Methods and Materials Relating to Breast Cancer Diagnosis

Abstract

Classification of breast tumours into Estrogen Receptor positive and negative (ER+ and ER−) subtypes is an important distinction in the treatment of breast cancer. ER typing is frequently performed using expression profiles of genes whose expression is known to be affected by ER activity. Some tumours cannot confidently be assigned to a particular ER type based on such expression data. The present inventors have found that such “low confidence” tumours constitute a distinct biological subtype of breast tumours associated with significantly worse overall survival than high confidence tumours. Gene sets capable of distinguishing low confidence from high confidence tumours are provided, along with methods and apparatus for performing appropriate classification of breast tumours.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1. Identification of Tumours with Low Prediction Strength (“Low-confidence”).

Each sample in the training (a) and test set (b) is plotted (x-axis) against the sample's prediction strength (PS, y-axis). The training data set consists of 55 tumours and the test data set consists of 41 tumours. Samples exhibiting high positive PS values are classified as ER+, while samples with a high negative PS are ER−. Blue samples were correctly classified while red samples were misclassified. In general, a group of ‘low-confidence’ samples is observed (grey box) in both the training and test tumours.

FIG. 2. Kaplan-Meier analysis comparing the clinical behaviour of ‘high’ and ‘low-confidence’ tumours. Overall survival data in (a) and (b) is obtained from Stanford data set (9), while Time to Distance Metastasis data in (c) and (d) is obtained from Rosetta data set (10). Patients with ‘high-confidence’ tumours are depicted as green, while patients with ‘low-confidence’ tumours are depicted in pink. a) Overall survival of patients with ‘high’ (60 patients) and ‘low-confidence’ (14 patients) tumours regardless of ER status, b) Overall survival of patients with ER+‘high’ (48) and ‘low-confidence’ (7) tumours; c) Time from initial tumour diagnosis to appearance of distant metastasis of patients with ‘high’ (82) and ‘low-confidence’ (15) tumours regardless of ER status, (d) Time from initial tumour diagnosis to appearance of distant metastasis of patients with ER+‘high’ (63) and ‘low-confidence’ (5) tumours.

FIG. 3. widespread perturbations in ER-correlated genes in low Vs high confidence samples.

(a) and (b) Depicted are the relative expression levels of the top 122 ER discriminating genes (obtained from the SAM-133 gene set, see text) that are positively correlated to ER+ status in (a) ER+/High (yellow) and ER+/Low (turquoise), and (b) ER−/High (dark blue) and ER−/Low (pink) samples.

The order of the 122 genes along the x axis is determined by their S2N ratio (see Materials and Methods). The S2N metric for a particular gene takes into account both the difference in mean expression level between two classes, as well as the standard deviation in expression for that gene within each class being compared. Note that the specific order of the 122 genes in (a) and (b) are different, depending on their S2N ratio (Table 2). (c) and (d) depicted are the relative expression levels of the top 54 ER discriminating genes that are negatively correlated to ER+ status (11 belonging to the SAM-133 gene set, see supplementary info for details) in (c) ER/High (yellow) and ER+/Low (turquoise), and (d) ER−/High (dark blue) and ER−/Low (pink) samples. There are considerably less perturbations observed than in (a) and (b).

FIG. 4. ERBB2+ is associated with ‘low-confidence’ prediction across multiple breast cancer expression datasets. Data is taken from ref. 3. a) Identification of tumour samples (columns) expressing high levels of ERBB2 and other genes (MLN64, GRB7) physically linked to the 17 q ERBB2 chromosomal locus (rows). High expression is represented by a red square. Tumour samples 5141, 8443, 7636, 4527, 5955, 10444, 5985, 6936 exhibit high expression of ERBB2 and ERBB2-linked genes, while 6080 and 10188 exhibit elevated but weaker expression. b) Summary of ANN models for ER classification (adapted from FIG. 1b in ref. 3). Tumour samples classified as ER+ are blue while ER− tumours are orange. Prediction confidence is represented by each sample's standard deviation (SD), with ‘low confidence’ samples having a high SD. The eight ‘highly expressing’ ERBB2+ve samples are depicted (ERBB2 at the left or right of the sample SD). Note that tumour samples with high SDs tend to be ERBB2+ve.

FIG. 5. Principle component analysis (PCA), a mathematical technique that provides a projection of complex data sets onto a reduced, easily visualized space, provides a useful visual assessment of how clearly the samples are discriminated on the basis of the SAM-133 gene set. ER+ and ER− tumours are clearly distinguishable from one another, while ERBB2+ samples lie in the intermediate space. Color-coding scheme: ER+ERBB2−, yellow; ER+ERBB2−, turquoise; ER−ERBB2+, blue; and ER−ERBB2+, pink. Color-coding scheme: ER+ ERBB2−, yellow; ER+ERBB2+, turquoise; ER− ERBB2−, blue; and ER− ERBB2+, pink. X-axis is principle component 1 and Y-axis is component 2. Samples that lie at the left of the red line are ER+ except two ER− samples; while the samples on the right are ER− samples except one misclassification. Samples close to the boundary (in the square) are all ERBB2+.

FIG. 6 shows the clinical prognoses of patients with ‘high-confidence’ ER negative tumours to those patients harboring ‘low-confidence’ ER negative tumours. Two independent data sets were analyzed, referred to as the ‘Rosetta’ and ‘Stanford’ data sets. FIG. 6(a) shows Rosetta tumours: Relapse free survival was measured. 11/19 (58%) High-confidence patients developed distant metastasis within 5 years; while in Low-confidence ER− the number is 8/10. (80%). FIG. 6(b) shows Stanford tumours: Overall survival was measured. 7/12 (58%) High-confidence patients are dead; while in Low-confidence ER− the number is 5/7 (71%).

FIG. 7 shows identification of Tumors with Low Prediction Strength (“Low-confidence”) in the Stanford and Rosetta Data Sets

RESULTS

Classification of Breast Tumours by ER Status Using Expression Profiles from Chinese Patients Reveals a Distinct Population of ‘Low Confidence’ Samples

The overall incidence patterns of breast cancer in Caucasian and Asian populations are distinct (8), prompting the inventors to investigate if findings from previous reports (3, 4) could also be observed in their local patient population. They first used gene expression profile data to classify a set of breast tumours by their ER status. A training set of 55 breast tumours was selected, where the ER status of each tumour was pre-determined using IHC. Two classification methods were tested: weighted-voting (WV) and support vector machines (SVM), and classification accuracy was assessed through leave-one-out cross validation (LOOCV) (Supplementary Information). In addition to classifying a sample, quantitative metrics were used to provide an assessment of classification uncertainty (Materials and Methods). The overall classification accuracy on the training set was 95% (WV) and 96% (SVM), with seven samples characterized by ‘low confidence’ or marginal predictions (grey box, FIG. 1a). To determine if such ‘low-confidence’ samples could also be observed in an independent set of tumours, a second set of 41 tumours was used as an independent test set. Although the overall classification accuracy on the independent test set was 91% (WV and SVM), nine samples once again displayed a ‘low-confidence’ prediction (FIG. 1b). Thus, using two different classification methods (WV and SVM), certain breast tumours were found to exhibit a distinct ‘low-confidence’ character when being classified by ER status on the basis of their gene expression profiles.

Patients with ‘Low-Confidence’ Tumours Exhibit Decreased Overall Survival and Shorter Time to Distant Metastasis in Comparison to Patients with ‘High confidence’ Tumours

Since the differentiation of tumours into ‘high’ and ‘low-confidence’ sub-populations was achieved through a purely computational analysis of tumour gene expression profiles, it is unclear if this distinction is biologically or clinically meaningful, and if the use of gene expression profiles in this manner affords any substantial advantage over conventional immunohistochemical techniques to determine the ER status of breast tumours. To address this issue, the inventors investigated if the ‘low-confidence’ tumours might exhibit any clinical behaviors distinct from their ‘high-confidence’ counterparts. They used two publicly available breast cancer expression data sets for which related but distinct types of clinical information was available. The first set (9) consists of a cDNA microarray data set of 78 breast carcinomas and 7 nonmalignant samples with overall patient survival information (referred to as the Stanford data set). The second one (10) consists of 71 ER+ and 46 ER lymph-node negative tumours profiled using oligonucleotide-based microarrays, out of them 97 samples had the clinical information being the time interval from initial tumour diagnosis to the appearance of a new distant metastasis (referred to as the Rosetta dataset). The inventors used WV to classify the breast tumours in the Stanford and Rosetta datasets by their ER subtype. Consistent with their own data set, among the 56 ER+ and 18 ER tumours in the Stanford data set (4 tumours were removed due to lack of ER status information), they observed an overall LOOCV accuracy of 93%, with 14 tumours being classified as ‘low-confidence’. Similarly, the WV analysis also identified 15 tumours in the Rosetta data set as exhibiting a ‘low-confidence’ classification, with an overall LOOCV accuracy of 92%. These numbers are comparable to that observed in the inventors' own patient population.

They then compared the clinical behaviour of the ‘high’ and ‘low-confidence’ tumour populations using Kaplan-Meier analysis. As shown in FIG. 2, patients with ‘low-confidence’ tumours exhibited a significantly worse overall survival (p=0.0003, log rank test) and shorter time to distant metastasis (p=0.0001, log-rank test) than their ‘high confidence’ counterparts. This result indicates that the ‘high’ vs ‘low-confidence’ binary distinction is indeed clinically meaningful. The inventors then repeated this analysis, but first subdividing the tumours into independent ER+ and ER− categories. For ER+ tumours, they once again found that ‘low-confidence’ ER+ tumours were associated with a significantly worse overall survival (p=0.03, log-rank test) and shorter time to metastasis (p=0.004, log-rank test) (FIG. 2) than ‘high-confidence’ ER+ tumours. No statistically significant differences in overall survival and time to metastasis were observed for the ER− tumours. These results indicate that ER+ tumours can be subdivided on the basis of the ‘high’ and ‘low-confidence’ binary classification into distinct disease groups exhibiting different clinical behaviours. Since distinguishing between these two groups is currently not possible by conventional immunohistochemical methods used for ER detection, this result also demonstrates how gene expression profile data can be a useful adjunct to conventional strategies for breast cancer prognostication and staging.

‘Low-Confidence’ Tumours Exhibit Widespread Perturbations in the Expression of Genes Important for ER Subtype Discrimination

The classification algorithms used in these and other studies (e.g. WV, SVM, ANN, see below) all rely upon the combinatorial input of multiple discriminator genes whose individual contributions are then combined to arrive at a particular classification decision (i.e. if the tumour is ER+ or ER−). It is formally possible that the ‘low-confidence’ prediction status of these breast tumours is due to either the dramatic deregulation of a few key discriminator elements (i.e. specific effects), or the more subtle perturbation of a large number of discriminator genes (i.e. widespread effects). To distinguish between these two possibilities, the inventors compared the expression levels of genes important for ER subtype discrimination between ‘high’ and ‘low’ confidence tumours. First, to identify ER discriminating genes which where differentially regulated between ER+ and ER− tumours, they utilized a statistical technique called significance analysis of microarrays (SAM) (11).

Employing their combined dataset (total number=96 tumours), a total of 133 differentially regulated genes (SAM-133) were identified at a ‘false discovery rate’ (FDR) of 0% (the FDR is an index used by SAM to estimate the number of false positives—an FDR of 10% for 100 genes indicates that 10 genes are likely to be false positives). In this set, 122 genes were up-regulated in ER+ samples (ie positively correlated to ER status), while the remaining 11 were down-regulated in ER+ tumours (ie negatively correlated to ER). As predicted, the SAM-133 gene set includes a number of genes related to the ER pathway, such as ESR1, LIV1 (an estrogen-inducible genes), and TFF1, and some genes (e.g. GATA-3) were identified multiple times. A number of genes in the SAM-133 list are also found in similar lists reported by others (3, 4).

The inventors then subdivided the ER+ and ER− tumours each into ‘high’ and ‘low’ confidence categories (ie ER+/High, ER+/Low, ER−/High, ER−/Low), and the expression levels of the SAM-133 genes were compared between the groups (FIG. 3). Of the 122 genes in the SAM-133 gene set that were positively correlated to ER status, approximately 62% exhibited a significantly lower average expression level (referred as ‘perturbed expression’) in the ER+/Low samples compared to the ER+/High tumours (p<0.05, FIG. 3a and Table 2). Genes with ‘perturbed’ expression included ER, GATA3, BCL2, IGF1R, and RARA, while other ER-discriminator genes, such as TFF1, TFF3 and XBP1 were unaffected. Similarly, in the ER− ‘high’ and ‘low’ confidence samples, the inventors witnessed a reciprocal pattern where approximately 42% of the 122 genes exhibited a higher average expression level in the ER−/Low samples compared to the ER−/High tumours (p<0.05, FIG. 3b and Table 2). Intriguingly, although the expression levels of certain genes (e.g. GATA3, BCL2) were perturbed between ‘low’ and ‘high’ confidence samples in both the ER+ and ER− subtypes, the perturbation of other genes appeared to be subtype-specific. For example, ESR1 and IGFR1 were only perturbed in the ER+ samples, while XBP1 was only perturbed in the ER− samples. Finally, there were minimal changes in the expression levels of ER-discriminating genes that were negatively correlated to ER+ status (i.e. highly expressed in ER− tumours) (FIGS. 3c and d). This result suggests that the expression perturbations observed in the ‘low-confidence’ samples, although widespread, are primarily observed in genes whose expression is positively correlated to ER (Supplementary Information).

Elevated Expression of the ERBB2 Oncogene is Significantly Associated with the ‘Low-Confidence’ Predictions

The expression perturbations observed in the ‘low-confidence’ breast tumours could be due to multiple reasons, ranging from experimental variation (e.g. poor sample quality, tumour excision and handling), choice of the classification method, to population and sample heterogeneity. To gain insights into the possible mechanisms underlying these expression perturbations, the inventors attempted to determine if there were any specific histopathological parameters that might be correlated to the ‘low-confidence’ state. No significant associations were observed between the ‘low-confidence’ status of a tumour and patient age, lymph node status, tumour grade, p53 mutation status or progesterone receptor status (Table 1). The inventors discovered, however, a significant positive association (p<0.001, Supplementary Information) between a tumours' ERBB2 status and a ‘low confidence’ prediction. This correlation, observed using the training set data, was then assessed using the independent test set samples. Of the nine ‘low-confidence’ samples in the independent test set, eight tumours were also ERBB2+(8/9), indicating that this association is not dataset-specific.

The inventors also investigated if the correlation between the ‘low-confidence’ predictions with high ERBB2 expression could have been independently discovered by comparing the global expression profiles of ‘high’ and ‘low’ confidence tumours. First, they compared the ‘high-confidence’ and ‘low-confidence’ tumours belonging to the ER+ subtype. A total of 89 genes were identified as being significantly regulated (FDR=14%). Among the top 50 most significantly up-regulated genes in the ER+‘low-confidence’ samples, 3 genes—PMNT (ranked 4th), GRB7V (8th), and ERBB2 (36th) were of particular interest (Supplementary Information), as they are all physically located on the 17 q region, a frequent target of DNA amplification in breast cancer (12). In a separate analysis, the ER− ‘high-confidence’ and ER− ‘low-confidence’ samples were also compared. Among the top 50 genes identified as being differentially regulated (FDR=4%), the inventors once again identified the 17 q genes PMNT (ranked 5th), GRB7V (10th) and ERBB2 (28th) as exhibiting increased expression in the ‘low-confidence’ samples (Supplementary Information). Taken collectively, these results suggest that for both the ER+ and ER− subtypes, the ‘low-confidence’ breast tumours are significantly associated with increased expression of ERBB2 in comparison to the ‘high confidence’ tumours, most likely resulting from DNA amplification of the 17 q locus. However, please note that the association between ‘low-confidence’ prediction and ERBB2+ expression, although highly significant, is not perfect, as a few tumours that were designated as ERBB2+ by conventional IHC exhibited ‘high-confidence’ predictions, while not all ‘low-confidence’ tumours are ERBB2+. One possibility may be that other genes, besides ERBB2, may also contribute to a breast tumour exhibiting a ‘low-confidence’ state.

To validate their finding, the inventors then analyzed the other independently derived breast cancer expression datasets. First, of the nine ERBB2+ tumours in the Stanford data set, all nine were predicted as being in the ‘low-confidence’ group (p<0.001, Supplementary Information). Second, in the Rosetta data set, they once again found a significant association between the confidence level of prediction and ERBB2 expression (p<0.001, Supplementary Information). Third, Gruvberger and his colleagues utilized artificial neural networks (ANNs) on a cDNA microarray data set of 28 ER+ and 30 ER− samples to predict the ER status of breast tumours (3). Their results, shown in FIG. 4b, depicts the output of the ANN model with sample standard deviations (SDs), as assessed using the top 100 discriminator genes for ER subtype. Samples with a wide SD are analogous to the ‘low-confidence’ status of the WV and SVM methodologies. As can be seen from FIG. 4b, ERBB2+ samples (determined in FIG. 4a) tend to be associated with large SDs, which indicate high uncertainty, particularly for ER+ tumours. Taken collectively, the association between the confidence level of ER prediction and ERBB2 status was observed on a wide range of data sets originating from different laboratories utilizing different microarray technologies (Affymetrix, cDNA and oligonucleotide) on different patient populations (Asian, European/Caucasian), and predicted by different classification algorithms (WV, SVM, ANN). The commonality of these results on both the inventor data set and publicly available data sets suggests that the correlation between high ERBB2 expression to ‘low-confidence’ prediction status may be an inherent feature of breast cancer in general.

A Significant Proportion of Genes Perturbed in the Low Confidence Samples are not Known to be Regulated by Estrogen and Lack Potential EREs in their Promoters

The strong correlation between high ERBB2 levels and the widespread perturbations of ER-subtype discriminating genes observed in the ‘low-confidence’ tumours raises the possibility that ERBB2 may be functionally contribute towards this phenomenon. One possible mechanism by which this could occur is through ERBB2 signaling which has been proposed to inhibit the transcriptional activity of ER (see Discussion). Under this scenario, one might expect that a significant proportion of the genes perturbed between the ‘high-confidence’ (ERBB2−) and ‘low-confidence (ERBB2+) tumours would consist of genes regulated by ER. The inventors tested this hypothesis in two ways. First, they compared their list of significantly-perturbed genes (Table 2) to SAGE expression data derived from estrogen (E2) stimulated MCF-7 cells (13) to determine if the extent of overlap between the two. Only two genes (STC2, TFF1) were found in common between the SAGE data and the ‘perturbed’ gene list, and one (TFF1) was regulated in the opposite manner from that expected, exhibiting higher expression in the ERBB2+ samples. This result, within the limits of the cell line assay, suggests that many of the ‘perturbed’ genes in the ‘low confidence’ tumours may not be directly regulated by estrogen. Second, as in-vitro cell line studies may not fully recapitulate the effects of estrogen in vivo, the inventors then adopted a bioinformatics approach using a recently described algorithm, Dragon Estrogen Response Element Finder (DEREF), to search for putative estrogen-response elements (EREs) in the promoter regions of the perturbed genes (14). The prediction accuracy of DEREF has been validated in a number of in vivo examples—it detects ERE patterns 2.8× more frequently in the promoter regions of estrogen responsive versus non-responsive genes in a microarray experiment, and 5.4× more frequently in the promoters of genes belonging to the estrogen-induced SAGE dataset versus genes whose expression is negatively correlated to ER in breast cancers (Supplementary Information). Of the top 50 perturbed genes in the ER+tumours (Table 2), the transcriptional start sites of 35 could be accurately determined and thus were subsequently analyzed by DEREF. Of this 35, EREs were detected with high-confidence in only 12 promoters (total frequency 34%) (Table 2).

Conversely, of the top 50 perturbed genes in the ER− tumours, 33 were analyzed by DEREF and high-confidence EREs were detected in only 3 (total frequency 9%) (Table 2). Thus, EREs were detected in the promoters of perturbed genes in ER+ tumours at 3.7× higher frequency than in the ER− tumours. This difference was significant by a chi-square analysis (p=0.012), suggesting that ERBB2 may affect transcription in ER+ and ER tumours via distinct mechanisms (see Discussion). Regardless, EREs were not detected as over represented in the perturbed genes in both subtypes (ER+ and ER−), suggesting that these genes may not be direct transcriptional targets of ER. These genes may represent either indirect targets of ER, or may be transcriptionally regulated via ER-independent mechanisms.

Definition of a Optimal Gene Set to Classify Low and High Confidence Tumours Irrespective of ER Subtype

The objective of this analysis was to identify an optimal set of genes which could be used to classify “high” and “low-confidence” tumours regardless of their ER status.

Details

A total of 96 tumours were analyzed, of which 16 were LC and 80 were HC. A series of three independent analytical methods (SAM, GR, and WT, see below) were used to identify genes that were differently regulated between the two groups (LC and HC). The ability of these gene sets to classify the HC or LC status of a tumour was assessed by a leave-one-out cross validation assay using either Support Vector Machine or Weighted Voting as the classification algorithm.

Results

SAM (Significance Analysis of Microarrays): At a FDR (False-discovery rate) of <15%, a total of 86 up-regulated and 2 down-regulated genes in low-confidence tumours were identified. Using this gene set, the LOOCV assay produced a classification accuracy of 84%. The 88 genes are shown in Table A1.

GR (Gene Ranking by SVM): A total of 251 genes were identified with the ability to classify the HC or LC status of a tumour, with a classification accuracy of 86%. The 251 genes are shown in Table A2.

WT (Wilcoxon Test): At a P-value of <0.05 and a >=2-fold change cutoff, a total of 38 genes were identified. This 38 gene set delivered a LOOCV accuracy of 80%. The 38 genes are shown in Table A3.

13 ‘common’ genes among the three gene sets (SAM-88, GR-251, WT-38) were then identified. This 13 member gene achieved a classification accuracy of 84% by LOOCV. In essence, these 13 ‘common genes’ are robust significant markers and can archive comparable performance as other ‘complete’ marker sets. Hence they could be taken as ‘optimal’ genes. The 13 genes are shown in Table A4.

Clinical Outcome of ER Negative ‘High-Confidence’ vs ‘Low-Confidence’ Tumours

The objective of this analysis was to compare the clinical prognoses of patients with ‘high-confidence’ ER negative tumours to those patients harbouring ‘low-confidence’ ER negative tumours.

Details

Two independent data sets were analysed, referred to as the ‘Rosetta’ and ‘Stanford’ data sets. The Rosetta data set contains 29 ER negative tumours, of which 19 are ‘high-confidence’ while 10 are ‘low-confidence’. The Stanford data set contains 19 ER negative tumours, of which 12 are ‘high-confidence’ and 7 are ‘low-confidence’. The results of the analysis are shown in FIGS. 6(a) and 6(b).

In both cases, patients with ‘low-confidence’ tumours exhibited a worse prognosis than their high-confidence counterparts. Although this difference is not statistically significant, this may be due to low numbers of patients analyzed in these studies.

Discussion

The findings in this report complement and extend the previous work in this area related to the classification of breast tumours by ER subtype. In general, these studies have shown that while gene expression data can be successfully used to classify the ER subtype of most tumours, there invariably exists a certain population of tumours that exhibit a low-confidence of prediction and thus cannot be accurately classified (3, 4). The inventors decided to investigate these ‘low-confidence’ samples, by performing an in-depth analysis of these ‘low-confidence’ tumours. They made a number of surprising findings. They found that in comparison to patients with ‘high-confidence’ tumours, patients with ‘low-confidence’ tumours exhibited a significantly worse overall survival and shorter time to distant metastasis. The ‘high’ vs ‘low-confidence’ classification, arrived at by computational analysis of gene expression profiles, also served to separate ER+ tumours into groups exhibiting distinct clinical behaviours (FIG. 2). As the discernment of such subgroups is currently not possible using conventional immuno-histopathological techniques, these results also demonstrate how the classification of a breast tumour's ER status by expression profiling and computational analysis can be medically extremely useful.

