The invention relates to the field of biochemistry, molecular biology and food production. More in particular, the invention relates to methods and means for regulating gene expression. Even more in particular, the invention relates to CodY target sequences.
The Gram-positive lactic acid bacterium Lactococcus lactis is an important microorganism in dairy food production. It is part of many starter cultures used in cheese manufacturing, where its function is to degrade the milk protein casein into small peptides and amino acids (Kok and Vos, 1993). L. lactis, like other lactic acid bacteria, is a multiple amino acid auxotroph. It has a complex proteolytic system to break down the major milk protein casein into small peptides and free amino acids that are necessary for growth in this medium (Kunji et al., 1996, Christensen et al., 1999). Initial breakdown of casein is carried out by the extracellular cell wall-bound serine proteinase PrtP. Several lactococcal prtP genes have been cloned and sequenced (Kok et al., 1985, Kok et al., 1988, de Vos et al., 1989, Kiwaki et al., 1989). Although they are over 98% identical on the amino. acid sequence level, the proteinases can have quite different caseinolytic specificities (Visser et al., 1986). For the production of an active proteinase, the product of prtM, a gene that is in a back-to-back orientation with prtP, is required. The so-called maturase PrtM plays a role as an extracellular chaperone, inducing the pro-proteinase to adopt a conformation in which it is able to autoproteolytically cleave off its pro-region (Kok, 1990, Haandrikman, 1990). Peptides that are produced by the proteinase can be internalized by either one of three different transport systems. Oligopeptides are taken up by Opp, while DtpT and DtpP transport di- and three-peptides respectively (Tynkkynen et al., 1993, Foucaud et al., 1995). Intracellularly, the peptides are further hydrolyzed into smaller peptides and amino acids by the action of over 15 different peptidases (Kunji et al., 1996, Christensen et al., 1999).
Proteinase and maturase production is inhibited in peptide-rich medium (e.g. containing casitone, a tryptic digest of casein) in a number of lactococcal strains (Exterkate, 1985, Laan et al., 1993, Marugg et al., 1995, Miladinov et al., 2001). As PrtP expression is not down-regulated in strains that lack the di- and tripeptide transporter DtpT, it was hypothesized that the internal concentration of small (di-tri) peptides, or amino acids derived thereof, are important in the regulation of proteinase production (Marugg et al., 1995). The genetic information for proteinase regulation was shown to be present on a 90-bp subfragment of the prtP/prtM intergenic region encompassing the transcription start sites of both genes (Marugg et al., 1996). Disruption of an inverted repeat that is present in this region resulted in derepression of the prtP and prtM promoters in medium with a high peptide concentration.
The expression of genes of other components of the proteolytic system of L. lactis is also affected by medium composition. The expression of OppA, DtpT and DtpP is increased when cells are grown in medium with a low peptide concentration (Detmers et al., 1998, Kunji et al., 1996, Foucaud et al., 1995). Moreover, the expression of the peptidases PepX and PepN in L. lactis MG1363 was shown to be regulated in a similar way (Meijer et al., 1996). Promoters of pepC, pepN, pepO1, and pepO2 were also reported to be more active in medium with amino acids than in peptide-rich medium (Guedon et al., 2001a). In the same study, the prtP promoter was shown to be subject of a similar regulatory circuit.
Recently, a pleiotropic regulator, CodY, has been identified in L. lactis MG1363 that represses several genes involved in the processes mentioned above (Guedon et al., 2001b). CodY, was first identified in the Gram-positive bacterium Bacillus subtilis, in which it also serves as a repressor of several genes involved in proteolysis (Serror and Sonenshein, 1996b; Serror and Sonenshein, 1996a). In B. subtilis, the activity of CodY is dependent on intracellular GTP levels, thereby sensing the energy state of the cell (Ratnayake-Lecamwasam et al., 2001). For L. lactis it was shown that the repression by CodY is relieved upon a decrease in the intracellular pool of the branched chain amino acids (BCAA's) Leu, Iso and Val (Guedon et al., 2001b).
Like its B. subtilis counterpart, CodY of L. lactis contains a C-terminal helix-turn-helix DNA binding motif. In B. subtilis it has been shown that the protein is able to bind to sequences overlapping the −35 and −10 sequences of its target promoters (Serror and Sonenshein, 1996b; Fisher, Rohrer, and Ferson, 1996).
Herein we show that CodY represses its target genes by binding to specific DNA sequences upstream of the respective genes. A conserved target site was identified by analyzing upstream sequences of derepressed genes in a delta codY L. lactis MG1363 derivative, as identified in a DNA micro-array study. The present application furthermore discloses CodY target sequences from other gram-positive bacteria, like B. subtilis and Streptococcus.
Hence, the invention provides CodY target sequences that may be used in different applications to repress or derepress gene expression.
In a first embodiment, the invention provides a method for regulating the expression of a gene of interest in a host cell that comprises a CodY-like protein comprising providing said cell with a gene of interest in operable linkage with a promoter and at least one CodY target sequence.
Regulation of gene expression is a very desirable characteristic of gene expression systems. For example, when one would like to express a protein that is toxic for the used host cell, preferably a gene encoding said protein is under the control of a regulator which can be switched on or off at will. Typically, for production of such a protein, expression of the corresponding gene is suppressed until enough biomass has been obtained and then expression of said gene is obtained for example by providing an inducer. However, also expression of non-toxic proteins is preferably regulated by an induction system. Examples of these kinds of expression systems are well known in the art and hence no further elaboration on this subject is necessary. In a method according to the invention a CodY-like protein and at least one CodY target sequence, control expression of a gene of interest. Binding of a CodY-like protein to said at least one CodY target sequence results in repression of expression of the gene of interest that is under control of said CodY target sequence. In the absence of (sufficient) CodY-like protein or in the presence of non-functional (i.e. non-binding) CodY-like protein, said gene of interest is expressed. Hence, the invention provides a way for regulating gene expression. As CodY-like proteins are typically found in gram-positive bacteria, for example lactic acid bacteria, the invention preferably provides a method for regulation gene expression in gram-positive bacteria. However, it is clear to the person skilled in the art that necessary components of the method according to the invention, i.e. a CodY-like protein and a CodY target sequence may easily be transferred to for example a gram-negative bacterium.
CodY proteins show a large amount of homology in gram-positive bacteria with a low G+C content. A Blast search with the CodY amino acid sequence of L. lactis shows homology with Bacillus subtilis, Bacillus anthracis, Bacillus halodurans, Bacillus stearothermophilus, Clostridium acetobutylicum, Clostridium difficile, Enterococcus faecalis, Staphylococcus aureus, Streptococcus mutans, Streptococcus pneumoniae and Streptococcus pyogenes. Moreover, these CodY proteins all comprise a DNA binding motif, preferably a helix-turn-helix DNA binding motif. It is furthermore shown that CodY proteins comprise putative GTP binding motifs as summarised in Table 1. Furthermore, binding of these CodY proteins to their target sequences is typically under the influence of the energy level of the cell (GTP) or the intracellular pool of branched chain amino acids or the nutritional value of the medium (nitrogen source like casitone).
