The methods, kits, and systems disclosed herein relate to the field of gene expression and phenotypic analysis for determining the risk of metastasis or poorer prognosis for a cancer patient.
The following discussion of the background of the invention is merely provided to aid the reader in understanding the invention and is not admitted to describe or constitute prior art to the present invention.
An initial step in cancer metastasis is the migration of tumor cells through the extracellular matrix (ECM) and into the lymphatic or vascular systems. Several features of the tumor ECM have been associated with progression to metastasis. In particular, regions of dense collagen are co-localized with aggressive tumor cell phenotypes in numerous solid tumors, including breast, ovarian, pancreatic, and brain cancers. However, sparse and aligned collagen fibers at the edges of tumors have also been reported to correlate with aggressive disease. Cancer cells migrating through densely packed collagen within the tumor use invadopodia and matrix metalloproteinase (MMP) activity to move, whereas cells in regions with less dense collagen with long, aligned fibers migrate rapidly using larger pseudopodial protrusions or MMP-independent amoeboid blebbing. It remains unclear whether and how these local migration behaviors contribute to the formation of distant metastases and whether collagen architecture functionally contributes to metastatic migration or is only a correlative hallmark of the process.
This question is further complicated by significant heterogeneity in the intrinsic ability of tumor cells to migrate and metastasize. Current methods of predicting metastasis or prognosis in cancer (e.g., MammaPrint and Oncotype DX) leave a great deal to be desired in terms of predictive power. Thus, there is a need in the art of better predicting metastasis and survival in cancer patients. The present disclosure satisfies this need.
Described herein is a novel gene signature of metastatic cancer cells and a novel three-dimensional (3D) culture system for use in improved methods of predicting metastasis or prognosis in cancer. Accordingly, described herein are novel methods of determining a risk of metastasis, novel methods of predicting prognosis for cancer patients, novel methods of treating a cancer patient identified at high risk of metastasis, novel methods of treating a cancer patient identified as having poorer prognosis, novel methods for determining the migration capacity of a tumor, novel methods of screening a tumor for sensitivity to a drug, and novel kits and culture systems for use in performing these methods.
Accordingly, in one aspect provided herein is a method of determining gene expression level of one or more genes of a vascular mimicry (VM) gene module in a sample isolated from a subject, comprising, or consisting of, or consisting essentially of, analyzing the expression of the one or more genes listed in the VM gene module. In some embodiments, the method further comprises, or alternatively consisting essentially of, or yet further consisting of, determining a risk of tumor metastasis in the subject by comparing a change in expression of the one or more genes in the VM gene module compared to a predetermined reference level. In one aspect, the predetermined reference level is the gene expression of level in a normal, non-diseased counterpart tissue.
In some embodiments, the one or more genes of the VM gene module comprise, consist of, or consist essentially of genes selected from COL5A1, FRMD6, TANC2, THBS1, PEAK1, ITGAV, DAAM1, RASEF, JAG1, LAMC2, ZNF532, SKIL, NAV1, ARHGAP32, SYNE1, GALNT10, LHFPL2, ABL2, LTBP1, COL4A1, DPY19L1, LPCAT2, TBC1D2B, LAMB1, AMIGO2, NREP, SNX30, TPM1, COL4A2, ARNTL, MRC2, TGFBI, TVP23C, BHLHE40, SMAD7, ABLIM3, ZNF224, PODXL, TAGLN, VHL, EPHB2, EDN1, GTF2IP4, HPS4, SIPA1L1, PID1, NLGN2, LTBP4, TRMT13, IGF2BP3, RBPJ, MKL1, ZMYM5, EFCAB11, WDR66, NKX3-1, HMOX1, TYRO3, SDHAP1, FURIN, FAM43A, AGTRAP, KCTD11, ID2, FERMT1, MTND2P28, H2BFS, LFNG, HES1, or KIN, or an equivalent of each thereof.
In some embodiments, the VM gene module comprises, consists of, or consists essentially of at least one, at least two, at least three, or four genes selected from ITGB1, LAMC2, COL4A1, and DAAM1, or an equivalent of each thereof.
In some embodiments, the gene expression level is determined by a method comprising, or consisting essentially of, or yet consisting of, determining the amount of an mRNA transcribed from the one or more genes of the VM gene module. In some embodiments, the gene expression level is determined by a method comprising, consisting of, or consisting essentially of one or more of in situ hybridization, northern blot, PCR, quantitative PCR, RNA-seq, or microarray. In some embodiments, the change in expression of the genes in the VM gene module is increased as compared to the predetermined reference level. In one aspect, the predetermined reference level is the gene expression of level in a normal, non-diseased counterpart tissue.
In some embodiments, the sample is a tumor sample. In some embodiments, the tumor sample is at least one of a fixed tissue, a frozen tissue, a biopsy tissue, a circulating tumor cell liquid biopsy, a resection tissue, a microdissected tissue, or a combination thereof. In particular embodiments, the sample is a biopsy tissue sample or a circulating tumor cell liquid biopsy sample.
In some embodiments, the subject has been diagnosed with cancer. In some embodiments, the cancer is a stage I or stage II cancer. In some embodiments, the cancer is selected from breast cancer, glioma, cervical squamous cell carcinoma, endocervical adenocarcinoma, lung adenocarcinoma, kidney renal clear cell carcinoma, and pancreatic adenocarcinoma.
In some embodiments, the method further comprises, or consisting essentially of, or yet consisting of, the step of culturing the sample in a high density 3D collagen culture system and determining the sample's migration capacity. In some embodiments, the method further comprises, or alternatively consisting essentially of, or yet further consists of, administering a cancer treatment comprising, or alternatively consisting essentially of, or yet further consisting of chemotherapy, that is optionally an aggressive treatment, and/or radiation therapy.
In some embodiments, the subject is a mammal. In some embodiments, the subject is an equine, bovine, canine, feline, murine, or a human. In a particular embodiment, the subject is a human.
In another aspect, disclosed herein is a method of predicting prognosis for a cancer patient, the method comprising, consisting of, or consisting essentially of, determining a gene expression level of one or more genes of a vascular mimicry (VM) gene module in a sample isolated from the cancer subject, wherein an increase in expression of the one or more genes in the VM gene module compared to a predetermined reference level is indicative of poor prognosis. In one aspect, increased expression intends an expression level of the gene over and above the expression of the gene in a counterpart, normal tissue not having a phenotype of the disease.
In some embodiments, the one or more genes of the VM gene module comprise, consist of, or consist essentially of genes selected from COL5A1, FRMD6, TANC2, THBS1, PEAK1, ITGAV, DAAM1, RASEF, JAG1, LAMC2, ZNF532, SKIL, NAV1, ARHGAP32, SYNE1, GALNT10, LHFPL2, ABL2, LTBP1, COL4A1, DPY19L1, LPCAT2, TBC1D2B, LAMB1, AMIGO2, NREP, SNX30, TPM1, COL4A2, ARNTL, MRC2, TGFBI, TVP23C, BHLHE40, SMAD7, ABLIM3, ZNF224, PODXL, TAGLN, VHL, EPHB2, EDN1, GTF2IP4, HIPS4, SIPA1L1, PID1, NLGN2, LTBP4, TRMT13, IGF2BP3, RBPJ, MKL1, ZMYM5, EFCAB11, WDR66, NKX3-1, HMOX1, TYRO3, SDHAP1, FURIN, FAM43A, AGTRAP, KCTD11, ID2, FERMT1, MTND2P28, H2BFS, LFNG, HES1, or KIN, and equivalents of each thereof.
In some embodiments, the VM gene module comprises, consists of, or consists essentially of at least one, at least two, at least three, or four genes selected from ITGB1, LAMC2, COL4A1, and DAAM1, and equivalents of each thereof.
In some embodiments, the gene expression level is determined by a method comprising determining the amount of an mRNA transcribed from the one or more genes of the VM gene module. In some embodiments, the gene expression level is determined by a method comprising, consisting of, or consisting essentially of one or more of in situ hybridization, northern blot, PCR, quantitative PCR, RNA-seq, or microarray. In some embodiments, the change in expression of the genes in the VM gene module is increased compared to the predetermined reference level. In one aspect, the predetermined reference level is the gene expression of level in a normal, non-diseased counterpart tissue.
In some embodiments, the sample is a tumor sample. In some embodiments, the tumor sample is at least one of a fixed tissue, a frozen tissue, a biopsy tissue, a circulating tumor cell liquid biopsy, a resection tissue, a microdissected tissue, or a combination thereof. In particular embodiments, the sample is a biopsy tissue sample or a circulating tumor cell liquid biopsy sample.
In some embodiments, the subject has been diagnosed with cancer. In some embodiments, the cancer is a stage I or stage II cancer. In some embodiments, the cancer is selected from breast cancer, glioma, cervical squamous cell carcinoma, endocervical adenocarcinoma, lung adenocarcinoma, kidney renal clear cell carcinoma, and pancreatic adenocarcinoma.
In some embodiments, the method further comprises the step of culturing the sample in a high density 3D collagen culture system and determining the sample's migration capacity. In some embodiments, cell migration is indicative of poorer or poor prognosis. In some embodiments, the method further comprises, or alternatively consists essentially of, or yet further consists of administering to the subject a cancer treatment comprising chemotherapy, that is optionally an aggressive treatment, and/or radiation therapy.
In some embodiments, the subject is a mammal. In some embodiments, the subject is an equine, bovine, canine, feline, murine, or a human. In a particular embodiment, the subject is a human.
In another aspect, provided herein is a method of treating a cancer patient, the method comprising, consisting of, or consisting essentially of administering a cancer treatment that is optionally an aggressive cancer treatment to the cancer patient, wherein a sample isolated from the cancer patient has previously been determined to have increased expression of one or more VM module genes compared to a predetermined reference level. In one aspect, increased expression intends an expression level of the gene over and above the expression of the gene in a counterpart, normal tissue not having a phenotype of the disease.
In some embodiments, the one or more genes of the VM gene module comprise, consist of, or consist essentially of genes selected from COL5A1, FRMD6, TANC2, THBS1, PEAK1, ITGAV, DAAM1, RASEF, JAG1, LAMC2, ZNF532, SKIL, NAV1, ARHGAP32, SYNE1, GALNT10, LHFPL2, ABL2, LTBP1, COL4A1, DPY19L1, LPCAT2, TBC1D2B, LAMB1, AMIGO2, NREP, SNX30, TPM1, COL4A2, ARNTL, MRC2, TGFBI, TVP23C, BHLHE40, SMAD7, ABLIM3, ZNF224, PODXL, TAGLN, VHL, EPHB2, EDN1, GTF2IP4, HPS4, SIPA1L1, PID1, NLGN2, LTBP4, TRMT13, IGF2BP3, RBPJ, MKL1, ZMYM5, EFCAB11, WDR66, NKX3-1, HMOX1, TYRO3, SDHAP1, FURIN, FAM43A, AGTRAP, KCTD11, ID2, FERMT1, MTND2P28, H2BFS, LFNG, HES1, or KIN, and equivalents of each thereof.
In some embodiments, the VM gene module comprises, consists of, or consists essentially of at least one, at least two, at least three, or four genes selected from ITGB1, LAMC2, COL4A1, and DAAM1, and equivalents of each thereof.
In some embodiments, the gene expression level is determined by a method comprising determining the amount of an mRNA transcribed from the one or more genes of the VM gene module. In some embodiments, the gene expression level is determined by a method comprising, consisting of, or consisting essentially of one or more of in situ hybridization, northern blot, PCR, quantitative PCR, RNA-seq, or microarray. In some embodiments, the change in expression of the genes in the VM gene module is increased as compared to expression of the gene in a counterpart, normal tissue not having a phenotype of the disease.
In some embodiments, the sample is a tumor sample. In some embodiments, the tumor sample is at least one of a fixed tissue, a frozen tissue, a biopsy tissue, a circulating tumor cell liquid biopsy, a resection tissue, a microdissected tissue, or a combination thereof. In particular embodiments, the sample is a biopsy tissue sample or a circulating tumor cell liquid biopsy sample.
In some embodiments, the cancer is a stage I or stage II cancer. In some embodiments, the cancer is selected from breast cancer, glioma, cervical squamous cell carcinoma, endocervical adenocarcinoma, lung adenocarcinoma, kidney renal clear cell carcinoma, and pancreatic adenocarcinoma.
In some embodiments, the method further comprises the step of culturing the sample in a high density 3D collagen culture system and determining the sample's migration capacity. In some embodiments, cell migration as compared to a normal counterpart cell, is indicative of poorer or poor prognosis.
In some embodiments, the subject is a mammal. In some embodiments, the cancer patient is an equine, bovine, canine, feline, murine, or a human. In a particular embodiment, the cancer patient is a human.
In some embodiments, the sample has previously been determined to migrate in a high density 3D collagen culture system.
In some embodiments, the cancer treatment and optional aggressive cancer treatment comprises chemotherapy and/or radiation therapy.
In another aspect, provided herein is a kit for determining the gene expression level and/or a risk of tumor metastasis, the kit comprising, consisting of, or consisting essentially of reagents for determining the gene expression level of at least one VM module gene in a sample isolated from a subject, and instructions for use.
In another aspect, provided herein is a method of determining the migration capacity of a tumor comprising tumor cells, the method comprising, consisting of, or consisting essentially of, culturing a tumor sample embedded in a 3D collagen matrix, wherein the tumor sample was isolated from a subject; and determining the migration capacity of the tumor sample by tracking motility of the tumor cells in the 3D collagen matrix.
In some embodiments, the 3D collagen matrix comprises a high density of collagen. In some embodiments, the collagen density is selected from the group of, from about 4 mg/mL to about 10 mg/mL, from about 4 mg/mL to about 8 mg/mL, or from about 4 mg/mL to about 6 mg/mL. In a particular embodiment, the collagen density is about 6 mg/mL.
In some embodiments, the 3D collagen matrix comprises, consists of, or consists essentially of a median fiber length less than or equal to 9.5 μm. In some embodiments, the 3D collagen matrix comprises, consists of, or consists essentially of a median pore size less than or equal to 10 μm.
In some embodiments, the 3D collagen matrix further comprises a molecular crowding agent. In some aspects it is selected from polyethylene glycol (PEG), polyvinyl alcohol, dextran and ficoll. In a particular embodiment, the molecular crowding agent is selected from polyethylene glycol (PEG), polyvinyl alcohol, dextran and ficoll. In one aspect it is PEG.
In some embodiments, motility is tracked by imaging the embedded tumor sample. In some embodiments, the embedded tumor sample is imaged at least once per day. In other embodiments, the embedded tumor sample is imaged at least once every two days. In other embodiments, the embedded tumor sample is imaged at least once every three days. In some embodiments, at least one image of the embedded tumor sample is analyzed to characterize tumor cell migration and/or motility. In some embodiments, the image is analyzed using an image processing algorithm.
In some embodiments, the method further comprises determining an invasion distance of a tumor cell, quantifying network structures formed by the tumor cells, determining the length of network structures formed by the tumor cells, and or/determining the shape of a tumor cell. These can be noted as the staging of the tumor and/or tumor cells, as known to those of skill in the art.
In particular embodiments, the 3D collagen matrix comprises, consists of, or consists essentially of about 2 mg/mL to about 6 mg/mL collagen and at least 4 mg/mL PEG.
In some embodiments, the method further comprises determining a gene expression level of one or more genes of a VM gene module in the tumor sample.
In some embodiments, the tumor sample is a biopsy tissue sample or a circulating tumor cell liquid biopsy sample.
In another aspect, provided herein is a method of screening a tumor for sensitivity to a drug, the method comprising, consisting of, or consisting essentially of, culturing a tumor sample embedded in a 3D collagen matrix comprising one or more drugs; and screening the tumor sample for sensitivity to the drug by determining the viability of the tumor sample.
In some embodiments, the 3D collagen matrix comprises a high density of collagen. In some embodiments, the collagen density is selected from the group of, from about 4 mg/mL to about 10 mg/mL, from about 4 mg/mL to about 8 mg/mL, or from about 4 mg/mL to about 6 mg/mL. In a particular embodiment, the collagen density is about 6 mg/mL.
In some embodiments, the 3D collagen matrix comprises, consists of, or consists essentially of a median fiber length less than or equal to 9.5 μm. In some embodiments, the 3D collagen matrix comprises, consists of, or consists essentially of a median pore size less than or equal to 10 μm.
In some embodiments, the 3D collagen matrix further comprises a molecular crowding agent selected from polyethylene glycol (PEG), polyvinyl alcohol, dextran and ficoll. In a particular embodiment, the molecular crowding agent is polyethylene glycol (PEG).
In some embodiments, the method further comprising tracking the motility of the tumor sample. In some embodiments, motility is tracked by imaging the embedded tumor sample. In some embodiments, the embedded tumor sample is imaged at least once per day. In other embodiments, the embedded tumor sample is imaged at least once every two days. In other embodiments, the embedded tumor sample is imaged at least once every three days. In some embodiments, at least one image of the embedded tumor sample is analyzed to characterize tumor cell migration and/or motility. In some embodiments, the image is analyzed using an image processing algorithm.
In some embodiments, the method further comprises determining an invasion distance of a tumor cell, quantifying network structures formed by the tumor cells, determining the length of network structures formed by the tumor cells, and or/determining the shape of a tumor cell.
In particular embodiments, the 3D collagen matrix comprises, consists of, or consists essentially of about 2 mg/mL to about 6 mg/mL collagen and at least 4 mg/mL PEG.
In some embodiments, the method further comprises determining a gene expression level of one or more genes of a VM gene module in the tumor sample.
In some embodiments, the tumor sample is a biopsy tissue sample or a circulating tumor cell liquid biopsy sample.
In another aspect, provided herein is a culture system comprising, consisting of, or consisting essentially of cells embedded in a high density 3D collagen matrix.
In some embodiments, the collagen density of the high density 3D collagen matrix is selected from the group of, from about 4 mg/mL to about 10 mg/mL, from about 4 mg/mL to about 8 mg/mL, or from about 4 mg/mL to about 6 mg/mL. In a particular embodiment, the collagen density is about 6 mg/mL.
In some embodiments, the 3D collagen matrix comprises a median fiber length less than or equal to 9.5 μm. In some embodiments, the 3D collagen matrix comprises a median pore size less than or equal to 10 μm.
In some embodiments, the 3D collagen matrix further comprises a molecular crowding agent. In some aspects it is selected from polyethylene glycol (PEG), polyvinyl alcohol, dextran and ficoll. In some embodiments, the molecular crowding agent is polyethylene glycol (PEG). In some embodiments, the 3D collagen matrix comprises from about 2 mg/mL to about 6 mg/mL collagen and at least 0.5 mg/mL PEG. In particular embodiments, the 3D collagen matrix comprises from about 2 mg/mL to about 4 mg/mL collagen and at least 4 mg/mL PEG.
When a person is diagnosed with a solid tumor, a gene expression test would be performed and the state of expression of the genes included in the gene set would be assessed as low or high. If the level of expression is high, a recommendation of an additional therapy to surgical resection, or a more aggressive treatment regimen and more careful follow-up would be recommended by the treating physician because the patient is high risk for metastasis.
Thus, in one aspect, the present disclosure provides methods of predicting prognosis in a cancer patient comprising, or alternatively consisting essentially of, or yet further consisting of, determining the expression level of at least a subset of genes in a vascular mimicry (VM) gene module, wherein increased expression of the genes in the VM gene module is indicative of a poor or poorer prognosis.
In some embodiments, the patient has stage I or stage II cancer.
In some embodiments, the cancer is selected from the group consisting of breast cancer, glioma, cervical squamous cell carcinoma, endocervical adenocarcinoma, lung adenocarcinoma, kidney renal clear cell carcinoma, and pancreatic adenocarcinoma.
