffer, in a final volume of 50 μl.
For the exponential version of CHAMP, the following sequences were used:
A reaction mixture containing LP-exp at a final concentration of 1 μM and SP1-exp at a final concentration of 5 μM was prepared in Nt.BstNBI reaction buffer. This solution was heated to 90° C. for 5 minutes, to destroy the secondary structure in LP-exp (i.e. a stable hairpin with a 16-bp stem), and then slowly cooled down to room temperature, to favour hybridization between LP-exp and SP1-exp and the formation of the probe complex. Then, 15 U of Nt.BstNBI nicking enzyme were added to the mixture in a final volume of 50 μl.
In LP, the positions of the fluorophore and of the quencher are underlined with a single and a double underscore, respectively.
In LP-exp, the position of the fluorophore is underlined with a single underscore. In SP1-exp, the position of the quencher is underlined with a double underscore.
The genomic DNA is double-stranded and therefore, before the CHAMP, a single-stranded target must be generated. This preliminary step can be carried out easily with various strategies and is a necessary step also for most of the isothermal amplification schemes of the prior art, and therefore does not represent a limitation to the broad applicability of CHAMP. For instance, an ssDNA target can be generated in the same reaction tube, selecting a region of the genome containing two sites for the endonuclease employed, for example Nt.BstNBI. For example, the plasmid pNL4.3, which contains the HIV-1 virus genome, contains the sequence GAGTCGAAGGTGTCCTTTTGCGCCGAGTC (the Nt.BstNBI sites are underlined), which generates a 24-mer ssDNA, which is a suitable substrate for CHAMP.
| Number | Date | Country | Kind |
|---|---|---|---|
| 102015000073893 | Nov 2015 | IT | national |
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/IB2016/056913 | 11/17/2016 | WO | 00 |