A CodY-like protein is typically a CodY protein or a functional equivalent and/or a functional fragment thereof, obtained/derived from a gram-positive bacterium, which CodY protein comprises the above outlined characteristics, i.e. capable of binding to a (consensus) CodY target sequence and sensitive to a change in the energy level of the cell, the intracellular pool of branched amino acids or the medium composition. Examples of CodY proteins are the CodY proteins from Lactococcus lactis (Guedon et al, 2001b)) or Bacillus subtilis (Serror and Sonenshein, 1996b; Serror and Sonenshein, 1996a). It is clear that for example a CodY protein from L. lactis can be modified without significantly changing the above outlined characteristics, for example, by introducing point mutations or (small) deletions. Hence, a CodY-like protein is a Cod protein obtained from a gram-positive bacterium such as Bacillus subtilis, Bacillus anthracis, Bacillus halodurans, Bacillus stearothermophilus, Clostridium acetobutylicum, Clostridium difficile, Enterococcus faecalis, Staphylococcus aureus, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, and Lactococcus lactis, possibly comprising mutations which do not interfere significantly with for example the binding of said CodY-like protein to a CodY target sequence and furthermore is sensitive to the energy state of a cell, the intracellular pool of branched amino acids or the medium composition.
The location of the CodY target sequence with regard to the promoter sequence is flexible. The CodY target sequence may be either located upstream, downstream or overlapping with regard to the −35 and −10 sequences. Furthermore, at least one CodY target sequence is used in a method according to the invention. As disclosed herein within the experimental part, an increase in the number of CodY target sequences results in a more pronounced regulation of expression and hence introduction of more than one CodY target sequence is useful depending on, for example, the characteristics of the gene of interest.
The promoter used in a method according to the invention is preferably a promoter that is functional in the used host cell. For example, a promoter that is functional in a gram-positive bacterium is used, in operable linkage with a CodY target sequence and a gene of interest, for regulating expression of said gene of interest in a gram-positive bacterium. The prior art provides a large amount of promoter sequences, both from gram-positive as well as gram-negative bacteria, and hence no further elaboration on this item is necessary.
In a preferred embodiment, said promoter and/or said CodY target sequence is heterologous with regard to said gene of interest. In yet another preferred embodiment, said CodY target sequence is heterologous with regard to said promoter. Hence, the invention preferably makes use of combinations in which at least one component (i.e. promoter sequence or gene of interest or CodY target sequence) is different when compared to wild type/natural situation. The gene of interest may be an endogenous gene or a heterologous gene. For an endogenous gene that is already in operable linkage with a promoter, only at least one CodY target sequence has to be introduced (in operable linkage with said promoter and said gene). After introduction of said at least one CodY target sequence, expression of said endogenous gene will, in the presence/absence of CodY-like protein, be repressed/derepressed and hence expression of said endogenous gene is regulated. Furthermore, it is within the scope of the present application to introduce an extra copy of an endogenous gene in operable linkage with its own promoter and/or at least one CodY target sequence or with another promoter and/or at least one CodY target sequence. Hence, at least two copies of said endogenous gene are then present. A heterologous gene in operable linkage with a promoter and at least one CodY sequence may for example be introduced via a plasmid. However, it also possible to only introduce said gene of interest and further provide said gene of interest with the necessary means for homologous recombination to an endogenous gene that is under control of a CodY target sequence. In this way an endogenous gene is replaced by another gene, which is, then under control of a CodY target sequence.
The introduction of new and/or extra genetic information into a host cell may be accomplished by methods known in the art, for example by electroporation, protoplast transformation, transfection, transduction or any other known method.
Any sequence can be used as sequence of interest. Preferably, said sequence enables the production of a protein of interest not present as such or present in a (too) low concentration, in said cell. For example, a sequence/open reading frame (ORF) specifying an enzyme (protease or peptidase), a vitamin or an anti-microbial peptide is used. Preferably, said gene of interest is a gene from a gram-positive bacterium. Even more preferably, said gene of interest is a gene from a lactic acid bacterium, like Lactococcus, Lactobacillus, Streptococcus, Leuconostoc, Pediococcus, Bifidobacterium, Carnobacterium or Propionibacterium. An example of a gene of interest is a gene that encodes a protease or a peptidase or an anti-microbial peptide or a vitamin. Other examples of gene products include, but is not limited to, hydrolytic enzymes selected from proteases such as chymosin, peptidases including endopeptidases, lipases, nucleases and carbohydrases; lytic enzymes such as lysozyme or phage lysins; flavour enhacing substances; bacteriocins including nisin, pediocin and bavaracin; amino acids; organic acids; and pharmacologically active substances. Further examples comprise genes of which the products make host cells more resistant to advere conditions, for instance conditions to which micro-organisms are confronted at various stages during industrial use, e.g. starvation, lactic acid accumulation, oxygen stress, drying-stress, temperature stress. For example probiotic formula's are made more robust during and/or after production, e.g. by optimising the survival of cells of probiotic strains. As another example, the re-growth of starter cultures is made more reliable.
In a preferred embodiment the invention provides a method for regulating the expression of a gene of interest in a host cell that comprises a CodY-like protein comprising providing said cell with a gene of interest in operable linkage with a promoter and at least one CodY target sequence, wherein said CodY target sequence comprises a sequence as depicted in the upper part of
One embodiment of the present invention provides a method for regulating the expression of a gene of interest in a host cell that comprises a CodY-like protein comprising providing said cell with a gene of interest in operable linkage with a promoter and at least one CodY target sequence, wherein said CodY target sequence comprises an ATGTTCA sequence and an inversely repeated ATGTTCA sequence. An example of such sequence is shown in
Based on the herein disclosed (consensus) CodY target sequences it is furthermore possible to construct for example constructs comprising two or more (identical or different) CodY-like target sequences. In this way a more stringent regulation of expression is obtained. For example a gene of interest in operable linkage with a promoter and two (identical or different) CodY target sequence is used to obtain more stringent control of expression. However, it is also possible to introduce a construct that comprises multiple CodY target sequences (with or without a promoter and/or a gene of interest) in a cell that comprises CodY regulated genes and hence a competitive binding of CodY to said construct that comprises multiple CodY target sequences and binding to a CodY target sequence in operable linkage with a gene of interest and a promoter takes place. In this way a gene of interest is derepresses and said gene of interest is expressed.
The method according to the invention allows both active as well as inactive/passive regulation of gene expression of a gene of interest. Said regulation is preferably based on influencing the binding between a CodY-like protein and at least one CodY target sequence. An example of passive/indirect/inactive regulation is a gene of interest in operable linkage with a promoter and a CodY target sequence that is introduced into a host cell that comprises CodY-like protein. During exponential growth of said host cell said CodY-like protein binds to said CodY target sequence and hence expression of said gene of interest is repressed. After the exponential phase, said CodY-like protein will release from said CodY target sequence and hence expression of said gene of interest is induced. Such an approach is extremely useful in cases in which one would like to have expression of a gene of interest after exponential growth. Active regulation of gene expression of a gene in operable linkage with a promoter and a at least one CodY target sequence is for example obtained by regulating binding of a CodY-like protein and a CodY target sequence by subjecting said cell to a change in a growth condition, preferably to a growth limiting condition like a limited availability of a nitrogen source. In case, a CodY-like protein or a functional fragment and/or a functional derivative thereof of L. lactis is used, means that result in a decrease in the intracellular pool of the branched amino acids Leu, Iso and Val results in relief of CodY repression. The CodY protein of B. subtilis is for example actively regulated by a means that influence the level of GTP in a host cell. Hence, actively subjecting a CodY-like protein comprising host cell that further comprises a gene of interest in operable linkage with a promoter and at least one CodY target sequence to a medium with a limited availability of a nitrogen source results in derepression and hence expression of said gene of interest.