In some embodiments, the poor prognosis comprises, consists of, or consists essentially of a decreased 5-year survival or increased chance of metastasis.
In some embodiments, the methods further comprising detecting the pore size of the collagen in a tumor sample obtained from the patient or determining the expression level ofR 1 integrin in a tumor sample from the patient relative to a control level.
The disclosed methods are applicable to all ages, races, and genders of subjects or patients with cancer. Thus, in some embodiments of the disclosed methods the subject is a pediatric subject, while is some embodiments, the subject is an adult.
The foregoing general description and following brief description of the drawings and the detailed description are exemplary and explanatory only. Other objects, advantages, and novel features of the disclosure will be readily apparent to those skilled in the art from the following detailed description.
Effectively targeting tumor cell migration behaviors that precede metastatic dissemination could substantially reduce the morbidity and mortality associated with cancer. The assembly of tumor cells into tubular structures mimicking vasculature has been reported across a broad range of solid tumors. Termed vascular mimicry (VM), histological evidence of this behavior is significantly correlated with metastatic dissemination in over 16 different cancer types. Despite the highly conserved nature of this metastatic process, the mechanisms underlying its induction were poorly understood prior to this disclosure. Based on this disclosure, diagnostic biomarkers and therapeutics targeting VM can be developed to impact the treatment and survival of a wide range of cancer patients. Disclosed herein are a set of genes that mediate the development of vasculogenic mimicry in solid tumors. Expression of this gene set was found to be predictive of patient survival in early stages of breast cancer and in 5 other solid tumor types, and therefor is likely predictive of numerous other types of cancer. This highly conserved gene set provides a useful diagnostic tool and a set of potential therapeutic targets.
It is to be understood that methods are not limited to the particular embodiments described, and as such may, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting. The scope of the present technology will be limited only by the appended claims.
As used herein, certain terms may have the following defined meanings. As used in the specification and claims, the singular form “a,” “an” and “the” include singular and plural references unless the context clearly dictates otherwise. For example, the term “a cell” includes a single cell as well as a plurality of cells, including mixtures thereof.
As used herein, the term “comprising” is intended to mean that the compositions and methods include the recited elements, but not excluding others. “Consisting essentially of” when used to define compositions and methods, shall mean excluding other elements of any essential significance to the composition or method. “Consisting of” shall mean excluding more than trace elements of other ingredients for claimed compositions and substantial method steps. Embodiments defined by each of these transition terms are within the scope of this disclosure. Accordingly, it is intended that the methods and compositions can include additional steps and components (comprising) or alternatively including steps and compositions of no significance (consisting essentially of) or alternatively, intending only the stated method steps or compositions (consisting of).
All numerical designations, e.g., pH, temperature, time, concentration, and molecular weight, including ranges, are approximations which are varied (+) or (−) by increments of 0.1. It is to be understood, although not always explicitly stated that all numerical designations are preceded by the term “about”. The term “about” also includes the exact value “X” in addition to minor increments of “X” such as “X+0.1” or “X−0.1.” It also is to be understood, although not always explicitly stated, that the reagents described herein are merely exemplary and that equivalents of such are known in the art.
As used herein, “about” means plus or minus 10%.
As used herein, “optional” or “optionally” means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.
As used herein, the term “cancer” and “tumor” are used interchangeably and refer to a cell, tissue, subject, or patient with a malignant phenotype characterized by the uncontrolled proliferation of malignant cells. The cancer can be metastatic, non-metastatic and pre-clinical. Hallmarks of cancer include self-sufficiency in growth signals, insensitivity to growth-inhibitory (antigrowth) signals, evasion of programmed cell death (apoptosis), limitless replicative potential, sustained angiogenesis, and tissue invasion and metastasis.
Some examples of such cancers include but are not limited to adrenocortical carcinoma; bladder cancer, breast cancer, breast cancer, ductal, breast cancer, invasive intraductal, breast-ovarian cancer, Burkitt's lymphoma, cervical carcinoma, colorectal adenoma, colorectal cancer, colorectal cancer, hereditary nonpolyposis, type 1, colorectal cancer, hereditary nonpolyposis, type 2, colorectal cancer, hereditary nonpolyposis, type 3, colorectal cancer, hereditary nonpolyposis, type 6, colorectal cancer, hereditary nonpolyposis, type 7, dermatofibrosarcoma protuberans, endometrial carcinoma, esophageal cancer, gastric cancer, fibrosarcoma, glioblastoma multiforme, glomus tumors, multiple, hepatoblastoma, hepatocellular cancer, hepatocellular carcinoma, leukemia, acute lymphoblastic, leukemia, acute myeloid, leukemia, acute myeloid, with eosinophilia, leukemia, acute nonlymphocytic, leukemia, chronic myeloid, Li-Fraumeni syndrome, liposarcoma, lung cancer, lung cancer, small cell, lymphoma, non-Hodgkin's, lynch cancer family syndrome II, male germ cell tumor, mast cell leukemia, medullary thyroid, medulloblastoma, melanoma, meningioma, multiple endocrine neoplasia, myeloid malignancy, predisposition to, myxosarcoma, neuroblastoma, osteosarcoma, ovarian cancer, ovarian cancer, serous, ovarian carcinoma, ovarian sex cord tumors, pancreatic cancer, pancreatic endocrine tumors, paraganglioma, familial nonchromaffin, pilomatricoma, pituitary tumor, invasive, prostate adenocarcinoma, prostate cancer, renal cell carcinoma, papillary, familial and sporadic, retinoblastoma, rhabdoid predisposition syndrome, familial, rhabdoid tumors, rhabdomyosarcoma, small-cell cancer of lung, soft tissue sarcoma, squamous cell carcinoma, head and neck, T-cell acute lymphoblastic leukemia, Turcot syndrome with glioblastoma, tylosis with esophageal cancer, uterine cervix carcinoma, colon-rectal cancer, lung cancer, prostate cancer, skin cancer, osteocarcinoma, solid tumors/malignancies, myxoid and round cell carcinoma, locally advanced tumors, human soft tissue carcinoma, cancer metastases, squamous cell carcinoma, esophageal squamous cell carcinoma, oral carcinoma, cutaneous T cell lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, cancer of the adrenal cortex, ACTH-producing tumors, non-small cell cancers, gastrointestinal cancers, urological cancers, malignancies of the female genital tract, malignancies of the male genital tract, kidney cancer, brain cancer, bone cancers, skin cancers, thyroid cancer, retinoblastoma, peritoneal effusion, malignant pleural effusion, mesothelioma, Wilms's tumors, gall bladder cancer, trophoblastic neoplasm, hemangiopericytoma, Kaposi's sarcoma and liver cancer.
The term “metastatic cells” refers to cancerous cells that have acquired the ability to migrate from the primary or original tumor lesion to surrounding tissues and/or have acquired the ability to penetrate and the walls of lymphatic cells or blood vessels and circulate through the bloodstream. The term “metastasis” as used herein refers to the migration or spread of cancerous cells from one location in the body to surrounding tissues, the lymphatic system, or to blood vessels. When tumor cells metastasize, the new tumor is referred to as a metastatic tumor.
As used herein, the term “aggressive” in the context of therapy refers to a therapy that is recommended to treat a metastatic tumor. Non-limiting examples of aggressive therapy include chemotherapy and/or radiation therapy. In some embodiments, the aggressive therapy is prophylactic.
The term “chemotherapy” encompasses cancer therapies that employ chemical or biological agents or other therapies, such as radiation therapies, e.g., a small molecule drug or a large molecule, such as antibodies, RNAi and gene therapies. Non-limiting examples of chemotherapies are provided below. It should be understood, although not always explicitly stated, that when a particular therapy is noted, the scope of the invention includes equivalents unless excluded.
Topoisomerase inhibitors are agents designed to interfere with the action of topoisomerase enzymes (topoisomerase I and II), which are enzymes that control the changes in DNA structure by catalyzing the breaking and rejoining of the phosphodiester backbone of DNA strands during the normal cell cycle. In one aspect, topoisomerase inhibitors include irinotecan, topotecan, camptothecin and lamellarin D, or compounds targeting topoisomerase IA. In another aspect, topoisomerase inhibitors include etoposide, doxorubicin or compounds targeting topoisomerase II.
Pyrimidine antimetabolite includes, without limitation, fluorouracil (5-FU), its equivalents and prodrugs. In one embodiment, a pyrimidine antimetabolite is a chemical that inhibits the use of a pyrimidine. The presence of antimetabolites can have toxic effects on cells, such as halting cell growth and cell division, so these compounds can be used as chemotherapy for cancer.
Fluorouracil (5-FU) belongs to the family of therapy drugs called pyrimidine based antimetabolites. It is a pyrimidine analog, which is transformed into different cytotoxic metabolites that are then incorporated into DNA and RNA thereby inducing cell cycle arrest and apoptosis. Chemical equivalents are pyrimidine analogs which result in disruption of DNA replication. Chemical equivalents inhibit cell cycle progression at S phase resulting in the disruption of cell cycle and consequently apoptosis. Equivalents to 5-FU include prodrugs, analogs and derivative thereof such as 5′-deoxy-5-fluorouridine (doxifluroidine), 1-tetrahydrofuranyl-5-fluorouracil (ftorafur), Capecitabine (Xeloda), S-1 (MBMS-247616, consisting of tegafur and two modulators, a 5-chloro-2,4-dihydroxypyridine and potassium oxonate), ralititrexed (tomudex), nolatrexed (Thymitaq, AG337), LY231514 and ZD9331, as described for example in Papamicheal (1999) The Oncologist 4:478-487.
“5-FU based adjuvant therapy” refers to 5-FU alone or alternatively the combination of 5-FU with other treatments, that include, but are not limited to radiation, methyl-CCNU, leucovorin, oxaliplatin, irinotecin, mitomycin, cytarabine, levamisole. Specific treatment adjuvant regimens are known in the art as FOLFOX, FOLFOX4, FOLFIRI, MOF (semustine (methyl-CCNU), vincrisine (Oncovin) and 5-FU). For a review of these therapies see Beaven and Goldberg (2006) Oncology 20(5):461-470. An example of such is an effective amount of 5-FU and Leucovorin. Other chemotherapeutics can be added, e.g., oxaliplatin or irinotecan.
Capecitabine is a prodrug of (5-FU) that is converted to its active form by the tumor-specific enzyme PynPase following a pathway of three enzymatic steps and two intermediary metabolites, 5′-deoxy-5-fluorocytidine (5′-DFCR) and 5′-deoxy-5-fluorouridine (5′-DFUR). Capecitabine is marketed by Roche under the trade name Xeloda®.
A therapy comprising a pyrimidine antimetabolite includes, without limitation, a pyrimidine antimetabolite alone or alternatively the combination of a pyrimidine antimetabolite with other treatments, that include, but are not limited to, radiation, methyl-CCNU, leucovorin, oxaliplatin, irinotecin, mitomycin, cytarabine, levamisole. Specific treatment adjuvant regimens are known in the art as FOLFOX, FOLFOX4, FOLFOX6, FOLFIRI, MOF (semustine (methyl-CCNU), vincrisine (Oncovin) and 5-FU). For a review of these therapies see Beaven and Goldberg (2006) Oncology 20(5):461-470. An example of such is an effective amount of 5-FU and Leucovorin. Other chemotherapeutics can be added, e.g., oxaliplatin or irinotecan.
Bevacizumab (BV) is sold under the trade name Avastin® by Genentech. It is a humanized monoclonal antibody that binds to and inhibits the biologic activity of human vascular endothelial growth factor (VEGF). Biological equivalent antibodies are identified herein as modified antibodies which bind to the same epitope of the antigen, prevent the interaction of VEGF to its receptors (Flt01, KDR a.k.a. VEGFR2) and produce a substantially equivalent response, e.g., the blocking of endothelial cell proliferation and angiogenesis. Bevacizumab is also in the class of cancer drugs that inhibit angiogenesis (angiogenesis inhibitors).
Trifluridine/tipiracil (CAS Number 733030-01-8) is sold under the trade name of Lonsurf. It is a combination of two active pharmaceutical ingredients: trifluridine, a nucleoside analog, and tipiracil hydrochloride, a thymidine phosphorylase inhibitor. Trifluridine has the chemical formula C10H11F3N2O5 and is also known as α,α,α-trifluorothymidine; 5-trifluromethyl-2′-deoxyuridine; and FTD5-trifluoro-2′-deoxythymidine (CAS number 70-00-8). Tipiracil has the chemical formula C9H11ClN4O2 and inhibits the enzyme thymidine phosphorylase, preventing rapid metabolism of trifluridine, increasing the bioavailability of trifluridine. Equivalents of trifluridine/tipiracil include trifluridine alone, trifluridine that modified to increase its halflife and/or resistance to metabolism by thymidine phosphorylase, or substitution of one or both of trifluridine and/or tipiracil hydrochloride with a chemical equivalent. Non-limiting examples of chemical equivalents include pharmaceutically acceptable salts or solvates of the active ingredients.
Irinotecan (CPT-11) is sold under the trade name of Camptosar®. It is a semi-synthetic analogue of the alkaloid camptothecin, which is activated by hydrolysis to SN-38 and targets topoisomerase I. Chemical equivalents are those that inhibit the interaction of topoisomerase I and DNA to form a catalytically active topoisomerase I-DNA complex. Chemical equivalents inhibit cell cycle progression at G2-M phase resulting in the disruption of cell proliferation. An equivalent of irinotecan is a composition that inhibits a topoisomerase. Non-limiting examples of an equivalent of irinotecan include topotecan, camptothecin and lamellarin D, etoposide, or doxorubicin.
Oxaliplatin (trans-/-diaminocyclohexane oxalatoplatinum; L-OHP; CAS No. 61825-94-3) is sold under the trade name of Elotaxin. It is a platinum derivative that causes cell cytotoxicity. Oxaliplatin forms both inter- and intra-strand cross links in DNA, which prevent DNA replication and transcription, causing cell death. Non-limiting examples of an equivalent of oxaliplatin include carboplatin and cisplatin.
The phrase “first line” or “second line” or “third line” refers to the order of treatment received by a patient. First line therapy regimens are treatments given first, whereas second or third line therapy are given after the first line therapy or after the second line therapy, respectively. The National Cancer Institute defines first line therapy as “the first treatment for a disease or condition. In patients with cancer, primary treatment can be surgery, chemotherapy, radiation therapy, or a combination of these therapies. First line therapy is also referred to those skilled in the art as “primary therapy and primary treatment.” See National Cancer Institute website at cancer.gov. Typically, a patient is given a subsequent chemotherapy regimen because the patient did not shown a positive clinical or sub-clinical response to the first line therapy or the first line therapy has stopped.
The term “treating” as used herein is intended to encompass curing as well as ameliorating at least one symptom of the condition or disease. For example, in the case of cancer, a response to treatment includes a reduction in cachexia, increase in survival time, elongation in time to tumor progression, reduction in tumor mass, reduction in tumor burden and/or a prolongation in time to tumor metastasis, reduction in tumor metastasis, time to tumor recurrence, tumor response, complete response, partial response, stable disease, progressive disease, progression free survival, overall survival, each as measured by standards set by the National Cancer Institute and the U.S. Food and Drug Administration for the approval of new drugs.
“An effective amount” or “therapeutically effect amount” intends to indicate the amount of a compound or agent administered or delivered to the patient which is most likely to result in the desired response to treatment. The amount is empirically determined by the patient's clinical parameters including, but not limited to the Stage of disease, age, gender, histology, and likelihood for tumor recurrence.
As used herein, “subject” and “patient” are used interchangeably and intend an animal subject or patient, a subject or mammal patient or yet further a human subject or patient. For the purpose of illustration only, a mammal includes but is not limited to a simian, a murine, a bovine, an equine, a porcine or an ovine subject.
The term “clinical outcome”, “clinical parameter”, “clinical response”, or “clinical endpoint” refers to any clinical observation or measurement relating to a patient's reaction to a therapy. Non-limiting examples of clinical outcomes include tumor response (TR), overall survival (OS), progression free survival (PFS), disease free survival, time to tumor recurrence (TTR), time to tumor progression (TTP), relative risk (RR), objective response rate (RR or ORR), toxicity or side effect.
“Overall Survival” (OS) refers to the length of time of a cancer patient remaining alive following a cancer therapy. OS is an example of an indication of prognosis.
“Progression free survival” (PFS) or “Time to Tumor Progression” (TTP) refers to the length of time following a therapy, during which the tumor in a subject or cancer patient does not grow. Progression-free survival includes the amount of time a patient has experienced a complete response, partial response or stable disease. PFS and TTP are indications of prognosis.
“Disease free survival” (DFS) refers to the length of time following a therapy, during which a subject or cancer patient survives with no signs of the cancer or tumor. DFS is an indication of prognosis.
“Time to Tumor Recurrence (TTR)” refers to the length of time, following a cancer therapy such as surgical resection or chemotherapy, until the tumor has reappeared (come back). The tumor may come back to the same place as the original (primary) tumor or to another place in the body. TRR is an indication of prognosis.
“Relative Risk” (RR), in statistics and mathematical epidemiology, refers to the risk of an event (or of developing a disease) relative to exposure. Relative risk is a ratio of the probability of the event occurring in the exposed group versus a non-exposed group.
“Objective response rate” refers to the proportion of responders (subjects or patients with either a partial (PR) or complete response (CR)) compared to nonresponders (subjects or patients with either SD or PD). Response duration can be measured from the time of initial response until documented tumor progression.
The term “identify” or “identifying” is to associate or affiliate a subject or patient closely to a group or population of subjects or patients who likely experience the same or a similar clinical response to a therapy, or who likely experience the same or a similar cancer pathology such as metastasis.
The term “selecting” a subject or patient for a therapy or treatment refers to making an indication that the selected patient is suitable for the therapy or treatment. Such an indication can be made in writing by, for instance, a handwritten prescription or a computerized report making the corresponding prescription or recommendation.
“Detecting” as used herein refers to determining the presence of a nucleic acid of interest (e.g., at least a subset of the VM biomarker gene signature identified as predictive of poor long-term survival and increased likelihood of metastasis) in a sample. Detection does not require the method to provide 100% sensitivity. Various means of detection are known in the art.
As used herein, the term “sample,” “test sample,” “test genomic sample” or “biological sample” refers to any liquid or solid material derived from an individual believed to have or having cancer. In some embodiments, a test sample is obtained from a biological source, such as cells in culture or a tissue or fluid sample from an animal, most preferably, a human. Exemplary samples include any sample containing the nucleic acid (e.g., DNA or RNA) of interest and include, but are not limited to, a tumor, a circulating tumor cell, cell free DNA (cfDNA), biopsy, aspirates, plasma, serum, whole blood, blood cells, lymphatic fluid, cerebrospinal fluid, synovial fluid, urine, saliva, and skin or other organs (e.g. biopsy material including tumor or bone marrow biopsy). The term “patient sample” as used herein may also refer to a tissue sample obtained from a human seeking diagnosis or treatment of cancer or a related condition or disease. It is also understood that these terms can encompass a population of purified cancer or pre-cancerous cells or a mixture of normal and cancer/precancerous cells. Each of these terms may be used interchangeably.
As used herein, the terms “individual”, “patient”, or “subject” can be an individual organism, a vertebrate, a mammal (e.g., a bovine, a canine, a feline, or an equine), or a human. In a preferred embodiment, the individual, patient, or subject is a human. In the case of human subjects, a pediatric subject is under 18 years of age and an adult subject is 18 years of age or older. A subject is still considered a pediatric subject if he or she begins a course of treatment prior to turning about 18 years of age, even if the subject continues treatment beyond 18 years of age.