The inventors also made the surprising finding that the ‘low-confidence’ state is significantly associated with elevated expression of the ERBB2 receptor. However, they emphasize that the connection between ERBB2 and ‘low-confidence’ predictions remains an association, and that at this point they have no evidence (from their own data) that ERBB2 is functionally responsible for causing the ‘low-confidence’ state. Nevertheless, given that ER and ERBB2 are currently the two most clinically relevant molecular biomarkers in breast cancer, it is tempting to speculate that these results suggest that there may exist substantial cross-talk between these two signaling pathways in breast cancer, a possibility that has also been proposed by others (7). Intriguingly, the association between ERBB2+ and ‘low-confidence’ prediction, although highly significant, is not perfect, as a few ERBB2+ tumours were also found to exhibit ‘high-confidence’ predictions, while not all ‘low-confidence’ tumours are ERBB2+. Thus, it is unlikely the ‘low-confidence’ population of breast tumours could have been discerned by conventional histopathological techniques used to detect ERBB2 such as IHC and FISH. Instead, the inventors believe that for tumours designed ERBB2+ by routine histopathology, that the further examination of these tumours for the presence of such characteristic ‘expression perturbations’ may be a promising method to distinguish between tumours that are likely to be more clinically aggressive versus those that will progress along a comparatively more indolent course.

Exploring this possibility will be an important task for future research. Clinically, elevated ERBB2 expression in ER+ breast tumours has long been associated with decreased sensitivity to anti-hormonal therapies, and a number of experimental papers have been reported addressing possible mechanisms by which ERBB2 activity might cause this effect. In general, the most popular model has been one in which elevated ERBB2 signaling causes ER to exhibit diminished transcriptional activity, either through transcriptional down-regulation of the ER gene (17), posttranslational modifications of ER (e.g. phosphorylation) (18), or via induction of ER binding corepressors such as MTA1 (19). If the effects of ERBB2 were mediated primarily through effects on ER transcriptional activity, then one might expect that a substantial number of the genes whose transcription is significantly perturbed in the ERBB2+‘low-confidence’ samples should correspond to genes which are direct targets of ER. The inventors found, however, that a significant proportion of the genes that were significantly perturbed in both ER+ and ER− tumours have not been previously identified as estrogen-induced genes, and these genes also appear to lack potential EREs in their promoters. This is particularly the case in the ER− tumours, in which only 9% of the significantly perturbed genes were found to contain high-confidence putative EREs in their promoters. Although the inventors cannot rule out the possibility that these perturbed genes may be indirect targets of ER or may be activated by ER via non-ERE mechanisms, these findings raise the possibility that ERBB2 activity may regulate a significant fraction of genes in breast tumours in an ER-independent fashion. There are numerous avenues by which this could occur. For example, ERBB2 might regulate other transcription factors besides ER through activation of the RAS/MAPK or PI3/Akt pathways (18).

Alternatively, ERBB2 activity may results in the induction of chromatin factors such as MTA1 which may play more pleiotropic effects (19).

Materials and Methods

Breast Tissue Samples and Patient Data Breast tissue samples and clinical data were obtained from the Tissue Repository in the institution National Cancer Center of Singapore, after appropriate approvals had been obtained from the institution's Repository and Ethics Committees. Samples were grossly dissected in the operating theater immediately after surgical excision, and flash-frozen in liquid N2. Histological information (ER, ERBB2) was provided by the Department of Pathology at Singapore General Hospital, and samples were selected to provide a comparable number of ER+ and ER− tumours (as determined by IHC) for each data set.

Tumour samples contained >50% tumour content as assessed by cryosections. 55 tumours (35 ER+ samples and 20 ER− samples), was used as training data, while a separate set of 41 tumours (21 ER+ and 20 ER− samples) was used for blind testing. A detailed list of all samples and clinical data for the patient is included in Table S1.

Sample Preparation and Microarray Hybridization

RNA was extracted from tissues using Trizol reagent and processed for Affymetrix Genechip hybridizations using U133A Genechips according to the manufacturer's instructions.

Data Preprocessing

Raw chip scans were quality controlled using the Genedata Refiner program and deposited into a central data storage facility. The expression data was pre-processed by removing genes whose expression was absent throughout all samples (i.e. ‘A’ calls), subjecting the remaining genes to a log 2 transformation, and mediate-centering by samples.

Prediction of ER Status

Two classification algorithms, weighted voting (WV) (20) and support vector machines (SVMs) (21), were used to classify breast tumours according to ER subtype. Classification accuracy is defined as the number of correctly classified samples divided by the total number of samples. For the WV analyses, classification accuracy was determined using a gene set of the top 50 discriminating genes for ER status, while the SVM-based binary classifier utilized all genes.

Weighted Voting (WV): The weighted voting algorithm utilizes a signal-to-noise (S2N) metric to perform binary classifications. Each gene belonging to a predictor set is assigned a ‘vote’, expressed as the weighted difference between the gene expression level in the sample to be classified and the average class mean expression level. Weighting is determined using the correlation metric

$P\left(g,c\right)=\frac{{\mu }_1-{\mu }_2}{{\sigma }_1+{\sigma }_2}$

(μ and σ denotes means and standard deviations of expression levels of the gene in each of the two classes). The ultimate vote for a particular class assignment is computed by summing all weighted votes made by each gene used in the class discrimination. The “prediction strength” (PS) is defined as:

$\mathrm{PS}=\frac{V_{\mathrm{WIN}}-V_{\mathrm{LOSE}}}{V_{\mathrm{WIN}}+V_{\mathrm{LOSE}}}$

where V_WIN and V_LOSE are the vote totals for the winning and losing classes, respectively. PS reflects the relative margin of victory and hence provides a quantitative reflection of prediction certainty.

Support Vector Machine (SVM): Support Vector Machines are classification algorithms which define a discrimination surface in the utilized feature (gene) space that attempts to maximally separate classes of training data (21). An unknown test sample's position relative to the discrimination surface determines its class. Distances are usually calculated in the n-dimensional gene space, corresponding to the total number of gene expression values considered. The inventors used SVM-FU (available at www.ai.mit.edu/projects/cbcl/) with the linear kernel to implement the SVM analysis. The confidence of each SVM prediction is based on the distance of a test sample from the discrimination surface, as previously described (22).

Identification of Low Confidence Tumours

Due to the clinical importance of achieving good prediction confidence, the inventors conservatively chose a high confidence threshold to minimize potential false positive classifications. On the basis of the leave-one-out cross validation (LOOCV) results, they used a threshold of 0.4 and identified 16 samples (out of a total of 96) as being in the ‘low confidence’ group. A tumour sample was assigned to the “low-confidence” category if its prediction strength (PS) from WV was less than this threshold.

Selection of Differentially Expressed Genes and Determination of Expression Perturbations Significance analysis of microarrays (SAM) is a statistical methodology developed to identify genes that are differentially expressed between separate groups (11). Genes are ranked are according to their statistical likelihood of being regulated. The SAM algorithm also performs a permutation analysis of the expression data to estimate the number of genes identified as being ‘differentially regulated’ by random chance (i.e. false positives). This number is the ‘false discovery rate’ (FDR). Depending upon the desired stringency, different reports have used FDRs ranging from <5% to 33% (23, 24).

Student's t-test was used to compare levels of expression in the SAM-133 gene set between ‘high’ and ‘low-confidence’ groups. A gene was classified as exhibiting significant ‘perturbed expression’ if its p-value was less than 0.05.

Computational Identification of Estrogen Response Elements (EREs) using DEREF A computational algorithm, Dragon ERE Finder (DEREF) (14), was used to identify putative estrogen response elements (EREs), which are DNA binding sites of ER within promoters (see http://sdmc.lit.org.sg/ERE-V2/index for a description of the underlying methodology of DEREF). On the default setting, DEREF produces on average one ERE pattern prediction per 13,000 nt on human genomic DNA, with a sensitivity of 83%. To reduce the number of false positives, the inventors applied in this report an additional criteria that a predicted ERE pattern of 17 nucleotides (14) also had to match (based on BLAST (25) matching without allowed gaps) a similar ERE pattern from at least one other human gene promoter, under conditions where the latter pattern could be predicted by DEREF at a sensitivity of 97%. The ERE searches in this report were performed against a database of approximately 11,000 reference human promoter sequences covering the range [−3000, +1000] relative to the 5′end of the gene, which was generated using the FIE2 program (26, 27). Some genes to be analyzed were not contained in this promoter database, and the ERE searches for these genes were thus not performed. Such genes are denoted in Table 2 by N/A.

Identification of Tumours with Low Prediction Strength (“Low-Confidence”) in Stanford and Rosetta Data Sets

Weighted Voting and Leave One Out Cross Validation was independently performed for two independent data sets (referred to as “Stanford” and “Rosetta” data sets). The results are plotted in a similar manner to those of FIG. 1, and the plots are shown in FIG. 7. In both data sets, the low-confidence tumours can be identified as the points at which tumours begin to demonstrate qualitatively reduced prediction strengths (PS's) (the ‘cliff-points’) from the majority of the tumour population. Although each dataset was analysed independently, the proportions of ‘low-confidence’ tumours for all datasets are highly comparable, ranging from 15-19% of all tumours (Rosetta data set shown in FIG. 7(a)=18/117 (15.4%); Stanford data set shown in FIG. 7(b)=14/74 (18.9%)), our data set=16/96 (16.7%))

Details of Different Array Technologies Used to Produce FIG. 7 Data

Stanford data set: This data was produced using 2-colour cDNA microarrays, in which PCR-amplified cDNA fragments (representing different genes) were robotically deposited onto a solid substrate to create the microarray

Rosetta data set: This data was produced using 2 colour oligonucleotide microarrays, in which 70-80mer oligonucleotides (representing different genes) were chemically synthesized in-situ on a solid substrate to create the microarray.

Details of Patient Populations

The Stanford data set consists of cDNA microarray data for 78 breast carcinomas (tumours) and 7 nonmalignant samples with overall patient survival information.

The Rosetta set consists of 117 early stage (lymph-node negative) breast tumours profiled using oligonucleotide-based microarrays

Population Size

As shown above, the low-confidence tumours occupy around 15-19% of each breast tumour population. To confidently identify this tumour subpopulation, a minimum data set of at least 25-30 profiles, preferably higher (around 80-100 tumours, as in the three data sets above) is preferably required.

Sample Data

Table S7 shows the mean (μ) and standard deviation (σ) parameters for use in a Weighted Voting algorithm for each gene of the SAM-133 geneset. These data could be used to assign the an unknown breast tumour sample as high or low confidence, given a set of expression levels for genes of the SAM-133 geneset. The genes of Table 2 are included in the SAM-133 geneset. The data is specific to Weighted Voting techniques applied to expression data from the Affymetrix U133 genechip.

Table S8 shows expression data for the Table A4 multigene classifier (common 13 genes) across high confidence and low confidence samples. The data are specific for the Affymetrix U133A genechip and have been through data preprocess. The gene expression profiles of the Table A4 multigene classifier can be used as training data to build a predictive model (eg, WV and SVM), which then can assign the confidence of an unknown breast tumour.

The data is tab delimited, and has the following format:

Columns:

1st column: Probe-ID of prognostic set genes2nd column: Gene Name3rd and other columns: gene expression data

Rows:

1st row: Sample Ids (35 samples)2nd row: Confidence (high or low) of sample.3rd and other rows: gene expression data

The gene expression data is derived as described in the ‘Sample Preparation and Microarray Hybridization’ and ‘Data Preprocessing’ (see Materials and Methods section).

Table S9 shows the mean (μ) and standard deviation (σ) parameters for use in a Weighted Voting algorithm for each gene of the Table A4 geneset. These data could be used to assign the an unknown breast tumour sample as high or low confidence, irrespective of ER status of the tumour, given a set of expression levels for genes of the Table A4 geneset.

The data is specific to Weighted Voting techniques applied to expression data from the Affymetrix U133 genechip.

REFERENCES

• 1. Tavassoli, F. A. and Schnitt S. J. (1992) Pathology of the Breast. In (Elsevier)
• 2. Biswas, D. K., Averboukh, L., Sheng, S., Martin, K. Ewaniuk, D. S., Jawde, T. F., Wang, F., Pardee, A. B. (1998) Classification of breast cancer cells on the basis of a functional assay for estrogen receptor. Mol Med, 4, 454-467
• 3. Gruvberger, S., M. Ringner, Y. Chen, S. Panavally, L. H. Saal, A. Borg, M. Ferno, C. Peterson, and P. Meltzer (2001) Estrogen Receptor Status in Breast Cancer is Associated with Remarkably Distinct Gene Expression Patterns. Cancer Research, 61, 5979-5984
• 4. West, M., Blanchette, C., Dressman, H., Huang, E., Ishida, S., Spang, R., Zuzan, H., Olson, J. A. Jr, Marks, J. R., Nevins, J. R. (2001) Predicting the clinical status of human breast cancer by using gene expression profiles. Proc Natl Acad Sci USA. 98, 11462-67.
• 5. Pietras R. J., Arboleda, J., Reese, D. M., Wongvipat, N., Pegram, M. D., Ramos, L., Gorman, C. M., Parker, M. G., Sliwkowski, M. X., Slamon, D. J. (1995) HER-2 tyrosine kinase pathway targets estrogen receptor and promotes hormone-independent growth in human breast cancer cells. Oncogene, 10, 2435-2446
• 6. Kurokawa, H. and Arteaga, C. L. (2001) Inhibition of erbB receptor (HER) tyrosine kinases as a strategy to abrogate antiestrogen resistance in human breast cancer. Clinical Cancer Research, 12, 4436s-4442s
• 7. Bange, J., Zwick, E., and Ullrich, A. (2001) Molecular targets for breast cancer therapy and prevention. Nature Medicine, 7, 548-552
• 8. Chia, K. S., A. Seow, H. P. Lee, and K. Shanmugaratnam (2000) Cancer Incidence in Singapore, 1993-1997. In (Singapore Cancer Registry)
• 9. Sorlie T, Perou C M, Tibshirani R, Aas T, Geisler S, Johnsen H, Hastie T, Eisen M B, van de Rijn M, Jeffrey S S, Thorsen T, Quist H, Matese J C, Brown P O, Botstein D, Eystein Lonning P, Borresen-Dale A L. (2001) Gene expression patterns of breast carcinomas distinguish tumour subclasses with clinical implications. Proc Natl Acad Sci USA. 98, 10869-74.
• 10. Van't Veer L J, Dai H, van de Vijver M J, He Y D, Hart A A, Mao M, Peterse H L, van der Kooy K, Marton M J, Witteveen A T, Schreiber G J, Kerkhoven R M, Roberts C, Linsley P S, Bernards R, Friend S H. (2002) Gene expression profiling predicts clinical outcome of breast cancer. Nature, 415, 530-6.
• 11. Tusher, V. G., R. Tibshirani, and G. Chu (2001) Significance Analysis of Microarrays Applied to the Ionizing Radiation Response. Proc. Natl. Acad. Sci USA. 98, 5116-5121
• 12. Kallioniemi A, Kallioniemi O P, Piper J, Tanner M, Stokke T, Chen L, Smith H S, Pinkel D, Gray J W, Waldman F M. (1994) Detection and mapping of amplified DNA sequences in breast cancer by comparative genomic hybridization. Proc Natl Acad Sci USA. 91, 2156-60.
• 13. Charpentier A H, Bednarek A K, Daniel R L, Hawkins K A, Laflin K J, Gaddis S, MacLeod M C, Aldaz C M. (2000) Effects of estrogen on global gene expression: identification of novel targets of estrogen action. Cancer Research, 60, 5977-83.
• 14. Bajic, V. B., Tan, S. L., Chong, A., Tang, S., Strom, A., Gustafsson, J., Lin, C. Y., Liu, E. (2002) Dragon ERE Finder ver.2: A tool for accurate detection and analysis of estrogen response elements in vertebrate genomes. Nucleic Acid Res., in press
• 15. Alizadeh, A. A., M. B. Eisen, R. E. Davis, C. Ma, I. S. Lossos, A. Rosenwald, J. C. Boldrick, H. Sabet, T. Truc, Y. Xin, J. I. Powell, L. Yang, G. E. Marti, T. Moore, J. Hudson, L. Lisheng, D. B. Lewis, R. Tibshirani, G. Sherlock, W. C. Chan, T. C. Greiner, D. D. Weisenburger, J. O. Armitage, R. Warnke, R. Levy, W. Wilson, M. R. Grever, J. C. Byrd, D. Botstein, P. O. Brown, and L. M. Staudt (2000) Distinct types of diffuse large B-cell lymphoma identified by gene expression profiling. Nature, 403, 503-511
• 16. Bittner, M., P. Meltzer, Y. Chen, Y. Jiang, E. Seftor, M. Hendeix, M. Radmacher, R. Simon, Z. Yakhini, A. Ben-Dor, N. Sampas, E. Dougherty, E. Wang, F. Marincola, C. Gooden, J. Lueders, A. Glatfelter, P. Pollock, J. Carpten, E. Gillanders, D. Leja, K. Dietrich, C. Beaudry, M. Berens, D. Alberts, V. Sondak, N. Hayward, and J. Trent (2000) Molecular classification of cutaneous malignant melenoma by gene expression profiling. Nature, 406, 536-540
• 17. Grunt T W, Saceda M, Martin M B, Lupu R, Dittrich E, Krupitza G, Harant H, Huber H, Dittrich C (1995). Bidirectional interactions between the estrogen receptor and the cerbB-2 signaling pathways: heregulin inhibits estrogenic effects in breast cancer cells. Int J Cancer, 63, 560-567
• 18. Stoica G E, Franke T F, Wellstein A, Morgan E, Czubayko F, List H J, Reiter R, Martin M B, Stoica A (2003). Heregulin-betal regulates the estrogen receptor-alpha gene expression and activity via the ErbB2/PI 3-K/Akt pathway. Oncogene, 22, 2073-2087.
• 19. Mazumdar, A., Wang, R. A., Mishra, S. K., Adam, L., Bagheri-Yarmand, R., Mandal, M., Vadlamudi, R. K., Kumar, R. (2000) Transcriptional repression of oestrogen receptor by metastasis-associated protein 1 corepressor. Nature Cell Biol, 3, 30-37
• 20. Golub T R, Slonim D K, Tamayo P, Huard C, Gaasenbeek M, Mesirov J P, Coller H, Loh M L, Downing J R, Caligiuri M A, Bloomfield C D, Lander E S. (1999). Molecular classification of cancer: class discovery and class prediction by gene expression monitoring. Science, 286, 531-7.
• 21. Vapnik V. (1998) Statistical Learning Theory. Wiley, New York.
• 22. Ramaswamy S, Tamayo P, Rifkin R, Mukherjee S, Yeang C H, Angelo M, Ladd C, Reich M, Latulippe E, Mesirov J P, Poggio T, Gerald W, Loda M, Lander E S, Golub T R. (2001) Multiclass cancer diagnosis using tumour gene expression signatures. Proc Natl Acad Sci USA. 98, 15149-54.
• 23. Mueller, A., O'Rourke, J., Grimm, J., Guillemin, K., Dixon, M. F., Lee, A. and Falkow, S. (2003) Distinct gene expression profiles characterize the histopathological stages of disease in Helicobacter-induced mucosa-associated lymphoid tissue lymphoma. Proc Natl Acad Sci USA, 100, 1292-1297.
• 24. Sanoudou, D., Haslett, J. N., Kho, A. T., Guo, S., Gazda, H. T., Greenberg, S. A., Lidov, H. G. V., Kohane, I. S., Kunkel, L. M., and Beggs, A. H. (2003) Expression profiling reveals altered satellite cell numbers and glycolytic enzyme transcription in nemaline myopathy muscle. Proc Natl Acad Sci USA, 100, 4666-4671.
• 25. Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W. and Lipman, D. J. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25, 3389-3402.
• 26. Chong, A., Zhang, G., Bajic, V. B. (2002) Information and sequence extraction around the 5′-end and translation initiation site of human genes, In Silico Biology, 2, 461-465.
• 27. Chong, A., Zhang, G., Bajic, V. B. (2003) FIE2: A program for the extraction of genomic DNA sequences around the start and translation initiation site of human genes, Nucleic Acids Research, in press.
• 28. Eisen M B, Spellman P T, Brown P O, Botstein D. (1998) Cluster analysis and display of genome-wide expression patterns. Proc Natl Acad Sci USA. 95(25), 14863-14868.

TABLE 1
Association Between Clinical Parameters and ER Classification Confidence
Training Data Set (This Report)	Stanford data set
	No. of	Mean	P		No. of	Mean	P
Patameter	patients	Confidence	value	Parameter	patients	Confidence	value
ERBB2			<0.001	ERBB2			<0.001
Positive	18	0.58		Positive	9	0.233
Negative	37	0.89		Negative	65	0.667
Age			0.45	Age			0.03
<55 yr	25	0.76		<55 yr	33	0.545
>=55 yr	30	0.81		>=55 yr	41	0.669
Node			0.98	Node			0.91
0	21	0.787		0	22	0.619
1-2	30	0.785		1-2	52	0.612
Histology			0.98	Histology			0.28
grade				grade
I	7	0.804		I	9	0.727
II	36	0.784		II	32	0.631
III-IV	8	0.779		III	32	0.583
PR			0.03	TP53			0.11
Positive	19	0.88		wild type	38	0.659
Negative	31	0.71		mutation	36	0.567

Table 2. The top 50 genes that are significantly perturbed between ER+/Low and ER+/High samples (a), and ER−/Low and ER−/High samples (b). In the ERE column, “ERE” indicates that the promoter contains a high confidence putative ERE as predicted by DEREF, “non-ERE” indicates that a putative ERE was not found, while “Low” indicates that an ERE was found for that promoter at medium confidence. N/A means that the promoter was not analyzed as it was not possible to determine their transcription start sites based on full-length transcripts. Genes are ranked in order of their S2N ratio between High and Low-confidence samples.