In a preferred embodiment, the invention provides a method for regulating the expression of a gene of interest in a host cell that comprises a CodY-like protein comprising providing said cell with a gene of interest in operable linkage with a promoter and at least one CodY target sequence, wherein said host cell is a cell from a food production species and even more preferably a dairy food production species. Preferably, said species is selected from the gram-positive species and even more preferably said species is a lactic acid bacterium such as Lactococcus or Lactobacillus or Streptococcus or Leuconostoc or Pediococcus or Bifidobacterium or Carnobacterium. An example of a gram-positive, non lactic acid bacterium is Propionibacterium. Amongst others, these species are used in the production of food, for example in a fermentation step for the production of a dairy product. Hence, by providing these species with a gene of interest under the control of a promoter and at least one CodY target sequence and either indirectly/passively or directly/actively influencing the binding between a CodY-like protein and its target sequence results in repression or derepression (i.e regulation) of gene expression of said gene of interest. This may be used for the metabolic engineering of various catabolic pathways by a rerouting strategy consisting of the controlled overproduction and/or disruption of genes. For example, genes of which the products, directly or indirectly, are involved in the production of compounds that are involved in the formation of off-flavours during exponential growth during a (dairy) food production, are repressed by providing said genes with a CodY target sequence. Food or dairy food production species in which said genes are under the control of a CodY target sequence, will produce less (or preferably no) off-flavours and hence these production processes are improved. It has for instance become possible to alter flavour formation in cheese, yoghurt and/or other fermented (dairy) products by altering the expression of enzymes that, when present in different quantities, give rise to re-routing of specific pathways. Examples of such enzymes are enzymes involved in e.g.
In an analogous way it is also possible to induce expression of a gene of interest after the exponential growth and hence provide said species with altered flavour formation, altered cell lysis capabilities or induce production of antimicrobial substances and/or health promoting substances (such as vitamins) or provide said species with means to at least in part prevent acidification of the same or another species. For the latter possibilities, a gene of interest (for example a gene involved in cell lysis or flavour formation or a gene encoding a vitamin) is placed under the control of a promoter and at least one CodY target sequence and after the end of exponential growth, CodY-like protein will be released from said CodY target sequence and hence expression of said gene is induced. Furthermore, CodY-like proteins are released from their target sequences by providing cells with for example synthetic CodY targets. Said CodY target may be added to the medium, taken up by the cells (for example B. subtilis) and the CodY-like proteins are released from their targets and will bind to the synthetic CodY targets. With a method of the invention it has for instance become possible to induce the production of antimicrobial substances (for instance antimicrobial peptides) of which the production would be detrimental during the fermentation process but is benificial after exponential growth to prevent spoilage organisms in the fermented product. A method of the invention is for instance suitable for inducing bacteriocin (e.g. nisin) production in cheese, yoghurt and/or other fermented (dairy) products after exponential growth thereby preventing that the fermenting micro-organisms are affected during fermentation.
In another aspect a method of the invention is used in order to decrease the expression of a gene in a stationary phase culture or equivalent of said culture. This is for instance done by providing a host cell with an antisense nucleic acid sequence in operable linkage with a promoter and at least one codY target sequence. In the presence of CodY, expression of said antisense nucleic acid is repressed during exponential growth. Upon transcription of said antisense nucleic acid during the stationary phase, produced RNA will bind mRNA of said undesired gene, thereby preventing translation of said undesired gene. Said undesired gene for instance comprises a gene involved in post-acidification. Said gene for instance comprises a gene involved in carbon catabolism, glucose and lactose catabolism (such as for instance glycolytic enzymes/lactate dehydrogenase) and lactose uptake. It has also become possible to prevent undesired CO2 production by inhibiting citrate catabolism, to prevent off-flavour production or re-routing of specific pathways by inhibiting expression of a gene encoding undesired proteins/peptides, and/or to extend the shelf life of fermented (dairy) products by decreasing metabolism, ((post-)acidification, glycolysis, lipolysis, proteolysis, peptidolysis) and/or cell lysis.
Hence, with a method of the present invention expression of a gene can be regulated at any stage of growth, for instance during exponential growth and/or during the stationary phase. In a further aspect a method of the invention is used in order to decrease expression of a gene, wherein binding of a CodY-like protein to a CodY target sequence is regulated by subjecting said cell to a change in a growth condition. Preferably, said cell is subjected to a growth limiting condition. In a preferred embodiment said growth limiting condition is a limited availability of a nitrogen source.
Now that the invention discloses multiple (consensus) CodY target sequences it is furthermore part of the invention to modify endogenous CodY sequences, to for example increase or decrease (or more generally alter) binding of CodY to one of its endogenous target sequences and hence production of an endogenous gene that is under control of the CodY/CodY target sequence regulation may be altered. For example, proteins which expression is under the control of CodY (and hence are not or hardly not produced during the exponential growth phase) but whose product provides advantageous uses when present during exponential growth may now be amended such that binding of CodY to said CodY target sequence is not or hardly not possible under the exponential growth phase conditions. Hence, said protein is expressed during exponential growth and advantage is taken of the properties of said expressed protein.
In case a host cell does not comprise or does not comprise enough CodY-like protein or comprises non-functional (i.e. CodY protein that is not capable of binding to a CodY target sequence) CodY-like protein, the invention furthermore provides a method for regulating the expression of a gene of interest in a host cell that comprises a CodY-like protein comprising providing said cell with a gene of interest in operable linkage with a promoter and at least one CodY target sequence wherein said host cell is further provided with a nucleic acid encoding a CodY-like protein. Examples of CodY sequences are already outlined above and hence no further details are provided. In case a host cell does not comprise/express enough CodY-like protein said cell may be provided with either endogenous and/or heterologous CodY-like protein.
In yet another preferred embodiment, the invention provides an isolated or recombinant nucleic acid that comprises at least one CodY target sequence or a functional fragment and/or a functional equivalent thereof. It is clear from
In a preferred embodiment said isolated or recombinant nucleic acid that comprises at least one CodY target sequence or a functional fragment and/or a functional equivalent thereof, further comprises a promoter sequence and/or a promoter sequence in operable linkage with a gene of interest.
In case a host cell does not comprise or does not comprise enough endogenous CodY-like or comprises non-functional CodY protein, the invention furthermore provides an isolated or recombinant nucleic acid that comprises at least one CodY target sequence or a functional fragment and/or a functional equivalent thereof wherein said nucleic acid further comprises a gene encoding a CodY-like protein or a functional fragment and/or a functional equivalent thereof.
In a preferred embodiment, said promoter and/or said at least one CodY target sequence is heterologous with regard to said gene of interest and in another preferred embodiment, said CodY target sequence is heterologous with regard to said promoter.
Again, as already outlined above, said gene of interest may either be an endogenous and/or a heterologous gene. Preferably, said gene of interest is a gene from a gram-positive bacterium, such as a gene from a lactic acid bacterium for example Lactococcus or Lactobacillus or Streptococcus or Leuconostoc or Pediococcus or Bifidobacterium or Carnobacterium. An example of a gram-positive, non lactic acid bacterium is Propionibacterium.