As used herein, “having an increased risk” means a subject is identified as having a higher than normal chance of developing metastasis and/or metastatic cancer, compared to the average cancer patient. In addition, a subject who has had, or who currently has, cancer is a subject who has an increased risk for developing cancer, as such a subject may continue to develop cancer. Subjects who currently have, or who have had, a tumor also have an increased risk for tumor metastases.
As used herein, “determining a prognosis” refers to the process in which the course or outcome of a condition in a patient is predicted. The term “prognosis” does not refer to the ability to predict the course or outcome of a condition with 100% accuracy. Instead, the term refers to identifying an increased or decreased probability that a certain course or outcome will occur in a patient exhibiting a given condition/marker, when compared to those individuals not exhibiting the condition. The nature of the prognosis is dependent upon the specific disease and the condition/marker being assessed. For example, a prognosis may be expressed as the amount of time a patient can be expected to survive, the likelihood that the disease goes into remission or experience recurrence, or to the amount of time the disease can be expected to remain in remission before recurrence.
“Expression” as applied to a gene, refers to the production of the mRNA transcribed from the gene, or the protein product encoded by the gene. The expression level of a gene may be determined by measuring the amount of mRNA or protein in a cell or tissue sample. In one aspect, the expression level of a gene is represented by a relative level as compared to a housekeeping gene as an internal control. In another aspect, the expression level of a gene from one sample may be directly compared to the expression level of that gene from a different sample using an internal control to remove the sampling error.
The expression “amplification of polynucleotides” includes methods such as PCR, ligation amplification (or ligase chain reaction, LCR) and amplification methods based on the use of Q-beta replicase. These methods are well known and widely practiced in the art. See, e.g., U.S. Pat. Nos. 4,683,195 and 4,683,202 and Innis et al., 1990 (for PCR); and Wu, D. Y. et al. (1989) Genomics 4:560-569 (for LCR). In general, the PCR procedure describes a method of gene amplification which is comprised of (i) sequence-specific hybridization of primers to specific genes within a DNA sample (or library), (ii) subsequent amplification involving multiple rounds of annealing, elongation, and denaturation using a DNA polymerase, and (iii) screening the PCR products for a band of the correct size. The primers used are oligonucleotides of sufficient length and appropriate sequence to provide initiation of polymerization, i.e. each primer is specifically designed to be complementary to each strand of the genomic locus to be amplified.
Reagents and hardware for conducting PCR are commercially available. Primers useful to amplify sequences from a particular gene region are preferably complementary to, and hybridize specifically to sequences in the target region or in its flanking regions. Nucleic acid sequences generated by amplification may be sequenced directly. Alternatively the amplified sequence(s) may be cloned prior to sequence analysis. A method for the direct cloning and sequence analysis of enzymatically amplified genomic segments is known in the art.
The term “isolated” as used herein refers to molecules or biological or cellular materials being substantially free from other materials. In one aspect, the term “isolated” refers to nucleic acid, such as DNA or RNA, or protein or polypeptide, or cell or cellular organelle, or tissue or organ, separated from other DNAs or RNAs, or proteins or polypeptides, or cells or cellular organelles, or tissues or organs, respectively, that are present in the natural source. The term “isolated” also refers to a nucleic acid or peptide that is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized. Moreover, an “isolated nucleic acid” is meant to include nucleic acid fragments which are not naturally occurring as fragments and would not be found in the natural state. The term “isolated” is also used herein to refer to polypeptides which are isolated from other cellular proteins and is meant to encompass both purified and recombinant polypeptides. The term “isolated” is also used herein to refer to cells or tissues that are isolated from other cells or tissues and is meant to encompass both cultured and engineered cells or tissues.
A “normal cell or tissue corresponding to the tumor tissue type” refers to a normal cell or tissue from a same tissue type as the tumor tissue. A non-limiting examples is a normal lung cell from a patient having lung tumor, or a normal colon cell from a patient having colon tumor.
The term “amplification” or “amplify” as used herein means one or more methods known in the art for copying a target nucleic acid, thereby increasing the number of copies of a selected nucleic acid sequence. Amplification can be exponential or linear. A target nucleic acid can be either DNA or RNA. The sequences amplified in this manner form an “amplicon.” While the exemplary methods described hereinafter relate to amplification using the polymerase chain reaction (“PCR”), numerous other methods are known in the art for amplification of nucleic acids (e.g., isothermal methods, rolling circle methods, etc.). The skilled artisan will understand that these other methods can be used either in place of, or together with, PCR methods.
As used herein the term “stringency” is used in reference to the conditions of temperature, ionic strength, and the presence of other compounds, under which nucleic acid hybridizations are conducted. With high stringency conditions, nucleic acid base pairing will occur only between nucleic acids that have sufficiently long segments with a high frequency of complementary base sequences. Exemplary hybridization conditions are as follows. High stringency generally refers to conditions that permit hybridization of only those nucleic acid sequences that form stable hybrids in 0.018 M NaCl at 65° C. High stringency conditions can be provided, for example, by hybridization in 50% formamide, 5×Denhardt's solution, 5×SSC (saline sodium citrate) 0.2% SDS (sodium dodecyl sulfate) at 42° C., followed by washing in 0.1×SSC, and 0.1% SDS at 65° C. Moderate stringency refers to conditions equivalent to hybridization in 50% formamide, 5×Denhardt's solution, 5×SSC, 0.2% SDS at 42° C., followed by washing in 0.2×SSC, 0.2% SDS, at 65° C. Low stringency refers to conditions equivalent to hybridization in 10% formamide, 5×Denhardt's solution, 6×SSC, 0.2% SDS, followed by washing in 1° SSC, 0.2% SDS, at 50° C.
As used herein the term “substantially identical” refers to a polypeptide or nucleic acid exhibiting at least 50%, 75%, 85%, 90%, 95%, or even 99% identity to a reference amino acid or nucleic acid sequence over the region of comparison. For polypeptides, the length of comparison sequences will generally be at least 20, 30, 40, or 50 amino acids or more, or the full length of the polypeptide. For nucleic acids, the length of comparison sequences will generally be at least 10, 15, 20, 25, 30, 40, 50, 75, or 100 nucleotides or more, or the full length of the nucleic acid.
As used herein, a “molecular crowding agent” or “crowding agent” refers to an agent capable of providing molecular crowding to the 3D collagen matrix. Nonlimiting examples include one or more of: polyethylene glycol (e.g., PEG1450, PEG3000, PEG8000, PEG10000, PEG14000, PEG15000, PEG20000, PEG250000, PEG30000, PEG35000, PEG40000, PEG compound with molecular weight between 15,000 and 20,000 daltons, or combinations thereof), polyvinyl alcohol, dextran and ficoll. In some embodiments, the crowding agent is present in the reaction mixture at a concentration between 1 to 12% by weight or by volume of the reaction mixture, e.g., between any two concentration values selected from 1.0%, 1.5%, 2.0%, 2.5%, 3.0%, 3.5% 4.0%, 4.5% 5.0%, 5.5%, 6.0%, 6.5%, 7.0%, 7.5% 8.0%, 8.5%, 9.0%, 9.5%, 10.0%, 10.5%, 11.0%, 11.5%, and 12.0%. In particular embodiments, the molecular crowding agent is PEG.
This disclosure provides methods and kits for predicting the prognosis of cancer patients and the likelihood of metastasis of a given caner, which is useful in stratifying patients and identifying/differentiating between aggressive and indolent disease. The disclosed kits and methods may further be useful for selecting a therapeutic regimen or determining if a certain therapeutic regimen is more likely to treat a cancer or is the appropriate chemotherapy for that patient than other chemotherapies that may be available to the patient. In general, a therapy is considered to “treat” cancer if it provides one or more of the following treatment outcomes: reduce or delay recurrence of the cancer after the initial therapy; increase median survival time or decrease metastases.
An initial step in cancer metastasis is the migration of tumor cells through extracellular matrix (ECM) and into the lymphatic or vascular systems. Several distinct cancer cell migration strategies exist in vivo, and the local density and alignment of collagen are implicated in modulating these migration behaviors. Yet, clonal cells within a tumor population also display heterogeneity in their ability to migrate and metastasize. Prior to this disclosure, it remained unclear to what extent tumor cell heterogeneity versus ECM heterogeneity contribute to the emergence of distinct migration phenotypes. This disclosure has identified such a phenotype through the use of a 3D collagen system to generate matrices of varying densities and monitored single cancer cell migration in these matrices with time-lapse microscopy. The existence of a collagen density threshold at 2.5 mg/ml, above which 86% of MDA-MB-231 breast cancer cells transition from single mesenchymal migration to collective cell migration was observed. Initially embedded as single cells, the majority of MDAs in 6 mg/ml collagen began migrating collectively with a 50% increase in persistence after cell division. The remainder of cells did not migrate, but instead formed spheroids. Conversely, in 2.5 mg/ml collagen, cells migrated individually. Moreover, highly similar behavior in HT-1080 fibrosarcoma cells was observed.
Within seven days, cells in 6 mg/ml undergoing collective motility created long interconnected networks coated with basement membrane molecules that resembled a clinical phenotype known as vascular mimicry (VM). Next the physical feature of high density collagen driving VM was identified. Compared to the 2.5 mg/ml condition, 6 mg/ml collagen corresponded to an increased stiffness and adhesive ligand concentration as well as decreased oxygen concentration and pore size. To test these features individually, cell were cultured in temperature stiffened 2.5 mg/ml matrices, or in 2.5 mg/ml with 1% oxygen, with integrin activating antibodies, or with a high density of polyethylene glycol (PEG). Neither hypoxia, matrix stiffness, or integrin activation was sufficient to induce VM. However, PEG-induced molecular crowding triggered VM network formation. Moreover, RNA sequencing revealed that cells undergoing collective migration up-regulated a conserved transcriptional program consisting of 70 genes. This gene set was not up-regulated in normal mesenchymal fibroblasts under the same conditions. Further analysis showed that this gene module was significantly enriched for annotations of vascular development and negative motility regulation and predicted survival in human tumor transcriptome datasets. Together, the disclosed results indicate that the VM phenotype arises in a subpopulation of cells from a conserved transcriptional and migratory response to molecular crowding in 3D.
Existing gene sets used as cancer diagnostic tools (i.e. OncoDX and MammaPrint) compile genes involved in many different aspects of cancer biology without any link to a functional phenotype. The gene set presented in this disclosure has been validated to be linked to the development of VM, a specific and highly aggressive metastatic cancer cell phenotype. Currently, V is identified by a pathologist's evaluation of histological slides, wherein vascular-like structures that do not stain positive for endothelial cells are identified as VM. Thus far, conserved molecular biomarkers that define this phenotype have remained unknown. The disclosed discovery informs a universal set of VMV diagnostic biomarkers for improving assignment of patients to therapies, which may be useful for diseases like ductal carcinoma in situ and prostate cancers that are frequently over-treated due to an inability to distinguish indolent from aggressive disease. Moreover, this disclosure will inform potential therapeutic strategies for combatting VM-mediated metastasis.
Thus, the present disclosure provides methods of detecting a novel VM gene module made up of the 70 up-regulated genes shown in Table 1 below. Detection of the expression level of these genes can be used to estimate the risk of tumor metastasis in a subject and/or the prognosis of a cancer patient. Up-regulation or increased expression of the genes in the gene module can be relative to a defined control level. The control level may be determined by detecting expression levels of the genes in a non-cancerous sample from the patient or based on expression data in the general population.
Accordingly, in one aspect provided herein is a method of determining gene expression level of one or more genes of a vascular mimicry (VM) gene module in a sample isolated from a subject, comprising, consisting of, or consisting essentially of analyzing the expression of the one or more genes listed in the VM gene module. In some embodiments, the method further comprises determining a risk of tumor metastasis in the subject by comparing a change in expression of the one or more genes in the VM gene module compared to a predetermined reference level.
In another aspect, disclosed herein is a method of predicting prognosis for a cancer patient, the method comprising, consisting of, or consisting essentially of: determining a gene expression level of one or more genes of a vascular mimicry (VM) gene module in a sample isolated from the cancer subject. In some embodiments, the method further comprises identifying the patient as having poor prognosis by comparing a change in expression of the one or more genes in the VM gene module compared to a predetermined reference level. In some embodiments, an increase in expression of the one or more genes in the VM gene module compared to a predetermined reference level is indicative of poor prognosis.
Methods to detect the disclosed VM biomarkers include, but are not limited to using PCR-based methods such as Q-PCR and RT-PCR to determine whether a subject has an increased risk of metastasis or a poor prognosis (i.e. decreased 5-year survival). Alternatively, mRNA levels can be detected using nucleic acid probes or arrays.
In some embodiments, the disclosure relates to methods and compositions for determining and identifying the presence of a VM phenotype based on detecting of the disclosed gene module. This information is useful to diagnose and prognose disease progression as well as select the most effective treatment among treatment options. Probes can be used to directly determine the genotype of the sample or can be used simultaneously with or subsequent to amplification. The term “probes” includes naturally occurring or recombinant single- or double-stranded nucleic acids or chemically synthesized nucleic acids. They may be labeled by nick translation, Klenow fill-in reaction, PCR or other methods known in the art. Probes of the present disclosure, their preparation and/or labeling are described in Sambrook et al. (1989) supra. A probe can be a polynucleotide of any length suitable for selective hybridization to a nucleic acid containing a polymorphic region of the invention. Length of the probe used will depend, in part, on the nature of the assay used and the hybridization conditions employed.
In some embodiments, the one or more genes of the VM gene module comprise, consist of, or consist essentially of at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, at least 50, at least 51, at least 52, at least 53, at least 54, at least 55, at least 56, at least 57, at least 58, at least 59, at least 60, at least 61, at least 62, at least 63, at least 64, at least 65, at least 66, at least 67, at least 68, at least 69, or 70 genes selected from COL5A1, FRMD6, TANC2, THBS1, PEAK1, ITGAV, DAAM1, RASEF, JAG1, LAMC2, ZNF532, SKIL, NAV1, ARHGAP32, SYNE1, GALNT10, LHFPL2, ABL2, LTBP1, COL4A1, DPY19L1, LPCAT2, TBC1D2B, LAMB1, AMIGO2, NREP, SNX30, TPM1, COL4A2, ARNTL, MRC2, TGFBI, TVP23C, BHLHE40, SMAD7, ABLIM3, ZNF224, PODXL, TAGLN, VHL, EPHB2, EDN1, GTF2IP4, HPS4, SIPA1L1, PID1, NLGN2, LTBP4, TRMT13, IGF2BP3, RBPJ, MKL1, ZMYM5, EFCAB11, WDR66, NKX3-1, HMOX1, TYRO3, SDHAP1, FURIN, FAM43A, AGTRAP, KCTD11, ID2, FERMT1, MTND2P28, H2BFS, LFNG, HES1, or KIN.
In some embodiments, the VM gene module comprises, consists of, consists essentially of, or further comprises at least one, at least two, at least three, or four genes selected from ITGB1, LAMC2, COL4A1, and DAAM1.
In some embodiments, probes are labeled with two fluorescent dye molecules to form so-called “molecular beacons” (Tyagi, S. and Kramer, F. R. (1996) Nat. Biotechnol. 14:303-8). Such molecular beacons signal binding to a complementary nucleic acid sequence through relief of intramolecular fluorescence quenching between dyes bound to opposing ends on an oligonucleotide probe. The use of molecular beacons for genotyping has been described (Kostrikis, L. G. (1998) Science 279:1228-9) as has the use of multiple beacons simultaneously (Marras, S. A. (1999) Genet. Anal. 14:151-6). A quenching molecule is useful with a particular fluorophore if it has sufficient spectral overlap to substantially inhibit fluorescence of the fluorophore when the two are held proximal to one another, such as in a molecular beacon, or when attached to the ends of an oligonucleotide probe from about 1 to about 25 nucleotides.
Labeled probes also can be used in conjunction with amplification of a polymorphism. (Holland et al. (1991) Proc. Natl. Acad. Sci. 88: 7276-7280). U.S. Pat. No. 5,210,015 by Gelfand et al. describe fluorescence-based approaches to provide real time measurements of amplification products during PCR. Such approaches have either employed intercalating dyes (such as ethidium bromide) to indicate the amount of double-stranded DNA present, or they have employed probes containing fluorescence-quencher pairs (also referred to as the “Taq-Man” approach) where the probe is cleaved during amplification to release a fluorescent molecule whose concentration is proportional to the amount of double-stranded DNA present. During amplification, the probe is digested by the nuclease activity of a polymerase when hybridized to the target sequence to cause the fluorescent molecule to be separated from the quencher molecule, thereby causing fluorescence from the reporter molecule to appear. The Taq-Man approach uses a probe containing a reporter molecule-quencher molecule pair that specifically anneals to a region of a target polynucleotide containing the polymorphism.
Probes can be affixed to surfaces for use as “gene chips.” Such gene chips can be used to detect genetic variations by a number of techniques known to one of skill in the art. In one technique, oligonucleotides are arrayed on a gene chip for determining the DNA sequence of a by the sequencing by hybridization approach, such as that outlined in U.S. Pat. Nos. 6,025,136 and 6,018,041. The probes of the invention also can be used for fluorescent detection of a genetic sequence. Such techniques have been described, for example, in U.S. Pat. Nos. 5,968,740 and 5,858,659. A probe also can be affixed to an electrode surface for the electrochemical detection of nucleic acid sequences such as described by Kayyem et al. U.S. Pat. No. 5,952,172 and by Kelley, S. O. et al. (1999) Nucleic Acids Res. 27:4830-4837.
In addition to methods which focus primarily on the detection of one nucleic acid sequence, profiles can also be assessed in such detection schemes. Fingerprint profiles can be generated, for example, by utilizing a differential display procedure, Northern analysis and/or RT-PCR.
In some detection methods, it is necessary to first amplify at least a portion of the VM gene module (i.e. the genes of interest) prior to identifying the expression level of the genes. Amplification can be performed, e.g., by PCR and/or LCR, according to methods known in the art. In one embodiment, genomic DNA of a sample (e.g. at least one cell from a patient) is exposed to PCR primers and amplification for a number of cycles sufficient to produce the required amount of amplified DNA.
Alternative amplification methods include: self-sustained sequence replication (Guatelli, J. C. et al., (1990) Proc. Natl. Acad. Sci. USA 87:1874-1878), transcriptional amplification system (Kwoh, D. Y. et al., (1989) Proc. Natl. Acad. Sci. USA 86:1173-1177), Q-Beta Replicase (Lizardi, P. M. et al., (1988) Bio/Technology 6:1197), or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques known to those of skill in the art. These detection schemes are useful for the detection of nucleic acid molecules if such molecules are present in very low numbers.
In some embodiments, any of a variety of sequencing reactions known in the art can be used to directly sequence at least a portion of the VM gene module (i.e. the genes of interest). Exemplary sequencing reactions include those based on techniques developed by Maxam and Gilbert ((1997) Proc. Natl. Acad Sci USA 74:560) or Sanger (Sanger et al. (1977) Proc. Nat. Acad. Sci. 74:5463). It is also contemplated that any of a variety of automated sequencing procedures can be utilized when performing the subject assays (Biotechniques (1995) 19:448), including sequencing by mass spectrometry (see, for example, U.S. Pat. No. 5,547,835 and international patent application Publication Number WO94/16101, entitled DNA Sequencing by Mass Spectrometry by H. Koster; U.S. Pat. No. 5,547,835 and international patent application Publication Number WO 94/21822 entitled “DNA Sequencing by Mass Spectrometry Via Exonuclease Degradation” by H. Koster; U.S. Pat. No. 5,605,798 and International Patent Application No. PCT/US96/03651 entitled DNA Diagnostics Based on Mass Spectrometry by H. Koster; Cohen et al. (1996) Adv. Chromat. 36:127-162; and Griffin et al. (1993) Appl Biochem Bio. 38:147-159). It will be evident to one skilled in the art that, for certain embodiments, the occurrence of only one, two or three of the nucleic acid bases need be determined in the sequencing reaction. For instance, A-track or the like, e.g., where only one nucleotide is detected, can be carried out.