TABLE 2
Gene Name	UniGene	ERE	Rank
(a) ER+/Low vs. ER+/High
estrogen receptor 1	Hs.1657	Non-ERE	1
dynein, axonemal, light intermediate polypeptide 1	Hs.406050	Low	2
cytochrome c oxidase subunit VIc	Hs.351875	Non-ERE	3
annexin A9	Hs.279928	ERE	4
N-acetyltransferase 1 (arylamine N-acetyltransferase)	Hs.155956	ERE	5
cytochrome P450, subfamily IIB (phenobarbital-inducible),	Hs.1360	Low	6
polypeptide 6
retinoic acid receptor, alpha	Hs.361071	ERE	7
insulin-like growth factor 1 receptor	Hs.239176	N/A	8
serine (or cysteine) proteinase inhibitor, clade A (alpha-1	Hs.76353	Low	9
antiproteinase, antitrypsin), member 5
Homo sapiens cDNA: FLJ21695 fis, clone COL09653, mRNA	Hs.306803	N/A	10
sequence
B-cell CLL/lymphoma 2	Hs.79241	ERE	11
GREB1 protein	Hs.193914	Non-ERE	12
RNB6	Hs.241471	ERE	13
GATA binding protein 3	Hs.169946	Non-ERE	14
Homo sapiens mRNA; cDNA DKFZp564F053 (from clone	Hs.71968	N/A	15
DKFZp564F053), mRNA sequence
WW domain-containing protein 1	Hs.355977	Non-ERE	16
GDNF family receptor alpha 1	Hs.105445	Non-ERE	17
chromosome 1 open reading frame 34	Hs.125783	N/A	18
lymphoid nuclear protein related to AF4	Hs.38070	N/A	19
interleukin 6 signal transducer (gp130, oncostatin M receptor)	Hs.82065	Non-ERE	20
regulator of G-protein signalling 11	Hs.65756	ERE	21
Human insulin-like growth factor 1 receptor mRNA, 3′ sequence,	Hs.405998	N/A	22
mRNA sequence
hepsin (transmembrane protease, serine 1)	Hs.823	Non-ERE	23
sema domain, immunoglobulin domain (Ig), short basic domain,	Hs.82222	Non-ERE	24
secreted, (semaphorin) 3B
UDP-glucose ceramide glucosyltransferase	Hs.432605	ERE	25
cytochrome P450, subfamily IIB (phenobarbital-inducible),	Hs.330780	N/A	26
polypeptide 7
troponin T1, skeletal, slow	Hs.73980	N/A	27
microtubule-associated protein tau	Hs.101174	Non-ERE	28
seven in absentia homolog 2 (Drosophila)	Hs.20191	Non-ERE	29
progesterone receptor	Hs.2905	Non-ERE	30
KIAA0882 protein	Hs.90419	N/A	31
hypothetical protein FLJ20151	Hs.279916	Low	32
ATP-binding cassette, sub-family A (ABC1), member 3	Hs.26630	ERE	33
carbonic anhydrase XII	Hs.5338	ERE	34
solute carrier family 16 (monocarboxylic acid transporters), member 6	Hs.114924	Low	35
hypothetical protein FLJ12910	Hs.15929	Non-ERE	36
hypothetical protein FLJ20627	Hs.238270	Non-ERE	37
trichorhinophalangeal syndrome I	Hs.26102	Non-ERE	38
calsyntenin 2	Hs.12079	N/A	39
serine (or cysteine) proteinase inhibitor, clade A (alpha-1	Hs.234726	ERE	40
antiproteinase, antitrypsin), member 3
vav 3 oncogene	Hs.267659	Non-ERE	41
LIV-1 protein, estrogen regulated	Hs.79136	N/A	42
Homo sapiens mRNA; cDNA DKFZp434E082 (from clone	Hs.432587	N/A	43
DKFZp434E082), mRNA sequence
adenylate cyclase 9	Hs.20196	ERE	44
KIAA0876 protein	Hs.301011	N/A	45
heme binding protein 1	Hs.294133	ERE	46
stanniocalcin 2	Hs.155223	Low	47
complement component 4B	Hs.433721	N/A	48
solute carrier family 27 (fatty acid transporter), member 2	Hs.11729	N/A.	49
T-box 3 (ulnar mammary syndrome)	Hs.267182	Non-ERE	50
(b) ER−/Low vs. ER−/High
hypothetical protein FLJ20151	Hs.279916	Low	1
carbonic anhydrase XII	Hs.5338	Low	2
GATA binding protein 3	Hs.169946	Non-ERE	3
homolog of yeast long chain polyunsaturated fatty acid elongation	Hs.250175	Non-ERE	4
enzyme 2
WW domain-containing protein 1	Hs.355977	Non-ERE	5
X-box binding protein 1	Hs.149923	Non-ERE	6
adipose specific 2	Hs.74120	Low	7
melanoma antigen, family D, 2	Hs.4943	N/A	8
anterior gradient 2 homolog (Xenepus laevis)	Hs.91011	Non-ERE	9
cytochrome c oxidase subunit VIc	Hs.351875	Non-ERE	10
aldo-keto reductase family 7, member A3 (aflatoxin aldehyde	Hs.284236	N/A	11
reductase)
tight junction protein 3 (zona occludens 3)	Hs.25527	N/A	12
LAG1 longevity assurance homolog 2 (S. cerevisiae)	Hs.285976	ERE	13
inositol 1,4,5-triphosphate receptor, type 1	Hs.198443	Non-ERE	14
fructose-1,6-bisphosphatase 1	Hs.574	ERE	15
KIAA0882 protein	Hs.90419	N/A	16
hypothetical protein FLJ12910	Hs.15929	Non-ERE	17
LIV-1 protein, estrogen regulated	Hs.79136	N/A	18
methylcrotonoyl-Coenzyme A carboxylase 2 (beta)	Hs.167531	Non-ERE	19
cytochrome P450, subfamily IIB (phenobarbital-inducible),	Hs.330780	N/A	20
polypeptide 7
trefoil factor 3 (intestinal)	Hs.82961	Low	21
Human clone 23948 mRNA sequence	Hs.159264	N/A	22
N-acetyltransferase 1 (arylamine N-acetyltransferase)	Hs.155956	Low	23
GREB1 protein	Hs.193914	Non-ERE	24
retinoic acid induced 3	Hs.194691	Non-ERE	25
solute carrier family 16 (monocarboxylic acid transporters), member 6	Hs.114924	Low	26
dynein, axonemal, light intermediate polypeptide 1	Hs.406050	Low	27
solute carrier family 7 (cationic amino acid transporter, y+ system),	Hs.22891	Low	28
member 8
WD repeat domain 10	Hs.70202	Non-ERE	29
calsyntenin 2	Hs.12079	N/A	30
v-myb myeloblastosis viral oncogene homolog (avian)	Hs.1334	Low	31
trefoil factor 1 (breast cancer, estrogen-inducible sequence	Hs.350470	Low	32
expressed in)
hypothetical protein MGC2601	Hs.124915	ERE	33
dachshund homolog (Drosophila)	Hs.63931	Non-ERE	34
mucin 1, transmembrane	Hs.89603	N/A	35
complement component 4B	Hs.433721	N/A	36
cysteine-rich protein 1 (intestinal)	Hs.423190	N/A	37
NPD009 protein	Hs.283675	Low	38
sema domain, immunoglobulin domain (Ig), short basic domain,	Hs.82222	Non-ERE	39
secreted, (semaphorin) 3B
HRAS-like suppressor 3	Hs.37189	N/A	40
ATP-binding cassette, sub-family A (ABC1), member 3	Hs.26630	Low	41
microtubule-associated protein tau	Hs.101174	Non-ERE	42
Myosin VI [Homo sapiens], mRNA sequence	Hs.385834	N/A	43
CGI-49 protein	Hs.238126	N/A	44
retinoic acid receptor, alpha	Hs.361071	Low	45
vav 3 oncogene	Hs.267659	Non-ERE	46
chromosome 1 open reading frame 34	Hs.125783	N/A	47
estrogen receptor 1	Hs.1657	Non-ERE	48
solute carrier family 27 (fatty acid transporter), member 2	Hs.11729	N/A	49
TBX3-iso protein	Hs.332150	N/A.	50

TABLE S1
Clinical information of breast tumor samples.
Table S1. Clinical Information for our data sets
Sample ID	ER	ERBB2*	PR	AGE	NODE	STAGE	RACE
The initial collection (55 samples)
980177	+	neg	+	75	2	IIIA	CHINESE
980178	+	neg	−	69	1	IIB	CHINESE
980194	−	pos	−	58	1	IIB	CHINESE
980197	+	pos	+	55	1	IIB	CHINESE
980203	+	neg	+	44	0	I	CHINESE
980208	+	neg	+	42	1	IIB	CHINESE
980214	+	pos	−	49	1	IIIB	CHINESE
980215	+	neg	−	54			CHINESE
980216	−	neg	−	65	1	IIB	Indian
980217	+	neg		54	1	IIB	CHINESE
980220	+	pos		43	0	IIA	CHINESE
980221	+	neg	+	34	1	IV	CHINESE
980238	−	pos		62			CHINESE
980247	−	neg		35			CHINESE
980261	+	neg	−	60			CHINESE
980338	−	neg	−	55	0	IIA	CHINESE
980346	+	neg	+	54	0	I	CHINESE
980353	−	neg	−	59	0	IIA	CHINESE
980373	−	pos	−	77	0	IIA	CHINESE
980380	−	pos	−	55	0	I	CHINESE
980383	+	neg		66	0	IIA	CHINESE
980391	+	neg	+	56	0	I	CHINESE
980395	−	pos	−	68	1	IIB	CHINESE
980396	−	pos	−	66	1	IIB	CHINESE
980403	+	neg	+	73	0	IIA	CHINESE
980404	+	neg	+	46	1	IIB	CHINESE
980409	+	neg	−	48	0	I	CHINESE
980411	−	neg	−	72	0	IIA	CHINESE
980434	+	neg	+	73	0	IIA	CHINESE
980441	−	neg	−	66	1	IIB	CHINESE
990075	+	neg	+	66	1	IIB	CHINESE
990082	+	neg	+	49	1	IIB	CHINESE
990107	+	neg	−	51	1	IIB	Indian
990113	+	neg	+	70	1	IIIA	CHINESE
990115	+	pos	+	38	1	IIB	CHINESE
990123	+	neg	+	53	1	IIIA	CHINESE
990134	−	pos	−	43	0	IIA	CHINESE
990148	+	pos	−	60	1	IIB	CHINESE
990174	−	neg	−	56	1	IIB	CHINESE
990223	+	pos	−	52	1	IIA	CHINESE
990262	−	pos	−	68	1	IIB	CHINESE
990299	−	neg	−	58	1	IIIA	CHINESE
990375	+	neg	−	38	0	I	CHINESE
2000209	+	pos	−	58	0	IIA	CHINESE
2000422	+	neg	+	52	1	IIIA	CHINESE
2000500	−	neg	−	44	1	IV	CHINESE
2000683	+	neg	+	72	0	IIA	CHINESE
2000759	−	pos	−	57	0	I	CHINESE
2000768	+	neg	+	39	0	IIA	CHINESE
2000775	+	neg	−	51	0	IIA	CHINESE
2000779	+	neg	−	48	0	IIB	CHINESE
2000804	+	neg	+	39	1	IIB	CHINESE
2000813	−	pos	−	60	1	IIB	CHINESE
2000829	−	pos	−	51	1	IIB	CHINESE
2000948	+	neg	−	56	1	IIB	CHINESE
The second collection (41 samples)
980058	+	neg		72			CHINESE
980193	−	neg		49			CHINESE
980256	−	neg		46			CHINESE
980278	+	neg		64			CHINESE
980285	−	neg		49			CHINESE
980288	+	pos		45			INDIAN
980315	−	neg		59			CHINESE
980333	+	neg		51			CHINESE
980335	−	pos		33			CHINESE
2000104	+	pos		59			CHINESE
2000171	−	pos		50			CHINESE
2000210	−	pos		50			MALAY
2000215	+	neg		50			CHINESE
2000220	+	neg		52			CHINESE
2000237	+	pos		43			CHINESE
2000272	+	neg		50			INDIAN
2000274	+	neg		40			CHINESE
2000287	−	pos		53			CHINESE
2000320	−	neg		67			CHINESE
2000376	−	pos		65			CHINESE
2000399	−	P05		44			CHINESE
2000401	+	neg		51			CHINESE
2000593	−	neg		60			CHINESE
2000597	+	neg		57			CHINESE
2000609	+	neg		62			CHINESE
2000638	−	neg		60			CHINESE
2000641	−	pos		47			MALAY
2000651	+	neg		45			CHINESE
2000652	−	pos		56			CHINESE
2000675	−	pos		78			CHINESE
2000709	−	pos		45			CHINESE
2000731	−	neg		68			INDIAN
2000787	+	neg		57			CHINESE
2000818	+	neg		52			CHINESE
2000880	−	neg		54			CHINESE
20020021	+	neg		64			CHINESE
20020051	+	neg		38			MALAY
20020056	+	neg		71			INDIAN
20020071	+	neg		58			CHINESE
20020090	−	pos		60			CHINESE
20020160	+	neg		82			CHINESE
*Determination of ERBB2 status: In the training set (55 samples), ERBB2 status was determined by conventional immunohistochemistry and in agreement with expression profiling. 21 are reported as ERBB2+. For other data sets, ERBB2 status was determined by expression profiling and analysis of ERBB2 and other 17q-linked genes.

Table S2: Classification Results of Independent Test and External Breast Cancer Datasets

Leave-One-Out Cross Validation (LOOCV): We used a standard leave-one-out cross-validation (LOOCV) approach to assess classification accuracy in the training set. In LOOCV, one sample in the training set is initially ‘left out’, and the classifier operations (eg gene selection and classifier training) are performed on the remaining samples. The ‘left out’ sample is then classified using the trained algorithm, and this process is then repeated for all samples in the training set.

The output of the WV analyses for all four data sets (including PS) and corresponding p-values for the association of ERBB2 expression with prediction confidence can be obtained as an Excel file from http://www.omniarray.com/ERClassification.html.

Table S3: Identification of Genes Important for ER Subtype Discrimination

Significance Analysis of Microarrays (SAM) was used to identify and rank 133 genes that were differentially regulated between ER+ and ER− tumors (FDR of 0%, ≧2-fold expression change). 122 of them are up-regulated in ER+(positive gene) and 11 are down-regulated in ER+ (negative genes). The S2N ratio of a particular gene reflects the extent of the expression perturbation observed between Low and High confidence samples.

TABLE S3
SAM-133 Gene List
	S2N Ratio
Rank	Probe_ID	UG	Gene Name	GB_Accession	ER−	ER+
122 Genes Positively Correlated to ER+ Status
1	205225_at	Hs.1657	estrogen receptor 1	NM_000125.1	−0.29577	1.273725
2	209603_at	Hs.169946	GATA-binding protein 3	AI796169_RC	−1.08401	0.863193
3	204508_s_at	Hs.279916	hypothetical protein FLJ20151	BC001012.1	−1.78617	0.608118
4	209604_s_at	Hs.169946	GATA-binding protein 3	BC003070.1	−1.45575	0.776251
5	209602_s_at	Hs.169946	GATA-binding protein 3	AI796169_RC	−0.8137	0.654881
6	206754_s_at	Hs.1360	cytochrome P450, subfamily IIB	NM_000767.2	−0.2593	1.022511
			(phenobarbital-Inducible), polypeptide 6
7	203963_at	Hs.5338	carbonic anhydrase XII	NM_001218.2	−1.46907	0.598453
8	214164_x_at	Hs.5344	adaptor-related protein complex 1,	BF752277	−1.38937	0.650127
			gamma 1 subunit
9	212956_at	Hs.90419	KIAA0882 protein	AI348094_RC	−0.64903	0.68526
10	215867_x_at	Hs.5344	adaptor-related protein complex 1,	AL050025.1	−1.63678	0.613887
			gamma 1 subunit
11	210735_s_at	Hs.5338	carbonic anhydrase XII	BC000278.1	−1.44687	0.484214
12	214440_at	Hs.155956	N-acetyltransferase 1 (arylamine N-	NM_000662.1	−0.52605	1.043165
			acetyltransferase)
13	202089_s_at	Hs.79136	LIV-1 protein, estrogen regulated	NM_012319.2	−0.61899	0.528173
14	210085_s_at	Hs.279928	annexin A9	AF230929.1	−0.24463	1.123041
15	205862_at	Hs.193914	KIAA0575 gene product	NM_014668.1	−0.51927	0.883508
16	202088_at	Hs.79136	LIV-1 protein, estrogen regulated	AI635449_RC	−0.5332	0.584697
17	211712_s_at		Homo sapiens, clone MGC: 1925,	BC005830.1
			mRNA, complete cds.
18	206401_s_at	Hs.101174	microtubule-associated protein tau	J03778.1	−0.33797	0.700836
19	215304_at	Hs.159264	Human clone 23948 mRNA sequence	U79293.1	−0.52908	0.19541
20	218195_at	Hs.15929	hypothetical protein FLJ12910	NM_024573.1	−0.62769	0.590894
21	212195_at	Hs.71968	Homo sapiens mRNA; cDNA	AL049265.1	−0.22898	0.854505
			DKFZp564F053 (from clone
			DKFZp564F053)
22	203928_x_at	Hs.101174	microtubule-associated protein tau	AI870749_RC	−0.35356	0.682993
23	209460_at	Hs.283675	NPD009 protein	AF237813.1	−0.18444	0.451265
24	212960_at	Hs.90419	KIAA0882 protein	BE646554_RC	−0.58169	1.072165
25	209443_at	Hs.76353	serine (or cysteine) proteinase inhibitor,	J02639.1	0.065273	0.94045
			clade A (alpha-1 antiproteinase,
			antitrypsin), member 5
26	209173_at	Hs.91011	anterior gradient 2 (Xenepus laevis)	AF088867.1	−0.80392	−0.25677
			homolog
27	203071_at	Hs.82222	sema domain, immunoglobulin domain	NM_004636.1	−0.39014	0.726153
			(Ig), short basic domain, secreted,
			(semaphorin) 3B
28	203571_s_at	Hs.74120	adipose specific 2	NM_006829.1	−0.81429	0.240008
29	205354_at	Hs.81131	guanidinoacetate N-methyltransferase	NM_000156.3	−0.01557	0.074452
30	213712_at	Hs.30504	Homo sapiens mRNA; cDNA	BF508639_RC	0.008265	0.522867
			DKFZp434E082 (from clone
			DKFZp434E082)
31	41660_at		Cluster Incl. AL031588: dJ1163J1.1
			(ortholog of mouse transmembrane receptor Celsr1
			(KIAA0279 LIKE EGF-like domain containing
			protein similar to rat MEG
32	220744_s_at	Hs.70202	WD repeat domain 10	NM_018262.1	−0.48046	0.159954
33	204798_at	Hs.1334	v-myb avian myeloblastosis viral	NM_005375.1	−0.46303	0.284211
			oncogene homolog
34	215552_s_at	Hs.272288	Human DNA sequence from clone RP1-	AI073549_RC	−0.19227	0.946801
			63I5 on chromosome 6q25.1-26.
			Contains the 3 part of a novel gene and
			an exon of the ESR1 gene for estrogen
			receptor 1 (NR3A1, estradiol receptor),
			ESTs, STSs and GSSs
35	209339_at	Hs.20191	seven in absentia (Drosophila) homolog 2	U76248.1	−0.0458	0.698282
36	210272_at	Hs.330780	Human cytochrome P450-IIB (hIIB3)	M29873.1	−0.58159	0.717949
			mRNA, complete cds
37	205186_at	Hs.33846	dynein, axonemal, light intermediate	NM_003462.2	−0.49548	1.221071
			polypeptide
38	207414_s_at	Hs.170414	paired basic amino acid cleaving	NM_002570.1	−0.00943	0.222009
			system 4
39	205009_at	Hs.1406	trefoil factor 1 (breast cancer, estrogen-	NM_003225.1	−0.44277	0.213135
			inducible sequence expressed in)
40	203628_at	Hs.239176	insulin-like growth factor 1 receptor	H05812_RC	0.241512	0.748503
41	211323_s_at	Hs.198443	inositol 1,4,5-triphosphate receptor,	L38019.1	−0.72886	0.116021
			type 1
42	201825_s_at	Hs.238126	CGI-49 protein	AL572542_RC	−0.32444	0.398111
43	211234_x_at	Hs.1657	estrogen receptor 1	AF258449.1	0.268077	0.482442
44	209459_s_at	Hs.283675	NPD009 protein	AF237813.1	−0.40497	0.048419
45	212196_at	Hs.71968	Homo sapiens mRNA; cDNA	AW242916_RC	−0.0843	0.516679
			DKFZp564F053 (from clone
			DKFZp564F053)
46	203438_at	Hs.155223	stanniocalcin 2	AI435828_RC	−0.15925	0.456003
47	217838_s_at	Hs.241471	RNB6	NM_016337.1	0.38602	0.872588
48	204041_at	Hs.82163	monoamine oxidase B	NM_000898.1	0.050799	0.120203
49	203929_s_at	Hs.101174	microtubule-associated protein tau	AI056359_RC	−0.27747	0.427658
50	200670_at	Hs.149923	X-box binding protein 1	NM_005080.1	−0.83621	0.279976
51	219414_at	Hs.12079	calsyntenin-2	NM_022131.1	−0.47893	0.553864
52	203627_at	Hs.239176	insulin-like growth factor 1 receptor	AI830698_RC	0.088492	0.976305
53	208451_s_at	Hs.278625	complement component 4B	NM_000592.2	−0.42162	0.448767
54	213419_at	Hs.324125	amyloid beta (A4) precursor protein-	U62325.1	−0.01491	−0.06708
			binding, family B, member 2 (Fe65-like)
55	205768_s_at	Hs.11729	fatty-acid-Coenzyme A ligase, very	NM_003645.1	−0.26778	0.41298
			long-chain 1
56	204862_s_at	Hs.81687	non-metastatic cells 3, protein	NM_002513.1	−0.24568	0.320418
			expressed in
57	210480_s_at	Hs.22564	myosin VI	U90236.2	−0.3344	−0.15111
58	205696_s_at	Hs.105445	GDNF family receptor alpha 1	NM_005264.1	0.013863	0.846687
59	203685_at	Hs.79241	B-cell CLLlymphoma 2	NM_000633.1	0.385651	0.915025
60	218976_at	Hs.260720	J domain containing protein 1	NM_021800.1	−0.17876	0.280663
61	219197_s_at	Hs.222399	CEGP1 protein	AI424243_RC	−0.09661	0.157384
62	202996_at	Hs.82520	polymerase (DNA-directed), delta 4	NM_021173.1	0.158087	0.060137
63	205734_s_at	Hs.38070	lymphoid nuclear protein related to AF4	AI990465_RC	0.187651	0.796703
64	211235_s_at	Hs.1657	estrogen receptor 1	AF258450.1	0.269909	0.7271
65	211000_s_at	Hs.82065	interleukin 6 signal transducer (gp130,	AB015706.1	0.204138	0.785104
			oncostatin M receptor)
66	217190_x_at	Hs.247976	Estrogen receptor {exon 6} human,	S67777	0.17102	0.653981
			tamoxifen-resistant breast tumor 17,
			Genomic Mutant, 187 nt
67	202752_x_at	Hs.22891	solute carrier family 7 (cationic amino	NM_012244.1	−0.48423	0.153806
			acid transporter, y+ system), member 8
68	201754_at	Hs.74649	cytochrome c oxidase subunit VIc	NM_004374.1	−0.79843	1.207003
69	204623_at	Hs.82961	trefoil factor 3 (intestinal)	NM_003226.1	−0.53903	0.149093
70	207038_at	Hs.114924	solute carrier family 16 (monocarboxylic	NM_004694.1	−0.50672	0.593732
			acid transporters), member 6
71	212637_s_at	Hs.324275	Homo sapiens mRNA; cDNA	AU155187_RC	−0.851	0.852788
			DKFZp434D2111 (from clone
			DKFZp434D2111)
72	208682_s_at	Hs.4943	hepatocellular carcinoma associated	AF126181.1	−0.80969	−0.06845
			protein; breast cancer associated gene 1
73	218502_s_at	Hs.26102	trichorhinophalangeal syndrome I	NM_014112.1	−0.26191	0.571226
74	202376_at	Hs.234726	serine (or cysteine) proteinase inhibitor,	NM_001085.2	0.02888	0.549323
			clade A (alpha-1 antiproteinase,
			antitrypsin), member 3
75	215616_s_at	Hs.301011	KIAA0876 protein	AB020683.1	−0.00184	0.507129
76	211233_x_at	Hs.1657	estrogen receptor 1	M12674.1	0.360947	0.949046
77	205081_at	Hs.17409	cysteine-rich protein 1 (intestinal)	NM_001311.1	−0.41153	−0.05483
78	214428_x_at	Hs.170250	complement component 4A	K02403.1	−0.22882	0.346824
79	209696_at	Hs.574	fructose-1,6-bisphosphatase 1	D26054.1	−0.68072	0.137814
80	219682_s_at	Hs.332150	TBX3-iso protein	NM_016569.1	−0.26452	0.412502
81	212496_s_at	Hs.301011	KIAA0876 protein	BE256900	−0.272	0.841331
82	203108_at	Hs.194691	retinoic acid induced 3	NM_003979.2	−0.51766	0.212322
83	206107_at	Hs.65756	regulator of G-protein signalling 11	NM_003834.1	−0.0233	0.778074
84	218806_s_at	Hs.267659	vav 3 oncogene	AF118887.1	−0.3126	0.544105
85	209581_at	Hs.37189	similar to rat HREV107	BC001387.1	−0.37261	0.359298
86	213412_at	Hs.25527	tight junction protein 3 (zona occludens	NM_014428.1	−0.76231	0.227893
			3)
87	212638_s_at	Hs.324275	Homo sapiens mRNA; cDNA	BF131791	−0.76733	0.888627
			DKFZp434D2111 (from clone
			DKFZp434D2111)
88	206469_x_at	Hs.284236	aldo-keto reductase family 7, member	NM_012067.1	−0.77705	0.278936
			A3 (aflatoxin aldehyde reductase)
89	210652_s_at	Hs.125783	DEME-6 protein	BC004399.1	−0.29655	0.806265
90	216381_x_at	Hs.284236	aldo-keto reductase family 7, member	AL035413	−0.61275	0.253454
			A3 (aflatoxin aldehyde reductase)
91	216092_s_at	Hs.22891	solute carrier family 7 (cationic amino	AL365347.1	−0.67193	0.152525
			acid transporter, y+ system), member 8
92	208788_at	Hs.250175	homolog of yeast long chain	AL136939.1	−0.87121	0.346787
			polyunsaturated fatty acid elongation
			enzyme 2
93	204792_s_at	Hs.111862	KIAA0590 gene product	NM_014714.1	0.085973	0.134751
94	207847_s_at	Hs.89603	mucin 1, transmembrane	NM_002456.1	−0.42941	−0.24975
95	213201_s_at	Hs.73980	troponin T1, skeletal, slow	AJ011712	−0.11892	0.71764
96	204497_at	Hs.20196	adenylate cyclase 9	AB011092.1	0.007184	0.509774
97	222314_x_at	Hs.205660	ESTs	AW970881_RC	−0.1322	0.201872
98	222212_s_at	Hs.285976	tumor metastasis-suppressor	AK001105.1	−0.74148	0.357607
99	219919_s_at	Hs.279808	hypothetical protein FLJ10928	NM_018276.1	0.085456	0.152147
100	214053_at	Hs.7888	Homo sapiens clone 23736 mRNA	AW772192_RC	−0.21533	0.32841
			sequence
101	204934_s_at	Hs.823	hepsin (transmembrane protease,	NM_002151.1	−0.03851	0.743961
			serine 1)
102	216109_at	Hs.306803	Homo sapiens cDNA: FLJ21695 fis,	AK025348.1	−0.03594	0.921802
			clone COL09653
103	203749_s_at	Hs.250505	retinoic acid receptor, alpha	AI806984_RC	−0.3159	1.006049
104	220329_s_at	Hs.238270	hypothetical protein FLJ20627	NM_017909.1	0.068053	0.588123
105	204881_s_at	Hs.152601	UDP-glucose ceramide	NM_003358.1	−0.248	0.724338
			glucosyltransferase
106	208305_at	Hs.2905	progesterone receptor	NM_000926.1	0.145722	0.687258
107	209623_at	Hs.167531	methylcrotonoyl-Coenzyme A	AW439494_RC	−0.61293	0.369239
			carboxylase 2 (beta)
108	218450_at	Hs.108675	heme-binding protein	NM_015987.1	−0.07982	0.486745
109	204343_at	Hs.26630	ATP-binding cassette, sub-family A	NM_001089.1	−0.36256	0.648789
			(ABC1), member 3
110	219051_x_at	Hs.124915	hypothetical protein MGC2601	NM_024042.1	−0.43578	0.112222
111	205471_s_at	Hs.63931	dachshund (Drosophila) homolog	AW772082_RC	−0.43168	−0.26408
112	203439_s_at	Hs.155223	stanniocalcin 2	BC000658.1	−0.28836	0.67174
113	204863_s_at	Hs.82065	Interleukin 6 signal transducer (gp130,	BE856546_RC	0.259289	0.691633
			oncostatin M receptor)
114	203289_s_at	Hs.19699	Conserved gene telomeric to alpha	BE791629	−0.18036	0.122646
			globin cluster
115	221765_at	Hs.23703	ESTs	AI378044_RC	−0.0539	0.714017
116	219001_s_at	Hs.317589	hypothetical protein MGC10765	NM_024345.1	−0.28755	0.64098
117	220581_at	Hs.287738	hypothetical protein FLJ23305	NM_025059.1	−0.13763	0.781039
118	211596_s_at		Homo sapiens mRNA for membrane	AB050468.1
			glycoprotein LIG-1, complete cds.
119	205645_at	Hs.80667	RALBP1 associated Eps domain	NM_004726.1	−0.29164	0.308819
			containing 2
120	219663_s_at	Hs.157527	hypothetical protein MGC4659	NM_025268.1	0.059072	−0.06016
121	205380_at	Hs.15456	PDZ domain containing 1	NM_002614.1	0.094959	0.486972
122	201508_at	Hs.1516	insulin-like growth factor-binding protein 4	NM_001552.1	0.102433	0.237825
11 Genes Negatively Correlated to ER+ Status
1	215729_s_at	Hs.9030	TONDU	BE542323	0.729732	−0.40161
2	201983_s_at	Hs.77432	epldermal growth factor receptor (avian	AW157070_RC	0.183968	−0.10873
			erythroblastic leukemia viral (v-erb-b)
			oncogene homolog)
3	204914_s_at	Hs.32964	SRY (sex determining region Y)-box 11	AW157202_RC	−0.3552	−0.61822
4	204913_s_at	Hs.32964	SRY (sex determining region Y)-box 11	AI360875_RC	−0.54222	−0.6594
5	205646_s_at	Hs.89506	paired box gene 6 (aniridia, keratitis)	NM_000280.1	0.667994	−0.15217
6	207030_s_at	Hs.10526	cysteine and glycine-rich protein 2	NM_001321.1	0.526203	−0.44193
7	204915_s_at	Hs.32964	SRY (sex determining region Y)-box 11	AB028641.1	−0.4419	−0.47414
8	203021_at	Hs.251754	secretory leukocyte protease inhibitor	NM_003064.1	−0.08293	−1.00559
			(antileukoproteinase)
9	209800_at	Hs.115947	keratin 16 (focal non-epidermolytic	AF061812.1	0.573263	−0.29962
			palmoplantar keratoderma)
10	203234_at	Hs.77573	uridine phosphorylase	NM_003364.1	0.30456	0.307505
11	201984_s_at	Hs.77432	epldermal growth factor receptor (avian	NM_005228.1	0.416409	0.086073
			erythroblastic leukemia viral (v-erb-b)
			oncogene homolog)