A gene of interest may be any gene, preferably said gene of interest encodes a protease or a peptidase or an anti-microbial peptide or a vitamin. Other suitable examples include hydrolytic enzymes selected from proteases such as chymosin, peptidases including endopeptidases, lipases, nucleases and carbohydrases; lytic enzymes such as lysozyme or phage lysins; flavour enhacing substances; bacteriocins including nisin, pediocin and bavaracin; amino acids; organic acids; and pharmacologically active substances.
In a preferred embodiment, the invention provides an isolated or recombinant nucleic acid that comprises at least one CodY target sequence or a functional fragment and/or a functional equivalent thereof, wherein said CodY target sequence comprises a sequence as depicted in
In a further preferred embodiment, the invention provides an isolated or recombinant nucleic acid that comprises at least one CodY target sequence or a functional fragment and/or a functional equivalent thereof, wherein said CodY target sequence comprises a sequence as depicted in Table 4, Table 4A, Table 5, Table 6, Table 7 and/or Table 8, or a functional equivalent and/or a functional fragment thereof.
In another preferred embodiment the invention provides an isolated or recombinant nucleic acid that comprises at least one CodY target sequence or a functional fragment and/or a functional equivalent thereof, wherein said CodY target sequence comprises an ATGTTCA sequence and an inversely repeated ATGTTCA sequence. Preferably, said nucleic acid sequence comprises a spacing of about 9 base pairs between said ATGTTCA sequence and said inversely repeated ATGTTCA sequence. More preferably, said nucleic acid sequence comprises the sequence ATGTTCAGAAAATTCATGAACAT.
Now that a consensus sequence and some of its variants are disclosed herein (see
Moreover, the present inventors have identified alternative sequences in the upstream region of CodY regulated genes that may also be included in a method for regulating the expression of a gene of interest in a host cell that comprises a CodY-like protein (
In another embodiment the invention provides a vector comprising a nucleic acid as described above. Said vector may further be provided with means for homologous recombination. With these means said at least one CodY target sequence and/or a gene of interest and/or a promoter and/or a gene encoding CodY-like protein may be integrated into the genome of a cell and hence a more stable situation may be obtained. In yet another embodiment, the invention provides a gene delivery vehicle comprising a nucleic acid or a vector according to the invention. Gene delivery vehicles are well known in the art and hence no further details are provided on this subject matter.
In a further embodiment the invention provides a host cell that comprises a nucleic acid, a vector or a gene delivery vehicle according to the invention. Preferably, said host cell is a cell from a food production species and even more preferably said host cell is a cell from a dairy food production species. Non-limiting examples of said species are gram positive lactic acid bacteria such as Lactococcus or Lactobacillus or Streptococcus or Leuconostoc or Pediococcus or Bifidobacterium or Carnobacterium. An example of a gram positive, non lactic acid species is Propionibacterium.
In another embodiment, the invention provides use of at least one CodY target sequence for regulating the expression of a gene of interest. Preferably, said at least one CodY target sequence is selected from
In yet another embodiment the invention provides a method for producing a food product comprising a nucleic acid or a vector or a gene delivery vehicle or a host cell as described above. Preferably said food product is a dairy food product. As a non-limiting example, the use of a host cell is described in more detail. A lot of (dairy) food production processes involve the use of a (fermenting) host cell. These host cells may now be manipulated with regard their protein products. For example, genes of which the products, directly or indirectly, are involved in the production of compounds that are involved in the formation of off-flavours during exponential growth during a (dairy) food production, are repressed by providing said genes with a CodY target sequence. Food or dairy food production species in which said genes are under the control of a CodY target sequence, will produce less (or preferably no (detectable)) off-flavours during exponential growth and hence these production processes are altered. In an analogous way it is also possible to induce expression of a gene of interest after the exponential growth of said host cell and hence provide said species with altered flavour formation, altered cell lysis capabilities or induce production of antimicrobial substances and/or health promoting substances (such as vitamins) or provide said species with means to prevent acidification of the same or another species. For the latter possibilities, a gene of interest (for example a gene involved in cell lysis or a gene involved in flavour formation or a gene encoding a vitamin) is placed under the control of a promoter and at least one CodY target sequence and after the end of exponential growth, CodY-like protein will be released from said CodY target sequence and hence expression of said gene is induced.
Furthermore expression of undesired genes during the stationary phase can be, at least in part, decreased.
With regard to a fluid dairy product a method to at least in part decrease lysis of bacteria and/or acidification after production of said fluid diary product, i.e. after exponential growth of the used bacteria, is very advantageous with regard to the shelf life of said fluid dairy product. First, genes that are capable of at least in part preventing lysis and/or acidification are identified. After identification, such genes are placed under the regulation of at least one CodY target sequence. Said genes are expressed and hence lysis and/or acidification is at least in part prevented (and more preferably completely inhibited) and hence the shelf life of said product is increased.
Moreover, in case integration of said nucleic acid or vector is desired, use may be made of food grade integration techniques (for example see Leenhouts, 1995, herein incorporated by reference).
Preferably, the invention provides a method for producing a (dairy) food product comprising a nucleic acid or a vector or a gene delivery vehicle or a host cell as described herein, wherein said dairy product is a cheese or a fermented milk product. The production of a lot of dairy products involves fermentation of lactic acid bacteria and hence the application of modified host cells as described herein are particularly advantageous. The term “dairy product” include but is not limited to cheese, fluid dairy products like milk and yoghurt, fermented milk product, ice cream, butter, buttermilk, margarine and milk powder.
In another embodiment the invention provides food or a dairy food, such as a cheese or a fermented milk product, obtainable by a method according to the invention. Such a product comprises for example a different or extra taste or comprises specific compounds/structures (such as health improving compounds as vitamins) not present in food or dairy food product not obtained according to a method of the invention. Food or dairy food products prepared by a method according to the invention may comprise different amounts or different kinds of enzymes, peptides, amino acids, flavour enhancing or pharmacologically active substances or organic acids.
In yet another embodiment, the invention provides a method for at least in part preventing the formation of off-flavours during a process for the production of a (dairy) food product, comprising providing at least one CodY target sequence in operable linkage with a gene which product is, directly or indirectly, involved in the formation of off-flavours.
Now that the present inventors have disclosed CodY target sequences, interesting leads are provided in the fight against food-spoilers and pathogens.
PpmA is a recently identified pneumococcal protein with significant sequence homology to the proteinase maturation protein (PrtM) of lactic acid bacteria. PrtM is a trans-acting protein involved in the processing of precursors of serine protease PrtP into active enzymes and belongs to the family of peptidyl-prolyl cis/trans isomerases. These enzymes are thought to assist in protein folding by catalyzing the cis/trans isomerization of the petidyl-prolyl bonds in peptides and proteins. The pneumococcal proteins(s) that is activated by PpmA is currently unknown. PpmA of Streptococcus pneumoniae was demonstrated to be involved in virulence. Inactivation of ppmA significantly reduced the virulence of strain D39 for mice as judged by the survival time after intranasal challenge. The present inventors identified a CodY target sequence upstream of ppmA (Table 7) indicating that the expression of this gene probably is under the control of CodY. Hence, the invention provides a method for regulating the expression of ppmA.