Yet other sequencing methods are disclosed, e.g., in U.S. Pat. No. 5,580,732 entitled “Method Of DNA Sequencing Employing A Mixed DNA-Polymer Chain Probe” and U.S. Pat. No. 5,571,676 entitled “Method For Mismatch-Directed In Vitro DNA Sequencing”.
In some embodiments, the gene expression level is determined by a method comprising determining the amount of an mRNA transcribed from the one or more genes of the VM gene module. In some embodiments, the gene expression level is determined by a method comprising, consisting of, or consisting essentially of one or more of in situ hybridization, northern blot, PCR, quantitative PCR, RNA-seq, or microarray. In some embodiments, the change in expression of the genes in the VM gene module is increased compared to the predetermined reference level.
In some embodiments, the sample is a tumor sample. In some embodiments, the tumor sample is at least one of a fixed tissue, a frozen tissue, a biopsy tissue, a circulating tumor cell liquid biopsy, a resection tissue, a microdissected tissue, or a combination thereof. In particular embodiments, the sample is a biopsy tissue sample or a circulating tumor cell liquid biopsy sample.
In some embodiments, the subject has been diagnosed with cancer. In some embodiments, the cancer is a stage I or stage II cancer. In some embodiments, the cancer is selected from breast cancer, glioma, cervical squamous cell carcinoma, endocervical adenocarcinoma, lung adenocarcinoma, kidney renal clear cell carcinoma, and pancreatic adenocarcinoma.
In some embodiments, the method further comprises the step of culturing the sample in a high density 3D collagen culture system and determining the sample's migration capacity. In some embodiments, the method further comprises administering a cancer treatment comprising chemotherapy, that is optionally an aggressive treatment, and/or radiation therapy.
In some embodiments, the subject is a mammal. In some embodiments, the subject is an equine, bovine, canine, feline, murine, or a human. In a particular embodiment, the subject is a human.
Disclosed herein are methods for diagnostic and prognostic evaluation of cancer. Also disclosed are methods of treating cancer. In one aspect, the expression of genes are determined in different subjects for which either diagnosis or prognosis information is desired, in order to provide cancer profiles.
Within the sample, different expression profiles may be indicative of different prognosis states (i.e. good long term survival prospects or poor long term survival prospects, for example). By comparing profiles of cancer tissue in different states, information regarding which genes are important (including both up- and down-regulation of genes of interest) in each of these states is obtained. The identification of sequences that are differentially expressed in cancer tissue, as well as differential expression resulting in different prognostic outcomes is clinically invaluable for determining patient treatment.
Accordingly, in some embodiments, the disclosed methods comprise determining or predicting a patient's prognosis (e.g., 5-year survival) or likelihood of metastasis by detect the expression levels of at least a subset of genes of interest in the disclosed VM module. Increased expression of at least subset of these genes is indicative of a decreased chance of survival, an increased likelihood of metastasis, and overall aggressive disease. Up-regulation or increased expression of the genes in the gene module can be relative to a defined control level. The control level may be determined by detecting expression levels of the genes in a non-cancerous sample from the patient or based on expression data in the general population. The subset of genes may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70 of the genes in the disclosed VM module (see
While the methods may be used to determine prognosis or risk of metastasis of all subject or cancer patients, the disclosed methods are particularly useful for predicting prognosis or risk of metastasis of patient with stage I or stage II cancers. Average accuracy for VM phenotype prediction need not be 100% in order to provide clinical benefit. For instance, subtype prediction may be 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% accurate.
Moreover, the disclosed methods may also comprise determining the pore size of the collagen in a tumor and the expression level of β1 integrin, as a small pore size and increased β1 integrin expression are also indicative of poor prognosis.
Furthermore, the disclosed methods are applicable to all types of cancer. In particular, the disclosed methods are predictive of patient prognosis in patients with breast cancer, glioma, cervical squamous cell carcinoma, endocervical adenocarcinoma, lung adenocarcinoma, kidney renal clear cell carcinoma, and pancreatic adenocarcinoma.
In some embodiments, the disclosed methods comprise determining the VM phenotype of a cell by detecting at least a subset of genes in the VM gene module. For instance, the subset may be about 30, 35, 40, 45, 50, 55, 60, 65, or 70 genes of interest, or a sufficient number of genes to predict the phenotype of the cell.
The disclosure further provides diagnostic, prognostic and therapeutic methods, which are based, at least in part, on determination of the expression of one or more genes of the VM module identified herein.
For example, information obtained using the diagnostic assays described herein is useful for determining if a subject is suitable for cancer treatment of a given type. Based on the prognostic information, a doctor can recommend a therapeutic protocol, useful for reducing the malignant mass or tumor in the patient or treat cancer in the individual.
A patient's likely clinical outcome can be expressed in relative terms. For example, a patient having a particular expression level can experience relatively shorter overall survival than a patient or patients not having the expression level. The patient having the particular expression level, alternatively, can be considered as likely to have poor prognosis. Similarly, a patient having a particular expression level can experience relatively shorter progression free survival, or time to tumor progression, than a patient or patients not having the expression level. The patient having the particular expression level, alternatively, can be considered as likely to suffer metastasis and/or tumor progression. Further, a patient having a particular expression level can experience relatively shorter time to tumor recurrence than a patient or patients not having the expression level. The patient having the particular expression level, alternatively, can be considered as likely to suffer tumor recurrence. Yet in another example, a patient or tumor sample having a particular expression level can experience relatively more complete response or partial response than a tumor, subject, patient or patients not having the expression level. The patient having the particular expression level, alternatively, can be considered as likely to respond.
It is to be understood that information obtained using the diagnostic assays described herein can be used alone or in combination with other information, such as, but not limited to, genotypes or expression levels of other genes, clinical chemical parameters, histopathological parameters, or age, gender and weight of the subject. When used alone, the information obtained using the diagnostic assays described herein is useful in determining or identifying the clinical outcome of a treatment, selecting a patient for a treatment, or treating a patient, etc. When used in combination with other information, on the other hand, the information obtained using the diagnostic assays described herein is useful in aiding in the determination or identification of clinical outcome of a treatment, aiding in the selection of a patient for a treatment, or aiding in the treatment of a patient and etc. In a particular aspect, the genotypes or expression levels of one or more genes as disclosed herein are used in a panel of genes, each of which contributes to the final diagnosis, prognosis or treatment.
The methods are useful in the assistance of an animal, a mammal or yet further a human patient. For the purpose of illustration only, a mammal includes but is not limited to a human, a simian, a murine, a bovine, an equine, a porcine or an ovine subject.
In some embodiments, the disclosure provides for kits for amplifying and/or determining the expression of at least a portion of the VM biomarkers. The kits may comprise probes or primers capable of hybridizing to the genes of interest and instructions for use, while in some embodiments the kits may comprise an array comprising the genes of interest.
The kits comprise one of more of the compositions described above and instructions for use. A kit may comprise oligonucleotides for amplifying and/or detecting the genes of the VM module. Oligonucleotides “specific for” a gene of interest may bind either to the gene locus or bind adjacent to the gene locus. For oligonucleotides that are to be used as primers for amplification, primers are adjacent if they are sufficiently close to be used to produce a polynucleotide comprising the polymorphic region. In one embodiment, oligonucleotides are adjacent if they bind within about 1-2 kb, and preferably less than 1 kb from the gene of interest. Specific oligonucleotides are capable of hybridizing to a sequence, and under suitable conditions will not bind to a sequence differing by a single nucleotide.
In some embodiments, the kit can comprise at least one probe or primer which is capable of specifically hybridizing to the polymorphic region of the gene of interest and instructions for use. The kits preferably comprise at least one of the above described nucleic acids. Preferred kits for amplifying at least a portion of the genes of interest comprise two primers. Such kits are suitable for detection of the VM gene module by, for example, fluorescence detection, by electrochemical detection, or by other detection.
Oligonucleotides, whether used as probes or primers, contained in a kit can be detectably labeled. Labels can be detected either directly, for example for fluorescent labels, or indirectly. Indirect detection can include any detection method known to one of skill in the art, including biotin-avidin interactions, antibody binding and the like. Fluorescently labeled oligonucleotides also can contain a quenching molecule. Oligonucleotides can be bound to a surface. In one embodiment, the preferred surface is silica or glass. In another embodiment, the surface is a metal electrode.
Yet other kits of the invention comprise at least one reagent necessary to perform the assay. For example, the kit can comprise an enzyme. Alternatively the kit can comprise a buffer or any other necessary reagent.
Conditions for incubating a nucleic acid probe with a test sample depend on the format employed in the assay, the detection methods used, and the type and nature of the nucleic acid probe used in the assay. One skilled in the art will recognize that any one of the commonly available hybridization, amplification or immunological assay formats can readily be adapted to employ the nucleic acid probes for use in the present invention. Examples of such assays can be found in Chard, T. (1986) “An Introduction to Radioimmunoassay and Related Techniques” Elsevier Science Publishers, Amsterdam, The Netherlands; Bullock, G. R. et al., “Techniques in Immunocytochemistry” Academic Press, Orlando, Fla. Vol. 1 (1982), Vol. 2 (1983), Vol. 3 (1985); Tijssen, P., (1985) “Practice and Theory of Immunoassays: Laboratory Techniques in Biochemistry and Molecular Biology”, Elsevier Science Publishers, Amsterdam, The Netherlands.
The test samples used in the diagnostic kits include cells, protein or membrane extracts of cells, or biological fluids such as sputum, blood, serum, plasma, or urine. The test sample used in the above-described method will vary based on the assay format, nature of the detection method and the tissues, cells or extracts used as the sample to be assayed. Methods for preparing protein extracts or membrane extracts of cells are known in the art and can be readily adapted in order to obtain a sample which is compatible with the system utilized.
The kits can include all or some of the positive controls, negative controls, reagents, primers, sequencing markers, probes and antibodies described herein for determining the subject's genotype in the polymorphic region of the gene of interest.
As amenable, these suggested kit components may be packaged in a manner customary for use by those of skill in the art. For example, these suggested kit components may be provided in solution or as a liquid dispersion or the like.
This disclosure utilizes experimentally observed indicia of cancer metastasis including: high density collagen promotes persistent migration in cancer cells; increased in invasion persistence occurs after cell division in high density collagen, but not in low density; and post division polarization initiates migration consistent with tubular structure formation. Detection of any of these indicia may be incorporated into a kit or used in the disclosed methods.
In another aspect, provided herein is a method of determining the migration capacity of a tumor comprising tumor cells, the method comprising, consisting of, or consisting essentially of: culturing a tumor sample embedded in a 3D collagen matrix, wherein the tumor sample was isolated from a subject; and determining the migration capacity of the tumor sample by tracking motility of the tumor cells in the 3D collagen matrix. As used herein, a tumor sample embedded in a 3D matrix refers to a condition where the sample is fully embedded, in contact with matrix components on all sides, and located a sufficient distance away from the bottom and sides of the container (e.g. culture dish or coverslip bottom) to avoid their influence.
Collagen is a structural protein that is generally found in connective tissue and the extracellular space of animals. Collagen is classified into several types including but not limited to type I (e.g. COL1A1 (Entrez gene: 1277, UniProt: P02452); COL1A2 (Entrez gene: 1278, UniProt: P08123)), type II (e.g. COL2A1 (Entrez gene: 1280, UniProt: P02458)), type III (e.g. COL3A1 (Entrez gene: 1281, UniProt: P02461)), type IV (basement membrane collagen, e.g. COL4A1 (Entrez gene: 1282, UniProt: P02462), COL4A2 (Entrez gene: 1284, UniProt: P08572), COL4A3 (Entrez gene: 1285, UniProt: Q01955), COL4A4 (Entrez gene: 1286, UniProt: P53420), COL4A5 (Entrez gene: 1287, UniProt: P29400), COL4A6 (Entrez gene: 1288, UniProt: Q14031)), type V (e.g. COL5A1 (Entrez gene: 1289, UniProt: P20908), COL5A2 (Entrez gene: 1290, UniProt: P05997), COL5A3 (Entrez gene: 5059, UniProt: P25940)), type VI (e.g. COL6A1 (Entrez gene: 1291, UniProt: P12109), COL6A2 (Entrez gene: 1292, UniProt: P12110), COL6A3 (Entrez gene: 1293, UniProt: P12111), COL6A5 (Entrez gene: 256076, UniProt: PA8TX70, HOY935)), type VII (e.g. COL7A1 (Entrez gene: 1294, UniProt: Q02388)), type VIII (e.g. COL8A1 (Entrez gene: 1295, UniProt: P27658), COL8A2 (Entrez gene: 1296, UniProt: P25067, Q4VAQ0)), type IX (e.g. COL9A1 (Entrez gene: 1297, UniProt: P20908), COL9A2 (Entrez gene: 1290, UniProt: P05997), COL9A3 (Entrez gene: 5059, UniProt: P25940)), type X (e.g. COL10A1 (Entrez gene: 1300, UniProt: A03692)), type XI (e.g. COL11A1 (Entrez gene: 1301, UniProt: P12107), COL11A2 (Entrez gene: 1302, UniProt: P13942)), type XII (e.g. COL12A1 (Entrez gene: 1303, UniProt: Q99715)), or type XIII (e.g. COL10A1 (Entrez gene: 1300, UniProt: A03692). In particular embodiments, the collagen is type IV collagen. Collagens are available from, for example, Sigma Aldrich, St. Louis, Missouri, U.S.A. (e.g. CAS #9007-34-5, cat. #: C6745).
In some embodiments, the 3D collagen matrix comprises a high density of collagen. In some embodiments, the collagen density is selected from the group of: from about 4 mg/mL to about 10 mg/mL, from about 4 mg/mL to about 8 mg/mL, or from about 4 mg/mL to about 6 mg/mL. In a particular embodiment, the collagen density is about 6 mg/mL.
In some embodiments, the 3D collagen matrix comprises, consists of, or consists essentially of a median fiber length less than or equal to 9.5 μm, less than or equal to 9 μm, less than or equal to 8.5 μm, less than or equal to 8 μm, less than or equal to 7.5 μm, less than or equal to 7 μm less than or equal to 6.5 μm, less than or equal to 6 μm, less than or equal to 5.5 μm, less than or equal to 5 μm, or less than or equal to 4.5 μm.
In some embodiments, the 3D collagen matrix comprises, consists of, or consists essentially of a median pore size less than or equal to 10 μm, less than or equal to 9.5 μm, less than or equal to 9 μm, less than or equal to 8.5 μm, less than or equal to 8 μm, less than or equal to 7.5 μm, less than or equal to 7 μm less than or equal to 6.5 μm, less than or equal to 6 μm, less than or equal to 5.5 μm, less than or equal to 5 μm, less than or equal to 4.5 μm, less than or equal to 4 μm, less than or equal to 3.5 μm, or less than or equal to 3.5 μm.
In some embodiments, the 3D collagen matrix further comprises a molecular crowding agent. Nonlimiting examples include one or more of: polyethylene glycol (e.g., PEG1450, PEG3000, PEG8000, PEG10000, PEG14000, PEG15000, PEG20000, PEG250000, PEG30000, PEG35000, PEG40000, PEG compound with molecular weight between 15,000 and 20,000 daltons, or combinations thereof), polyvinyl alcohol, dextran and ficoll. In some embodiments, the crowding agent is present in the reaction mixture at a concentration between 1 to 12% by weight or by volume of the matrix, e.g., between any two concentration values selected from 1.0%, 1.5%, 2.0%, 2.5%, 3.0%, 3.5%, 4.0%, 4.5%, 5.0%, 5.5%, 6.0%, 6.5%, 7.0%, 7.5%, 8.0%, 8.5%, 9.0%, 9.5%, 10.0%, 10.5%, 11.0%, 11.5%, and 12.0%. In a particular embodiment, the molecular crowding agent is polyethylene glycol (PEG).
In particular embodiments, the 3D collagen matrix comprises, consists of, or consists essentially of about 2 mg/mL to about 6 mg/mL collagen and at least 4 mg/mL PEG. In a particular embodiment, the 3D collagen matrix comprises 2.5 mg/mL collagen and 6 mg/mL PEG.
In some embodiments, motility is tracked by imaging the embedded tumor sample. The tumor sample may be imaged by any method known in the art including, but not limited to, microscopy, confocal microscopy, optical coherence tomography, multiphoton microscopy, time lapse microscopy, live microscopy, and video microscopy. Additional methods of imaging 3D cultures are described in Graf, B. and Boppart, S. Methods Mol. Biol. (2010) 591: 211-27. In some embodiments, the embedded tumor sample is imaged at least once per day. In other embodiments, the embedded tumor sample is imaged at least once every two days. In other embodiments, the embedded tumor sample is imaged at least once every three days. In some embodiments, at least one image of the embedded tumor sample is analyzed to characterize tumor cell migration and/or motility. In some embodiments, the image is analyzed using an image processing algorithm.
In some embodiments, the method further comprises determining an invasion distance of a tumor cell, quantifying network structures formed by the tumor cells, determining the length of network structures formed by the tumor cells, and or/determining the shape of a tumor cell.
In some embodiments, the method further comprises determining a gene expression level of one or more genes of a VM gene module in the tumor sample as described herein.
In some embodiments, the tumor sample is a biopsy tissue sample or a circulating tumor cell liquid biopsy sample.
In another aspect, provided herein is a method of screening a tumor for sensitivity to a drug, the method comprising, consisting of, or consisting essentially of: culturing a tumor sample embedded in a 3D collagen matrix comprising one or more drugs; and screening the tumor sample for sensitivity to the drug by determining the viability of the tumor sample. The drug may comprise any known or suspected cancer therapeutic including but not limited to the cancer therapeutics described herein.