Top 54 ER Discriminating Genes that are Negatively Correlated to ER+ Status

Due to the limited number of ER negative genes, we decreased the threshold of SAM to derive 54 genes with FDR of 0%. These negative genes were used in FIG. 2c) and d).

Table S4: Comparing the Global Expression Profiles of ‘High’ and ‘Low-Confidence’ Tumors

SAM was used to identify differentially regulated genes between a) ER+ ‘High’ and ‘Low’ Confidence tumors, and b) ER− ‘High’ and ‘Low’ Confidence tumors. For the ER+ comparison, 50 genes were identified as up-regulated in ER+/Low and 39 are downregulated in comparison to ER+/High tumors. For the ER− comparison, 50 genes were identified as up-regulated in ER−/Low, and no genes were identified as being downregulated in comparison to ER−/High tumors.

TABLE S4
Top-ranked genes differently expressed in Low/High confidence samples
	UniGene	Rank	Chromosome
a) ER+/Low vs. ER+/High
Genes Up-regulated in ER+/Low
chloride channel, calcium activated, family member 2	Hs.241551	1
ESTs, Weakly similar to hypothetical protein H. sapiens	Hs.106642	2
v-myc avian myelocytomatosis viral related oncogene, neuroblastoma	Hs.25960	3
derived
phenylethanolamine N-methyltransferase	Hs.1892	4	17q21-q22
Alu-binding protein with zinc finger domain	Hs.289104	5
fibroblast growth factor receptor 4	Hs.165950	6
KIAA0300 protein	Hs.173035	7
growth factor receptor-bound protein 7	Hs.86859	8	17q21.1
myosin, heavy polypeptide 4, skeletal muscle	Hs.272207	9
apomucin	Hs.103707	10
proline oxidase homolog	Hs.274550	11
S100 calcium-binding protein AB (calgranulin A)	Hs.100000	12
glycine C-acelyltransferase (2-amino-3-ketobutyrate coenzyme A	Hs.54609	13
ligase)
phospholamban	Hs.85050	14
CGI-96 protein	Hs.239934	15
leptin (murine obesity homolog)	Hs.194236	16
hypothetical protein FLJ14146	Hs.103395	17
kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)	Hs.107318	18
Inhibin, beta B (activin AB beta polypeptide)	Hs.1735	19
hydroxysteroid (17-beta) dehydrogenase 2	Hs.155109	20
fatty acid binding protein 7, brain	Hs.26770	21
orosomucoid 2	Hs.278388	22
secretory leukocyte protease inhibitor (antileukoproteinase)	Hs.251754	23
actin, gamma 2, smooth muscle, enteric	Hs.78045	24
Homo sapiens mRNA; cDNA DKFZp564G112 (from clone	Hs.51515	25
DKEp564G112)
peptidylarginine delminase type III	Hs.149195	26
myosin, heavy polypeptide 11, smooth muscle	Hs.78344	27
S100 calcium-binding protein A9 (calgranulin B)	Hs.112405	28
Homo sapiens clone 23809 mRNA sequence	Hs.6932	29
integrin, beta 6	Hs.123125	30
lipopolysaccharide-binding protein	Hs.154078	31
glutamate receptor, lonotrophic, AMPA 3	Hs.100014	32
Homo sapiens PAC clone RP5-1093O17 from 7q11.23-q21	Hs.193606	33
KIAA1102 protein	Hs.202949	34
transmembrane 4 superfamily member 3	Hs.84072	35
v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	Hs.323910	36	17q11.2-q12
(neuroglioblastoma derived oncogene homolog)
protein phosphatase 1, regulatory (inhibitor) subunit 1A	Hs.76780	37
HGC6.1.1 protein	Hs.225962	38
mucin and cadherin-like	Hs.165619	39
homeo box A9	Hs.127428	40
4-hydroxyphenylpyruvate dioxygenase	Hs.2899	41
lactotransferrin	Hs.105938	42
KIAA1069 protein	Hs.193143	43
folate hydrolase (prostate-specific membrane antigen) 1	Hs.1915	44
argininosuccinate synthetase	Hs.160786	45
keratin 7	Hs.23881	46
angiotensin receptor 2	Hs.3110	47
calmodulin-like skin protein	Hs.180142	48
electron-transfer-flavoprotein, alpha polypeptide (glutaric aciduria II)	Hs.169919	49
S100 calcium-binding protein A7 (psoriasin 1)	Hs.112408	50
Genes Down-regulated in ER+/Low
phorbol-12-myristate-13-acetate-induced protein 1	Hs.96	1
dynein, axonemal, light intermediate polypeptide	Hs.33846	2
cytochrome P450, subfamily IIB (phenobarbital-inducible), polypeptide 6	Hs.1360	3
estrogen receptor 1	Hs.1657	4
artemin	Hs.194689	5
carcinoembryonic antigen-related cell adhesion molecule 1 (biliary	Hs.50964	6
glycoprotein)
ESTs	Hs.23703	7
KIAA0575 gene product	Hs.193914	8
retinoic acid receptor, alpha	Hs.250505	9
annexin A9	Hs.279928	10
Cas-BF M (murine) ectropic retroviral transforming sequence c	Hs.156637	11
GATA-binding protein 3	Hs.169946	12
hypothetical protein FLJ12650	Hs.4243	13
arsenate resistance protein ARS2	Hs.111801	14
huntingtin interacting protein 2	Hs.155485	15
hypothetical protein FLJ13134	Hs.99603	16
zinc finger protein 165	Hs.55481	17
Homo sapiens cDNA: FLJ21695 fis, clone COL09653	Hs.306803	18
insulin-like growth factor 1 receptor	Hs.239176	19
hepsin (transmembrane protease, serine 1)	Hs.823	20
two pore potassium channel KT3.3	Hs.203845	21
UDP-glucose ceramide glucosyltransferase	Hs.152601	22
Human cytochrome P450-IIB (hIIB3) mRNA, complete cds	Hs.330780	23
sema domain, immunoglobulin domain (Ig). short basic domain,	Hs.32981	24
secreted, (semaphorin) 3F
microtubule-associated protein tau	Hs.101174	25
phosphatidylserine-specific phospholipase A1alpha	Hs.17752	26
Similar to hypothetical protein PRO2831 [Homo sapiens], mRNA	Hs.406646	27
sequence
cytochrome c oxidase subunit VIc	Hs.74649	28
adenylate cyclase 9	Hs.20196	29
Homo sapiens cytokine-like nuclear factor n-pac mRNA, complete	Hs.331584	30
cds
Human DNA sequence from clone RP1-63I5 on chromosome	Hs.272288	31
6q25.1-26. Contains the 3 part of a novel gene and an exon of
the ESR1 gene for estrogen receptor 1 (NR3A1, estradiol receptor).
ESTs, STSs and GSSs
calsyntenin-2	Hs.12079	32
interleukin 6 signal transducer (gp130, oncostatin M receptor)	Hs.82065	33
A kinase (PRKA) anchor protein 10	Hs.75456	34
N-acetyltransferase 1 (arylamine N-acetyltransferase)	Hs.155956	35
hypothetical protein FLJ13687	Hs.278850	36
cystatin SA	Hs.247955	37
heat shock 27 kD protein 1	Hs.76067	38
synaptojanin 2	Hs.61289	39
b) ER−/Low vs. ER−/High
Genes Up-regulated in ER/Low
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-	Hs.151678	1
acetylgalactosaminyltransferase 6 (GalNAc-T6)
aldehyde dehydrogenase 4 family, member A1	Hs.77448	2
chromosome 6 open reading frame 29	Hs.334514	3
melanoma antigen, family D, 2	Hs.4943	4
phenylethanolamine N-methyltransferase	Hs.1892	5	17q21-q22
tripartite motif-containing 3	Hs.321576	6
hypothetical gene MGC9753	Hs.91668	7
ATP-binding cassette, sub-family C (CFTR/MRP), member 6	Hs.274260	8
SH3 domain binding glutamic acid-rich protein like	Hs.14368	9
growth factor receptor-bound protein 7	Hs.86859	10	17q21.1
3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2 (mitochondrial)	Hs.59889	11
fibroblast growth factor receptor 4	Hs.165950	12
fatty acid synthase	Hs.83190	13
mucin 1, transmembrane	Hs.89603	14
phafin 2	Hs.29724	15
carnitine acetyltransferase	Hs.12068	16
hypothetical protein FLJ20151	Hs.279916	17
GATA binding protein 3	Hs.169946	18
WW domain-containing protein 1	Hs.355977	19
transcription factor AP-2 beta (activating enhancer binding protein 2	Hs.33102	20
beta)
KIAA0882 protein	Hs.90419	21
tetraspan 1	Hs.38972	22
peroxisomal biogenesis factor 11A	Hs.31034	23
solute carrier family 4, sodium bicarbonate cotransporter, member 8	Hs.132136	24
hypothetical gene MGC9753	Hs.91668	25
forkhead box A1	Hs.70604	26
aquaporin 3	Hs.234642	27
v-erb-b2 erythroblastic leukemia viral oncogene homolog 2,	Hs.323910	28	17q11.2-q12
neuro/glioblastoma derived oncogene homolog (avian)
inositol 1,4,5-triphosphate receptor, type 1	Hs.198443	29
hypothetical protein PRO1489	Hs.197922	30
aldehyde dehydrogenase 3 family, member B2	Hs.87539	31
Hypothetical protein [Homo sapiens], mRNA sequence	Hs.381412	32
dual specificity phosphatase 6	Hs.180383	33
carbonic anhydrase XII	Hs.5338	34
NAD(P)H dehydrogenase, quinone 1	Hs.406515	35
mannosidase, alpha, class 1C, member 1	Hs.8910	36
KIAA0703 gene product	Hs.6168	37
stearoyl-CoA desaturase (delta-9-desaturase)	Hs.119597	38
fructose-1,6-bisphosphatase 1	Hs.574	39
arylsulfatase D	Hs.326525	40
X-box binding protein 1	Hs.149923	41
methylcrotonoyl-Coenzyme A carboxylase 2 (beta)	Hs.167531	42
synaptosomal-associated protein, 23 kDa	Hs.184376	43
kraken-like	Hs.301947	44
anterior gradient 2 homolog (Xenepus laevis)	Hs.91011	45
hypothetical protein FLJ20174	Hs.114556	46
chaperonin containing TCP1, subunit 2 (beta)	Hs.432970	47
immunoglobulin heavy constant gamma 3 (G3m marker)	Hs.300697	48
transmembrane 4 superfamily member 3	Hs.84072	49
sorbitol dehydrogenase	Hs.878	50

Use of DRAGON-ERE Finder (DEREF) to Identify Putative EREs in Gene Promoters

The DEREF algorithm was used to define potential EREs in the promoters of genes belonging to various categories (see http://sdmc.lit.org.sg/ERE-V2/index for a description of the underlying methodology of DEREF). The manuscript of ref. 14 can be accessed via http://www.omniarray.com/ERClassification.html. The estrogen-induced SAGE data set was derived from (http://143.111.133.249/ggeg/, see ref. 13), using the thresholds of 3 hr fold increase >=2 and 3 hr p value <0.005. 65 SAGE Tags were selected. These 65 SAGE Tags matched 68 genes that are furthered subject to ERE analysis. The gene set of the top 100 genes negatively correlated to ER status was derived using SAM. Table S6a depicts the results.

TABLE S6a
The ERE prediction on various data sets: E2-induced SAGE data set,
genes negatively correlated to ER+, and the SAM-133 gene set.
				ERE Hit with
				high
Data set	Non-ERE	Low	High	confidence	‘N/A’
SAGE E2-induced	21	15	21	41.18%	11
ER-negative genes	50	22	6	7.69%	22
SAM-133	15	15	17	36.17%	23

TABLE S6b
Predicted ERE patterns by DEREF for genes listed in Table 2 of the main text.
ERE pattern for Table 2
Gene Name	Rank	ERE pattern
12 ERE with high confidence out of 50 genes perturbed in ER+
annexin A9	4	PP 2783 CA-GGGCA-CCC-CAGCC-TG new
		CCTGTTGGGGCACATACCAGCAGGGCACCCCAGCCT
		GCACCCCAGAGGGGGTCCCAG 21
N-acetyltransferase 1 (arylamine N-	5	PP 150 AA-GGTTA-CAA-TAACC-AA new
acetyltransferase)		CCACCTTCAAATCATACTACAAGGTTACAATAACCAA
		AACAGCGTGGTACTGATACA 21
retinoic acid receptor, alpha	7	PP 2149 GA-GGTCC-CTC-TGCCC-CT new
		TGAAGTTGATCTGTTGTATTGAGGTCCCTCTGCCCCT
		ATATTTATCCTAAATGGTAT 21
B-cell CLL/lymphoma 2	11	PP 647 CA-GGGCA-CAG-TGGCT-CA new
		GACAAAATAAAGATGTCAGGCAGGGCACAGTGGCTC
		ATGTCTGTAATCCCAGCACTT 21
RNB6	13	PP 1920 TT-GGTCA-GGC-TGGTC-TC known
		AAAGACAGGGTTTCACCATGTTGGTCAGGCTGGTCT
		CGAACTTCTGACCTCAGGTGA 21
regulator of G-protein signalling 11	21	PP 847 CG-GGTCA-CTG-CAACC-TC new
		GGAGTGCAATGGTGCAATCTCGGGTCACTGCAACCT
		CCGCCTCCTGGGTTCAAGCGA 21
UDP-glucose ceramide	25	PP 466 TG-AGTCA-CCG-TGCCC-AG new
glucosyltransferase		AAGTGCTGGGATTACAGGCGTGAGTCACCGTGCCCA
		GCCAATGGCTTGTGGTTTTCT 21
ATP-binding cassette, sub-family A	33	PP 1363 CA-GGGCA-CAG-TGGCT-CA new
(ABC1), member 3		GCACAGAGATAAAACCTCGGCAGGGCACAGTGGCTC
		ACGCCTGTAATCCCCACACTT 21
carbonic anhydrase XII	34	PP 1376 TA-GGCCA-AAC-TAACC-TT new
		TCCTTATTCATTCCTGGGCATAGGCCAAACTAACCTT
		AGAAAGGAATTCAGTTTATG 21
serine (or cysteine) proteinase	40	PP 2408 TT-GGTCG-GAC-TGGTC-TT new
inhibitor, clade A (alpha-1		AGAGACAGGGTTTCACCTTGTTGGTCGGACTGGTCT
antiproteinase, antitrypsin), member 3		TGAACTCCTGACCTCGTGATC 21
adenylate cyclase 9	44	PP 710 TT-GGTCA-GGC-TGGTC-TC known
		AGAGATGGGGTTTCTCCGTGTTGGTCAGGCTGGTCT
		CGAACTCCCGACCTCAGGTGA 21
heme binding protein 1	46	PP 1738 GA-GGTCC-GGG-TGGCC-GC new
		AAAGAGCAGAGGCGCCCGTAGAGGTCCGGGTGGCC
		GCTGCTGTTAACATCCATCACT 21
3 ERE with high confidence out of 50 genes perturbed in ER−
LAG1 longevity assurance homolog 2	13	PP 3662 CA-GGCCA-GGG-CAAGC-CC new
(S. cerevisiae)		CCCAAGCCACAGGACGCGTCCAGGCCAGGGCAACC
		CCGCGGGCCGCTGCCAGGGTGG 21
fructose-1,6-bisphosphatase 1	15	PP 776 TT-GGTCA-GGC-TGGTC-TC known
		AGAGACGGGGTTTCTCCATGTTGGTCAGGCTGGTCT
		CGAGCTCCCAACCTCAGGTGA 21
hypothetical protein MGC2601	33	PP 966 CT-GGTCA-GGC-TGGTC-TT new
		AGAGACGAGGTTTCTCCATGCTGGTCAGGCTGGTCT
		TGAACTCCCGACCTCAGGTGA 21