Spore-forming bacteria (e.g. Bacillus) can cause serious problems in industrial food fermentations as the spores can survive most processing conditions. In Bacillus subtilis it was shown that the target genes of CodY generally encode proteins useful to the cell in adapting to poor nutritional conditions, but also include several genes whose expression is critical to the acquisition of genetic competence and the initiation of sporulation. The present invention provides a method for influencing the expression of these genes.
In Clostridium difficile, the synthesis of two toxin proteins responsible for antibiotic-associated colitis and pseudomembranous colitis were shown to be dependent on a RNA polymerase sigma factor TxeR (Sonenshein, unpublished). Both TxeR and the toxin proteins were not synthesized in exponential phase cells, probably due to the action of CodY as it was shown to bind to the toxin regulatory region.
The invention will now be illustrated by means of the following, non-limiting examples.
Bacterial Strains, Plasmids and Growth Conditions
The strains and plasmids used in this study are listed in Table 9. Escherichia coli was grown in TY medium at 37° C. with vigorous agitation or on TY medium solidified with 1.5% agar, containing 100 μg of erythromycin per ml when needed. 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal) was used at a final concentration of 40 μg/ml. L. lactis was grown at 30° C. in M17 broth or on M17 medium solidified with 1.5% agar, supplemented with 0.5% glucose. When needed, erythromycin, chloramphenicol and X-gal were added at final concentrations of 5 μg, 5 μg and 80 μg per ml, respectively. Chemically defined medium (CDM) was prepared according to Poolman and Koning (1988).
DNA Preparation, Molecular Cloning and Transformation
Routine DNA manipulations were performed as described by Sambrook et al.(1989). Total chromosomal DNA from L. lactis MG1363 was extracted as described previously. Plasmid DNA was isolated by the alkaline lysis procedure described by Sambrook et al (1989). Minipreparations of plasmid DNA from E. coli and L. lactis were made using the High Pure Plasmid isolation Kit from Roche, with minor modifications for L. lactis. Restriction enzymes and T4 DNA ligase were purchased from Roche. PCR amplifications were carried out using Pwo DNA polymerase for cloning fragments and Taq DNA polymerase for checking DNA insert sizes in plasmids from transformants. Electrotransformation of E. coli and L. lactis were performed with a Bio-Rad Gene Pulser (Bio-Rad Laboratories, Richmond, Calif.).
RNA Preparation and Primer Extension
The opp transcript was subjected to primer extension analysis using the oligonucleotide sto14 (CTTGCCATGGAATCACCCG) essentially as described previously (Buist et al, 1997). In the reactions, 30 μg of total RNA that was isolated from L. lactis MG1363 cells as described (van Asseldonk et al, 1993) was used as template. A DNA sequence ladder was obtained using the T7 sequencing kit (Amersham Pharmacia Biotech, Little Chalfont, United Kingdom) according to the manufacturers' descriptions.
Cloning of oppD Promoter Fragments
In order to study the regulation of promoter strength upstream of the oppD a deletion analysis of the respective promoters was carried out. Combinations of oligonucleotides oppl (5′ GCTCTAGACACTCACTTGTTTTGCTTCC 3′), opp2 (5′ AACTGCAGGAAAATTCATGAACATACC 3′), opp1-opp3 (5′ AACTGCAGTAAAACAATAATAAAAGCAG 3′), opp1-opp4 (5′ AACTGCAGGATAATAAAATTTGGACTG 3′), opp1-opp14 (5′ AACTGCAGCGTAATGTTCAGAAAATTC 3′), opp1-opp15 (a) (5′ AACTGCAGCGTAATATTTAGAAAATTCATGAACATACC 3′) and opp1-opp15 (b) (5′ AACTGCAGCGTACTGTGCCGAAAATTCATGAACATACC 3′) were used to amplify chromosomal DNA from L. lactis MG1363 in order to obtain fragments encompassing the oppD promoter. The PCR products were digested with XbaI and PstI and transcriptionally fused upstream of the promoterless lacZ gene in the integration vector pORI13 (Sanders et al., 1998), also digested with the same enzymes. The resulting plasmids were called pORIopp2, pORIopp3, pORIopp4, pORIopp14, pORIopp15 (a) and pORIopp15 (b). All pORI constructions were preformed in E. coli EC101 which contains a chromosomal copy of the lactococcal repA gene needed for replication. They were then transformed into L. lactis LL108 and/or LL302 which contain multiple and single chromosomal copies of repA, respectively.
Random Mutagenesis of oppD Promoter Region
PCR fragments encompassing the oppD promoter region containing randomly introduced base pair substitutions were obtained essentially as described (Spee, de Vos, and Kuipers, 1993). Chromosomal DNA isolated from L. lactis MG1363 cultures were used as a template in the amplification step. Subsequently, the obtained variants were cloned into plasmid pORI13 and introduced into L. lactis LL108 as described above. Mutants showing distorted blue coloring on plates containing X-gal were selected and analyzed in more detail as described in results.
Construction of a codY Deletion Strain.
A 1400 bp EcoRI/HinDIII chromosomal fragment of L. lactis MG1363, containing codY, was subcloned in pUC19. The resulting plasmid was digested with SnaBI and subsequently selfligated. In this way, 423 bp were deleted from codY The oligonucleotides cod280A (5′ GGGAATTCGGATTGTCTATCTGCCTCG 3′) and cod280B (5′ GGGGGATCCAGATCTGACCATGATTACGCCAAGCTT 3) were used to amplify the ΔcodY-containing fragment. PCR product was digested with EcoRI/BamHI (restriction sites are underlined in the oligonucleotide sequence) and ligated into corresponding sites in pORI280. The resulting plasmid, pORIΔcodY, was introduced together with pVE6007 into L. lactis MG1363. As this strain does not contain the repA gene, selection for growth in the presence of erythromycin and increased temperature (37° C.) forces pORIΔcodY to integrate into the chromosome by homologous recombination. A number of integrants were subsequently grown for about 30 generations under nonselective conditions allowing a second recombination event to occur, which results in either the deletion or the wild-type gene codY. The ΔCodY mutation was confirmed by PCR.
β-Galactosidase Activity Assay
In vivo β-galactosidase (β-gal) assays were carried out in a Tecan microplate reader. Overnight cultures of L. lactis grown in GM17 were washed twice in 0.9% NaCl before inoculation to 2.5% in 200 μl of the appropriate medium containing erythromycin (5 μg/ml) for maintenance of pORI13 in L. lactis LL108/LL302 and erythromycin and chloramphenicol (2.5 μg/ml each) (Leenhouts et al., 1996). The media also contained the β-gal substrate 2% β-triiluoromethylumbelliferyl β-D-galactopyranoside (Molecular probe T-657). Multilabelling experimental data (absorbance and fluorescence measurements) were processed using the Magellan software program. β-Gal production due to the transcription driven from the oppD upstream region was calculated as a function of light emission. β-Gal assays were performed throughout the growth of L. lactis grown in media in which growth rates differ significantly as a function of the nitrogen source i.e. CDM 0.2% casitone and CDM 2% casitone and measured of the culture. β-Galactosidase activities were determined in permeabilized cell suspensions as described previously (Israelsen et al, 1995). β-Galactosidase enzyme activities, calculated as an average of three independent experiments, were expressed in arbitrary units (Miller, 1972).
Overproduction and Purification of His6-CodY.