The concentration of the drug in the 3D collagen matrix ranges from about 1 mM to about 100 mM, about 1 mM to about 50 mM, about 1 mM to about 40 mM, about 1 mM to about 30 mM, about 1 mM to about 25 mM, about 1 mM to about 20 mM, about 1 mM to about 15 mM, about 1 mM to about 10 mM, about 1 mM to about 9 mM, about 1 mM to about 8 mM, about 1 mM to about 7 mM, about 1 mM to about 6 mM, about 1 mM to about 5 mM, about 1 mM to about 2 mM, about 3 mM to about 50 mM, about 3 mM to about 30 mM, about 3 mM to about 25 mM, about 3 mM to about 20 mM, about 3 mM to about 15 mM, about 3 mM to about 10 mM, about 3 mM to about 9 mM, about 3 mM to about 8 mM, about 3 mM to about 7 mM, about 3 mM to about 6 mM, about 3 mM to about 5 mM, about 6 mM to about 50 mM, about 6 mM to about 30 mM, about 6 mM to about 25 mM, about 6 mM to about 15 mM, or about 6 mM to about 10 mM. Alternatively, the concentration of the drug ranges from about 10 μM from about 1 μM to about 100 μM, about 1 μM to about 50 μM, about 1 μM to about 40 μM, about 1 μM to about 30 μM, about 1 μM to about 25 μM, about 1 μM to about 20 μM, about 1 μM to about 15 M, about 1 μM to about 10 μM, about 1 μM to about 9 μM, about 1 μM to about 8 μM, about 1 M to about 7 μM, about 1 μM to about 6 μM, about 1 μM to about 5 μM, about 1 μM to about 2 M, about 3 μM to about 50 μM, about 3 μM to about 30 μM, about 3 μM to about 25 μM, about 3 μM to about 20 μM, about 3 μM to about 15 μM, about 3 μM to about 10 μm, about 3 μM to about 9 μM, about 3 μM to about 8 μM, about 3 μM to about 7 μM, about 3 μM to about 6 μM, about 3 μM to about 5 μM, about 6 μM to about 50 μM, about 6 μM to about 30 μM, about 6 μM to about 25 μM, about 6 μM to about 15 μM, or about 6 μM to about 10 μM. Alternatively, the concentration of the drug ranges from about 1 nM to about 100 nM, about 1 nM to about 50 nM, about 1 nM to about 40 nM, about 1 nM to about 30 nM, about 1 nM to about 25 nM, about 1 nM to about 20 nM, about 1 nM to about 15 nM, about 1 nM to about 10 nM, about 1 nM to about 9 nM, about 1 nM to about 8 nM, about 1 nM to about 7 nM, about 1 nM to about 6 nM, about 1 nM to about 5 nM, about 1 nM to about 2 nM, about 3 nM to about 50 nM, about 3 nM to about 30 nM, about 3 nM to about 25 nM, about 3 nM to about 20 nM, about about 3 nM to about 15 nM, about 3 nM to about 10 nM, about 3 nM to about 9 nM, about 3 nM to about 8 nM, about 3 nM to about 7 nM, about 3 nM to about 6 nM, about 3 nM to about 5 nM, about 6 nM to about 50 nM, about 6 nM to about 30 nM, about 6 nM to about 25 nM, about 6 nM to about 15 nM, or about 6 nM to about 10 nM.
Tumor viability may be detected by any method known in the art including but not limited to staining with trypan blue, staining with annexin, determining viability by light microscopy, refraction, and cell morphology, flow cytometry, dye uptake, and commercially available viability kits such as the LIVE/DEAD™ Viability/Cytotoxicity Kit for mammalian cells (available from Thermo Fisher Scientific, Cat #L3224).
In another aspect, provided herein is a culture system comprising, consisting of, or consisting essentially of cells embedded in a high density 3D collagen matrix. In some embodiments, the 3D collagen matrix comprises a high density of collagen. In some embodiments, the collagen density is selected from the group of: from about 4 mg/mL to about 10 mg/mL, from about 4 mg/mL to about 8 mg/mL, or from about 4 mg/mL to about 6 mg/mL. In a particular embodiment, the collagen density is about 6 mg/mL.
In some embodiments, the 3D collagen matrix comprises, consists of, or consists essentially of a median fiber length less than or equal to 9.5 μm, less than or equal to 9 μm, less than or equal to 8.5 μm, less than or equal to 8 μm, less than or equal to 7.5 μm, less than or equal to 7 μm less than or equal to 6.5 μm, less than or equal to 6 μm, less than or equal to 5.5 μm, less than or equal to 5 μm, or less than or equal to 4.5 μm.
In some embodiments, the 3D collagen matrix comprises, consists of, or consists essentially of a median pore size less than or equal to 10 μm, less than or equal to 9.5 μm, less than or equal to 9 μm, less than or equal to 8.5 μm, less than or equal to 8 μm, less than or equal to 7.5 μm, less than or equal to 7 μm less than or equal to 6.5 μm, less than or equal to 6 μm, less than or equal to 5.5 μm, less than or equal to 5 μm, less than or equal to 4.5 μm, less than or equal to 4 μm, less than or equal to 3.5 μm, or less than or equal to 3.5 μm.
In some embodiments, the 3D collagen matrix further comprises a molecular crowding agent. Nonlimiting examples include one or more of: polyethylene glycol (e.g., PEG1450, PEG3000, PEG8000, PEG10000, PEG14000, PEG15000, PEG20000, PEG250000, PEG30000, PEG35000, PEG40000, PEG compound with molecular weight between 15,000 and 20,000 daltons, or combinations thereof), polyvinyl alcohol, dextran and ficoll. In some embodiments, the crowding agent is present in the reaction mixture at a concentration between 1 to 12% by weight or by volume of the matrix, e.g., between any two concentration values selected from 1.0%, 1.5%, 2.0%, 2.5%, 3.0%, 3.5%, 4.0%, 4.5%, 5.0%, 5.5%, 6.0%, 6.5%, 7.0%, 7.5%, 8.0%, 8.5%, 9.0%, 9.5%, 10.0%, 10.5%, 11.0%, 11.5%, and 12.0%. In a particular embodiment, the molecular crowding agent is polyethylene glycol (PEG).
One skilled in the art readily appreciates that the present disclosure is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. Modifications therein and other uses will occur to those skilled in the art. These modifications are encompassed within the spirit of the disclosure and are defined by the scope of the claims.
All patents and publications mentioned in the specification are indicative of the levels of those of ordinary skill in the art to which the disclosure pertains. All patents and publications are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.
The disclosure illustratively described herein suitably may be practiced in the absence of any element or elements, limitation or limitations which is not specifically disclosed herein. Thus, for example, in each instance herein any of the terms “comprising”, “consisting essentially of” and “consisting of” may be replaced with either of the other two terms. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention that in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of that claimed. Thus, it should be understood that although the present disclosure has been specifically disclosed by preferred embodiments and optional features, modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this disclosure as defined by the appended claims.
Other features and advantages of will be apparent to those of skill in the art from the following examples and claims. For instance, commercial applications of the disclosed methods and kits include a personalized medicine diagnostic tool for cancer patients, which takes into account the molecular makeup of the tumor and can help differentiate aggressive from indolent disease.
Particular embodiments of the disclosure further described by reference to the following examples, which are provided for illustration only. The present disclosure is not limited to the examples, but rather includes all variations that are evident from the teachings provided herein.
The tumor microenvironment is heterogeneous from both a cellular and an extracellular matrix (ECM) perspective. Regions of dense, stiff, or aligned collagen fibers have each been implicated in locally driving aggressive tumor cell migration behaviors that are thought to contribute to metastatic progression. Cell-to-cell differences in innate migration and metastatic capabilities have also been described. However, it remains unclear how intrinsic tumor cell factors and extrinsic ECM factors work together to promote the emergence of distinct migration phenotypes, and whether some migration phenotypes contribute more to metastasis than others. To probe the extrinsic basis of cancer cell migration regulation, MDA-MB-231 breast cancer and HT1080 fibrosarcoma cells were embedded within engineered 3D collagen matrices of varying architectures and used high throughput time-lapse microscopy to monitor single cancer cell migration. A collagen matrix architecture defined by small pores and short fibers was identified that gives rise to two subpopulations of breast cancer cells wherein migration is differentially regulated. In this matrix architecture, the majority of cells adopted a rapid, persistent migration behavior while the minority population migrated slowly and randomly. After seven days, rapidly migrating cells organized into long interconnected networks coated with basement membrane, a phenotype known as vascular mimicry (VM). In contrast, cells undergoing slow migration formed spheroids. The network-forming versus spheroid-forming migration response was not mediated by hypoxia or matrix stiffness, but rather matrix architecture and β1 integrin expression. Fibrosarcoma cells also displayed the network-forming phenotype. In both breast and fibrosarcoma cells, this phenotype was associated with the upregulation of a conserved transcriptional program enriched for genes involved in vascular development and regulation of cell migration. This gene module was predictive of poor survival in multiple human tumor transcriptome datasets. Thus, the engineered 3D collagen model system revealed that VM arises from a cancer cell-intrinsic transcriptional and migratory response triggered by 3D collagen architecture through integrin β1 and represents a unique system for studying the migration behavior underlying VM. Furthermore, these analyses suggest that matrix-induced VM migration may be broadly relevant as a driver of metastatic progression in solid human cancers.
To investigate the role of the 3D collagen microenvironment on the migration phenotype of breast cancer cells, MDA-MB-231 cells were embedded in collagen I matrices of varying densities mimicking normal breast tissue, 2.5 mg/mL collagen, and cancerous breast tissue, 6 mg/mL collagen. Long-term time-lapse microscopy was used to monitor the migration response of single cells in these conditions. Analysis of the invasion distance of individual cells revealed that cells embedded in the high density environment displayed two distinct phenotypes. Some of the cells moved less than 1 cell length (characteristic cell length taken as 50 m) from their initial position while the remaining cells invaded to distances up to 7 cell lengths over the course of 48 hrs (
Without being bound by theory, ECM structural heterogeneity could be responsible for the observed migration heterogeneity in high density but not low density collagen. To assess structural heterogeneity, matrix pore sizes were measured in each condition by analysis of confocal reflection imaging of collagen fibers. Interestingly, pore size distributions in the high density matrix were more homogeneous than in the low density matrix (
The motility responses observed in 2.5 and 6 mg/mL collagen matrices were not unique to MDA-MB-231 breast cancer cells. Similar migration patterns were observed for HT-1080 fibrosarcoma cells embedded in the same collagen matrix conditions (
That both MDA-MB-231 and HT-1080 cancer cells migrated faster and further in high density collagen conditions was unexpected. Intuitively, cell migration would be expected to slow in dense conditions where more matrix must be remodeled to enable cell movement. Moreover, this behavior was common to both cancer cell types but not displayed by normal fibroblasts, which represent residents of the tumor stroma and also undergo mesenchymal migration in collagen. The long-term implications of the rapid migration phenotype induced in cancer cells under high density conditions was investigated. After one week of culture in high density collagen, breast cancer cells undergoing rapid and persistent migration formed branched network structures that resembled the early stages of endothelial tubulogenesis (
Without being bound by theory, the persistent migration phenotype of cancer cells in high density conditions leading to network formation could be the result of a cancer-specific transcriptional response that activates unique cell motility pathways. To test this, RNA sequencing was conducted on MDA-MB-231, HT-1080, and HFF cells cultured in low and high density collagen matrices after 24 hours, the time point where most cancer cells in the high density collagen matrix had undergone at least one cycle of cell division and had begun to invade with increase persistence (
Further exploration of the datasets for individual cancer cell types revealed that, while some aspects of the VM transcriptional response were conserved, high density collagen also triggered the expression of genes related to vasculogenesis in a cell type dependent manner. For example, several additional genes previously implicated in VM were upregulated in breast cancer cells only (e.g. VEGFA Fold change=1.65, MMP2 Fold change=2.24), not in fibrosarcoma cells undergoing VM. A full list is shown. Interestingly, thirty-five genes were upregulated in response to high density collagen by all three cell types (
In human tumor biopsies, vessel-like structures that stain positively for basement membrane molecules but not for the endothelial marker CD31 have been associated with the phenomenon of VM. Without being bound by theory, it is believed that the high density 3D culture condition induces network-forming cells to undergo a form of MEndoT and that the 70 common-to-cancer genes identified were a signature of VM. Moreover, this transdifferentiation is induced by a feature of the high density 3D collagen culture condition that differed from the low density culture condition. Next, the matrix feature triggering transdifferentiation was identified including the physical parameters of stiffness, pore size, and fiber organization which differ between the 2.5 and 6 mg/mL collagen matrices. Without being bound by theory, chemical cues may also change. For example, adhesive ligand density and binding site-presentation to integrins and other matrix receptors may differ. Each of these features could potentially impact cancer cell motility behavior and gene expression.
To determine whether increased stiffness of the high density collagen matrix14 was responsible for triggering transdifferentiation, a collagen polymerization procedure was developed that enhanced the stiffness of the low density matrix to match the stiffness of the high density matrix (
Next it was determined whether the smaller pore size of the high density matrices triggered transdifferentiation. Without being bound by theory, one way in which smaller pore sizes could influence cell behavior is by restricting the diffusion of molecules to and from the cells, including oxygen. Since regions of VM have previously been associated with markers of hypoxia in vivo, without being bound by theory, it is believed that high density collagen created a more hypoxic condition than low density collagen and that a lack of oxygen triggered susceptible cells to undergo VM. To test this, MDA-MB-231 cells were cultured in low density collagen under hypoxic conditions of 1% oxygen for one week. To confirm that a hypoxic response was achieved, the level of HIF1A mRNA expression was assessed by RT-qPCR. It was found that 7-day culture caused a significant decrease in HIF1A expression (
To further explore whether pore size reduction induced transdifferentiation of cancer cells, this parameter was interrogated independently of collagen density. In this model, the high density condition contains 2.4 times more collagen than the low density condition. This increase in total collagen reduces pore size, but also presents more adhesive ligands to cells, which could increase integrin activation. To separate pore size from bulk density, a collagen structure engineering technique was developed that reduced the pore size and fiber length of the low density matrix to approximate that of the high density matrix. Under normal polymerization conditions, low density collagen self-assembles into relatively long, structured fibers. When non-functionalized, inert polyethylene glycol (PEG) was mixed into collagen monomer solution prior to polymerization, molecular crowding restricted fiber formation. This resulted in shorter, more interconnected fibers yielding smaller pores (
Confinement of cells in matrices with small pores could trigger VM transdifferentiation by limiting diffusion and thereby increasing autocrine signaling events. Short, homogeneously spaced fibers could also alter local collagen-cell interactions. Since R31 integrin (ITGB1) is a canonical receptor for collagen I and a central node in the ECM signal transduction pathway, without being bound by theory it was hypothesized that the expression level mediated the cellular response to confining collagen matrices. CRISPR-Cas9 technology was used to silence ITGB1 expression with single guide RNAs (sgRNAs) (sg_ITGB1,
To determine if the VM transdifferentiation triggered by the 3D collagen system was clinically relevant, the 70 common-to-cancer genes associated with VM in vitro were assayed to determine if they could predict cancer patient prognosis. Without being bound by theory, it was anticipated that if this gene signature is indicative of a more metastatic cancer cell migration phenotype, its expression would correlate with poor patient outcomes. Since late stage tumors are already characterized by migration of tumor cells to distant lymph nodes or organs, a VM associated gene signature would correlate with prognosis in early (Stage I & II) but not late (Stage III & IV) stage tumors. Using the cancer genome atlas (TCGA), data was first analyzed for breast cancer patients with respect to the expression of the VM signature. An expression metagene was constructed using the loadings of the first principal component (PC1) of a 195 Stage I patient by 70 gene matrix (VM PC1) (
This example describes a 3D in vitro model system designed to probe the physical basis of cancer cell migration responses to collagen matrix organization. Using this system, it was discovered that confining matrix architectures induced two distinct migration behaviors in breast cancer cells leading to spheroid formation or VM network formation. This the first identified physical driver of VM induction. ITGB1 modulated these migration responses and subsequent superstructure formation. Moreover, VM network formation was associated with a conserved transcriptional response used by multiple cancer cell types and that was predictive of patient survival in six clinical tumor datasets. These are the first identified core molecular markers of VM. Thus, without being bound by theory, these findings link a matrix-induced 3D migration phenotype and gene expression program to a clinical tumor cell phenotype driving blood borne metastasis.
Cell culture. HT-1080 and HFF-1 were purchased from (ATCC, Manassas, VA) MDA-MB-231 cells were provided by Adam Engler (UCSD Bioengineering). All cell lines were cultured in high glucose Dulbecco's modified Eagle's medium supplemented with 10% (v/v) fetal bovine serum (FBS, Corning, Corning, NY) and 0.1% gentamicin (Gibco Thermofisher, Waltham, MA) and maintained at 37° C. and 5% CO2 in a humidified environment during culture and imaging. The cells were passaged every 2-3 days. Cell culture under hypoxia was done on a humidified and temperature controlled environment at 1% O2.
3D culture in collagen I matrix. Cells embedded in 3D collagen matrices were prepared by mixing cells suspended in culture medium and 10× reconstitution buffer, 1:1 (v/v), with soluble rat tail type I collagen in acetic acid (Corning, Corning, NY) to achieve the desired final concentration. 1 M NaOH was used to normalize pH in a volume proportional to collagen required at each tested concentration (pH 7.0, 10-20 μl 1 M NaOH), and the mixture was placed in 48 well culture plates and let polymerize at 37° C. Final gel volumes were 200 uL.
Cell tracking and motility analysis. Cells were embedded in 3D collagen matrices in 48 well plates and left polymerize for 1 hour in a standard tissue culture incubator and then 200 uL of complete growth medium were added on top of the gels. The gels were transferred to a microscope stage top incubator and cells were imaged at low magnification (X10) every 2 minutes for 48 h. Coordinates of the cell location at each time frame were determined by tracking single cells using image recognition software (Metamorph/Metavue, Molecular Devices, Sunnyvale, CA). Tracking data was processed using custom written python scripts based on previously published scripts to calculate cell speed, invasion distances and Mean Squared Displacements (MSDs). For cell motility analysis before and after division the time lapse videos were scanned to identify dividing cells within the imaging period and the division point was identified as the frame at which a clear separation could be identified between daughter cells. The dividing cell was tracked up to the division point and one of the daughter cells (randomly chosen) was tracked from that point until the 48 h time point. For collective cell invasion distance the 48 h time lapse video was processed to obtain the maximum intensity projection (MIP), which highlights the tracks taken by the cells/groups of cells. Individual tracks distinguishable in the MIP were measured to obtain an equivalent invasion distance. All cell tracking data comes from 3 independent experiments performed on different days and with different cell passages.
Persistence random walk model implementation. To quantify the differences in the mean squared displacement (MSDs) the MSDs were fitted for each condition using the persistent random walk model (PRW model) as described previously in the art. Briefly, the MSDs were calculated as in Equation 1. The Equation 2 describing the PWR was fitted using python's lmfit library for each MSD. The persistent time (parameter P) was then extracted to calculate differences between groups as presented in
MSD(τ)=(x(t+τ)−x(t))2+(y(t+τ)−y(t))
Equation 1.
Where x and y are que coordinates of the position of a cell at each time point and tau is the time lag.
Where, S is the cell speed and P is the persistence time and δ is a function of the error in the position of the cell as described previously in the art.
Collagen stiffness modification and measurement using shear rheology. To modify the stiffness of collagen matrices without increasing density of material, 2.5 mg/mL gels at 20° C. for 30 minutes were kept until they were fully polymerized. After the initial polymerization the gels were placed on a humidified tissue culture incubator at 37° C. for at least 1 hour extra before adding cell growth media on top. To measure the effect of polymerization temperature on the gel stiffness the polymerization conditions were recreated for rheology testing (hybrid rheometer (DHR-2) from TA Instruments, New Castle, DE) using a cone and plate geometry with a sample volume of 0.6 mL. Shear storage modulus G′ was measured as reported before. Briefly, a strain sweep was performed from 0.1% to 100% strain at a frequency of 1 rad/s to determine the elastic region. Then a frequency sweep was performed at a strain within the linear region (0.8%) between 0.1-100 rad/s. Three independent replicates were performed for each condition tested.
Collagen structure modification using Poly-Ethylene-Glycol. To modify the structure if the collagen fibers within the gels without changing the final collagen concentration, Polyethylene glycol (PEG, MW=8000, Sigma, St. Louis, MO) was solubilized in phosphate-buffered solution (PBS), filter sterilized. Solubilized PEG was then mixed into the cells, reconstitution buffer solution described above to produce a final PEG concentration of 10 mg/mL in the collagen gel. The gels were allowed to polymerized in the same conditions as collagen only gels. Collagen structure modification was verified using confocal reflection microscopy.
RNA Isolation and purification. 3D collagen I gels were seeded in three independent experiments and harvested after 24 hours of culture for RNA extraction and directly homogenized in Trizol reagent (Thermofisher, Waltham, MA). Total RNA was isolated following manufacturer's instructions. Isolated RNA was further purified using High Pure RNA Isolation Kit (ROCHE, Branford, CT). RNA integrity was verified using RNA Analysis ScreenTape (Agilent Technologies, La Jolla, CA) before sequencing.