e S7: Weighted Voting parameters for mean (μ) and standard deviation (σ) of expression data
SAM-133 geneset
	ER−	ER+
_ID	Gene Name	mean	SD	mean	SD
0_at	X-box binding protein 1	0.786506	0.716285	4.265411	1.422852
8_at	insulin-like growth factor-binding protein 4	−0.34357	1.388805	2.57045	0.925761
4_at	cytochrome c oxidase subunit VIc	−1.58027	1.870693	1.927493	1.237708
5_s_at	CGI-49 protein	3.371655	1.153737	5.720964	0.582412
3_s_at	epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b)	−0.23687	1.75591	2.753161	0.803569
	oncogene homolog)
4_s_at	epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b)	−1.44281	0.960058	2.42027	2.337701
	oncogene homolog)
8_at	LIV-1 protein, estrogen regulated	1.312524	1.221556	3.870357	0.929939
9_s_at	LIV-1 protein, estrogen regulated	1.734565	1.093064	4.085214	0.81537
6_at	serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin),	2.023548	1.032196	4.420661	0.934515
	member 3
2_x_at	solute carrier family 7 (cationic amino acid transporter, y+ system), member 8	1.981605	1.049118	4.149982	0.712426
6_at	polymerase (DNA-directed), delta 4	0.786499	1.029001	3.014232	0.865812
1_at	secretory leukocyte protease inhibitor (antileukoproteinase)	0.355523	0.675879	3.16287	1.761351
1_at	sema domain, immunoglobulin domain (Ig), short basic domain, secreted,	1.825558	0.726706	4.052804	1.145816
	(semaphorin) 3B
8_at	retinoic acid induced 3	−2.75146	0.887259	−0.09227	1.606679
4_at	uridine phosphorylase	−2.68964	1.552946	0.243702	1.641435
9_s_at	Conserved gene telomeric to alpha globin cluster	3.20195	0.718557	5.197518	0.987453
8_at	stanniocalcin 2	−1.29648	1.055361	0.795528	0.993152
9_s_at	stanniocalcin 2	−1.57332	1.345545	0.998514	1.454402
1_s_at	adipose specific 2	0.233895	0.988328	2.283714	1.060332
7_at	insulin-like growth factor 1 receptor	0.141016	0.610073	2.127288	1.174363
8_at	insulin-like growth factor 1 receptor	2.29995	0.509475	3.833107	0.788714
5_at	B-cell CLLlymphoma 2	−1.10751	1.324287	1.15701	1.355875
9_s_at	retinoic acid receptor, alpha	−1.58118	1.167735	0.537334	1.268906
8_x_at	microtubule-associated protein tau	0.359852	0.516477	1.888305	0.821962
9_s_at	microtubule-associated protein tau	−2.59884	0.565755	−0.00962	2.145673
3_at	carbonic anhydrase XII	1.190756	3.229512	4.402	1.181501
1_at	monoamine oxidase B	−3.13061	1.085626	−0.75919	1.755041
3_at	ATP-binding cassette, sub-family A (ABC1), member 3	−0.29571	1.843682	2.228971	1.512369
7_at	adenylate cyclase 9	−2.34613	1.534418	−0.05573	1.429526
8_s_at	hypothetical protein FLJ20151	−3.52135	1.303031	−0.87495	2.10528
3_at	trefoil factor 3 (intestinal)	−0.37083	1.33889	1.50405	0.899477
2_s_at	KIAA0590 gene product	−0.9475	1.745737	1.257564	1.170708
8_at	v-myb avian myeloblastosis viral oncogene homolog	1.288571	1.107004	3.060625	0.97928
2_s_at	non-metastatic cells 3, protein expressed in	−1.44821	0.786716	0.388854	1.271171
3_s_at	interleukin 6 signal transducer (gp130, oncostatin M receptor)	−0.10956	1.179102	1.970259	1.431009
1_s_at	UDP-glucose ceramide glucosyltransferase	−1.39262	1.195462	1.156751	2.153286
3_s_at	SRY (sex determining region Y)-box 11	−2.53383	1.536914	−0.16571	1.727001
4_s_at	SRY (sex determining region Y)-box 11	−1.8799	1.273909	0.144791	1.375233
5_s_at	SRY (sex determining region Y)-box 11	0.484505	1.125341	2.823356	1.941558
4_s_at	hepsin (transmembrane protease, serine 1)	0.462278	0.985428	2.501289	1.570414
9_at	trefoil factor 1 (breast cancer, estrogen-inducible sequence expressed in)	−1.98675	1.39922	−0.14861	0.959657
1_at	cysteine-rich protein 1 (intestinal)	0.366598	1.124549	1.87895	0.590829
6_at	dynein, axonemal, light intermediate polypeptide	−2.39302	0.959482	−0.48343	1.433455
5_at	estrogen receptor 1	−1.62943	1.558096	0.486988	1.459551
4_at	guanidinoacetate N-methyltransferase	0.719039	0.547264	2.096279	0.868384
0_at	PDZ domain containing 1	−0.92507	1.254295	1.252606	1.789471
1_s_at	dachshund (Drosophila) homolog	1.676963	0.591793	3.169036	1.05951
5_at	RALBP1 associated Eps domain containing 2	−0.63258	1.838056	2.053427	2.368533
6_s_at	paired box gene 6 (aniridia, keratitis)	−0.06075	0.836545	1.524428	1.119938
6_s_at	GDNF family receptor alpha 1	3.8834	1.041947	5.212661	0.43379
4_s_at	lymphoid nuclear protein related to AF4	−1.3702	1.00987	0.420671	1.393757
8_s_at	fatty-acid-Coenzyme A ligase, very long-chain 1	0.5008	0.790296	2.069968	1.166292
2_at	KIAA0575 gene product	2.848348	1.291904	4.670661	1.303459
7_at	regulator of G-protein signalling 11	−1.36697	1.337414	0.179662	0.681822
1_s_at	microtubule-associated protein tau	−3.3514	1.637863	−1.01214	2.020108
9_x_at	aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase)	0.948475	0.99349	2.289914	0.621401
4_s_at	cytochrome P450, subfamily IIB (phenobarbital-inducible), polypeptide 6	−0.71324	1.775643	1.082716	0.869708
207030_s_at	cysteine and glycine-rich protein 2	−2.03214	1.126525	−0.19338	1.540646
207038_at	solute carrier family 16 (monocarboxylic acid transporters), member 6	0.374876	0.580637	1.790818	1.094049
207414_s_at	paired basic amino acid cleaving system 4	0.341324	1.065353	2.062852	1.376036
207847_s_at	mucin 1, transmembrane	0.247008	1.354516	2.257601	1.737215
208305_at	progesterone receptor	−1.24605	0.974745	0.384022	1.29497
208451_s_at	complement component 4B	−4.78762	1.049086	−2.66361	2.080728
208682_s_at	hepatocellular carcinoma associated protein; breast cancer associated gene 1	−1.959	0.821013	−0.3239	1.382716
208788_at	homolog of yeast long chain polyunsaturated fatty acid elongation enzyme 2	0.152008	0.660975	1.523099	1.038038
209173_at	anterior gradient 2 (Xenepus laevis) homolog	−4.28803	0.661578	−2.56017	1.677193
209339_at	seven in absentia (Drosophila) homolog 2	1.270858	1.066389	2.646046	0.849767
209443_at	serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin),	4.667825	0.671724	5.873446	0.804606
	member 5
209459_s_at	NPD009 protein	1.072112	1.457092	2.973341	1.645057
209460_at	NPD009 protein	−0.96002	1.349904	0.607753	1.04472
209581_at	similar to rat HREV107	−0.56188	0.872894	0.668399	0.727131
209602_s_at	GATA-binding protein 3	2.019065	1.056594	3.416464	0.940078
209603_at	GATA-binding protein 3	1.985985	0.863569	3.186089	0.674166
209604_s_at	GATA-binding protein 3	2.395052	1.790175	4.34208	1.519527
209623_at	methylcrotonoyl-Coenzyme A carboxylase 2 (beta)	−1.00419	1.154041	0.445889	1.017354
209696_at	fructose-1,6-bisphosphatase 1	−1.68104	0.963742	−0.1215	1.377052
209800_at	keratin 16 (focal non-epidermolytic palmoplantar keratoderma)	2.324715	1.562155	4.012295	1.229197
210085_s_at	annexin A9	2.4829	1.125042	4.043161	1.290489
210272_at	Human cytochrome P450-IIB (hIIB3) mRNA, complete cds	1.01495	0.91653	2.191543	0.64021
210480_s_at	myosin VI	−0.14392	1.616287	1.455335	1.006298
210652_s_at	DEME-6 protein	1.251577	0.889677	2.556116	0.970199
210735_s_at	carbonic anhydrase XII	1.213425	2.03426	3.084783	1.272118
211000_s_at	interleukin 6 signal transducer (gp130, oncostatin M receptor)	−3.02427	1.43442	−1.18813	1.697067
211233_x_at	estrogen receptor 1	−0.0459	1.740133	1.544577	0.867934
211234_x_at	estrogen receptor 1	0.044649	1.763802	1.765441	1.206805
211235_s_at	estrogen receptor 1	−2.24335	1.765844	−0.48324	1.306074
211323_s_at	inositol 1,4,5-triphosphate receptor, type 1	2.749775	0.789763	3.855643	0.652063
211596_s_at	Homo sapiens mRNA for membrane glycoprotein LIG-1, complete cds.	0.451307	1.03825	1.691284	0.751559
211712_s_at	Homo sapiens, clone MGC: 1925, mRNA, complete cds.	0.615955	1.516076	2.069047	0.790366
212195_at	Homo sapiens mRNA; cDNA DKFZp564F053 (from clone DKFZp564F053)	0.66476	0.873729	1.797193	0.663081
212196_at	Homo sapiens mRNA; cDNA DKFZp564F053 (from clone DKFZp564F053)	1.370605	0.637597	2.49272	0.820267
212496_s_at	KIAA0876 protein	2.9339	0.874367	4.097768	0.756001
212637_s_at	Homo sapiens mRNA; cDNA DKFZp434D2111 (from clone DKFZp434D2111)	−1.88266	1.081913	−0.63578	0.780821
212638_s_at	Homo sapiens mRNA; cDNA DKFZp434D2111 (from clone DKFZp434D2111)	2.261515	1.394089	3.785398	1.192581
212956_at	KIAA0882 protein	−2.7829	1.397052	−0.86347	2.046812
212960_at	KIAA0882 protein	−0.50333	1.45485	0.947772	1.02444
213201_s_at	troponin T1, skeletal, slow	−1.9544	1.210569	−0.40381	1.441706
213412_at	tight junction protein 3 (zona occludens 3)	2.951875	0.714379	4.007446	0.711117
213419_at	amyloid beta (A4) precursor protein-binding, family B, member 2 (Fe65-like)	−2.21361	1.478023	−0.51415	1.591816
213712_at	Homo sapiens mRNA; cDNA DKFZp434E082 (from clone DKFZp434E082)	0.270749	0.847277	1.499404	1.020576
214053_at	Homo sapiens clone 23736 mRNA sequence	−0.39205	1.186238	0.845048	0.820314
214164_x_at	adaptor-related protein complex 1, gamma 1 subunit	−1.08541	1.111223	0.178117	0.95879
214428_x_at	complement component 4A	0.533406	0.838849	1.642348	0.807099
214440_at	N-acetyltransferase 1 (arylamine N-acetyltransferase)	−0.99962	0.684062	0.154358	0.999297
215304_at	Human clone 23948 mRNA sequence	2.4353	0.529481	3.488893	0.879103
215552_s_at	Human DNA sequence from clone RP1-63I5 on chromosome 6q25.1-26. Contains the	−4.0518	1.024367	−2.20072	2.254477
	3 part of a novel gene and an exon of the ESR1 gene for estrogen
	receptor 1 (NR3A1, estradiol receptor), ESTs, STSs and GSSs
215616_s_at	KIAA0876 protein	2.582125	0.659442	3.570411	0.700552
215729_s_at	TONDU	1.641575	0.849076	2.756482	0.863148
215867_x_at	adaptor-related protein complex 1, gamma 1 subunit	−0.42352	0.884606	0.727052	0.926142
216092_s_at	solute carrier family 7 (cationic amino acid transporter, y+ system), member 8	0.063651	1.352604	1.366287	0.918248
216109_at	Homo sapiens cDNA: FLJ21695 fis, clone COL09653	−1.17386	1.143511	0.232514	1.345207
216381_x_at	aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase)	0.46636	0.383625	1.657506	1.251032
217190_x_at	Estrogen receptor {exon 6} human, tamoxifen-resistant breast tumor 17,	0.899139	0.533766	2.030393	1.097631
	Genomic Mutant, 187 nt
217838_s_at	RNB6	−1.31066	0.930532	−0.16453	0.933916
218195_at	hypothetical protein FLJ12910	0.847629	0.786234	2.077682	1.202885
218450_at	heme-binding protein	0.080843	0.82158	1.234993	1.027254
218502_s_at	trichorhinophalangeal syndrome I	−1.57325	1.012703	−0.27651	1.276184
218806_s_at	vav 3 oncogene	1.662298	0.790643	2.689179	0.799202
218976_at	J domain containing protein 1	−1.84709	1.306292	−0.43267	1.374615
219001_s_at	hypothetical protein MGC10765	−2.18314	1.146729	−0.93169	1.100879
219051_x_at	hypothetical protein MGC2601	−1.64776	1.079359	−0.04531	1.917545
219197_s_at	CEGP1 protein	3.017955	0.866409	4.110571	0.929583
219414_at	calsyntenin-2
219663_s_at	hypothetical protein MGC4659
219682_s_at	TBX3-iso protein	−2.31967	2.774285	−5.24093	1.743328
219919_s_at	hypothetical protein FLJ10928	1.5957	1.348698	−0.22476	1.003375
220329_s_at	hypothetical protein FLJ20627	1.476165	1.643622	−0.81183	1.617203
220581_at	hypothetical protein FLJ23305	0.707923	1.691725	−1.11592	1.188481
220744_s_at	WD repeat domain 10	−1.15664	1.569856	−2.79242	0.859538
221765_at	ESTs	1.266316	0.936218	−0.08462	0.892242
222212_s_at	tumor metastasis-suppressor	0.105187	1.541242	−1.65582	1.335109
222314_x_at	ESTs	2.914925	1.476344	1.290308	1.093452
41660_at	Cluster Incl. AL031588:dJ1163J1.1 (ortholog of mouse transmembrane receptor Celsr1	−1.50101	2.986928	−3.88453	1.411412
	(KIAA0279 LIKE EGF-like domain containing protein similar to rat MEG
		−0.50993	0.923661	−1.93244	1.140847
		0.987597	0.893199	−0.11725	0.498882
indicates data missing or illegible when filed

TABLE S8
Gene Expression data for Genes of Table A4 (common-13 genes)
UID NAME	2000683T+neg	2000775T+neg	2000804T+neg	980346T+pos	980383T+neg
990082T+neg	980177T+neg	980178T+neg	980403T+neg	980434T+neg	990075T+neg
990113T+neg	990107T+neg	980203T+neg	980208T+pos	980220T+pos	980221T+neg
990115T+pos	990375T+neg	980404T+neg	980409T+neg	990123T+neg	2000422T+neg
2000787T-LA	2000818T-LA	20020021T-LA	20020051T-LA	20020056T-LA	980197T+pos
980215T+neg	980217T+neg	980261T+neg	980391T+neg	2000768T+pos	2000779T+neg
2000948T+neg	20020160T-LA	2000401T-LA	20020071T-LA	2000215T-normal-like
2000220T-LA	980333T-LA	980058T-LA	980278T-LA	980288T-ERBB2	2000597T-LA
2000609T-LA	2000272T-LA	2000274T-normal-like	980285T-Basal	2000593T-Basal
2000638T-Basal	2000641T-ERBB2	2000675T-ERBB2	2000287T-ERBB2	2000320T-Basal
2000880T-Basal	2000731T-Basal	980353T−neg	2000829T−pos	980373T−pos	2000500T−neg
2000759T−pos	980238T−pos	980395T−pos	980396T−pos	980411T−neg	980441T−neg
990262T−neg	980216T−neg	980194T−pos	980247T−pos	980338T−neg	990174T−neg
990299T−neg	2000210T-ERBB2	980315T-LA	980335T-ERBB2	980193T-Basal
980256T-Basal	980214T+pos	990148T+pos	2000209T+pos	990223T+pos
2000104T-ERBB2	2000651T-normal-like	2000237T-ERBB2	2000652T-ERBB2	2000376T-ERBB2
2000399T-ERBB2	20020090T-ERBB2	2000709T-ERBB2	2000813T−pos	980380T−pos	990134T−pos
2000171T-ERBB2
	Confidence		High	High	High	High	High	High	High	High	High
	High	High	High	High	High	High	High	High	High	High	High	High
	High	High	High	High	High	High	High	High	High	High	High	High
	High	High	High	High	High	High	High	High	High	High	High	High
	High	High	High	High	High	High	High	High	High	High	High	High
	High	High	High	High	High	High	High	High	High	High	High	High
	High	High	High	High	High	High	High	High	High	High	High	Low
	Low	Low	Low	Low	Low	Low	Low	Low	Low	Low	Low	Low
	Low	Low	Low
201525_at	apolipoprotein D	2.749	7.332	2.111	2.803	1.752	1.958	1.75
2.712	4.541	3.009	3.613	4.291	1.486	4.204	2.849	3.388	3.262	3.603
3.097	7.419	5.491	4.873	1.444	2.954	1.296	3.352	2.856	2.266	5.145
4.695	4.072	6.963	4.804	2.886	0.7888	3.226	0.3389	1.921	2.803	4.261
4.993	4.251	0.785	6.066	4.539	2.019	5.235	1.808	4.592	0.09904	2.77	2.85
3.059	3.353	1.229	1.679	1.879	2.77	0.9126	4.246	6.957	3.753	7.109	4.31
1.624	2.986	2.603	0.984	4.797	0.5836	5.433	2.722	1.66	3.161	2.94
0.3395	1.008	4.023	2.417	4.21	4.833	5.118	0.7322	7.893	5.443	5.369
1.104	6.198	2.819	3.773	1.536	1.673	6.562	4.973	6.796	6.121
202991_at	START domain containing 3	0.1623	0.7959	−0.3925	3.014	0.4513
0.2522	0.3208	−0.2599	0.5714	−0.5644	0.5246	0.8061	0.6035	−0.3416	2.886	0.8943
−0.6905	2.991	0.6204	0.4511	−0.4408	−0.2534	0.07863	1.517	0.6792	0.6636	0.2455
−0.1443	2.871	−0.3209	−0.05486		1.605	0.1314	2.252	0.002929		0.9972
0.08306	2.623	0.4914	0.4794	−0.02506		0.1142	0.3137	0.5399	3.005	0.2001
2.758	0.1815	0.1945	−0.05305		0.6643	0.5267	2.002	0.462	3.014	0.2885
0.1389	−0.05295		−1.923	1.882	0.5175	0.09324	1.667	3.328	2.384	3.651
1.299	0.1444	0.158	1.234	2.21	0.1798	−0.1465	0.411	0.5087	3.457	1.745
3.551	−0.2846	0.158	2.62	3.53	3.728	3.149	0.2238	−0.9861	−0.3033	3.286
−0.07757		2.736	3.579	2.466	1.495	2.523	3.703	3.77
203628_at	Human insulin-like growth factor 1 receptor mRNA, 3′ sequence, mRNA sequence
2.795	2.381	5.773	1.45	3.568	3.288	2.631	2.062	2.515	4.693	2
2.984	3.098	4.667	2.513	2.232	2.442	0.5148	2.452	3.675	4.111	2.55
3.705	1.115	1.538	1.731	2.76	3.559	2.259	1.855	0.6405	3.657	4.928
2.664	6.732	6.752	0.5081	2.53	1.503	1.872	4.124	1.466	3.48	2.903
0.2213	3.556	1.22	1.193	3.206	−0.1502	0.07299	0.3962	0.5347	0.7098	0.06693
0.09198	0.3905	−0.02844		−0.009415		1.025	0.7389	2.194	−0.4784	1.723
0.222	0.05793	0.573	3.054	1.338	0.6058	1.426	1.54	0.9868	0.84	0.1264
0.2324	−0.258	1.21	−0.8171	1.998	1.449	−0.1467	0.3772	1.21	−0.4615	1.451
0.1205	−0.1947	−0.9146	1.441	−0.8475	0.04923	0.4557	−2.688	0.2235	0.5537
205307_s_at	kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)	−0.117	−1.011
−2.489	−0.9037	−1.085	−1.12	−1.219	−1.735	−1.829	−1.721	−1.433	−0.02038
1.167	−1.694	−1.571	1.055	−2.743	0.03987	0.01731	0.1225	0.1203	−1.484	−0.591
−1.35	−0.2275	0.7435	−1.218	−0.4883	−0.8609	−0.7848	−0.2848	−1.499	−0.3403	−1.388
−0.9036	−0.3888	−0.4186	−1.082	−1.261	−1.201	−0.1329	−1.222	−1.679	−0.2855	0.5551
−1.587	−0.1132	−1.485	−1.13	−0.7033	−0.7773	0.7705	0.008025		−0.2992	0.06924
−0.3291	−2.038	−1.017	−3.967	−0.4769	0.8039	−1.589	−0.7423	−0.4919	−1.328	0.2971
−1.549	−0.7277	1.643	−1.604	0.5154	−0.09918		−0.6515	−0.8327	−0.986	−0.04337
−0.95	−0.273	−0.3601	−2.266	1.182	0.7985	−0.8065	1.063	2.302	−0.6945	−1.219
0.9502	−0.894	0.7855	−1.668	0.1515	−0.3956	−1.677	0.22	1.595
210761_s_at	growth factor receptor-bound protein 7	0.4452	1.205	1.412	2.858
1.493	1.508	0.3961	0.7703	1.033	0.922	0.4947	1.016	1.668	1.669	2.906
1.568	0.889	3.42	1.335	0.6151	0.7453	0.6185	1.248	1.748	2.238	0.6557
0.7697	1.296	4.588	0.7527	0.5559	0.7794	0.9863	1.981	1.503	0.3864	0.5489
3.704	0.7039	1.561	0.9271	0.6039	0.9461	1.471	3.699	1.334	1.981	0.6054
0.5662	1.051	1.677	1.507	3.042	1.307	4.472	1.189	0.7615	0.228	0.6253
3.214	1.966	0.6688	2.263	3.093	2.839	1.988	1.721	1.684	0.6625	1.159	2.94
1.063	0.1599	1.04	0.2849	3.697	2.31	3.887	0.6321	0.7463	3.728	5.268
3.912	3.666	1.984	0.7088	0.5511	3.982	5.042	4.321	4.339	4.248	2.174
3.317	4.032	4.736
210930_s_at	v-erb-b2 erythroblastic leukemia viral oncogene homolog 2,
neuro/glioblastoma derived oncogene homolog (avian)	−0.8461	−2.708	−0.9694	0.3187
−1.475	−1.568	0.3559	−1.343	−2.559	−0.9886	−1.727	−1.466	−0.1998	−0.8977	0.3377
−0.3748	−1.943	1.36	−1.455	−1.361	−1.218	−1.374	−0.4494	1.16	0.7238	−0.4209
−2.201	−0.4352	1.833	−1.829	−0.6478	−4.138	−0.5983	0.6215	−1.066	−1.07	−0.332
1.556	−0.5345	−0.8175	−0.2384	−1.649	−0.837	0.487	1.322	−0.7451	0.7285	−0.9136
−1.812	−3.225	−0.1626	−1.19	1.542	−0.4326	1.705	0.2116	−0.2503	−1.408	−1.292
1.544	−0.8231	−1.735	0.4762	0.09548	−0.7243	−0.7869	−1.927	−1.524	−2.637	−4.457
−0.278	−2.773	−2.013	−1.611	−2.056	1.532	0.08922	2.774	−0.2269	−1.08	1.078	2.7
1.397	1.554	−1.5	−0.9627	−0.8952	2.069	1.728	3.212	3.121	3.149	1.108
−0.7891	0.9288	2.864
211657_at	carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific
cross reacting antigen)	3.887	1.127	5.069	1.162	4.256	2.372	0.06854	2.496
0.534	1.805	0.6949	4.237	3.755	−0.05911		1.471	1.388	1.548	1.032
4.176	0.407	3.742	3.638	4.006	3.88	5.988	1.433	0.1368	2.179	3.537
0.7946	0.4718	3.327	−0.02141		1.842	0.3149	5.084	0.3826	1.889	−0.9834
2.416	0.3955	0.08346	1.603	2.92	3.158	0.7611	5.397	−0.485	0.3396	0.1982
0.2382	1.376	4.494	0.6605	4.674	4.38	−0.2242	0.2056	−0.3151	3.863	0.983
0.8939	1.474	0.5326	3.265	−0.034	−0.8774	−0.5614	2.687	5.257	4.683	0.7389
0.7168	0.8051	4.189	4.894	4.905	1.134	0.431	0.5341	3.92	5.643	4.536
4.869	3.96	0.6223	5.275	4.33	3.687	4.673	0.2819	1.224	2.126	5.62
3.871	0.6072
213557_at	ESTs, Weakly similar to ubiquitously transcribed tetratricopeptide repeat
gene, Y chromosome; Ubiquitously transcribed TPR gene on Y chromosome [Homo sapiens]
[H. sapiens]	1.252	1.184	0.5043	3.153	1.387	1.868	0.5293	−0.2155	0.3275
0.5276	1.395	1.851	1.543	0.5434	2.397	1.591	0.1861	1.623	1.723	0.7596
0.5377	0.3335	1.596	2.154	1.513	1.603	0.1632	1.181	3.969	0.5737	1.136
2.645	0.6143	2.339	0.2645	0.7221	0.6219	3.499	0.5513	1.099	0.9166	1.378
0.6302	0.9299	3.592	0.9732	3.427	0.7249	0.7654	0.586	1.397	−1.58	3.088
0.7145	4.663	0.5107	1.368	1.251	0.8759	1.862	2.072	1.048	0.8533	3.836
2.693	4.055	1.126	0.493	0.3712	1.462	1.211	0.621	1.516	0.4326	1.09	2.63
2.419	0.667	0.5337	0.3296	3.749	3.494	3.834	3.956	1.295	−0.3071	0.5377
0.8307	1.086	2.534	3.733	3.321	2.127	0.05067	3.98	4.461
214451_at	transcription factor AP-2 beta (activating enhancer binding protein 2 beta)
−3.097	2.467	−3.372	3.439	0.1365	−1.298	2.39	1.441	2.839	2.516	−1.258
−2.597	−0.5943	1.978	−0.9813	−1.202	1.496	3.43	3.001	−1.562	2.541	−4.519
2.889	0.6659	1.661	−2.472	1.623	3.059	−2.935	3.575	1.469	−4.59	3.603
3.517	−3.813	−0.1878	4.003	−0.4031	0.88	2.51	−4.28	2.753	1.234	−4.588
3.173	−4.705	1.066	−1.809	1.967	−2.498	1.153	0.279	2.117	3.623	−0.005383
1.745	−4.141	−1.479	−1.257	1.798	4.45	−1.547	2.506	3.646	−3.226	−0.913
−3.058	−3.123	3.658	−1.289	3.548	−0.2634	−1.531	−4.923	2.247	1.723	−2.025
3.197	−2.015	−0.7008	4.068	3.333	−1.154	4.028	3.88	0.3311	3.34	2.444
2.631	3.682	3.38	3.92	3.618	4.305	3.96	4.973
215465_at	ATP-binding cassette, sub-family A (ABC1), member 12	−5.53	−0.2993
−2.982	−1.196	−1.515	−1.129	1.018	−2.386	−0.3181	−1.932	−1.838	0.7215	−1.211
−1.273	−1.483	−0.995	−1.928	−1.288	−1.39	−0.7415	−0.23	−2.464	−1.478	−0.2715
−1.114	−2.064	1.22	−2.498	−0.9399	−2.507	−0.4786	−2.321	−0.5358	−2.004	−2.388
−2.234	0.078	−1.043	1.185	−1.93	−1.992	−2.169	−2.156	−2.18	0.381	−4.889
1.702	−1.345	−1.946	−1.149	−0.7878	−0.6671	−1.429	−0.559	−1.242	−2.897	−2.329
−1.631	−2.476	−0.6065	0.4199	−2.905	−0.8082	−1.942	−1.804	−1.404	−1.384	−3.471
0.2961	−0.6596	−0.5091	−2.246	−2.386	−2.697	−1.245	0.4357	−0.7417	−0.01172
−1.168	−2.224	−0.5227	1.617	−0.04832		0.4729	−0.4882	−2.002	−0.5482	1.449
−1.664	0.7275	0.8683	−2.091	0.14	0.4634	1.916	0.7919
219429_at	fatty acid hydroxylase	−1.539	−0.2486	−0.06329		−0.606	−1.426
−1.273	0.05695	0.4841	0.3636	−0.7702	−1.403	−0.7	−1.611	−0.5367	0.6557	−0.5048
−0.9159	0.8194	−1.687	−1.037	−0.6167	−0.1531	−1.306	0.1918	−0.531	0.2454	0.7654
−1.344	0.7986	0.2327	−0.9519	−0.8758	−1.052	−0.6758	0.8207	−0.1432	−0.4994	−0.0002446
−0.2944	−1.152	−0.2746	−1.314	0.3005	−0.5842	0.218	−0.5254	−0.7197	−0.6967	−0.2
−0.8899	−0.2978	0.2625	1.562	−1.044	1.383	−0.5091	−0.3997	−0.8286	−3.217	−0.2482
0.5994	0.06282	0.06886	0.1471	0.9134	0.1739	0.6888	−1.575	0.3812	−0.6085	0.7442
−0.7528	−0.5949	−0.4236	−0.7073	1.218	−0.4363	1.209	0.3444	−0.969	0.2863	0.9532
0.7178	1.296	0.6456	−0.4466	1.152	0.4512	1.933	1.497	−0.3116	0.1834	0.142
1.228	1.876	1.35
220149_at	hypothetical protein FLJ22671	−0.585	−1.416	−0.7662	2.221	−0.3646
−0.8895	−0.6838	−0.5557	−0.4347	−0.4597	−0.07175		−0.09613		−0.4148	−0.781
−1.112	−0.482	−1.328	−0.6111	−2.445	−1.028	−0.6113	−0.08989		−1.397	−0.5025
−0.3443	−1.424	−0.3695	−0.8427	0.4616	−1.052	−1.163	−0.9368	−0.3882	0.7431	−0.04467
−0.4188	−0.7193	2.204	−1.393	−0.7435	−1.423	−0.5707	−0.4196	−0.6552	2.686	−0.6905
4.914	−0.3156	−0.9062	−0.1168	0.2261	0.1723	0.386	1.191	2.885	−0.7671	−2.42
−0.2398	−1.799	2.044	0.8819	−0.3224	3.604	1.023	3.736	2.807	−0.5473	−1.357
0.3665	−0.2828	−0.246	−0.01971		0.4476	−0.5921	−0.2366	1.906	−0.3266	2.079
0.2249	−0.5295	0.08667	2.691	1.636	1.349	−0.3243	−1.536	1.435	4.099	−0.8161
1.734	2.641	1.301	1.355	−1.242	1.708	3.096
39248_at	aquaporin 3	0.4769	−0.2623	−0.7927	1.948	0.03186	2.194	0.6044
2.335	−0.1663	0.4244	1.476	3.025	0.6734	2.102	3.241	−0.5173	0.8267	3.789
2.556	−0.07496		2.804	1.786	−1.024	0.4586	2.795	0.6762	0.07351	0.3396
0.4198	0.7147	1.677	2.114	−0.1301	0.06363	3.336	3.314	0.1946	1.919	−0.1613
0.8785	−0.1946	−0.1926	−1.876	3.881	0.3148	−1.082	−0.852	0.0508	0.3455	−0.9268
0.2052	0.2611	0.8294	2.1	1.987	3.696	0.8302	1.104	−1.175	3.041	0.07521
3.434	3.543	0.13	1.305	0.1424	2.271	1.841	0.7022	4.044	4.959	0.2898
0.4821	1.642	0.9258	1.169	−0.382	−0.8969	0.8155	1.156	3.712	2.333	1.722
1.466	3.247	1.128	1.167	3.68	4.088	4.324	−0.5153	2.505	5.002	0.05894
5.292	0.9251