The chromosomaly located codY of L. lactis MG1363 was amplified by PCR with the oligonucleotides HC-5 (5′ CTAGACCACCATGGGG CATCACCATCACCATCACGTGGCTACATTACTTGAAAAAACACG 3′), introducing the underlined NcoI restriction enzyme site upstream of the hexa-histidine tag (italic) and HC-6 (5′ CTAGTCTAGATTAGAAATTACGTCCAGCAAGTTTATC 3′), introducing the underlined XbaI restriction enzyme site downstream of the stop codon (italic) of codY. The purified 833-bp PCR product was digested with NcoI and XbaI and ligated into the corresponding sites of pNZ8048, downstream of the nisin-inducible PnisA. The resulting plasmid, pNH6CodY, was introduced in L. lactis NZ9000 to enable nisin induction of his6-codY, as described (de Ruyter, Kuipers, and de Vos, 1996; Kuipers et al., 1998). His6-CodY was isolated by affinity chromatography in an FPLC procedure (Amersham Pharmacia Biotech) using Ni-NTA agarose (Qiagen GmbH, Hilden, Germany).
Electrophoretic Mobility Shift Assays (EMSA's)
Gel retardation experiments were carried out essentially as described by Ebbole and Zalkin (Ebbole et al., 1989). Purified PCR products (2 μg) were end-labelled with polynucleotide kinase (Amersham Pharmacia Biotech) for 1 h at 37° C. using 30 μCi [γ-32P]-ATP (Amersham Pharmacia Biotech) in a volume of 20 μl. Reactions were stopped by incubating the mixtures for 10 min at 70° C. Binding studies were carried out in 20 μl reaction volumes containing 20 mM Tris-HCl (pH 8.0), 8.7% (v/v) glycerol, 1 mM EDTA (pH 8.0), 5 mM MgCl2, 100 mM KCL, 0.5 mM DTT, labelled DNA fragment (3000 cpm), and purified His6-CodY protein (50-400 ng). BSA (1 μg) and poly(dI-dC) (Amersham Pharmacia Biotech) were added to the reaction mixtures in order to reduce non-specific interactions. After incubation for 15 min at 30° C., samples were loaded onto a 4% polyacrylamide gel. Electrophoresis was performed in the Protean II Minigel System (Bio Rad Laboratories B. V., Veenendaal, The Netherlands) using a gradient (0.5× to 2×) of TAE buffer (Sambrook, Fritsch, and Maniatis, 1989) at 150 V for 1.5 h. Gels were dried and used for autoradiography at −80° C. using Kodak XAR-5 films and intensifying screens.
Preparation of Cells for Transcriptome Analysis
Cells were grown at 30° C. in GM17 supplemented with 0.5% glucose. Cells were grown till mid-exponential phase (OD600˜1.0). Approximately 5×109 cells (50 ml culture) were harvested by centrifugation for 5 min at 10.000 rpm and 4° C. Cells were resuspended in 2 ml ice-cold growth media and divided over 4 screw-cap tubes with rubber seal. After the addition of 500 μl Phenol/Chloroform, 30 μl 10% SDS, 30 μl 3 M NaAc (pH5.2) and 500 mg glass-beads (diameter 75-150 μm), cells were frozen in liquid nitrogen and stored at −80° C. or immediately used for RNA isolation.
Transcriptome Analysis
The DNA micro array experiments were essentially performed as described earlier (Kuipers et al., 2002), with the following modifications.
RNA Isolation
For each RNA isolation, one aliquot of the stored cell samples was used. Cells were disrupted by mechanical force using the Savant FastPrep FP120 system (Omnilabo) for 40 seconds at setting 5.0. Subsequently, RNA was extracted using the Roche “High Pure RNA Isolation Kit” according to the provided protocol. RNA yield and quality were determined spectrophotometrically and by performing a RNA 6000 Nano Labchip assay (Caliper Inc.) on the Agilent 2100 Bioanalyzer (Agilent Technologies, Amstelveen, the Netherlands) according to the manufacturers description respectively.
cDNA Labeling
Single-strand reverse transcription (amplification) and indirect labeling of 25 μg of isolated total RNA with either Cy3- or Cy5-dye were done with the Amersham CyScribe Post Labelling Kit according to the manufacturers protocol and, subsequently, used for hybridization.
Hybridisation and Scanning
Sylilated slides (Cel Associates) on which 2145 amplicons of L. lactis strain IL1403 were spotted in duplicate were used in the hybridization procedure. In addition, the slides contained 96 amplicons from L. lactis strain MG1363. Slides were pre-hybridized in Ambion SlideHyb buffer for 15 min at 40° C. in a Genomic Solutions Hybstation. After removal of the pre-hybridization buffer, 10-25 μl of the Cy3/Cy5-labeled cDNA mix in 150 μl Ambion SlideHyb buffer I was added and incubated for 1 h at 42° C. and finally for 16 h at 40° C. Afterwards, the hybridized slides were washed for 1 min in 2×SSC, 0.5% SDS and 5 min in 1×SSC, 0.25% SDS. The slides were scanned using a confocal laser scanner GeneTAC LS IV).
Signal Analysis
After scanning of the slides with the GeneTAC LS IV, individual spot intensities were determined. The raw data, along with the scanning image were stored in the Molecular Genetics Information System (MolGenIS). A grid definition was made to enable the spot analysis software Array Pro (Phoretix) to produce tables containing gene names and signal intensities. Using the program Excel Microsoft corporation), signal intensities were corrected for background and the ratios in signal intensity between the different samples were determined.
DNaseI Footprinting Analysis
DNaseI footprinting was performed essentially according to the description supplied with the Sure Track Footprinting Kit (Amersham Pharmacia Biotech). The DNA fragments were prepared by PCR, using Expand DNA polymerase (Amersham Pharmacia Biotech) and the oligonucleotides opp1 and opp3, one of which was first end-labeled with T4 polynucleotide kinase (Amersham Pharmacia Biotech) and [γ-32P]ATP as described by the manufacturer. Binding reactions were identical to those used in EMSAs, in a total volume of 40 μl and in the presence of approximately 150,000 cpm of DNA probe. DNAseI footprinting experiments were then performed as described previously (Hamoen et al, 1998)
In Vitro Protein Cross-linking 5
Cross-linking reactions were performed in 1× cross-linking buffer (100 mM KCl, 15 mM Tris-HCl pH 7.5) in a total volume of 40 μl, containing 300 ng of purified H6-CodY, and, where indicated, GMP (1 mM) or GTP (1 mM). Formaldehyde was used as the cross-linking agent at a final concentration of 1% (v/v), with a 10 min incubation step at room temperature. Cross-linking reactions were stopped by the addition of 20 μl of 2×SDS gel loading buffer [4% SDS, 10% 2-mercaptoethanol, 20% glycerol, 100 mM Tris-HCl (pH 6.0)]. Samples were boiled for 5 min before separation by SDS polyacrylamide (10%) gel electrophoresis (Laemmli, 1970). SDS polyacrylamide gels were stained with Coomassie Brilliant Blue (Bio-Rad).
Determination of the Transcription Start Site of oppD.