RNA sequencing and data analysis. Biological triplicates of total RNA were prepared for sequencing using the TruSeq Stranded mRNA Sample Prep Kit (Illumina, San Diego, CA) and sequenced on the Illumina MiSeq platform at a depth of >25 million reads per sample. The read aligner Bowtie2 was used to build an index of the reference human genome hg19 UCSC and transcriptome. Paired-end reads were aligned to this index using Bowtie241 and streamed to eXpress42 for transcript abundance quantification using command line “bowtie2 -a - p 10 -x/hgl9 -1 reads_R1.fastq -2 reads_R2.fastq|express transcripts_hgl9.fasta”. For downstream analysis TPM was used as a measure of gene expression. A gene was considered detected if it had mean TPM>5.
Gene ontology term overrepresentation analysis. To assess the overrepresented GO terms the cytoscape app BiNGO was used. Statistical test used was hypergeometric test, Benjamini-Hochberg false discovery rate (FDR) correction was used to account for multiple tests and the significance level was set at 0.05.
HIF1A Gene expression using qPCR. For qPCR experiments RNA was extracted as stated above and cDNA was synthesized using superscript iii first-strand synthesis system (Thermofisher, Waltham, MA). Relative mRNA levels were quantified using predesigned TaqMan gene expression assays (Thermofisher, Waltham, MA). Relative expression was calculated using the DCt method using GAPDH as reference gene. Assays used were: GAPDH (Hs02758991_g1), HIF1A (Hs00153153_m1).
CRISPR Mediated gene Knock-out: The lentiCRISPR v2 was a gift from Feng Zhang (Addgene plasmid #52961). Small guide RNAs targeting the genes of interest were cloned into the lentiCRISPR v2 following Zhang's lab instructions. The sg_RNA sequences using were taken from the GECKO human library A44. Used sequences were: ITGB1 sg_RNA1 (5′-TGCTGTGTGTTTGCTCAAAC-3′) (SEQ ID NO.: 1), ITGB1 sg_RNA2 (5′-ATCTCCAGCAAAGTGAAACC-3′) (SEQ ID NO.: 2), EGFP sgRNA (5′-GGGCGAGGAGCTGTTCACCG-3′) (SEQ ID NO.: 3). The lentiCRISPR v2 vectors with the cloned desired sgRNA were sequence verified and viral particles were generated by transfecting into lentiX293T cells (Clonetech, Mountain View, CA. Cat #632180) along with packaging expressing plasmid (psPAX2, Addgene #12260) and envelope expressing plasmid (pMD2.G, Addgene #12259). Viral particles were collected at 48 h after transfection and they were purified by filtering through a 0.45 μm filter. Target cells were transduced with the viral particles in the presence of polybrene (Allele Biotechnology, San Diego, CA). After overnight incubation media was changed and cells were left 24h-48h in normal growth media and then changed to puromycin selection media (2.5 ug/mL puromycin) for 7 days before experiments were performed.
Immunofluorescence and cell imaging. For cell imaging after 7 days of culture to visualize VM structures collagen gels were fixed using 2 washes of 4% PFA for 30 mins each at room temperature. F-actin was stained using Alexa Fluor® 488 Phalloidin (Cell signaling technology, Danver, MA) and the nuclei were counterstained with DAPI. For immunofluorescence staining the gels were incubated with the primary antibody for 48 to 72 hours. Anti-COL4A1 (1:200 dilution, NB120-6586, novus biologicals).
Confocal reflection imaging and quantification: Confocal reflection images were acquired using a Leica SP5 confocal microscope (Buffalo Grove, IL) equipped with a HCX APO L 20×1.0 water immersion objective. The sample was excited at 488 nm and reflected light was collected without an emission filter. For the estimation of pore size, modification of a previously reported digital imaging processing technique was used. Briefly, the images were normalized to account for uneven illumination effects. Then a threshold was applied to generate a binary mask where pores were identified as the darkest areas of the image. Pore diameter was measured using NIS elements software (Nikon Instruments Inc., Melville, NY) measure objects tool.
Western blotting: Cells were grown to >90% confluency in 100 mm dishes. After washing 2× with PBS cells were collected into 100 uL of lysis buffer with 1× Halt protease inhibitor cocktail (Pierce IP lysis Buffer, Thermofisher, Waltham, MA) by thoroughly scraping the dish surface. Cell lysate was incubate in ice with constant shaking for 30 min and then centrifuged at 15,000×g for 20 for protein purification. Samples were loaded at 50 ug total protein concentration for SDS-PAGE. Membranes were probed with antibodies against ITGB1 (#4706 from Cell signaling technology, Danver, MA. 1:10000 dilution) and aTubulin (TU-01 MA1-19162, Thermofisher, Waltham, MA. 1:30000 dilution).
Experimental data analysis and statistics: All cell motility data was analyzed for statistical significance using the scipy python package. Experimental data in
TCGA data reprocessing and survival analysis: The TCGA raw data were downloaded from CGHub directly using gtdownload. Corresponding clinical metadata were obtained from the TCGA data portal (tcga423data.nci.nih.gov/docs/publications/tcga/). RNAseq fastq files were realigned and quantified using sailfish v.0.7.6 with default parameters. Only primary tumors were considered in the analysis. In the analysis of breast invasive carcinoma, only the patients with reported histological staining for the three markers (Her2, ER, PR) could be associated with a molecular subtype. Patients for which any of the histological markers were not evaluated or were detected at an equivocal level were assigned to an “unknown” subtype. TCGA data for Stage I, II, III and IV breast cancer patients was analyzed by Principal Component Analysis (PCA) with respect to the 70 VM genes to construct gene expression meta-markers as previously described47. PCA-based score quantiles were mapped to VM high and VM low categories based on mean VM gene expression levels. Because the VM signature comprised only genes that were upregulated in the presence of the VM phenotype, the overall mean expression of VM genes was used to map PCA score to VM signature activity level.
TCGA pan cancer analysis. Tumor types for which at least 100 patients had both expression and clinical metadata were analyzed to determine correlation between a VM gene expression and 5-year survival. Only primary tumors were considered. Kaplan-Meier analysis was performed comparing the 30% of individuals with the lowest VM expression score to the 30% with the highest score using the Lifelines python library (lifelines.readthedocs.io/en/latest/). The log rank test was used to determine significance of survival differences between groups.
The topographical organization of collagen within the tumor microenvironment has been implicated in modulating cancer cell migration and independently predicts progression to metastasis. This example shows that collagen matrices with small pores and short fibers, but not Matrigel, trigger a conserved transcriptional response and subsequent motility switch in cancer cells resulting in the formation of multicellular network structures. The response is not mediated by hypoxia, matrix stiffness, or bulk matrix density, but rather by matrix architecture-induced p 1 integrin upregulation. The transcriptional module associated with network formation is enriched for migration and vasculogenesis-associated genes that predict survival in patient data across nine distinct tumor types. Evidence of this gene module at the protein level is found in patient tumor slices displaying a vasculogenic mimicry (VM) phenotype. These findings link a collagen-induced migration program to VM and support the conclusion that this process is broadly relevant to metastatic progression in solid human cancers.
An initial step in cancer metastasis is the migration of tumor cells through the extracellular matrix (ECM) and into the lymphatic or vascular systems. Several features of the tumor ECM have been associated with progression to metastasis. In particular, regions of dense collagen are co-localized with aggressive tumor cell phenotypes in numerous solid tumors, including breast, ovarian, pancreatic, and brain cancers. However, sparse and aligned collagen fibers at the edges of tumors have also been reported to correlate with aggressive disease. It remains unclear whether and how collagen architectures play a role in driving metastatic migration programs or if they simply correlate with progression of the tumor.
Intravital microscopy studies have shown that distinct collagen architectures are associated with specific cell motility behaviors. Cancer cells migrating through densely packed collagen within the tumor use invadopodia and matrix metalloproteinase (MMP) activity to move, whereas cells in regions with less dense collagen and long, aligned fibers migrate rapidly using larger pseudopodial protrusions or MMP-independent amoeboid blebbing. Cell migration speed, invasion distance, and cellular protrusion dynamics are modulated by collagen fiber alignment, but that this relationship breaks down at high collagen densities (>2.5 mg mL−1). Without being bound by theory, these findings suggest that distinct motility regimes exist in low and high density collagen, which may have implications for metastatic progression.
The relationships between collagen density, collagen architecture, cell migration behavior, gene expression and metastatic potential were explored by developing a 3D in vitro model system designed to probe the physical basis of cancer cell migration responses to collagen matrix organization. Using this system, it was found that confining collagen matrix architectures with short fibers and small pores induced a conserved migration behavior in cancer cells leading to network formation and the upregulation of a conserved transcriptional module, both of which are mediated by integrin μ1 upregulation. Without being bound by theory, this evidence shows that this in vitro behavior is consistent with phenotypic and molecular features of clinical VM. Moreover, without being bound by theory, the evidence showed that the associated transcriptional response is conserved among cancer types in vitro and is predictive of patient survival in multiple clinical datasets for various tumor types. This integrative study supports the conclusion that a collagen induced migration phenotype and gene expression program are linked to a metastatic clinical tumor cell phenotype.
To first investigate the role of 3D collagen density in modulating the migration phenotype of breast cancer cells, MDA-MB-231 cells were embedded in collagen I matrices at densities mimicking normal breast tissue, 2.5 mg/mL collagen, and cancerous breast tissue, 6 mg mL−1 collagen. Cells migrating in dense collagen initially appeared to be trapped and were unable to invade. However, after one division cycle, most cells switched to a highly invasive motility behavior, significantly increasing their persistence, velocity, and total invasion distance (
It was unexpected that both MDA-MB-231 and HT-1080 cancer cells migrated faster and further in high density collagen conditions. Intuitively, cell migration would be expected to slow in dense conditions where more matrix must be remodeled to enable cell movement. Moreover, this behavior was common to both cancer cell types but not displayed by normal fibroblasts, which represent residents of the stroma and also undergo mesenchymal migration in collagen. This motivated us to investigate the long-term implications of the rapid migration phenotype induced in cancer cells under high density conditions. After one week of culture in high density collagen, breast cancer cells undergoing rapid and persistent migration formed interconnected network structures that resembled the early stages of endothelial tubulogenesis (
Previous pioneering studies have shown that several aggressive melanoma cell lines which produce VM in vivo also intrinsically form VM network structures when cultured on top of Matrigel or collagen I in a 2D in vitro context. Recently, other aggressive tumor cell types have been shown to intrinsically form VM-like network structures on top of Matrigel or in 2.5D culture in Matrigel. Here, it is important to note that variations exist in the consistency of commercial ECM products as well as the terminology used to describe 3D culture. In this example, 3D culture is defined strictly as a condition where cells are fully embedded, in contact with ECM on all sides, and located a sufficient distance away from the coverslip bottom and sides of the culture dish to avoid their influence. 2.5D culture is defined as a pseudo 3D culture where cells are embedded in the ECM but in contact with coverslip. To understand whether the network phenotype induced by a 3D collagen I environment was distinct from that induced by a 2D Matrigel environment, experiments were performed to determine whether the cells formed network structures on top of Matrigel. Few cells aligned within the first 24 hrs of culture, and nearly all cells aggregated after 72h (
Without being bound by theory, it is believed that the persistent migration phenotype of cancer cells leading to network formation in high density collagen conditions (collagen induced network phenotype, CINP) is the result of a transdifferentiation event wherein a unique cell motility gene module was upregulated. To test this, RNA sequencing was performed of MDA-MB-231, HT-1080, and HFF cells cultured in low and high density collagen matrices after 24 hours (
Analyzing more broadly, it was asked which genes were differentially regulated (TPM Fold change >=1.5) in high density collagen compared to low density collagen in each cell type and whether these genes represented unique or conserved transcriptional response modules. As expected, cell type accounted for the most variance in gene expression (
Using a Venn Diagram approach to identify conserved expression modules, a set of 70 genes was discovered that were upregulated by both cancer cell types but not normal cells in response to high density collagen (
Further exploration of this dataset with respect to individual cancer cell types revealed that, beyond the conserved transcriptional response, high density collagen also triggered the expression of genes related to vasculogenesis in a cell type dependent manner. For example, breast cancer cell networks upregulated VEGFA fold change=1.65 and MMP14 fold change=1.72, but fibrosarcoma cell networks did not. Some of these genes have been previously associated with the V network phenotype of melanoma cells (
Next the thirty-five genes that were upregulated in response to high density collagen by all three cell types was assessed (
Cancer types for which there is data available in TCGA but no significant differences between high and low CINP groups were detected. Table 5 shows number of patients available, number of deaths reported, hazard ratio and cox model p value.
Interestingly, SERPINE1, a secreted protease inhibitor involved in coagulation and inflammation regulation, was identified in the common-to-all gene module (
Integrin β1 upregulation is required for CINP
Identifying the matrix feature triggering transdifferentiation. The physical parameters of stiffness, pore size, and fiber organization differ between the low density 2.5 mg mL−1 and high density 6 mg mL−1 collagen matrices. Chemical cues may also change. For example adhesive ligand density and binding site presentation to integrins and other matrix receptors may differ as well as accumulation or release of autocrine and paracrine signals sequestered by the ECM. Each of these features could potentially impact cancer cell motility behavior and gene expression.
Since matrix stiffness has been implicated in driving epithelial to mesenchymal transitions (EMT) and aggressive phenotypes, it was asked whether increased stiffness of the high density collagen matrix was responsible for triggering transdifferentiation. To test this, a collagen polymerization procedure was developed that increases the stiffness of the low density matrix to match the stiffness of the high density matrix (
Determining whether the smaller pore size of the high density matrices triggered transdifferentiation. One way in which smaller pore sizes could influence cell behavior is by restricting the diffusion of molecules to and from the cells. More specifically, the imbalance between oxygen diffusion to cells and oxygen consumption by cells in 3D matrices has been shown to promote hypoxic conditions in some cases. Since regions of VM have previously been associated with markers of hypoxia in vivo, without being bound by theory, it is believed that cells in high density collagen created a more hypoxic condition than in low density collagen and that low oxygen levels could trigger network formation. To test this, MDA-MB-231 cells were cultured in low density collagen under a hypoxic atmosphere of 1% oxygen for one week. To confirm that a hypoxic response was achieved, the level of HIF1A mRNA expression by RT-qPCR at day seven was assessed and revealed a significant decrease in HIF1A expression (
To further explore whether pore size reduction induced transdifferentiation of cancer cells, this parameter was interrogated independently of collagen density. In this model, the high density condition contains 2.4 times more collagen than the low density condition. This increase in total collagen reduces pore size, but also presents more adhesive ligands to cells, which could increase integrin activation. To separate pore size from bulk density, a collagen structure engineering technique was developed that reduced the pore size and fiber length of the low density matrix to approximate that of the high density matrix. Under normal polymerization conditions, low density collagen self-assembles into relatively long, structured fibers. When non-functionalized, inert polyethylene glycol (PEG) was mixed into collagen monomer solution prior to polymerization, molecular crowding restricted fiber formation. This resulted in shorter, more interconnected fibers yielding smaller pores (
The short, more isotropic arrangement of fibers associated with both the high density collagen and low density PEG crowded collagen conditions could act on cells through local cell-matrix interactions transduced by integrin signaling. Integrin β1 (ITGB1) is a canonical receptor for collagen I, a central node in ECM signal transduction, and a critical mediator of breast cancer progression in mouse and in vitro models. Here, ITGB1 was upregulated by both cancer cell types in response to confining matrix conditions (
To further explore the link between the upregulated transcriptional module and the network forming phenotype, we asked whether ITGB1 silenced spheroid forming cells showed different gene expression patterns than WT network forming cells. To assess this, qRT-PCR analysis was conducted of a subset of the 70-gene panel in the two cell phenotypes. Upregulation of several key genes were maintained in the spheroid forming cells, while other genes were no longer upregulated (
Finally, it was asked if upregulated genes in the transcriptional module that have previously been implicated as drivers of VM in vitro were functionally active in the network forming phenotype. LAMC2 (Ln-5, gamma 2 chain) was previously found to be upregulated in aggressive melanoma cells that intrinsically display the VM phenotype compared to less aggressive melanoma cells that don't display VM. Moreover, it was implicated as a driver of VM network formation, since the cleavage of this secreted matrix molecule by MMP-2 and MT1-MMP produces pro-migratory fragments. In 2D culture of aggressive melanoma cells on top of collagen I, the inhibition of LAMC2 cleavage blocked VM network formation. Using shRNA to knock down LAMC2, we found that LAMC2 KD MDA-MB-231 cells maintain their ability to form network structures in 3D high density collagen (
Finally, to determine if the CINP triggered by the 3D system was clinically relevant, analysis was performed to determine whether the 70 common-to-cancer genes associated with the CINP could predict cancer patient prognosis. Without being bound by theory, it was anticipated that if this gene signature was indicative of a more metastatic cancer cell migration phenotype, its expression would correlate with poor patient outcomes. Since late stage tumors are already characterized by migration of tumor cells to distant lymph nodes or organs, without being bound by theory, it was hypothesized that a gene signature associated with metastatic migration would correlate with prognosis in early (Stage I & II) but not late (Stage III & IV) stage tumors. Using the cancer genome atlas (TCGA), data was analyzed for breast cancer patients with respect to the expression of the 70 gene signature. An expression metagene was constructed using the loadings of the first principal component (CINP PC1) of a 195 Stage I patient by 70 gene matrix (
Analysis of CINP score potential to predict prognosis in Stage I patients from METABRIC database broken down by molecular subtype.
Next, the predictive value of the gene module in additional cancer types in TCGA independently of stage or subtype was screened using only age and CINP score as covariates. The CINP gene module was a significant predictor of survival in lung adenocarcinoma (LUAD), lower grade glioma (LGG), cervical squamous cell carcinoma and endocervical adenocarcinoma (CESC), pancreatic adenocarcinoma (PAAD), mesothelioma (MESO), adrenocortical carcinoma (ACC), bladder urothelial carcinoma (BLCA), and kidney chromophobe carcinoma (KICH) (Table 7), but was not a significant predictor in several other tumor types found in TCGA.
Table showing results from Kaplan Meier and hazard ratio analysis across all cancer types in TCGA where the CINP gene score is significant predictor of prognosis (p<0.05).
Finally, it was determined whether the in vitro network forming phenotype and associated transcriptional signature were related to the clinical VM phenotype. Using the Human Protein Atlas (www.proteinatlas.org), breast cancer tumor slices displaying hallmarks of the VM phenotype were identified, namely linear chains of cells lining glycogen-rich matrix networks that conduct blood flow but do not stain positively for CD31. The tumor of patient 1910 displayed linear chains of cancer cells lining interconnected matrix networks (
The transcriptional, histopathologic, and phenotypic data suggest that the in vitro CINP and clinical VM share many commonalities. This is the first time that collagen fiber architecture, characterized by short fibers and small pores, has been identified as an inducer of cancer transdifferentiation associated with a VM-like phenotype or more normal acinar phenotype, depending on the capacity of cells to upregulate ITGB1. More broadly, these findings show that collagen fiber architecture modulates the role ITGB1 plays in migration. In one architectural context, ITGB1 facilitates a switch from mesenchymal to amoeboid migration and in another architectural context it mediates migration persistence and the shape of structures formed by collective morphogenesis.