TABLE S9
Weighted Voting parameters for mean (μ) and standard deviation (σ) of expression data
for Table A4 (common-13) geneset
	Full Length
	Ref.		High-Confidence	Low-confidence
Probe_ID	Gene Name	Sequences	Unigene	mean	SD	mean	SD
Upregulated in Low Confidence Tumours
201525_at	apolipoprotein D	NM_001647	Hs.75736	3.213993	1.711066	4.43395	2.23157
202991_at	START domain containing 3	NM_006804	Hs.77628	0.838735	1.186229	2.215114	1.621765
205307_s_at	kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)	NM_003679	Hs.107318	−0.75339	0.924201	0.105819	1.199695
210761_s_at	growth factor receptor-bound protein 7	NM_005310	Hs.86859	1.512564	1.051211	3.500556	1.421506
210930_s_at	v-erb-b2 erythroblastic leukemia viral oncogene homolog 2,	NM_004448	Hs.323910	−0.71309	1.339254	1.297613	1.591897
	neuro/glioblastoma derived oncogene homolog (avian)
211657_at	carcinoembryonic antigen-related cell adhesion molecule 6	NM_002483	Hs.73848	1.948209	1.842322	3.452838	1.859184
	(non-specific cross reacting antigen)
213557_at	ESTs, Weakly similar to ubiquitously transcribed	—	Hs.14691	1.359728	1.098941	2.417623	1.605763
	tetratricopeptide repeat gene, Y chromosome; Ubiquitously
	transcribed TPR gene on Y chromosome [Homo sapiens]
	[H. sapiens]
214451_at	transcription factor AP-2 beta (activating enhancer binding	NM_003221	Hs.33102	0.234429	2.657284	3.171194	1.547226
	protein 2 beta)
215465_at	ATP-binding cassette, sub-family A (ABC1), member 12	NM_015657	Hs.134585	−1.35669	1.237705	0.067599	1.228661
219429_at	fatty acid hydroxylase	—	Hs.249163	−0.32527	0.827988	0.809581	0.722212
220149_at	hypothetical protein FLJ22671	NM_024861	Hs.193745	−0.05674	1.363225	1.200829	1.596251
39248_at	aquaporin 3	NM_004925	Hs.234642	1.076674	1.458035	2.508421	1.755277
Up-regulated in High Confidence tumours
203628_at	Human insulin-like growth factor 1 receptor mRNA, 3′	—	Hs.405998	1.956068	1.625758	0.129864	1.072433
	sequence, mRNA sequence

TABLE A1
SAM (Significance Analysis of Microarrays): At a FDR (False-discovery rate) of <15%,
a total of 86 up-regulated and 2 down regulated genes in low-confidence tumors were identified.
Using this gene set, the LOOCV assay produced a classification accuracy of 84%.
		q-value
Gene Name	Score(d)	(%)	Unigene	Full Length Ref. Sequences
Genes up-regulated in Low-confidence tumors
206793_at	4.1852709	1.3837984	Hs.1892	NM_002686 // phenylethanolamine N-methyltransferase
211237_s_at	4.071839	1.3837984	Hs.165950	NM_002011 // fibroblast growth factor receptor 4 isoform 1 precursor /// NM_022963 // fibroblast
				growth factor receptor 4 isoform 2 precursor
210761_s_at	3.9001438	1.3837984	Hs.86859	NM_005310 // growth factor receptor-bound protein 7
206164_at	3.8109161	1.3837984	Hs.241551	NM_006536 // calcium activated chloride channel 2
204913_s_at	3.4806716	1.3837984	Hs.32964	NM_003108 // SRY (sex determining region Y)-box 11
210930_s_at	3.4544924	1.3837984	Hs.323910	NM_004448 // v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma
				derived oncogene homolog
204910_s_at	3.3311974	1.3837984	Hs.321576	NM_006458 // tripartite motif-containing 3 isoform alpha /// NM_033278 // tripartite motif-
				containing 3 isoform beta /// NM_033279 // tripartite motif-containing 3 isoform gamma
214451_at	3.2935388	1.3837984	Hs.33102	NM_003221 // transcription factor AP-2 beta (activating enhancer binding protein 2 beta)
217562_at	3.2344498	1.3837984	Hs.106642	—
217276_x_at	3.0703975	1.3837984	Hs.301947	NM_014509 // kraken-like
215686_x_at	3.0323791	1.3837984	—	—
215559_at	3.0225718	1.3837984	Hs.274260	NM_001171 // ATP-binding cassette, sub-family C, member 6
206827_s_at	2.9342047	1.3837984	Hs.302740	NM_014274 // transient receptor potential cation channel, subfamily V, member 6 ///
				NM_018646 // transient receptor potential cation channel, subfamily V, member 6
208893_s_at	2.9089684	1.3837984	Hs.180383	NM_001946 // dual specificity phosphatase 6 isoform a /// NM_022652 // dual specificity
				phosphatase 6 isoform b
203619_s_at	2.8107802	1.3837984	Hs.182859	—
203824_at	2.7813798	1.3837984	Hs.84072	NM_004616 // transmembrane 4 superfamily member 3
221811_at	2.747613	1.3837984	Hs.91668	—
216202_s_at	2.7319622	1.3837984	Hs.59403	NM_004863 // serine palmitoyltransferase, long chain base subunit 2
209757_s_at	2.7152502	1.3837984	Hs.25960	NM_005378 // v-myc myelocytomatosis viral related oncogene, neuroblastoma derived
219429_at	2.665359	1.3837984	Hs.249163	—
215465_at	2.628031	1.3837984	Hs.134585	NM_015657 // ATP-binding cassette, sub-family A, member 12 isoform b /// NM_173076 //
				ATP-binding cassette, sub-family A, member 12 isoform a
214203_s_at	2.6018018	1.3837984	Hs.343874	NM_005974 // /// NM_016335 // proline dehydrogenase (oxidase) 1
202942_at	2.5652724	1.3837984	Hs.74047	NM_001985 // electron-transfer-flavoprotein, beta polypeptide
205478_at	2.545305	1.3837984	Hs.76780	NM_006741 // protein phosphatase 1, regulatory (inhibitor) subunit 1A
203722_at	2.5390254	1.3837984	Hs.77448	NM_003748 // aldehyde dehydrogenase 4A1 precursor /// NM_170726 // aldehyde
				dehydrogenase 4A1 precursor
202991_at	2.5022628	1.3837984	Hs.77628	NM_006804 // steroidogenic acute regulatory protein related
205104_at	2.4827654	1.3837984	Hs.323833	NM_014723 // syntaphilin
215659_at	2.4619073	1.3837984	Hs.306777	—
220622_at	2.407245	1.3837984	Hs.114005	NM_024727 // hypothetical protein FLJ23259
208083_s_at	2.3715062	1.3837984	Hs.57664	NM_000888 // integrin, beta 6
206043_s_at	2.3543638	1.3837984	Hs.6168	NM_014861 // KIAA0703 gene product
221345_at	2.3351396	1.3837984	Hs.248056	NM_005306 // G protein-coupled receptor 43
39248_at	2.3213986	1.3837984	Hs.234642	NM_004925 // aquaporin 3
205766_at	2.3057935	1.3837984	Hs.343603	NM_003673 // telethonin
211682_x_at	2.2991204	1.3837984	Hs.137585	NM_053039 // UDP glycosyltransferase 2 family, polypeptide B28
210571_s_at	2.2806771	1.3837984	Hs.24697	XR_000114 //
219233_s_at	2.2752973	1.3837984	Hs.19054	NM_018530 // hypothetical protein PRO2521
204818_at	2.2720676	1.3837984	Hs.155109	NM_002153 // hydroxysteroid (17-beta) dehydrogenase 2
211828_s_at	2.2270979	1.3837984	Hs.170204	—
205916_at	2.2142817	1.3837984	Hs.112408	NM_002963 // S100 calcium-binding protein A7
209522_s_at	2.2117774	1.3837984	Hs.12068	NM_000755 // carnitine acetyltransferase precursor, isoform 1 /// NM_004003 // carnitine
				acetyltransferase isoform 2 /// NM_144782 // carnitine acetyltransferase precursor, isoform 3
209016_s_at	2.2112214	1.3837984	Hs.23881	—
209505_at	2.2006627	1.3837984	Hs.374991	—
200831_s_at	2.1927228	1.3837984	Hs.119597	NM_005063 // stearoyl-CoA desaturase (delta-9-desaturase)
207802_at	2.1832898	1.3837984	Hs.54431	NM_006061 // specific granule protein (28 kDa)
216633_s_at	2.1766477	1.3837984	Hs.193143	—
214614_at	2.1670563	1.3837984	Hs.37035	NM_005515 // homeo box HB9
204607_at	2.1402505	1.3837984	Hs.59889	NM_005518 // 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2 (mitochondrial)
220149_at	2.1400852	1.3837984	Hs.193745	NM_024861 // hypothetical protein FLJ22671
219756_s_at	2.1391208	1.3837984	Hs.267038	NM_024921 // premature ovarian failure 1B
213674_x_at	2.1351759	1.3837984	Hs.300697	—
211657_at	2.1231572	1.3837984	Hs.73848	NM_002483 // carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific cross
				reacting antigen)
204941_s_at	2.1178907	1.3837984	Hs.87539	NM_000695 // aldehyde dehydrogenase 3B2
214133_at	2.0836401	3.5733527	Hs.99918	—
210663_s_at	2.0766057	3.5733527	Hs.169139	NM_003937 // kynureninase (L-kynurenine hydrolase)
220414_at	2.0543228	3.5733527	Hs.180142	NM_017422 // calmodulin-like skin protein
205808_at	2.0365629	3.5733527	Hs.283664	NM_004318 // aspartate beta-hydroxylase isoform a /// NM_020164 // aspartate beta-hydroxylase
				isoform e /// NM_032466 // aspartate beta-hydroxylase isoform c /// NM_032467 // aspartate
				beta-hydroxylase isoform d /// NM_032468 // aspartate beta-hydroxylase isoform b
203365_s_at	2.0185514	3.5733527	Hs.80343	NM_002428 // matrix metalloproteinase 15 preproprotein
206509_at	2.0114514	3.5733527	Hs.99949	NM_002652 // prolactin-induced protein
213557_at	1.9942427	3.5733527	Hs.14691	—
214971_s_at	1.9917977	3.5733527	Hs.2554	NM_003032 // sialyltransferase 1 isoform a /// NM_173216 // sialyltransferase 1 isoform a ///
				NM_173217 // sialyltransferase 1 isoform b
211899_s_at	1.9768615	4.5901604	Hs.8375	NM_004295 // TNF receptor-associated factor 4 isoform 1 /// NM_145751 // TNF receptor-
				associated factor 4 isoform 2
220615_s_at	1.9216703	4.5901604	Hs.100895	NM_018099 // hypothetical protein FLJ10462
206915_at	1.8471141	7.400989	Hs.355454	NM_002509 // NK2 transcription factor related, locus 2
201388_at	1.8446012	7.400989	Hs.9736	NM_002809 // proteasome 26S non-ATPase subunit 3
205307_s_at	1.8282052	7.400989	Hs.107318	NM_003679 // kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)
209616_s_at	1.8059335	7.400989	Hs.76688	NM_001266 // carboxylesterase 1 (monocyte/macrophage serine esterase 1)
205910_s_at	1.7828285	7.400989	Hs.406160	NM_001807 // carboxyl ester lipase precursor
201525_at	1.7490382	7.400989	Hs.75736	NM_001647 // apolipoprotein D precursor
201729_s_at	1.7197176	9.106286	Hs.151761	—
204304_s_at	1.6603865	9.106286	Hs.112360	NM_006017 // prominin-like 1
220225_at	1.6559087	9.106286	Hs.196927	NM_016358 // iroquois homeobox protein 4
209560_s_at	1.6357376	10.248328	Hs.169228	NM_003836 // delta-like homolog
207131_x_at	1.6311017	10.248328	Hs.401847	NM_005265 // gamma-glutamyltransferase 1 /// NM_013421 // gamma-glutamyltransferase 1
				precursor /// NM_013430 // gamma-glutamyltransferase 1
220972_s_at	1.6233436	10.248328	Hs.307010	NM_030975 // keratin associated protein 9.9
209641_s_at	1.6169812	10.248328	Hs.90786	NM_003786 // ATP-binding cassette, sub-family C, member 3 isoform MRP3 /// NM_020037 //
				ATP-binding cassette, sub-family C, member 3 isoform MRP3A /// NM_020038 // ATP-binding
				cassette, sub-family C, member 3 isoform MRP3B
211588_s_at	1.6135313	10.248328	Hs.381618	—
201946_s_at	1.5784917	10.248328	Hs.432970	NM_006431 // chaperonin containing TCP1, subunit 2 (beta)
205029_s_at	1.5779091	10.248328	Hs.26770	NM_001446 // fatty acid binding protein 7, brain
201942_s_at	1.5530281	11.432502	Hs.5057	NM_001304 // carboxypeptidase D precursor
213913_s_at	1.5514129	11.432502	Hs.11912	—
207102_at	1.5436816	11.432502	Hs.201667	NM_005989 // aldo-keto reductase family 1, member D1
214624_at	1.5133976	11.432502	Hs.159309	NM_007000 // uroplakin 1A /// NM_032896 //
206714_at	1.5040028	11.432502	Hs.111256	NM_001141 // arachidonate 15-lipoxygenase, second type
205765_at	1.4589879	12.831585	Hs.104117	NM_000777 // cytochrome P450, family 3, subfamily A, polypeptide 5
213043_s_at	1.4469888	12.831585	Hs.23106	NM_014815 // thyroid hormone receptor-associated protein
Genes up-regulated in High-confidence tumours
204286_s_at	−3.429773	1.3837984	Hs.96	NM_021127 // phorbol-12-myristate-13-acetate-induced protein 1
203628_at	−2.907564	1.3837984	Hs.405998	—