It has been demonstrated that the genes of the oligopeptide permease system, encoded in the oppDFBCA-pepO1 locus of L. lactis MG1363, are transcribed polycistronically. Upstream of both oppD and oppA regions are present that could serve as promoter elements. To determine the location of the promoter upstream of oppD, the transcription start site (TSS) was determined. The opp transcript was analyzed by primer extension, using RNA that was isolated from exponentially growing MG1363 cells. The mRNA 5′ end corresponds to an adenine residue located 35 bases upstream of the translation start codon AUG of oppD. The −35 sequence (TTGCAA) is separated by a consensus 17 bases from the −10 region (TATACT) and a proper lactococcal ribosome binding site; GAGG is also present. The sequence upstream of oppD contains two regions of dyad symmetry centered around position −135 (−14.0 kcal/mol) and −62 (−5.6 kcal/mol) relative to the oppD transcriptional start site, respectively.
CodY Specifically Binds to the oppD Upstream Region.
In order to examine whether L. lactis CodY directly interacts with upstream DNA sequences of its main target known so far, oppD, in vitro DNA binding studies were performed. For this purpose, histidine-tagged CodY was overexpressed using the nisin inducible gene expression system (Kuipers et al., 1998) and subsequently purified to apparent homogeneity. A radioactively labeled PCR fragment spanning the oppD upstream region (
Upon gradually increasing the amount of H6-CodY from 10 to 100 ng, four distinct bands can be observed, indicating a tetrameric state of the protein. In most of our DNA binding experiments, a band corresponding to single stranded probe (s.s. DNA) was observed irrespective of the presence of H6-CodY. The occurrence of this denatured DNA probably results from the high AT content of the opp promoter region. No H6-CodY binding occurred when DNA fragments, with similar AT contents, were used that were obtained from internal gene segments (e.g. from comg of B. subtilis), indicating that H6-CodY binding to PoppD is specific (data not shown).
CodY Regulates the Expression of oppD by Binding to a Specific Upstream Sequence.
The upstream oppD region contains a small sequence that is inversely repeated with a spacing of 9 base pairs in between (
As the fragments used in the EMSA's were also cloned upstream of the promoterless lacZ gene in plasmid pORI13, the in vivo regulation of a downstream reporter gene (lacZ) could be determined by performing β-galactosidase (β-gal) assays in a chemically defined medium (Poolman and Konings, 1988) containing 2% of casitone as a nitrogen source. It was shown that deletion of the sequence abolished medium dependent repression of lacZ expression. the fragments were fused upstream of the promoterless lacZ gene in plasmid pORI13 (Sanders et al, 1998) and introduced in L. lactis LL108. β-Galactosidase activities in exponential phase cells growing in CDM supplemented with 2% casitone, where strong CodY-mediated repression is ensured, correlated with the observed binding pattern (
The introduction of base substitutions in the upstream half-site of the inverted repeat gave rise to both weaker binding of H6-CodY and resulted in derepression of the promoter as shown by gel retardation analysis and β-gal assays, respectively (
H6-CodY Protects an Extended Region of the oppD Promoter.
Although the EMSA experiments using truncated PoppD DNA fragments pointed to a specific region that is important for CodY binding, the actual area facilitating binding was rather large (position −68 to −111). Moreover, the assays did not exclude the possibility that more downstream sequences could contribute to CodY binding. Therefore, complex formation of H6-CodY with the oppD promoter region was investigated by DNaseI footprinting experiments, using the labeled promoter fragment (opp162) and binding conditions as used for the EMSAs (
A Region in the oppD Promoter Containing an Inverted Repeat is Important for CodY-mediated Regulation.
A closer inspection of the area in the oppD promoter to which CodY binds revealed the presence of a short sequence (ATGTTCA) that is inversely repeated (IR) with a spacing of 9 bp between the partners (
Random Mutation analysis of the oppD Upstream Region.
In order to identify bindings sites of CodY in the oppD upstream region, random mutation was carried out on the smallest oppD promoter fragment that is still bound by CodY (see
Identification of Additional CodY Targets.
In order to identify additional genes that are regulated by CodY, the transcriptional profile of wild-type (WT) L. lactis MG1363 was compared with that of a L. lactis MG1363 strain containing a 423 bps internal deletion in the codY gene using DNA micro arrays containing genes of L. latis IL1403. These studies revealed several differentially expressed genes in the delta codY strain. The genes of which the expression is increased most significantly in the delta codY strain are listed in Table 2. The genes of which the expression is decreased most significantly in the absence of a CodY-like protein are listed in Table 3. As this increased expression (Table 2) could be a direct effect of the absence of CodY (derepression), the upstream regions were examined- for the presence of conserved nucleotide sequences. It was found that many of these genes contain an upstream sequence that is homologous to the upstream half-site of the palindromic sequence found to be important in oppD regulation (
The conserved sequence could not be discerned in the upstream regions of all the differentially expressed genes. This could mean that the altered expression in the delta codY strain is an indirect effect of the mutation or that other sequences or structural determinants also play a role in the recognition/regulation by CodY. As can be seen in
Using a weight matrix constructed from the sequences that comprise the putative CodY box, a search was performed in a data set containing the upstream regions of all IL1403 genes (Table 4). The presence of such an element could indicate that the downstream gene is under direct transcriptional control of CodY.
An Overrepresented Motif is Present in the Upstream Regions of a Number of the CodY-repressed Genes
In order to assess whether the lactococcal members of the CodY regulon share a sequence motif in their regulatory regions, an in silico sequence analysis was performed using the algorithm of the MEME software tool. Firstly, a dataset was created containing the upstream regions of the genes that were derepressed to the highest extent in the codY strain in our DNA microarray experiments, as we assumed that these genes are most likely to be under direct control of CodY and thus contain a CodY binding site. This dataset was supplemented with the upstream regions of genes of which it is known that they are under direct control of CodY (i.e. oppD, pepC, pepN) as is the case for the intergenic region of the divergently transcribed L. lactis subsp. cremoris SK11 plasmid-located prtP and prtM genes for which it has been shown that purified H6-CodY of the closely related lactococcal strain MG1363 is able to interact with DNA fragments spanning this region in in vitro DNA binding studies. Since operator sites of regulatory proteins in bacteria are usually located within close proximity of their target promoters, fragments of 200 bps were chosen such that they encompassed the known or predicted promoter sequences of their cognate genes. In cases were a complete operon was found to be up-regulated in the codY deletion strain, the upstream region of the first gene of the transcriptional unit was selected (i.e ilv, his, opp and dpp). Of the latter operon, the region preceding dppA was also included in the dataset, since a putative promoter sequence is present in this area that, thus, might contain a CodY binding site as well.
Subsequently, the dataset containing 14 sequences was examined for the occurrence of common elements using the MEME algorithm. As there is no prior knowledge about a possible CodY binding site, MEME was not restricted with respect to the motif width and number of repetitions and allowed to search on either of the given or the reverse DNA strand. Moreover, these settings did prevent that the common upstream elements (−35 and −10 sequences and the ribosome binding site) would conceal the presence of a CodY binding site. As can be seen from Table 4A and
Interestingly, the upstream region of the operons that show the highest fold difference in expression when comparing the codY strain to WT L. lactis MG1363, dpp and ilv, contain two copies of this C-box preceding both dppP, dpp and ilvD, encoding the peptide binding proteins of the uptake system and the three branched-chain amino acid biosynthesis genes, respectively, whereas in case of ctrA and in front of gltA, even 3 copies of the motif can be found.