Although ITGB1 was critical for directing the fate of cells during collagen induced transdifferentiation, it was not necessary for initiating the transition from single cell to collective morphogenesis. Without being bound by theory, the response appears to be unique to stem-like cancer cells (MDA-MB-231 and HT1080) as opposed to normal cells (HFF-1). Since, in this system, cells are embedded sparsely and undergo transcriptional reprogramming prior to cell division, the involvement of cell-cell interactions does not appear to play a role in transdifferentiation initiation. Without being bound by theory, it is possible that cell interactions with the unique matrix architecture involve matrix sequestration of soluble factors and autocrine signaling. Indeed, TGF pathways were implicated by GO enrichment analysis (
ECM molecules COL4A1 and LAMC2 were also upregulated by CINP cells and have previously been implicated in driving migration and VM network formation in 2D culture. In this 3D collagen system, knockdown of either gene was not sufficient to block the VM-like phenotype (
Interestingly, SERPINE1, a secreted protease inhibitor involved in coagulation and inflammation regulation, was upregulated by cancer cells as well as normal fibroblasts in response to confining collagen architectures. Cells which intrinsically expressed SERPINE family members were most efficient at spreading hematogenously, a characteristic that also correlated with their capacity to undergo VM in vivo. Without being bound by theory, both cell-intrinsic and ECM factors may contribute to the emergence of VM. Interestingly, the finding that fibroblasts and cancer cells both upregulate SERPINE1 expression in confining collagen conditions supports a role for stromal cells in SERPINE mediated VM metastasis.
The significant predictive value of the CINP gene signature in several tumor types may signify the physiological relevance of the ECM context and network forming migration phenotype created in vitro to a conserved mechanism of solid tumor metastasis. Without being bound by theory, it is possible that gene expression analysis of additional cancer cell types induced into VM-like behavior by the 3D collagen system could help to further refine the conserved CINP gene module. Without being bound by theory, this would facilitate prioritization of the genes for targeted functional studies to identify key regulators and potential therapeutic targets. In addition to regulators of the CINP, the conserved gene module also likely contains elements responsive to collagen but not directly involved.
Profiling additional cancer cell types and patient derived tumor cells could also help to refine the gene module's prognostic value in the nine tumor types already identified or define additional cancer specific versions of the CINP. Validation of the prognostic value of this gene module could help patients avoid the long-term side effects of aggressive radiation and chemotherapy if the likelihood of metastasis is very low. Without being bound by theory, molecular detection of VM markers could provide a more quantitative measure.
Cell culture. HT-1080 and HFF-1 were purchased from (ATCC, Manassas, VA) MDA-MB-231 cells were provided by Adam Engler (UCSD Bioengineering). All cell lines were cultured in high glucose Dulbecco's modified Eagle's medium supplemented with 10% (v/v) fetal bovine serum (FBS, Corning, Corning, NY) and 0.1% gentamicin (Gibco Thermofisher, Waltham, MA) and maintained at 37° C. and 5% CO2 in a humidified environment during culture and imaging. The cells were passaged every 2-3 days. Cell culture under hypoxia was done on a humidified and temperature controlled environment at 1% O2. Cells were tested for mycoplasma contamination using the Mycoalert kit (Lonza, Basel, Switzerland) before performing experiments.
3D culture in collagen I matrix. Cells embedded in 3D collagen matrices were prepared by mixing cells suspended in culture medium and 10× reconstitution buffer, 1:1 (v/v), with soluble rat tail type I collagen in acetic acid (Corning, Corning, NY) to achieve the desired final concentration10,20,21. 1 M NaOH was used to normalize pH in a volume proportional to collagen required at each tested concentration (pH 7.0, 10-20 μl 1 M NaOH), and the mixture was placed in 48 well culture plates and let polymerize at 37° C. Final gel volumes were 200 μL.
Cell tracking and motility analysis. Cells were embedded in 3D collagen matrices in 48 well plates and left polymerize for 1 hour in a standard tissue culture incubator and then 200 μL of complete growth medium were added on top of the gels. The gels were transferred to a microscope stage top incubator and cells were imaged at low magnification (X10) every 2 minutes for 48 h. Coordinates of the cell location at each time frame were determined by tracking single cells using image recognition software (Metamorph/Metavue, Molecular Devices, Sunnyvale, CA). Tracking data was processed using custom written python scripts based on previously published scripts to calculate cell speed, invasion distances and Mean Squared Displacements (MSDs). For cell motility analysis before and after division the time lapse videos were scanned to identify dividing cells within the imaging period and the division point was identified as the frame at which a clear separation could be identified between daughter cells. The dividing cell was tracked up to the division point and one of the daughter cells (randomly chosen) was tracked from that point until the 48h time point. For collective cell invasion distance the 48h time lapse video was processed to obtain the maximum intensity projection (MIP), which highlights the tracks taken by the cells/groups of cells. Individual tracks distinguishable in the MIP were measured to obtain an equivalent invasion distance. All cell tracking data comes from 3 independent experiments performed on different days and with different cell passages.
Persistence random walk model implementation. To quantify the differences in the mean squared displacement (MSDs) the MSDs were fitted for each condition using the persistent random walk model (PRW model) as described in53,54. Briefly, the MSDs were calculated as in Equation 1. The Equation 2 describing the PWR was fitted using python's lmfit library for each MSD. The persistent time (parameter P) was then extracted to calculate differences between groups as presented in
Where x and y are que coordinates of the position of a cell at each time point and tau is the time lag.
Where, S is the cell speed and P is the persistence time and σ is a function of the error in the position of the cell as described in.
Collagen stiffness modification and measurement using shear rheology. To modify the stiffness of collagen matrices without increasing density of material, kept 2.5 mg mL−1 gels at 20° C. for 30 minutes until they were fully polymerized. After the initial polymerization the gels were placed on a humidified tissue culture incubator at 37° C. for at least 1 hour extra before adding cell growth media on top. To measure the effect of polymerization temperature on the gel stiffness recreated the polymerization conditions for rheology testing (hybrid rheometer (DHR-2) from TA Instruments, New Castle, DE) using a cone and plate geometry with a sample volume of 0.6 mL. Shear storage modulus G′ was measured as reported before10. Briefly, first performed a strain sweep was from 0.1% to 100% strain at a frequency of 1 rad/s to determine the elastic region. Then a frequency sweep was performed at a strain within the linear region (0.8%) between 0.1-100 rad/s. Three independent replicates were performed for each condition tested.
Collagen structure modification using Poly-Ethylene-Glycol. To modify the structure of the collagen fibers within the gels without changing the final collagen concentration, Polyethylene glycol (PEG, MW=8000, Sigma, St. Louis, MO) was solubilized in phosphate-buffered solution (PBS), filter sterilized. Solubilized PEG was then mixed into the cells, reconstitution buffer solution described above to produce a final PEG concentration of 10 mg/mL in the collagen gel. The gels were allowed to polymerized in the same conditions as collagen only gels. Collagen structure modification was verified using confocal reflection microscopy.
RNA Isolation and purification. 3D collagen I gels were seeded in three independent experiments and harvested after 24 hours of culture for RNA extraction and directly homogenized in Trizol reagent (Thermofisher, Waltham, MA). Total RNA was isolated following manufacturer's instructions. Isolated RNA was further purified using High Pure RNA Isolation Kit (ROCHE, Branford, CT). RNA integrity was verified using RNA Analysis ScreenTape (Agilent Technologies, La Jolla, CA) before sequencing.
RNA sequencing and data analysis. Biological triplicates of total RNA were prepared for sequencing using the TruSeq Stranded mRNA Sample Prep Kit (Illumina, San Diego, CA) and sequenced on the Illumina MiSeq platform at a depth of >25 million reads per sample. The read aligner Bowtie2 was used to build an index of the reference human genome hgl9 UCSC and transcriptome. Paired-end reads were aligned to this index using Bowtie2 and streamed to eXpress for transcript abundance quantification using command line “bowtie2 -a -p 10 -x/hg19 -1 reads_R1.fastq -2 reads_R2.fastq|express transcripts_hgl9.fasta”. For downstream analysis TPM was used as a measure of gene expression. A gene was considered detected if it had mean TPM>5.
Gene ontology term overrepresentation analysis. To asses the overrepresented GO terms the cytoscape app BiNGO was used. Statistical test used was hypergeometric test, Benjamini-Hochberg false discovery rate (FDR) correction was used to account for multiple tests and the significance level was set at 0.05. For a given term, to assess the sensitivity of the enriched gene sets to the genes used in the analysis, varied the threshold for including a gene as differentially upregulated from a fold change of 1.3 to a fold change of 1.9. The probability of a gene enriched with term is (# of genes in background with term)/(# of genes in background). The fold enrichment is the observed number of genes associated with term divided by the expected number of genes associated with term.
Gene expression using qPCR. For qPCR experiments RNA was extracted as stated above and cDNA was synthesized using superscript iii first-strand synthesis system (Thermofisher, Waltham, MA). Relative mRNA levels were quantified using predesigned TaqMan gene expression assays (Thermofisher, Waltham, MA). Relative expression was calculated using the DCt method using GAPDH as reference gene. Assays used were: GAPDH (Hs02758991_g1), HIF1A (Hs00153153_m1), THBS1 (Hs00962908_m1), TGFBI (Hs00932747_m1), TPM1 (Hs04398572_m1), LAMC2 (Hs01043717_m1), HMOX1 (Hs01110250_m1).
Immunofluorescence and cell imaging. For cell imaging after 7 days of culture to visualize VM structures collagen gels were fixed using 2 washes of 4% PFA for 30 mins each at room temperature. F-actin was stained using Alexa Fluor® 488 Phalloidin (Cell signaling technology, Danver, MA) and the nuclei were counterstained with DAPI. For immunofluorescence staining the gels were incubated with the primary antibody for 48 to 72 hours. Anti-COL4A1 (1:200 dilution, NB120-6586, novus biologicals).
Confocal reflection imaging and quantification: Confocal reflection images were acquired using a Leica SP5 confocal microscope (Buffalo Grove, IL) equipped with a HCX APO L 20×1.0 water immersion objective. The sample was excited at 488 nm and reflected light was collected without an emission filter. For the estimation of pore size, used modification of a previously reported digital imaging processing technique. Briefly, the images were normalized to account for uneven illumination effects. Then a threshold was applied to generate a binary mask where pores were identified as the darkest areas of the image. Pore diameter was measured using NIS elements software (Nikon Instruments Inc., Melville, NY) measure objects tool.
Gene Suppression: The lentiCRISPR v2 was a gift from Feng Zhang (Addgene plasmid #52961). Small guide RNAs were cloned targeting the genes of interest into the lentiCRISPR v2 following Zhang's lab instructions. The sg_RNA sequences using were taken from the GECKO human library A. Used sequences were: ITGB1 sg_RNA1 (5′-TGCTGTGTGTTTGCTCAAAC-3′) (SEQ ID NO.: 1), ITGB1 sg_RNA2 (5′-ATCTCCAGCAAAGTGAAACC-3′)) (SEQ ID NO.: 2), EGFP sgRNA (5′-GGGCGAGGAGCTGTTCACCG-3′)) (SEQ ID NO.: 3). The lentiCRISPR v2 vectors with the cloned desired sgRNA were sequence verified and viral particles were generated by transfecting into lentiX293T cells (Clonetech, Mountain View, CA. Cat #632180) along with packaging expressing plasmid (psPAX2, Addgene #12260) and envelope expressing plasmid (pMD2.G, Addgene #12259). Viral particles were collected at 48 h after transfection and they were purified by filtering through a 0.45 μm filter. Target cells were transduced with the viral particles in the presence of polybrene (Allele Biotechnology, San Diego, CA). After overnight incubation media was changed and cells were left 24h-48h in normal growth media and then changed to puromycin selection media (2.5 ug/mL puromycin) for 7 days before experiments were performed. For shRNA mediated gene knock down, Glycerol stocks of TRC2-pLKO.1-puro shRNA targeting LAMC2 (NM_005562.1-1019s1c1: CCGGGCTCACCAAGACTTACACATTCTCGAGAATGTGTAAGTCTTGGTGAGCTTTTTG) (SEQ ID NO.: 4), COL4A1 (NM_001845.3-3859s1c1:CCGGCCTGGGATTGATGGAGTTAAACTCGAGTTTAACTCCATCAA TCCCAGGTTTTTG) (SEQ ID NO.: 5) and a non-targeting scramble sequence (SHC016:CCGGGCGCGATAGCGCTAATAATT TCTCGAGAAATTATTAGCGCTATCGCGCTTTTT) (SEQ ID NO.: 6) were purchased from Sigma-Aldrich packaged in LentiX293T (Clonetech, Mountain View, CA. Cat #632180) along with packaging expressing plasmid as described above. Lentiviral particles were transduced into target cells and stably expressing cells were selected with puromycin (2 ug/mL) for at least 5 days before using.
Western blotting: Cells were grown to >90% confluency in 100 mm dishes. After washing 2× with PBS cells were collected into 100 uL of lysis buffer with 1× Halt protease inhibitor cocktail (Pierce IP lysis Buffer, Thermofisher, Waltham, MA) by thoroughly scraping the dish surface. Cell lysate was incubate in ice with constant shaking for 30 min and then centrifuged at 15,000×g for 20 for protein purification. Samples were loaded at 50 ug total protein concentration for SDS-PAGE. Membranes were probed with antibodies against ITGB1 (#4706 from Cell signaling technology, Danver, MA. 1:10000 dilution) and Tubulin (TU-01 MA1-19162, Thermofisher, Waltham, MA. 1:30000 dilution).
Fluorescence activated cell sorting (FACS): Wild type MDA-MB-231 cells were grown in collagen I coated tissue culture dished until 80% confluence. Cells were harvested using HyClone HyQtase (GE Healthcare Life Sciences, Marlborough, MA) and resuspended in FACS buffer (1% BSA, 0.5 mM EDTA in PBS). The cell suspension was then labeled using a monoclonal antibody against human CD29 (b1 integrin) conjugated to AlexaFluor 488. A cell suspension without added antibody was used as negative control. After labeling, the cells were analyzed within 1 hour of detachment at the stem cell core of Sanford Consortium of Regenerative Medicine (La Jolla, CA) using a BD Influx cell sorter (BD, Franklin lakes, NJ). Cells were sorted based on fluorescence intensity into the top expressing population (˜15%, ITGB1 high) and bottom expressing population (˜13%, ITGB1 low). Sorted cells were replated into collagen coated dishes and left to recover overnight. After recovery the cells were embedded in 3D collagen gels as described above.
Experimental data analysis and statistics: All cell motility data was analyzed for statistical significance using the scipy python package. Additional experimental data was analyzed using prism graphpad (San Diego, CA). Significance (p) was indicated within the figures using the following scale: * p<0.05 **p<0.01 ***p<0.001. Additional relevant information is detailed in the figure captions.
TCGA data reprocessing and survival analysis: The TCGA raw data were downloaded from CGHub directly using gtdownload. Corresponding clinical metadata were obtained from the TCGA data portal (https://tcga-data.nci.nih.gov/docs/publications/tcga/). RNAseq fastq files were realigned and quantified using sailfish v.0.7.6 with default parameters. Only primary tumors were considered in the analysis. In the analysis of breast invasive carcinoma, only the patients with reported histological staining for the three markers (Her2, ER, PR) could be associated with a molecular subtype. Patients for which any of the histological markers were not evaluated or were detected at an equivocal level were assigned to an “unknown” subtype. TCGA data for Stage I, II, III and IV breast cancer patients was analyzed by Principal Component Analysis (PCA) with respect to the 70 CINP genes to construct gene expression meta-markers as previously described. PCA-based score quantiles were mapped to CINP high and CINP low categories based on mean CINP gene expression levels. Because the CINP signature comprised only genes that were upregulated in the presence of the network phenotype, the overall mean expression of CINP genes was used to map PCA score to CINP signature activity level.
METABRIC data retrieval and survival analysis. The clinical and microarray expression dataset was from cBioPortal (www.cbioportal.org/study?id=brca_metabric). 59 out of 70 CINP genes mapped to METABRIC microarray data (missing genes: ZNF532, TRMT13, AMIGO2, KIN, NKX3-1, TANC2, TVP23C, SDHAP1, MTND2P28, GTF2TP4, H2BFS). Survival analysis was performed using the same method as described above for TCGA data. The Cox multiple regression uses CINP score, age, and three molecular subtype categories as covariates.
TCGA pan cancer analysis. Tumor types for which at least 100 patients had both expression and clinical metadata were analyzed to determine correlation between a CINP gene expression and 5-year survival. Only primary tumors were considered. Kaplan-Meter analysis was performed comparing the 30% of individuals with the lowest CINP expression score to the 30% with the highest score. The cox multiple regression uses age and CINP score as covariates. Both analyses use the Lifelines python library (lifelines.readthedocs.io/en/latest/). The log rank test was used to determine significance of survival differences between groups.
Human protein atlas data: The online database Human Protein Atlas was used to identify breast cancer tumor slices displaying hallmarks of the VM phenotype and subsequently assess protein expression of the genes associated with the in vitro network forming phenotype. The tumor of patient ID 1910 was found to display linear chains of cancer cells lining interconnected matrix networks and had been stained for numerous other proteins of interest. Histological images shown in
Data availability. All sequencing data from this study has been deposited in the National Center for Biotechnology Information Gene Expression Omnibus (GEO) and is accessible through the GEO Series accession number GSE101209. All other relevant data are available within the Article and Supplementary Files, or from the corresponding author upon request.
Code availability: Relevant scripts for the analysis of TCGA and METABRIC data are available at: github.com/brianyiktaktsui/Vascular_Mimicry.
It is well established that the collagenous extracellular matrix surrounding solid tumors significantly influences the dissemination of cancer cells. However, the underlying mechanisms remain poorly understood, in part because of a lack of methods to progressively modulate collagen fiber topology in the presence of embedded cells. In this work, a technique is developed to tune the fiber architecture of cell-laden 3D collagen matrices using PEG as an inert molecular crowding agent. With this approach, it is demonstrated that fiber length and pore size can be modulated independently of bulk collagen density and stiffness. Using live cell imaging and quantitative analysis, matrices with long fibers are shown to induce cell elongation and single cell migration, while shorter fibers induce cell rounding, collective migration, and morphogenesis. Without being bound by theory, it is concluded that fiber architecture is an independent regulator of cancer cell phenotype and that cell shape and invasion strategy are functions of collagen fiber length.
Accumulating evidence suggests that matrix architecture is capable of modulating cell migration phenotype as profoundly as matrix stiffness. Largely, studies of matrix architecture have relied on micropatterned 2D surfaces and have focused on imparting contact guidance. Systematically controlling 3D ECM architecture remains a substantial challenge. Yet, it is now widely appreciated that cell behavior is distinct in native 3D ECM. Compared to 2□models, changes in the abundance, localization, and functional status of intracellular proteins have been documented in 3D culture. Thus, a major tradeoff exists between the physiological relevance of an ECM model system and the ability to tune and control specific physical features. It is currently impossible to decouple all of the architectural features of a 3D fibrillar protein network. Nonetheless, several studies have developed novel methods to produce highly aligned, anisotropic 3D collagen matrices, which impart both contact guidance and stiffness anisotropy. These methods include magnetic, mechanical, and cell force driven reorganization of collagen fibers as well as electrospinning. From these studies, matrix stiffness and alignment have been established as modulators of cell phenotype through mechanotransduction processes. However, the mechanisms by which matrix architecture may act independently on cells are not clear. This is due in part to the scarcity of in vitro experimental techniques that satisfy the need to modulate fiber characteristics independently of collagen density and stiffness while also allowing cells to be fully embedded in 3D.
Molecular crowding (MC) is one approach that can potentially achieve these goals. Crowding is a physiologically relevant phenomenon whereby high concentrations of macromolecules occupy the extracellular space and generate excluded volume effects. In the context of collagen polymerization, this results in alterations to the rates of nucleation and fiber growth.