TABLE A2
GR (Gene Ranking by SVM): A total of 251 genes were identified with the ability to classify the HC or LC status of a
tumor, with a classification accuracy of 86%. The genes are ranked by their discriminative strength, which is calculated by gene-specific
misclassification rate. The Gene Rank-SVM package is provided by GeneData ™ (Basel, Switzerland)
Probe ID	Gene Description	Unigene ID
205225_at	estrogen receptor 1	Hs.1657
206165_s_at	chloride channel, calcium activated, family member 2	Hs.241551
202917_s_at	S100 calcium binding protein A8 (calgranuilin A)	Hs.100000
210761_s_at	growth factor receptor-bound protein 7	Hs.86859
202376_at	serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3	Hs.234726
211657_at	carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific cross reacting antigen)	Hs.73848
206509_at	prolactin-induced protein	Hs.99949
201650_at	keratin 19	Hs.182265
204734_at	keratin 15	Hs.80342
203627_at	Human insulin-like growth factor 1 receptor mRNA, 3′ sequence, mRNA sequence	Hs.405998
39248_at	aquaporin 3	Hs.234642
209603_at	GATA binding protein 3	Hs.169946
204508_s_at	hypothetical protein FLJ20151	Hs.279916
215470_at	Homo sapiens cDNA FLJ36630 fis, clone TRACH2018278, mRNA sequence	Hs.14658
203749_s_at	retinoic acid receptor, alpha	Hs.361071
210930_s_at	v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene	Hs.323910
	homolog (avian)
219233_s_at	hypothetical protein PRO2521	Hs.19054
204475_at	matrix metalloproteinase 1 (interstitial collagenase)	Hs.83169
203875_at	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1	Hs.152292
211699_x_at	hemoglobin, alpha 1	Hs.272572
205239_at	amphiregulin (schwannoma-derived growth factor)	Hs.270833
205009_at	trefoil factor 1 (breast cancer, estrogen-inducible sequence expressed in)	Hs.350470
221811_at	hypothetical gene MGC9753	Hs.91668
218541_s_at	chromosome 8 open reading frame 4	Hs.283683
203628_at	Human insulin-like growth factor 1 receptor mRNA, 3′ sequence, mRNA sequence	Hs.405998
209301_at	carbonic anhydrase II	Hs.155097
219263_at	hypothetical protein FLJ23516	Hs.9238
203917_at	coxsackie virus and adenovirus receptor	Hs.79187
203980_at	fatty acid binding protein 4, adipocyte	Hs.391561
207076_s_at	argininosuccinate synthetase	Hs.160786
203408_s_at	special AT-rich sequence binding protein 1 (binds to nuclear matrix/scaffold-associating DNA's)	Hs.74592
203060_s_at	3′-phosphoadenosine 5′-phosphosulfate synthase 2	Hs.274230
63825_at	Similar to hypothetical protein PRO2831 [Homo sapiens], mRNA sequence	Hs.406646
222303_at	ESTs	Hs.292477
211959_at	Unknown (protein for IMAGE: 4183312) [Homo sapiens], mRNA sequence	Hs.380833
217776_at	retinol dehydrogenase 11 (all-trans and 9-cis)	Hs.179817
204863_s_at	interleukin 6 signal transducer (gp130, oncostatin M receptor)	Hs.82065
202887_s_at	HIF-1 responsive RTP801	Hs.111244
201841_s_at	heat shock 27 kDa protein 1	Hs.76067
207847_s_at	mucin 1, transmembrane	Hs.89603
215294_s_at	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1	Hs.152292
218677_at	S100 calcium binding protein A14	Hs.288998
201931_at	etectron-transfer-flavoprotein, alpha polypeptide (glutaric aciduria II)	Hs.169919
202991_at	START domain containing 3	Hs.77628
210633_x_at	keratin 10 (epidermolytic hyperkeratosis; keratosis palmaris et plantaris)	Hs.99936
203571_s_at	adipose specific 2	Hs.74120
220625_s_at	E74-like factor 5 (ets domain transcription factor)	Hs.11713
205567_at	carbohydrate (keratan sulfate Gal-6) sulfotransferase 1	Hs.104576
212202_s_at	DKFZP564G2022 protein	Hs.16492
202888_s_at	alanyl (membrane) aminopeptidase (aminopeptidase N, aminopeptidase M, microsomal	Hs.1239
	aminopeptidase, CD13, p150)
207023_x_at	keratin 10 (epidermolytic hyperkeratosis; keratosis palmaris et plantaris)	Hs.99936
204913_s_at	SRY (sex determining region Y)-box 11	Hs.32964
204404_at	solute carrier family 12 (sodium/potassium/chloride transporters), member 2	Hs.110736
211719_x_at	fibronectin 1	Hs.287820
216510_x_at	immunoglobulin heavy constant mu	Hs.153261
218772_x_at	hypothetical protein FLJ10493	Hs.279610
201951_at	activated leukocyte cell adhesion molecule	Hs.10247
209250_at	degenerative spermatocyte homolog, lipid desaturase (Drosophila)	Hs.185973
214745_at	KIAA1069 protein	Hs.193143
201946_s_at	chaperonin containing TCP1, subunit 2 (beta)	Hs.432970
205916_at	S100 calcium binding protein A7 (psoriasin 1)	Hs.112408
212736_at	hypothetical gene BC008967	Hs.6349
213438_at	Homo sapiens cDNA FLJ34019 fis, clone FCBBF2002898, mRNA sequence	Hs.7309
205518_s_at	cytidine monophosphate-N-acetylneuraminic acid hydroxylase	Hs.24697
	(CMP-N-acetylneuraminate monooxygenase)
221728_x_at	Homo sapiens cDNA FLJ30298 fis, clone BRACE2003172, mRNA sequence	Hs.351546
205943_at	tryptophan 2,3-dioxygenase	Hs.183671
207431_s_at	degenerative spermatocyte homolog, lipid desaturase (Drosophila)	Hs.185973
209267_s_at	BCG-induced gene in monocytes, clone 103	Hs.284205
204018_x_at	hemoglobin, alpha 1	Hs.272572
212204_at	DKFZP564G2022 protein	Hs.16492
202310_s_at	collagen, type I, alpha 1	Hs.172928
201998_at	sialyltransferase 1 (beta-galactoside alpha-2,6-sialytransferase)	Hs.2554
208792_s_at	clusterin (complement lysis inhibitor, SP-40, 40, sulfated glycoprotein 2, testosterone-repressed	Hs.75106
	prostate message 2, apolipoprotein J)
204731_at	transforming growth factor, beta receptor III (betaglycan, 300 kDa)	Hs.342874
204881_s_at	UDP-glucose ceramide glucosyltransferase	Hs.432605
205242_at	chemokine (C—X—C motif) ligand 13 (B-cell chemoattractant)	Hs.100431
200601_at	actinin, alpha 4	Hs.182485
202037_s_at	secreted frizzled-related protein 1	Hs.7306
219795_at	solute carrier family 6 (neurotransmitter transporter), member 14	Hs.162211
217028_at	chemokine (C—X—C motif) receptor 4	Hs.89414
205066_s_at	ectonucleotide pyrophosphatase/phosphodiesterase 1	Hs.11951
202357_s_at	B-factor, properdin	Hs.69771
202743_at	phosphoinositide-3-kinase, regulatory subunit, polypeptide 3 (p55, gamma)	Hs.372548
203874_s_at	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1	Hs.152292
210072_at	chemokine (C—C motif) ligand 19	Hs.50002
202990_at	phosphorylase, glycogen; liver (Hers disease, glycogen storage disease type VI)	Hs.771
206115_at	early growth response 3	Hs.74088
205498_at	growth hormone receptor	Hs.125180
212789_at	KIAA0056 protein	Hs.13421
222155_s_at	putative G-protein coupled receptor GPCR41	Hs.6459
218776_s_at	hypothetical protein FLJ23375	Hs.285996
200820_at	proteasome (prosome, macropain) 26S subunit, non-ATPase, 8	Hs.78466
203337_x_at	integrin cytoplasmic domain-associated protein 1	Hs.173274
214218_a_at	Human XIST, coding sequence ‘a’ mRNA (locus DXS399E), mRNA sequence	Hs.352403
201729_s_at	KIAA0100 gene product	Hs.151761
204285_s_at	phorbol-12-myristate-13-acetate-induced protein 1	Hs.96
214451_at	transcription factor AP-2 beta (activating enhancer binding protein 2 beta)	Hs.33102
218313_s_at	UDP-N-acetyl-alpha-D-galactosamine: polypeptide N-acetylgalactosaminyltransferase 7 (GalNac-T7)	Hs.246315
217838_s_at	RNB6	Hs.241471
209189_at	v-fos FBJ murine osteosarcoma viral oncogene homolog	Hs.25647
201131_s_at	cadherin 1, type 1, E-cadherin (epithelial)	Hs.194657
203058_s_at	3′-phosphoadenosine 5′-phosphosulfate synthase 2	Hs.274230
213557_at	ESTs, Weakly similar to ubiquitously transcribed tetratricopeptide repeat gene, Y chromosome; Ubiquitously	Hs.14691
	transcribed TPR gene on Y chromosome [Homo sapiens] [H. sapiens]
215465_at	ATP-binding cassette, sub-family A (ABC1), member 12	Hs.134585
213693_s_at	mucin 1, transmembrane	Hs.89603
202218_s_at	fatty acid desaturase 2	Hs.184641
207175_at	adipose most abundant gene transcript 1	Hs.80485
205798_at	interleukin 7 receptor	Hs.362807
200916_at	transgelin 2	Hs.406504
216623_x_at	trinucleotide repeat containing 9	Hs.110826
211776_s_at	erythrocyte membrane protein band 4.1-like 3	Hs.103839
204472_at	GTP binding protein overexpressed in skeletal muscle	Hs.79022
220149_at	hypothetical protein FLJ22671	Hs.193745
219517_at	hypothetical protein FLJ22637	Hs.296178
208653_s_at	CD164 antigen, sialomucin	Hs.43910
202457_s_at	protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform (calcineurin A alpha)	Hs.272458
222108_at	—	—
200648_s_at	glutamate-ammonia ligase (glutamine synthase)	Hs.170171
203287_at	ladinin 1	Hs.18141
219429_at	fatty acid hydroxylase	Hs.249163
212934_at	Homo sapiens cDNA FLJ30096 fis, clone BNGH41000045, mRNA sequence	Hs.155572
205307_s_at	kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)	Hs.107318
212686_at	KIAA1157 protein	Hs.21894
204623_at	trefoil factor 3 (intestinal)	Hs.82961
209459_s_at	NPD009 protein	Hs.283675
203827_at	hypothetical protein FLJ10055	Hs.9398
201952_at	activated leukocyte cell adhesion molecule	Hs.10247
202047_s_at	chromobox homolog 6	Hs.107374
206036_s_at	v-rel reticuloendotheliosis viral oncogene homolog (avian)	Hs.44313
205048_s_at	phosphoserine phosphatase-like	Hs.369508
211527_x_at	vascular endothelial growth factor	Hs.73793
202660_at	minor histocompatibility antigen HA-1	Hs.196914
210495_x_at	fibronectin 1	Hs.287820
216442_x_at	fibronectin 1	Hs.287820
212865_s_at	collagen, type XIV, alpha 1 (undulin)	Hs.403836
221765_at	UDP-glucose ceramide glucosyltransferase	Hs.432605
210538_s_at	baculoviral IAP repeat-containing 3	Hs.127799
204151_x_at	aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid	Hs.306098
	dehydrogenase)
213836_s_at	hypothetical protein FLJ10055	Hs.9398
202724_s_at	forkhead box O1A (rhabdomyosarcoma)	Hs.170133
202404_s_at	collagen, type I, alpha 2	Hs.179573
202871_at	TNF receptor-associated factor 4	Hs.8375
204455_at	bullous pemphigoid antigen 1, 230/240 kDa	Hs.198689
203640_at	muscleblind-like protein MBLL39	Hs.283609
823_at	chemokine (C—X3—C motif) ligand 1	Hs.80420
214203_s_at	proline dehydrogenase (oxidase) 1	Hs.343874
201963_at	fatty-acid-Coenzyme A ligase, long-chain 2	Hs.154890
221730_at	collagen, type V, alpha 2	Hs.82985
217047_s_at	family with sequence similarity 13, member A1	Hs.177664
203814_s_at	NAD(P)H dehydrogenase, quinone 2	Hs.73956
202581_at	heat shock 70 kDa protein 1B	Hs.274402
218640_s_at	phafin 2	Hs.29724
201752_s_at	adducin 3 (gamma)	Hs.324470
221558_s_at	lymphoid enhancer-binding factor 1	Hs.44865
211798_x_at	immunoglobulin lambda joining 3	Hs.102950
218400_at	2′-5′-oligoadenylate synthetase 3, 100 kDa	Hs.56009
203549_s_at	lipoprotein lipase	Hs.180878
201525_at	apolipoprotein D	Hs.75736
203207_s_at	likely ortholog of chicken chondrocyte protein with a poly-proline region	Hs.170198
201397_at	phosphoglycerate dehydrogenase	Hs.3343
217996_at	pleckstrin homology-like domain, family A, member 1	Hs.82101
211479_s_at	5-hydroxytryptamine (serotonin) receptor 2C	Hs.46362
213287_s_at	keratin 10 (epidermolytic hyperkeratosis; keratosis palmaris et plantaris)	Hs.99936
221517_s_at	cofactor required for Sp1 transcriptional activation, subunit 6, 77 kDa	Hs.22630
212775_at	KIAA0657 protein	Hs.6654
217791_s_at	pyrroline-5-carboxylate synthetase (glutamate gamma-semialdehyde synthetase)	Hs.114366
215250_at	Homo sapiens cDNA FLJ12140 fis, clone MAMMA1000340, mRNA sequence	Hs.287491
208733_at	RAB2, member RAS oncogene family	Hs.78305
219629_at	hypothetical protein FLJ20635	Hs.265018
205542_at	six transmembrane epithelial antigen of the prostate	Hs.61635
208682_s_at	melanoma antigen, family D, 2	Hs.4943
218729_at	latexin protein	Hs.109276
205376_at	inositol polyphosphate-4-phosphatase, type II, 105 kDa	Hs.153687
203953_s_at	claudin 3	Hs.25640
206916_x_at	tyrosine aminotransferase	Hs.161640
212196_at	Homo sapiens mRNA; cDNA DKFZp564F053 (from clone DKFZp564F053), mRNA sequence	Hs.71968
211000_s_at	interleukin 6 signal transducer (gp130, oncostatin M receptor)	Hs.82065
212254_s_at	bullous pemphigoid antigen 1, 230/240 kDa	Hs.198689
204914_s_at	SRY (sex determining region Y)-box 11	Hs.32964
221505_at	leucine-rich acidic nuclear protein like	Hs.71331
208498_s_at	amylase, alpha 1A; salivary	Hs.274376
201694_s_at	early growth response 1	Hs.326035
201936_s_at	eukaryotic translation initiation factor 4 gamma, 3	Hs.25732
203090_at	stromal cell-derived factor 2	Hs.118684
37117_at	Rho GTPase activating protein 8	Hs.102336
202770_s_at	cyclin G2	Hs.429880
209522_s_at	carnitine acetyltransferase	Hs.12068
212451_at	KIAA0256 gene product	Hs.118978
201839_s_at	tumor-associated calcium signal transducer 1	Hs.692
218309_at	hypothetical protein PRO1489	Hs.197922
212450_at	KIAA0256 gene product	Hs.118978
221589_s_at	aldehyde dehydrogenase 6 family, member A1	Hs.293970
217281_x_at	immunoglobulin heavy constant gamma 3 (G3m marker)	Hs.300697
217388_s_at	kynureninase (L-kynurenine hydrolase)	Hs.169139
203336_s_at	integrin cytoplasmic domain-associated protein 1	Hs.173274
217704_x_at	—	—
201563_at	sorbitol dehydrogenase	Hs.878
208151_x_at	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 17, 72 kDa	Hs.349121
217880_at	cell division cycle 27	Hs.406631
213229_at	Dicer1, Dcr-1 homolog (Drosophila)	Hs.87889
219768_at	hypothetical protein FLJ22418	Hs.36563
200602_at	amyloid beta (A4) precursor protein (protease nexin-II, Alzheimer disease)	Hs.177486
201082_s_at	dynactin 1 (p150, glued homolog, Drosophila)	Hs.74617
214774_x_at	trinucleotide repeat containing 9	Hs.110826
208654_s_at	CD164 antigen, sialomucin	Hs.43910
202018_s_at	lactotransferrin	Hs.105938
212915_at	likely ortholog of mouse semaF cytoplasmic domain associated protein 3	Hs.177635
202196_s_at	dickkopf homolog 3 (Xenopus laevis)	Hs.4909
221024_s_at	solute carrier family 2 (facilitated glucose transporter), member 10	Hs.305971
211702_s_at	ubiquitin specific protease	Hs.155787
205110_s_at	fibroblast growth factor 13	Hs.6540
219956_at	UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)	Hs.151678
202687_s_at	tumor necrosis factor (ligand) superfamily, member 10	Hs.83429
205882_x_at	adducin 3 (gamma)	Hs.324470
203476_at	trophoblast glycoprotein	Hs.82128
208991_at	Homo sapiens cDNA FLJ35646 fis, clone SPLEN2012743, mRNA sequence	Hs.381933
204866_at	KIAA0215 gene product	Hs.82292
208180_s_at	H4 histone family, member H	Hs.421737
219410_at	hypothetical protein FLJ10134	Hs.104800
209290_s_at	nuclear factor I/B	Hs.33287
202718_at	insulin-like growth factor binding protein 2, 36 kDa	Hs.433326
205862_at	GREB1 protein	Hs.193914
203895_at	Homo sapiens mRNA; cDNA DKFZp434E235 (from clone DKFZp434E235), mRNA sequence	Hs.348724
212171_x_at	vascular endothelial growth factor	Hs.73793
217762_s_at	RAB31, member RAS oncogene family	Hs.223025
208891_at	dual specificity phosphatase 6	Hs.180383
221543_s_at	chromosome 8 open reading frame 2	Hs.125849
218834_s_at	hypothetical protein FLJ20539	Hs.118552
201852_x_at	collagen, type III, alpha 1 (Ehlers-Danlos syndrome type IV, autosomal dominant)	Hs.119571
211965_at	zinc finger protein 36, C3H type-like 1	Hs.85155
202015_x_at	methionyl aminopeptidase 2	Hs.78935
203348_s_at	ets variant gene 5 (ets-related molecule)	Hs.43697
202783_at	nicotinamide nucleotide transhydrogenase	Hs.18136
202403_s_at	collagen, type I, alpha 2	Hs.179573
214440_at	N-acetyltransferase 1 (arylamine N-acetyltransferase)	Hs.155956
211748_x_at	prostaglandin D2 synthase 21 kDa (brain)	Hs.8272
215073_s_at	Homo sapiens, clone IMAGE: 5287010, mRNA, mRNA sequence	Hs.288869
215806_x_at	T cell receptor gamma constant 2	Hs.274509
205158_at	ribonuclease, RNase A family, 4	Hs.283749
221841_s_at	Homo sapiens cDNA FLJ38575 fis, clone HCHON2007046, mRNA sequence	Hs.376206
214858_at	Homo sapiens clone 24566 mRNA sequence	Hs.133342
212464_s_at	fibronectin 1	Hs.287820
206510_at	sine oculis homeobox homolog 2 (Drosophila)	Hs.101937
216246_at	ribosomal protein S20	Hs.173717
200923_at	lectin, galactoside-binding, soluble, 3 binding protein	Hs.79339
221989_at	ribosomal protein L10	Hs.29797
211284_s_at	granulin	Hs.180577
209173_at	anterior gradient 2 homolog (Xenepus laevis)	Hs.91011
200924_s_at	solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2	Hs.79748
212859_x_at	—	—
213109_at	KIAA0551 protein	Hs.170204

TABLE A3
WT (Wilcoxon Test): At a P-value of <0.05 and a >=2-fold change cutoff, a total of 38 genes were identified. This 38 gene set
delivered a LOOCV accuracy of 80%. The genes are ranked by their significance (P-value).
Probe	Gene Description	Unigene
210761_s_at	growth factor receptor-bound protein 7	Hs.86859
201931_at	electron-transfer-flavoprotein, alpha polypeptide (glutaric aciduria II)	Hs.169919
219429_at	fatty acid hydroxylase	Hs.249163
204285_s_at	phorbol-12-myristate-13-acetate-induced protein 1	Hs.96
209603_at	GATA binding protein 3	Hs.169946
206165_s_at	chloride channel, calcium activated, family member 2	Hs.241551
216836_s_at	v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene	Hs.323910
	homolog (avian)
203627_at	Human insulin-like growth factor 1 receptor mRNA, 3′ sequence, mRNA sequence	Hs.405998
205225_at	estrogen receptor 1	Hs.1657
215465_at	ATP-binding cassette, sub-family A (ABC1), member 12	Hs.134585
203628_at	Human insulin-like growth factor 1 receptor mRNA, 3′ sequence, mRNA sequence	Hs.405998
202991_at	START domain containing 3	Hs.77628
208891_at	dual specificity phosphatase 6	Hs.180383
214451_at	transcription factor AP-2 beta (activating enhancer binding protein 2 beta)	Hs.33102
204508_s_at	hypothetical protein FLJ20151	Hs.279916
202376_at	serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3	Hs.234726
200832_s_at	stearoyl-CoA desaturase (delta-9-desaturase)	Hs.119597
205307_s_at	kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)	Hs.107318
203060_s_at	3′-phosphoadenosine 5′-phosphosulfate synthase 2	Hs.274230
201963_at	fatty-acid-Coenzyme A ligase, long-chain 2	Hs.154890
209802_s_at	GATA binding protein 3	Hs.169946
211138_s_at	kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)	Hs.107318
39248_at	aquaporin 3	Hs.234642
220149_at	hypothetical protein FLJ22671	Hs.193745
55616_at	hypothetical gene MGC9753	Hs.91668
205306_x_at	kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)	Hs.107318
205862_at	GREB1 protein	Hs.193914
217388_s_at	kynureninase (L-kynurenine hydrolase)	Hs.169139
204942_s_at	aldehyde dehydrogenase 3 family, member B2	Hs.87539
202218_s_at	fatty acid desaturase 2	Hs.184641
213557_at	ESTs, Weakly similar to ubiquitously transcribed tetratricopeptide repeat gene, Y chromosome;	Hs.14691
	Ubiquitously transcribed TPR gene on Y chromosome [Homo sapiens] [H. sapiens]
211657_at	carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific cross reacting antigen)	Hs.73848
214598_at	claudin 8	Hs.162209
218532_s_at	hypothetical protein FLJ20152	Hs.82273
202917_s_at	S100 calcium binding protein A8 (calgranulin A)	Hs.100000
208792_s_at	clusterin (complement lysis inhibitor, SP-40, 40, sulfated glycoprotein 2, testosterone-repressed prostate	Hs.75106
	message 2, apolipoprotein J)
215659_at	Homo sapiens cDNA: FLJ21521 fis, clone COL05880, mRNA sequence	Hs.306777
201525_at	apolipoprotein D	Hs.75736

TABLE A4
13 ‘common’ genes among the three gene sets (SAM-88, GR-251, WT-38) were then identified. This 13 member
gene achieved a classification accuracy of 84% by LOOCV. In essence, these 13 ‘common genes’ are robust significant
markers and can archive comparable performance as other ‘complete’ marker sets.
Probe_ID	Unigene	Full Length Ref. Sequences	Location
39248_at	Hs.234642	NM_004925 // aquaporin 3	Chr: 9p13
201525_at	Hs.75736	NM_001647 // apolipoprotein D precursor	Chr: 3q26.2-qter
202991_at	Hs.77628	NM_006804 // steroidogenic acute regulatory protein related	Chr: 17q11-q12
203628_at	Hs.405998	—	—
205307_s_at	Hs.107318	NM_003679 // kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)	Chr: 1q42-q44
210761_s_at	Hs.86859	NM_005310 // growth factor receptor-bound protein 7	Chr: 17q21.1
211657_at	Hs.73848	NM_002483 // carcinoembryonic antigen-related cell adhesion molecule 6	Chr: 19q13.2
		(non-specific cross reacting antigen)
213557_at	Hs.14691	—	—
214451_at	Hs.33102	NM_003221 // transcription factor AP-2 beta (activating enhancer binding protein 2 beta)	Chr: 6p12
215465_at	Hs.134585	NM_015657 // ATP-binding cassette, sub-family A, member 12 isoform	Chr: 2q35
		b /// NM_173076 // ATP-binding cassette, sub-family A, member 12 isoform a
219429_at	Hs.249163	—	Chr: 16q23
220149_at	Hs.193745	NM_024861 // hypothetical protein FLJ22671	Chr: 2q37.3
210930_s_at	Hs.323910	NM_004448 // v-erb-b2 erythroblastic leukemia viral oncogene homolog 2,	Chr: 17q11.2-q12
		neuro/glioblastoma derived oncogene homolog

TABLE L1
Look-up ID table for SAM-133 Genes
SAM-133
Rank	Probe_ID	Unigene	GenBank
1	205225_at	Hs.1657	NM_000125.1
2	209603_at	Hs.169946	AI796169
3	204508_s_at	Hs.279916	BC001012.1
4	209604_s_at	Hs.169946	BC003070.1
5	209602_s_at	Hs.169946	AI796169
6	206754_s_at	Hs.1360	NM_000767.2
7	203963_at	Hs.5338	NM_001218.2
8	214164_x_at	Hs.5344	BF752277
9	212956_at	Hs.90419	AI348094
10	215867_x_at	Hs.5344	AL050025.1
11	210735_s_at	Hs.5338	BC000278.1
12	214440_at	Hs.155956	NM_000662.1
13	202089_s_at	Hs.79136	NM_012319.2
14	210085_s_at	Hs.279928	AF230929.1
15	205862_at	Hs.193914	NM_014668.1
16	202088_at	Hs.79136	AI635449
17	211712_s_at		BC005830.1
18	206401_s_at	Hs.101174	J03778.1
19	215304_at	Hs.159264	U79293.1
20	218195_at	Hs.15929	NM_024573.1
21	212195_at	Hs.71968	AL049265.1
22	203928_x_at	Hs.101174	AI870749
23	209460_at	Hs.283675	AF237813.1
24	212960_at	Hs.90419	BE646554
25	209443_at	Hs.76353	J02639.1
26	209173_at	Hs.91011	AF088867.1
27	203071_at	Hs.82222	NM_004636.1
28	203571_s_at	Hs.74120	NM_006829.1
29	205354_at	Hs.81131	NM_000156.3
30	213712_at	Hs.30504	BF508639
31	41660_at
32	220744_s_at	Hs.70202	NM_018262.1
33	204798_at	Hs.1334	NM_005375.1
34	215552_s_at	Hs.272288	AI073549
35	209339_at	Hs.20191	U76248.1
36	210272_at	Hs.330780	M29873.1
37	205186_at	Hs.33846	NM_003462.2
38	207414_s_at	Hs.170414	NM_002570.1
39	205009_at	Hs.1406	NM_003225.1
40	203628_at	Hs.239176	H05812
41	211323_s_at	Hs.198443	L38019.1
42	201825_s_at	Hs.238126	AL572542
43	211234_x_at	Hs.1657	AF258449.1
44	209459_s_at	Hs.283675	AF237813.1
45	212196_at	Hs.71968	AW242916
46	203438_at	Hs.155223	AI435828
47	217838_s_at	Hs.241471	NM_016337.1
48	204041_at	Hs.82163	NM_000898.1
49	203929_s_at	Hs.101174	AI056359
50	200670_at	Hs.149923	NM_005080.1
51	219414_at	Hs.12079	NM_022131.1
52	203627_at	Hs.239176	AI830698
53	208451_s_at	Hs.278625	NM_000592.2
54	213419_at	Hs.324125	U62325.1
55	205768_s_at	Hs.11729	NM_003645.1
56	204862_s_at	Hs.81687	NM_002513.1
57	210480_s_at	Hs.22564	U90236.2
58	205696_s_at	Hs.105445	NM_005264.1
59	203685_at	Hs.79241	NM_000633.1
60	218976_at	Hs.260720	NM_021800.1
61	219197_s_at	Hs.222399	AI424243
62	202996_at	Hs.82520	NM_021173.1
63	205734_s_at	Hs.38070	AI990465
64	211235_s_at	Hs.1657	AF258450.1
65	211000_s_at	Hs.82065	AB015706.1
66	217190_x_at	Hs.247976	S67777
67	202752_x_at	Hs.22891	NM_012244.1
68	201754_at	Hs.74649	NM_004374.1
69	204623_at	Hs.82961	NM_003226.1
70	207038_at	Hs.114924	NM_004694.1
71	212637_s_at	Hs.324275	AU155187
72	208682_s_at	Hs.4943	AF126181.1
73	218502_s_at	Hs.26102	NM_014112.1
74	202376_at	Hs.234726	NM_001085.2
75	215816_s_at	Hs.301011	AB020683.1
76	211233_x_at	Hs.1657	M12674.1
77	205081_at	Hs.17409	NM_001311.1
78	214428_x_at	Hs.170250	K02403.1
79	209696_at	Hs.574	D26054.1
80	219682_s_at	Hs.332150	NM_016569.1
81	212496_s_at	Hs.301011	BE256900
82	203108_at	Hs.194691	NM_003979.2
83	206107_at	Hs.65756	NM_003834.1
84	218806_s_at	Hs.267659	AF118887.1
85	209581_at	Hs.37189	BC001387.1
86	213412_at	Hs.25527	NM_014428.1
87	212638_s_at	Hs.324275	BF131791
88	206469_x_at	Hs.284236	NM_012067.1
89	210652_s_at	Hs.125783	BC004399.1
90	216381_x_at	Hs.284236	AL035413
91	216092_s_at	Hs.22891	AL365347.1
92	208788_at	Hs.250175	AL136939.1
93	204792_s_at	Hs.111862	NM_014714.1
94	207847_s_at	Hs.89603	NM_002456.1
95	213201_s_at	Hs.73980	AJ011712
96	204497_at	Hs.20196	AB011092.1
97	222314_x_at	Hs.205660	AW970881
98	222212_s_at	Hs.285976	AK001105.1
99	219919_s_at	Hs.279808	NM_018276.1
100	214053_at	Hs.7888	AW772192
101	204934_s_at	Hs.823	NM_002151.1
102	216109_at	Hs.306803	AK025348.1
103	203749_s_at	Hs.250505	AI806984
104	220329_s_at	Hs.238270	NM_017909.1
105	204881_s_at	Hs.152601	NM_003358.1
106	208305_at	Hs.2905	NM_000926.1
107	209623_at	Hs.167531	AW439494
108	218450_at	Hs.108675	NM_015987.1
109	204343_at	Hs.26630	NM_001089.1
110	219051_x_at	Hs.124915	NM_024042.1
111	205471_s_at	Hs.63931	AW772082
112	203439_s_at	Hs.155223	BC000658.1
113	204863_s_at	Hs.82065	BE856546
114	203289_s_at	Hs.19699	BE791629
115	221765_at	Hs.23703	AI378044
116	219001_s_at	Hs.317589	NM_024345.1
117	220581_at	Hs.287738	NM_025059.1
118	211596_s_at		AB050468.1
119	205645_at	Hs.80667	NM_004726.1
120	219663_s_at	Hs.157527	NM_025268.1
121	205380_at	Hs.15456	NM_002614.1
122	201508_at	Hs.1516	NM_001552.1
1	215729_s_at	Hs.9030	BE542323
2	201983_s_at	Hs.77432	AW157070
3	204914_s_at	Hs.32964	AW157202
4	204913_s_at	Hs.32964	AI360875
5	205646_s_at	Hs.89506	NM_000280.1
6	207030_s_at	Hs.10526	NM_001321.1
7	204915_s_at	Hs.32964	AB028641.1
8	203021_at	Hs.251754	NM_003064.1
9	209800_at	Hs.115947	AF061812.1
10	203234_at	Hs.77573	NM_003364.1
11	201984_s_at	Hs.77432	NM_005228.1