Inter-species Analysis of the over Represented Motif
A multi-species string search was performed on several Gram-positive bacteria in order to assess whether the putative CodY box found upstream of the genes belonging to the CodY regulon is also present in other bacteria containing a CodY protein. Such a comparison could reveal subtle differences in the consensus sequence of this motif. As depicted in
Recently, Molle et al. (2003) reported the genome wide expression analysis of a B. subtilis codY mutant strain. Using the upstream nucleotide sequences of the targets found in that study, we searched for the presence of the putative CodY box in these sequences. Although the similarity scores with the consensus where not very high, derivates of the motif could be identified in some instances in this set of sequences (Table 5). Analysis of the full genome sequence of B. subtilis resulted in the identification of additional promoters containing the putative CodY box (Table 6).
A similar search was performed using the genomes of several other Gram-positive bacteria (Tables 7 and 8). Currently, we are mining the genome of L. lactis strain MG1363 of which the genome sequence is nearly completed.
Regulation of prtP and prtM is Derepressed in the CodY-deficient Strain.
As prtP and prtM respond in a similar way to changes in the nitrogen content of the growth medium as CodY-regulated genes (Miladinov, Kuipers, and Topisirovic, 2001; Guedon et al., 2001 a), the role of CodY in prtP and prtM expression was studied. A fragment containing the prtP/prtM intergenic region of L. lactis BGMN1-5 was cloned in between the promoterless Escherichia coli β-galactosidase (lacZ) and the Cyamopsis tetragonoloba α-galactosidase (α-gal) genes of pGKH10. Thus, translational fusions of prtP and prtM with the two reporter genes were created, the AUG codons of prtP or prtM serving as a start codon for lacZ or α-gal. In the resulting plasmid pGKB11, lacZ is under the control of the prtP promoter of BGMN1-5. In this plasmid the prtM promoter directs the transcription of the α-gal gene. In the corresponding plasmid pGKB12, the fragment is present in the opposite orientation. Plasmids pGKB11 and pGKB12 were introduced in the CodY-deficient L. lactis MG1363 strain (L. lactis MG1363codYΔ1) and lacZ expression was analysed in CDM media containing different amounts of casitone, and in peptide-rich M17 medium. In the WT strain, the β-gal activities of the prtP::lacZ and prtM::lacZ fusions were 6- and 8-fold lower in CDM with 2% than in CDM with 0.2% casitone, respectively. In the codY mutant, β-gal activity in CDM with 2% casitone was less than twofold lower than that in CDM with 0.2% casitone. β-gal activities in M17 were similar to those in CDM with 2% casitone for both MG1363 and MG1363codYΔ1. These results show that repression of these two gene fusions by medium peptides was almost fully abolished in the codY mutant.
CodY Binds to the prtP/prtM Intergenic Region.
The prtP/prtM intergenic regions of the L. lactis strains BGMN1-5, E8, SK11 and Wg2 each contain an inverted repeat (
H6-CodY Forms Multimers in the Absence of GTP.
In order to identify whether the active form of H6-CodY, a protein of 29 kDa, consists of mono- or multimers, cross-linking experiments were carried out on purified H6-CodY. Initial experiments, using glutaraldehyde as a cross-linking reagent proved to be unsuccessful (data not shown). The results using formaldehyde as a cross-linking agent are shown in
BCAAs Affect H6-CodY Binding Properties. 22
Evidence has been presented that CodY senses the nitrogen supply of the cell as a function of the BCAA pool. Although BCAAs might act as direct effectors of CodY activity, the exact nature of this signal remains to be established. Therefore, in vitro DNA binding of H6-CodY was examined in the presence or absence of the three BCAAs Val, Leu and Ile (
Similarly, we also tested whether GTP could stimulate the binding of H6-CodY to lactococcal PoppD, since in B. subtilis GTP serves as an effector molecule that enhances binding of bacillus CodY to a number of its targets. However, no effect is seen on lactococcal CodY at a concentration of 2.5 mM GTP (right lane in
CodY Directly Complexes with the asnB and ctrA Upstream Regions
To distinguish whether repression by CodY occurs directly or indirectly, an electric mobility shift assay (EMSA) was performed in which purified H6-CodY was used.
This result, together with those of the in vivo transcription assays indicate that expression of asnB is probably under the direct control of CodY. Using EMSA's, direct interaction of H6-CodY was also shown for a probe encompassing the upstream region of ctrA. As is apparent from Table 2 and Table 10, the transcript level of ctrA, a gene encoding a putative transporter with homology to several cationic amino acid permeases is highly elevated in L. lactis MG1363Dcody).
Panel A shows a schematic overview of the opp-pepO1 operon. Panel B shows a detailed view of the upstream sequence encompassing the oppD promoter. The −35, −10 and ribosome binding site (RBS) sequences are underlined. The arrows show the positions of the two pairs of inverted repeats. The inverted repeat that is discussed in the text in more detail is indicated in bold.
Gel retardation assay using His6-CodY and the oppD promoter fragment. A DNA fragment encompassing the oppD promoter was amplified by PCR, radioactively labelled and incubated with no (lane 2) or increasing amounts of purified H6-CodY (lanes 3 to 9). Lane 1 contains the same probe, but was boiled in a 95% formamide solution in order to obtain single stranded DNA fragments.
Different parts of the oppD promoter region were amplified by PCR (panel A), radioactively labelled and incubated with no (lanes 1), 20 ng (lanes 2) or 200 ng (lanes 3) of His6-CodY protein, respectively (panel B).
Panel A shows the positions of the basepair substitutions (indicated in bold) of the mutants that showed distorted repression by CodY relative to the WT. Solid lines mark the inverted repeat. Panel B shows the relative binding of H6-CodY (compared to WT) to labelled PCR products encompassing the promoter region of the mutants in an in vitro binding assay. The relative affinity was calculated by comparing the amount of H6-CodY required to shift 50% of the labelled DNA in the binding assay.
a(uit Ratnayake-Lecamwasam et al., 2001), NA; not available.
L. lactis IL1403.
Detected motifs are sorted according to their similarity to the consensus
Detected motifs are sorted according to their similarity to the consensus
B. subtilis 168.
Detected motifs are sorted according to their similarity to the consensus
Detected motifs are sorted according to their similarity to the consensus
Streptococcus agalacticiae.
Detected motifs are sorted according to their similarity to the consensus
L. lactis subsp.
cremoris
L. lactis subsp.
lactis
E. coli
Emr, Cmr Apr, resistance to erythromycin, chloramphenicol and ampicilin, respectively. PnisA—inducible nisA promoter, PprtP—prtP promoter, PprtM—prtM promoter, α-gal—α-galactosidase, β-gal—β-galactosidase.
(NA = not available)
Israelsen, H., S. M. Madsen, A. Vrang, E. B. Hansen, and E. Johansen. 1995. Cloning and partial characterization of regulated promoters from Lactococcus lactis Tn917-lacZ integrants with the new promoter probe vector, pAK80. Appl. Environ. Microbiol. 61:2540- 2547.
Number | Date | Country | Kind |
---|---|---|---|
03077074.7 | Jul 2003 | EP | regional |
Filing Document | Filing Date | Country | Kind | 371c Date |
---|---|---|---|---|
PCT/NL04/00474 | 7/2/2004 | WO | 3/1/2007 |