Thus far, architectural engineering of 3D collagen hydrogels with MC has been investigated in cell-free conditions. Herein is established a crowding technique for cell-laden 3D collagen matrices using biologically inert PEG. Adjustments to the amount of PEG added during collagen assembly and cell embedding reliably tune fiber topography. The biophysical properties of the MC matrices are quantitatively evaluated as well as the morphological and migration response of cancer cells in the engineered constructs. Importantly, through control experiments it is shown that the influence of the crowding agent on cell morphology and migration behavior occurs only through the topographic alterations MC induces in the matrix. Finally, matrix architecture is demonstrated as a critical modulator of cancer cell phenotype independently of matrix stiffness or density.
Macromolecular Crowding with PEG Tunes Collagen Fiber Characteristics
To explore the impact of fiber architecture on cancer cell behavior in a 3D collagen matrix, Applicant sought to develop a method for tuning fiber length in a collagen I hydrogel while simultaneously embedding cells. More specifically, the goal was to shorten fiber length of a 2.5 mg/ml collagen matrix without changing the density or stiffness of the matrix. The assembly of collagen I solution into a fibrous 3D matrix is driven by diffusion-limited growth of nucleated monomers (
First Applicant tested the ability of PEG to alter collagen architecture. To do so, Applicant introduced increasing amounts of 8,000 Da PEG (0-10 mg/ml, labeled P0-P10) into a 2.5 mg/ml collagen I solution, then washed the gel after polymerization to remove the PEG, and finally imaged the resulting fiber architecture with reflection confocal microscopy. Increasing amounts of PEG led to gradual changes in collagen fibers (
It is also interesting to quantify the relative heterogeneity of the fiber architecture, especially in the context of studying cell behavioral responses. Even the behavior of isogenic cells is heterogeneous, making it challenging to decouple intrinsic from extrinsic sources of cell heterogeneity. Using the coefficient of variation (CV) to assess heterogeneity in the fiber length and pore size of each condition, Applicant found that increased crowding results in a gradual decrease in CV (
To further characterize the biophysical properties of the crowded collagen constructs, Applicant measured their bulk and local elastic moduli using shear rheology and atomic force microscopy (AFM), respectively. Slightly differences in the bulk moduli were observed and statistically significant between the P4 crowded condition (14 Pa) and higher crowding conditions (˜8 Pa,
PEG Crowding Alone does not Directly Influence Cell Morphology or Migration Behavior
Having confirmed that PEG is an effective MC agent for tuning collagen architecture, Applicant next sought to determine whether it would directly influence cell behavior independently of its effects on matrix architecture. This control experiment was undertaken to ensure that even if the washing procedure did not remove all traces of PEG from the matrix, as suggested by the SEM images in
Next, Applicant assessed the viability of the cells after one week of culture in the control and crowded conditions where the MC agent was not washed out. For comparison, Applicant also tested the effects of 25 mg/ml Ficoll 400 (400,000 Da) under the same condition, which has been used previously to tune collagen matrix architecture to approximately the same degree as Applicant accomplish here using 10 mg/ml PEG. Cells were seeded at the same initial density in all conditions.
Having established PEG crowding as a method to modulate collagen fiber topology, Applicant next sought to quantify the influence of matrix architecture on the morphology and migration of embedded cancer cells. To do so, Applicant polymerized 2.5 mg/ml collagen with a low seeding density of MDA-MB-231 cells and 0-10 mg/ml PEG mixed in. After polymerization, the cell-laden gels were washed to remove the PEG, a process Applicant confirmed to be successful by SEM (
3D Collagen Fiber Topography Modulates a Transition from Single Cell Migration Through Collective Cell Migration to Morphogenesis
To examine the impact of collagen fiber topography on breast cancer cell migration, Applicant monitored MDA-MB-231 cells for one week in each construct. A striking transition from single cell migration to collective migration was observed in the 2.5 mg/ml collagen matrices crowded with 6 mg/ml of PEG (P6) and higher.
Applicant next sought to identify which matrix feature(s) could be responsible for driving the switch from single to collective migration and further morphogenesis in the constructs, where the total density and overall stiffness of collagen was held constant. Since the phenotypic transition of breast cancer cells in the constructs was not gradual but sharp, Applicant hypothesized that matrix feature(s) could act in a thresholding capacity. To assess this, Applicant compared characteristic values for each matrix feature to the frequency at which Applicant observed single versus multicellular phenotypes across matrix conditions. Plotting the mean, median, and CV of fiber length against the frequency of single cell migration revealed that indeed a threshold in fiber length predicted the reduction in the single cell phenotype and the emergence of multicellular phenotypes (
Applicant created a novel 3D collagen system that physically decouples both stiffness and density from fiber architecture to independently assess the impact of fiber architecture on cell behavior. the study reveals that when individual cells interact with different collagen matrix architectures, initial cell shape is a function of fiber length. Further, this interaction ultimately drives distinct modes of cell migration. Single cell migration is favored in matrices with long fibers whereas multicellular cell migration and morphogenesis is favored in matrices with short fibers. These two behaviors can be predicted based on a fiber length threshold and a related cell circularity threshold.
Previous work using hanging drops and 2D systems demonstrated that cell-ECM adhesion competes with cell-cell cohesion following physical principles related to surface tension. Without being bound by theory, it is possible that the short collagen fibers in the system restrict the size or stability of cell-ECM adhesion compared to longer fibers and thereby promote cell-cell cohesion. Alternatively, without being bound by theory, confinement in a rounded shape could alter the tensegrity of the cell, reducing the activation of cell surface integrins and their affinity for binding ECM. Tensile forces that are generated by contractile actomyosin filaments are resisted inside the cell by microtubules and outside the cell by the ECM and by adhesions to nearby cells. In rounded single cells, microtubules serve as the primary resistance to the pre-stressed cytoskeleton and also provide a mechanical force balance to a tensed network of chromosomes and nuclear scaffolds. This mechanical linkage could alter gene expression and cell behavior in a cell shape dependent way. Previous studies on 2D patterned substrates have shown that cellular geometry influences modular gene expression programs, differentiation, nuclear deformation, cytoskeleton reorganization, chromatin compaction, growth, apoptosis, and cell division. However, cell roundedness due to loss of attachment has also been shown to impair glucose uptake, inducing metabolic defects that drive gene expression changes.
A small percentage of the smooth multicellular structures Applicant observed in the P8 and P10 conditions (
Increases in collagen matrix density induced “cellular jamming” in highly aggressive fibrosarcoma and melanoma cells leading to cell chain formation. These studies implicated pore size as the critical matrix feature inducing this migration switching phenomenon. The multicellular chain phenotype Applicant observed in the P6 construct is highly similar to that previously reported, where individual cell bodies are distinguishable but connected, resembling a pearl necklace. However, the fused networks, glands, and lobule structures formed in the P8 and P10 conditions are distinct. Further, Applicant found no relationship of pore size with the phenotypic switch. Without being bound by theory, these differences could arise from differences in cell type or from the fact that the system allowed us to hold collagen density constant while varying fiber architecture. Another distinction is that Applicant automated the measurement of pore sizes through image processing. However, the automated pore size measurement for the 2.5 mg/ml collagen condition (˜2.2 μm2) is consistent with that reported previously by other groups using confocal reflection microscopy image analysis (˜0.78-1.8 μm2 pore areas for 2.5 mg/ml collagen; 2-5 μm2 pore areas for 1.7 mg/ml) and cryo-EM (˜3 μm2 pore areas, 2 mg/ml collagen).
The successful use of varying concentrations of 8,000 Da PEG to modulate collagen matrix architecture begs the question of whether MC chain size and chemistry could be two additional matrix “tuning knobs” that could be further explored for collagen matrix engineering. The chemical nature of an MC agent as well as its size can determine its exclusion from molecular surfaces. Measurements of the exclusion of different molecular weights of PEG from proteins is largely consistent with the crowding by hard spheres model, where the radii is approximated by the radius of gyration of the PEG polymer. However, other measurements have shown that PEG polymers of different sizes are not always excluded from well defined cavities, as a hard-sphere model would require. A wide range of partial exclusion as a function of molecular size and concentration are possible. Without being bound by theory, this may explain, in part, the reverse in matrix parameter trends Applicant observed in the high concentration, 10 mg/ml PEG, condition. The nonlinearity of the behavior of collagen, a semiflexible crosslinked biopolymer network, in response to crowding by PEG, is not unexpected. A deep and predictive understanding of such networks has proven to be a daunting theoretical challenge in the field of soft matter and polymer physics. Another example of such non-linear behavior has been demonstrated by crowding actin filaments with PEG, where bundling is induced when the concentration of PEG exceeds a critical onset value. Indeed, the unique characteristics of biopolymers compared to synthetic polymers make their study highly important for fundamental biological understanding.
Also intriguing is the observation that cancer cell proliferation and viability increased slightly when PEG was added after collagen polymerization and maintained in culture for one week. Yet, no significant effect on cell morphology and migration was observed under these control conditions. Without being bound by theory, these findings suggest that molecular crowding may promote proliferation of tumor cells. Previous studies have found that PEG crowding can have the effect of increasing the hydration of proteins and imposing osmotic stress on cells. Both increased hydration and osmotic stress have been associated with cancerous tissues.
While collagen is only one of many matrix components within the tissue and tumor microenvironment, both clinical and in vivo studies have established the relevance of this particular ECM molecule. Collagen is both an independent clinical prognostic indicator of cancer progression and a driver of tumorigenesis and metastasis. As such, understanding how 3D collagen regulates cancer cell migration behavior is likely to provide useful insights into disease pathogenesis.
A deeper understanding of the microenvironmental regulators of cancer cell migration could help identify therapies to combat metastasis and improve patient outcomes. By decoupling matrix architecture from matrix density and stiffness, the study identifies a novel role for collagen architecture in modulating cancer cell behavior. The techniques developed herein to modulate collagen architecture allowed us to identify relationships between fiber length, cell shape, and migration phenotype. Without being bound by theory, the same techniques could be extendable to investigations of metastatic migration in vivo, since the 3D matrix constructs are collagen and PEG-based, non-toxic, and implantable. Without being bound by theory, these techniques may also be useful for stem cell and regenerative medicine studies as a means to control 3D cell shape and morphogenesis outcomes.
MDA-MB-231 breast cancer cells were ordered from ATCC (Manassas, VA) and cultured in Dulbecco's Modified Eagle's Medium (Life Technologies, Carlsbad, CA) supplemented with fetal bovine serum (Corning, Corning, NY) and gentamicin (Life Technologies, Carlsbad, CA), at 37° C. and 5% CO2. Culture media was changed every other day as needed. Cells were cultured to confluence prior to being trypsinized and embedded inside of collagen gels. Cell laden gels were cultured for a week to observe long-term phenotypic differences.
High concentration, rat tail acid extracted type I collagen was ordered form Corning (Corning, NY). MMC agents, PEG 8000 (8,000 Da) and Ficoll 400 (400,000 Da), were ordered in powder form from Sigma-Aldrich (St. Louis, MO) and reconstituted in PBS (Life Technologies, Carlsbad, CA) prior to usage. Trypsinized cells to be embedded, were first mixed with 1× reconstitution buffer composed of sodium bicarbonate, HEPES free acid, and nanopure water. Appropriate amounts of MMC agent, PEG or Ficoll, were then added to produce final concentrations of 0, 2, 4, 6, 8, and 10 mg ml−1 PEG (denoted by P0, P2, P4, P6, P8, P10) or 25 mg ml−1 Ficoll (denoted by F25). Afterwards, collagen solution was added to the mixture for a final concentration of 2.5 mg ml−1 collagen. Finally, pH of the final mixture was adjusted using 1N sodium hydroxide, prior to polymerization via incubation at 37° C. (˜20-30 minutes). Gels were prepared inside of 48-well plates with a total volume of 200 μl. Following gel polymerization and solidification, MMC molecules were washed out of the collagen gels by rinsing with PBS 3× for 5 min each. Cell culture media was then added on top of the gels after and changed every two days as necessary.
To ensure that the MMC molecules being used were truly inert, Applicant investigated any potential effect that the MMC molecules may have on cells independent of the changing matrix architecture. Applicant conducted a series of MMC control experiments, where MDA-MB-231 cells were embedded inside of three 2.5 mg ml−1 collagen gels. After the gels had polymerized, normal culture media was added on top to one of the gel, while the other two either had 10 mg ml−1 PEG or 25 mg ml−1 Ficoll added into the media on top. The MMC molecules were left in the media and allowed to diffuse down into the gel with the cells. Subsequent media changes would also include appropriate amounts of MMC agent to maintain the PEG and Ficoll concentrations in the gel.
Collagen matrix architecture and topography was investigated by imaging gels using confocal reflection microscopy (CRM) using a Leica SP5 inverted confocal microscope, equipped with a 20× immersion objective (NA=1.0). Collagen fibers were imaged by exciting with and collecting backscattered light at 488 nm. Confocal reflection imaging is restricted to fibers that are oriented within 500 of the imaging plane. To verify that the gels are isotropic in their fiber structure, Applicant imaged a gel from the top and from one of the sides (XY and YZ planes), using the same imaging settings.
Time lapse microscopy was conducted using a Nikon Ti-E inverted microscope, equipped with a stage top incubation system, to analyze cell motility and migration behavior, morphology, and proliferation and viability. Cells were allowed to settle in the collagen gel in the incubator for approximately 7 h after gel polymerization; time-lapse imaging began at around the 8th hour after the cells were embedded into the collagen gels. Each gel was imaged over 6 fields of view (FOV) for a period of 15 h, with images being taken every 2 min.
Cell viability was assessed using a Live and Dead Cell Assay (Abcam, Cambridge, UK). Intact, viable cells fluoresce green (imaged under FITC channel) while dead cells fluoresce red (imaged under TRITC channel). The average number of live cells, dead cells, and live cell viability percentages were calculated over 4 FOVs per condition. Live cell viability % is defined as the number of live cells/the total number of cells*100.
All matrix analyses were done using the CRM images of the collagen gels in each condition over 3 FOVs. Fiber analysis was conducted in CT-FIRE v1.3 by measuring individual fiber length and width as previously published. Minimum fiber length, dangler length threshold (thresh_dang_L), short fiber length threshold (thresh_short L), distance for linking same-oriented fibers (thresh_linkd), and minimum length of a free fiber (thresh_flen), were all set to three pixels. Default settings were used for all other fiber extraction parameters and output figure controls. Settings were optimized to detect and analyze discrete fibers in CRM images on scales of 0.72 μm per pixel. Examples of the fibers found by CT-FIRE are shown in
Pore size was calculated using NIS-Elements software (Nikon) as the 2D area encompassed by fibers. The total pore area (ε′) as a 2D approximation of the 3D tissue ultrastructure (ε) can be described as:
as long as the stereological assumption is met. This assumption was validated by imaging XY and YZ planes of a 2.5 mg/ml collagen gel and analyzing the fiber length (no significant difference), pore area (<0.5 μm2 difference), which are shown in
to be ˜0.67 microns. This is smaller than the pixel size in the system and smaller than the expected ε, which makes the fraction in Eq 1<1 and suggests that ε′≅ε is a valid approximation. These analyses suggest that the 2D confocal micrographs are a close representation of the 3D architecture. Pre-processing of images were conducted by implementing a Gauss-Laplace Sharpen set to a power of 2 and then by using a Rolling Ball Correction with a rolling ball radius of 15. The contrast of all images were equalized, then images were binarized by thresholding to the same range. Next the automated measurement tool was used to measure pore areas in the binarized images. Single pixel pore values were attributed to speckle noise and removed from all conditions. Homo-/heterogeneity of the matrices was characterized by calculating the coefficient of variation (CV) of fiber length and pore size data distributions.
Rheological measurements were conducted as shown previously with a TA Instruments AR-G2 Rheometer. A parallel-plate geometry (20 mm diameter) with a 1000 μm gap height was used on 500 μl collagen gels. For each condition, a strain sweep at frequency of 1 rad/s was recorded to determine each respective linear viscoelastic region. The storage modulus (G′) and loss modulus (G″) were recorded over frequencies of 0.25-100 rad/s for each condition. The storage modulus at 1 rad/s was reported for each condition.
AFM was performed to measure local collagen gel stiffness as previously described59. Briefly, nano-indentations were performed using a MFP-3D Bio Atomic Force Microscope (Oxford Instruments) mounted on a Ti—U fluorescent inverted microscope (Nikon Instruments). A pyrex-nitride probe (spring constants ˜0.04 N/m, NanoAndMore USA Corporation, cat #PNP-TR) with a pyramid tip was calibrated using a thermal noise method provided by the Igor 6.34A software (WaveMetrics). Samples were loaded on the AFM, submersed in phosphate buffered saline (PBS), and indented at a velocity of 2 μm/s. Tip deflections were converted to indentation force for all samples using their respective tip spring constants and Hooke's Law. Elastic modulus was calculated based on a Hertz-based fit using a built-in code written in the Igor 6.34A software.
Collagen gels were prepared at 2.5 mg/mL concentration with and without the addition of 10 mg/mL 8KDa PEG, then placed in a humidified incubator (37° C.) until fully polymerized as described above. The samples polymerized in the presence of PEG were separated into washed and not washed preparations. To wash the PEG after polymerization, PBS was added on top of the gel and placed in the incubator for 5 minutes 3 times. Next, all samples were fixed with 4% PFA for 1 hour at room temperature and the washed 3× with PBS. The samples were then dehydrated by treating them with increasing concentrations of ethanol (50% to 100%). Samples immersed in 100% ethanol were subjected to critical point drying (Autosamdri-815, Tousimis, Rockville, MD, USA), coated with a thin layer of Iridium (Emitech K575X, Quorum technologies, Ashford, UK) and imaged using a Zeiss sigma 500 SEM.
Individual cells in the time lapse videos were tracked in Metamorph for motility characterization. Within the 15 h time lapse window, cells were analyzed in terms of the total path length traveled, their average speed, the invasion distance (displacement), and the persistence of their migration (defined as the invasion distance/the total path length traveled). Cell morphology analysis was conducted using images of the cells during the 15th hour after seeding in the gel, in terms of circularity (computed as: [4*π*area]/perimeter2)
Correlations were calculated in terms of the Pearson correlation coefficient. Correlations were drawn between various matrix parameters to evaluate whether they had been decoupled, as well as between matrix and cell parameters to investigate cell-matrix interactions.
Data presented in bar graph format was analyzed using one-way analysis of variance (ANOVA) followed by Tukey or Newman-Keuls post hoc test in GraphPad Prism (v5). Correlation plots were analyzed by Pearson Correlation in GraphPad Prism (v5). Pearson r correlation coefficient and two-tailed p values are reported. N=3 biological replicates for each condition tested. Statistical significance was set at values of p<0.05 and reported as p<0.001, ***; p<0.01, **; p<0.05, *.
The following articles are referenced in the disclosure hereinabove and are incorporated by reference in their entirety:
This application is a continuation of U.S. Ser. No. 16/465,991, filed May 31, 2019, which is a national stage application under 35 U.S.C. § 371 of International Application No. PCT/US2017/064348, filed Dec. 1, 2017, which claims the benefit under 35 U.S.C. 119(e) of U.S. Provisional Ser. No. 62/429,581, filed Dec. 2, 2016, the contents of each of which are hereby incorporated by reference in their entireties.
Number | Date | Country | |
---|---|---|---|
62429581 | Dec 2016 | US |
Number | Date | Country | |
---|---|---|---|
Parent | 16465991 | May 2019 | US |
Child | 18110341 | US |