TABLE L2
Lookup table for Table 2 genes
	Table 2
	Probe_ID	Unigene	GenBank
	205225_at	Hs.1657	NM_000125.1
	205186_at	Hs.406050	NM_003462.2
	201754_at	Hs.351875	NM_004374.1
	210085_s_at	Hs.279928	AF230929.1
	214440_at	Hs.155956	NM_000662.1
	206754_s_at	Hs.1360	NM_000767.2
	203749_s_at	Hs.361071	AI806984
	215552_s_at	Hs.239176	AI073549
	209443_at	Hs.76353	J02639.1
	216109_at	Hs.306803	AK025348.1
	203685_at	Hs.79241	NM_000633.1
	205862_at	Hs.193914	NM_014668.1
	217838_s_at	Hs.241471	NM_016337.1
	209603_at	Hs.169946	AI796169
	212195_at	Hs.71968	AL049265.1
	212637_s_at	Hs.355977	AU155187
	205696_s_at	Hs.105445	NM_005264.1
	210652_s_at	Hs.125783	BC004399.1
	205734_s_at	Hs.38070	AI990465
	211000_s_at	Hs.82065	AB015706.1
	206107_at	Hs.65756	NM_003834.1
	203628_at	Hs.405998	H05812
	204934_s_at	Hs.823	NM_002151.1
	203071_at	Hs.82222	NM_004636.1
	204881_s_at	Hs.432605	NM_003358.1
	210272_at	Hs.330780	M29873.1
	213201_s_at	Hs.73980	AJ011712
	206401_s_at	Hs.101174	J03778.1
	209339_at	Hs.20191	U76248.1
	208305_at	Hs.2905	NM_000926.1
	212956_at	Hs.90419	AI348094
	214164_x_at	Hs.279916	BF752277
	204343_at	Hs.26630	NM_001089.1
	203963_at	Hs.5338	NM_001218.2
	207038_at	Hs.114924	NM_004694.1
	218195_at	Hs.15929	NM_024573.1
	220329_s_at	Hs.238270	NM_017909.1
	218502_s_at	Hs.26102	NM_014112.1
	219414_at	Hs.12079	NM_022131.1
	202376_at	Hs.234726	NM_001085.2
	218806_s_at	Hs.267659	AF118887.1
	202089_s_at	Hs.79136	NM_012319.2
	213712_at	Hs.432587	BF508639
	204497_at	Hs.20196	AB011092.1
	215616_s_at	Hs.301011	AB020683.1
	218450_at	Hs.294133	NM_015987.1
	203438_at	Hs.155223	AI435828
	208451_s_at	Hs.433721	NM_000592.2
	205768_s_at	Hs.11729	NM_003645.1
	219682_s_at	Hs.267182	NM_016569.1
	204508_s_at	Hs.279916	BC001012.1
	203963_at	Hs.5338	NM_001218.2
	209603_at	Hs.169946	AI796169
	208788_at	Hs.250175	AL136939.1
	212637_s_at	Hs.355977	AU155187
	200670_at	Hs.149923	NM_005080.1
	203571_s_at	Hs.74120	NM_006829.1
	208682_s_at	Hs.4943	AF126181.1
	209173_at	Hs.91011	AF088867.1
	201754_at	Hs.351875	NM_004374.1
	206469_x_at	Hs.284236	NM_012067.1
	213412_at	Hs.25527	NM_014428.1
	222212_s_at	Hs.285976	AK001105.1
	211323_s_at	Hs.198443	L38019.1
	209696_at	Hs.574	D26054.1
	212956_at	Hs.90419	AI348094
	218195_at	Hs.15929	NM_024573.1
	202089_s_at	Hs.79136	NM_012319.2
	209623_at	Hs.167531	AW439494
	210272_at	Hs.330780	M29873.1
	204623_at	Hs.82961	NM_003226.1
	215304_at	Hs.159264	U79293.1
	214440_at	Hs.155956	NM_000662.1
	205862_at	Hs.193914	NM_014668.1
	203108_at	Hs.194691	NM_003979.2
	207038_at	Hs.114924	NM_004694.1
	205186_at	Hs.406050	NM_003462.2
	202752_x_at	Hs.22891	NM_012244.1
	220744_s_at	Hs.70202	NM_018262.1
	219414_at	Hs.12079	NM_022131.1
	204798_at	Hs.1334	NM_005375.1
	205009_at	Hs.350470	NM_003225.1
	219051_x_at	Hs.124915	NM_024042.1
	205471_s_at	Hs.63931	AW772082
	207847_s_at	Hs.89603	NM_002456.1
	208451_s_at	Hs.433721	NM_000592.2
	205081_at	Hs.423190	NM_001311.1
	209459_s_at	Hs.283675	AF237813.1
	203071_at	Hs.82222	NM_004636.1
	209581_at	Hs.37189	BC001387.1
	204343_at	Hs.26630	NM_001089.1
	206401_s_at	Hs.101174	J03778.1
	210480_s_at	Hs.385834	U90236.2
	201825_s_at	Hs.238126	AL572542
	203749_s_at	Hs.361071	AI806984
	218806_s_at	Hs.267659	AF118887.1
	210652_s_at	Hs.125783	BC004399.1
	205225_at	Hs.1657	NM_000125.1
	205768_s_at	Hs.11729	NM_003645.1
	219682_s_at	Hs.332150	NM_016569.1

TABLE L3
Look up table for Table S4 Genes
Unigene   GenBank
Hs.106642 BF589529
Hs.25960  AF320053.1
Hs.1892   NM_002686.1
Hs.289104 NM_014274.1
Hs.165950 NM_002011.2
Hs.173035 AF338650.1
Hs.86859  AB008790.1
Hs.272207 NM_017533.1
Hs.103707 AW192795
Hs.274550 AA074145
Hs.100000 AW238654
Hs.54609  NM_014291.1
Hs.85050  NM_002667.1
Hs.239934 AL022316
Hs.194236 NM_000230.1
Hs.103395 NM_024709.1
Hs.107318 NM_003679.1
Hs.1735   NM_002193.1
Hs.155109 NM_002153.1
Hs.26770  NM_001446.1
Hs.278388 NM_000608.1
Hs.251754 NM_003064.1
Hs.378774 NM_001615.2
Hs.51515  AA053967
Hs.149195 NM_016233.1
Hs.78344  AI889739
Hs.112405 NM_002965.2
Hs.417091 AF052117.1
Hs.57664  NM_000888.3
Hs.154078 NM_004139.1
Hs.100014 NM_007325.1
Hs.193606 AA343027
Hs.202949 AK027231.1
Hs.84072  NM_004616.1
Hs.323910 AF177761.2
Hs.76780  NM_006741.1
Hs.225962 NM_014354.1
Hs.165619 NM_017717.2
Hs.127428 AI246769
Hs.2899   NM_002150.1
Hs.105938 NM_002343.1
Hs.193143 AK022610.1
Hs.1915   NM_004476.1
Hs.160786 NM_000050.1
Hs.23881  AI920979
Hs.3110   NM_000686.2
Hs.180142 NM_017422.2
Hs.169919 NM_000126.1
Hs.112408 NM_002963.2
Hs.96     NM_021127.1
Hs.33846  NM_003462.2
Hs.1360   NM_000767.2
Hs.1657   NM_000125.1
Hs.194689 AF120274.1
Hs.50964  NM_001712.1
Hs.23703  BF970427
Hs.193914 NM_014668.1
Hs.250505 AI806984
Hs.279928 AF230929.1
Hs.156637 NM_012116.1
Hs.169946 AI796169
Hs.4243   NM_024522.1
Hs.111801 NM_015908.1
Hs.155485 NM_005339.2
Hs.99603  NM_024701.1
Hs.55481  NM_003447.1
Hs.306803 AK025348.1
Hs.239176 NM_000875.2
Hs.823    NM_002151.1
Hs.203845 NM_022358.1
Hs.432605 NM_003358.1
Hs.330780 M29873.1
Hs.32981  U38276
Hs.101174 NM_016835.1
Hs.17752  NM_015900.1
Hs.406646 Data not found
Hs.351875 NM_004374.1
Hs.20196  AB011092.1
Hs.331584 AF326966.1
Hs.272288 AI073549
Hs.12079  NM_022131.1
Hs.82065  NM_002184.1
Hs.372446 NM_007202.1
Hs.155956 NM_000662.1
Hs.278850 NM_024935.1
Hs.247955 NM_001322.1
Hs.76067  NM_001540.2
Hs.61289  AL157424.1
Hs.334514 NM_032794
Hs.4943   NM_177433
Hs.1892   NM_002686
Hs.321576 NM_006458
Hs.91668  BF033007
Hs.274260 NM_001171
Hs.14368  NM_003022
Hs.86859  NM_005310
Hs.59889  NM_005518
Hs.165950 NM_002011
Hs.83190  NM_004104
Hs.89603  NM_002456
Hs.29724  NM_024613.1
Hs.12068  NM_000755
Hs.279916 NM_017689
Hs.169946 NM_002051
Hs.355977 NM_007013
Hs.33102  NM_003221
Hs.90419  XM_093895
Hs.38972  NM_005727
Hs.31034  NM_003847
Hs.132136 NM_004858
Hs.91668  BF033007
Hs.70604  NM_004496
Hs.234642 NM_004925
Hs.323910 NM_004448
Hs.198443 NM_002222
Hs.197922 NM_018584.1
Hs.87539  NM_000695
Hs.381412 Data not found
Hs.180383 NM_001946
Hs.5338   NM_001218
Hs.406515 NM_000903
Hs.8910   NM_020379
Hs.6168   NM_014861
Hs.119597 NM_005063
Hs.574    NM_000507
Hs.326525 NM_009589
Hs.149923 NM_005080
Hs.167531 NM_022132
Hs.184376 NM_003825
Hs.301947 NM_014509
Hs.91011  NM_006408
Hs.114556 NM_017699
Hs.432970 NM_006431
Hs.300697 AK090461
Hs.84072  NM_004616
Hs.878    NM_003104

Claims

1. A method for classifying a breast tumour sample as “low confidence” or “high confidence”, the method comprising providing the expression profile of said breast tumour sample, wherein the expression profile comprises the expression level of a multi-gene classifier comprising at least 5 genes from Table S4, and classifying the tumour as a high or low confidence tumour based on the expression profile, said method optionally comprising determining the estrogen receptor (ER) status of the sample.

2. A method according to claim 1 comprising determining the estrogen receptor (ER) status of the sample.

3. A method according to claim 1 comprising the steps of: (a) obtaining expression products from a breast tumour sample obtained from a patient;(b) determining the expression levels of a multi-gene classifier comprising at least 5 genes identified in Table S4 by contacting said expression products with binding members, each binding member being capable of specifically binding to an expression product of the multi-gene classifier; and(c) identifying the presence of a low confidence breast tumour in said patient based on the expression levels.

4. A method according to claim 3 wherein the expression products are cDNA and the binding members are nucleic acid probes capable of specifically hybridising to the cDNA.

5. A method according to claim 3 wherein the expression products are RNA or mRNA and the binding members are nucleic acid primers capable of specifically hybridising to the RNA or mRNA and amplifying them in a PCR.

6. A method according to claim 3 wherein the expression products are polypeptides and the binding members are antibody binding domains capable of binding specifically to the polypeptides.

7. A method according to claim 3 comprising comparing the binding profile of the expression products from the breast tumour sample under test with a database of other previously obtained profiles and/or a previously determined “standard” profile which is characteristic of the presence of low confidence tumour.

8. A method according to claim 7 wherein the comparison is performed by a computer programmed to report the statistical similarity between the profile under test and the standard profiles so that a classification may be made.

9. A method according to claim 1 wherein the step of classifying the breast tumour sample comprises the use of Weighted Voting, Support Vector Machines and/or Hierarchical Clustering.

10. A method according to claim 1 wherein the multi-gene classifier comprises the genes from Table S4 (a), the genes from Table S4 (b), or a subset of either.

11. A method according to claim 10 wherein the subset of genes is derived from the upper half of Table S4 (a) or Table S4 (b).

12. A method according to claim 10 wherein the multi-gene classifier comprises a mixture of upregulated and downregulated genes from Table S4 (a) and/or Table S4 (b).

13. A method for classifying a breast tumour sample as “low confidence” or “high confidence”, the method comprising providing the expression profile of said breast tumour sample, wherein the expression profile comprises the expression level of a multi-gene classifier comprising at least 5 genes from Table 2, and classifying the tumour as a high or low confidence tumour based on the expression profile, said method optionally comprising determining the estrogen receptor (ER) status of the sample.

14. A method according to claim 13 comprising determining the estrogen receptor (ER) status of the sample.

15. A method according to claim 13 comprising the steps of: (a) obtaining expression products from a breast tumour sample obtained from a patient;(b) determining the expression levels of a multi-gene classifier comprising at least 5 genes identified in Table 2 by contacting said expression products with binding members, each binding member being capable of specifically binding to an expression product of the multi-gene classifier; and(c) identifying the presence of a low confidence breast tumour in said patient based on the expression levels.

16. A method according to claim 15 wherein the expression products are cDNA and the binding members are nucleic acid probes capable of specifically hybridising to the cDNA.

17. A method according to claim 15 wherein the expression products are RNA or mRNA and the binding members are nucleic acid primers capable of specifically hybridising to the RNA or mRNA and amplifying them in a PCR.

18. A method according to claim 15 wherein the expression products are polypeptides and the binding members are antibody binding domains capable of binding specifically to the polypeptides.

19. A method according to claim 15 comprising comparing the binding profile of the expression products from the breast tumour sample under test with a database of other previously obtained profiles and/or a previously determined “standard” profile which is characteristic of the presence of low confidence tumour.

20. A method according to claim 19 wherein the comparison is performed by a computer programmed to report the statistical similarity between the profile under test and the standard profiles so that a classification may be made.

21. A method according to claim 13 wherein the step of classifying the breast tumour sample comprises the use of Weighted Voting, Support Vector Machines and/or Hierarchical Clustering.

22. A method according to claim 13 wherein the multi-gene classifier comprises the genes from Table 2 (a), the genes from Table 2 (b), or a subset of either.

23. A method according to claim 22 wherein the subset of genes is derived from the upper half of Table 2 (a) or Table 2 (b).

24. A method according to claim 22 wherein the multi-gene classifier comprises a mixture of upregulated and downregulated genes Table 2 (a) and/or Table 2 (b).

25. A method for classifying a breast tumour sample as “low confidence” or “high confidence”, the method comprising providing the expression profile of said breast tumour sample, wherein the expression profile comprises the expression level of a multi-gene classifier comprising at least 5 genes from at least one table selected from the group consisting of Table A1, Table A2, Table A3, and Table A4, and classifying the tumour as a high or low confidence tumour based on the expression profile.

26. A method according to claim 25 comprising the steps of: (a) obtaining expression products from a breast tumour sample obtained from a patient;(b) determining the expression levels of a multi-gene classifier comprising at least 5 genes identified in at least one table selected from the group consisting of Table A1, Table A2, Table A3, and Table A4 by contacting said expression products with binding members, each binding member being capable of specifically binding to an expression product of the multi-gene classifier; and(c) identifying the presence of a low confidence breast tumour in said patient based on the expression levels.

27. A method according to claim 26 wherein the expression products are cDNA and the binding members are nucleic acid probes capable of specifically hybridising to the cDNA.

28. A method according to claim 26 wherein the expression products are RNA or mRNA and the binding members are nucleic acid primers capable of specifically hybridising to the RNA or mRNA and amplifying them in a PCR.

29. A method according to claim 26 wherein the expression products are polypeptides and the binding members are antibody binding domains capable of binding specifically to the polypeptides.

30. A method according to claim 26 comprising comparing the binding profile of the expression products from the breast tumour sample under test with a database of other previously obtained profiles and/or a previously determined “standard” profile which is characteristic of the presence of low confidence tumour.

31. A method according to claim 30 wherein the comparison is performed by a computer programmed to report the statistical similarity between the profile under test and the standard profiles so that a classification may be made.

32. A method according to claim 25 wherein the step of classifying the breast tumour sample comprises the use of Weighted Voting, Support Vector Machines and/or Hierarchical Clustering.

33. A method according to claim 25 wherein the multi-gene classifier comprises the genes from Table A4 or a subset thereof.

34. A method of producing a nucleic acid expression profile for a breast tumour sample comprising the steps of (a) isolating expression products from said breast tumour sample;(b) identifying the expression levels of a multi-gene classifier comprising at least 5 genes selected from any one of Table S4, Table 2, Table A1, Table A2, Table A3 and Table A4; and(c) producing from the expression levels an expression profile for said breast tumour sample.

35. A method according to claim 34 comprising the steps of (a) isolating expression products from a breast tumour sample;(b) contacting said expression products with a multi-gene classifier comprising at least 5 binding members capable of specifically and independently binding to expression products of a plurality of genes selected from Table S4 or Table 2, or independently selected from a table selected from the group consisting of at least one of Table A1, Table A2, Table A3, and Table A4, so as to create a first expression profile of a tumour sample from the expression levels of said multi-gene classifier;(c) comparing the expression profile with an expression profile characteristic of a high confidence tumour and/or a low confidence breast tumour.

36. An expression profile database comprising a plurality of gene expression profiles of high confidence and/or low confidence breast tumour samples wherein each gene expression profile is derived from a multi-gene classifier comprising at least 5 genes selected from Table S4 or Table 2, or independently selected from a table selected from the group consisting of at least one of Table A1, Table A2, Table A3, and Table A4, and wherein the database is retrievably held on a data carrier.

37. An expression profile database according to claim 36 wherein the expression profiles making up the database are produced by (a) isolating expression products from said breast tumour sample; (b) identifying the expression levels of a multi-gene classifier comprising at least 5 genes selected from any one of Table S4, Table 2, Table A1, Table A2, Table A3 and Table A4; and(c) producing from the expression levels an expression profile for said breast tumour sample or(a) isolating expression products from a breast tumour sample;(b) contacting said expression products with a multi-gene classifier comprising at least 5 binding members capable of specifically and independently binding to expression products of a plurality of genes selected from Table S4 or Table 2, or independently selected from a table selected from the group consisting of Table A1, Table A2, Table A3 and Table A4, so as to create a first expression profile of a tumour sample from the expression levels of said multi-gene classifier;(c) comparing the expression profile with an expression profile characteristic of a high confidence tumour and/or a low confidence breast tumour.

38. Apparatus for classifying a breast tumour sample as “high confidence” or “low confidence”, comprising a plurality of binding members attached to a solid support, each binding member being capable of specifically binding to an expression product of a multi-gene classifier comprising at least 5 genes from any one or more of Table S4, Table 2, Table A1, Table A2, Table A3 and Table A4.

39. Apparatus according to claim 38 comprising binding members capable of binding to expression products of a plurality of genes from each of said Tables.

40. Apparatus according to claim 38, comprising binding members capable of specifically and independently binding to expression products of all genes identified in Table A4.

41. Apparatus according to claim 38 comprising a microarray wherein the binding members are nucleic acid sequences capable of capable of specifically hybridising to RNA or mRNA expression products, or cDNA derived therefrom.

42. A kit for classifying a breast tumour sample as “high confidence” or “low confidence”, said kit comprising a plurality of binding members, each binding member being capable of specifically binding to an expression product of one of a multi-gene classifier comprising at least 5 genes identified in any one or more of Table S4, Table 2, Table A1, Table A2, Table A3 and Table A4, and-a detection reagent.

43. A kit according to claim 42 wherein the binding members are antibody binding domains or nucleic acid sequences fixed to one or more solid supports.

44. A kit according to claim 43 comprising a microarray.

45. A kit according to claim 42 wherein the binding members are nucleic acid primers capable of binding to the expression products, such that they can be amplified in a PCR.

46. A kit according to claim 42 further comprising one or more standard expression profiles retrievably held on a data carrier for comparison with expression profiles of a test sample.

47. A kit according to claim 46 wherein the one or more standard expression profiles are produced by (a) isolating expression products from said breast tumour sample;(b) identifying the expression levels of a multi-gene classifier comprising at least 5 genes selected from any one of Table S4, Table 2, Table A1, Table A2, Table A3 and Table A4; and(c) producing from the expression levels an expression profile for said breast tumour sample or(a) isolating expression products from a breast tumour sample;(b) contacting said expression products with a multi-gene classifier comprising at least 5 binding members capable of specifically and independently binding to expression products of a plurality of genes selected from Table S4 or Table 2, or independently selected from a table selected from the group consisting of Table A1, Table A2, Table A3 and Table A4, so as to create a first expression profile of a tumour sample from the expression levels of said multi-gene classifier;(c) comparing the expression profile with an expression profile characteristic of a high confidence tumour and/or a low confidence breast tumour.