Patent Application
20120094935
The material in the text file titled “65251SequenceListing”, created Apr. 9, 2010, and being 2700 bytes, is herein incorporated by reference in its entirety.
The present invention relates to methods of creating and/or identifying thereapeutic candidate compounds expected to have useful immonomodulatory and/or anti-inflammatory properties. In particular, the methods make use of a crystal structure of a Yatapoxvirus 2L polypeptide bound to human TNFα to provide guidance as to desirable characteristics of the therapeutic candidate compounds.
Tumor necrosis factor (TNF) secreted primarily by macrophages and monocytes, is a potent mediator cytokine of inflammation and the immune response to various pathogens (Aggarwal, B B 2003, Nat. Rev. Immunol. 3:745-756; Ware, C. F., 2005, Annu. Rev. Immunol. 23:787-819). The proinflammatory cytokine tumor necrosis factor α (TNFa) is the prototype member of the TNF superfamily that forms trimers, and is expressed as a membrane-bound 26-kDa protein and a soluble 17-kDa protein, both of which are biologically active. TNFα is a major target for pharmaceutical intervention in a number of autoimmune diseases including rheumatoid arthritis, septic shock, ulcerative colitis, Crohn's disease and other syndromes (Mocellin et al., 2005, Cytokine Growth Ractor Rev., 16:35-53).
Large DNA viruses such as poxviruses, which replicate exclusively within the cytoplasm of infected cells, encode diverse immunomodulatory proteins to modulate, avoid, or diminish multiple antiviral responses mediated by hosts (Seet et al., 2003, Annu. Rev. Immunol., 21:377-423; Alcami, 2003, Nat. Rev. Immunol. 3:36-50; Nazarian et al., 2006, Future Virol., 1:123-132). Given the broad immune effects of TNFα, viruses have developed potent TNFα inhibitors—some derived from host TNF receptors (Rahman, 2006, PLoS Pathog, 2 e4). The Yatapoxvirus genus of poxviruses includes Tanapox virus (TPV), Yaba monkey tumor virus (YMTV), and Yaba-like disease virus (YLDV) (Knight et al., 1989, Virology, 172:116-124). Several members of this genus of poxviruses have been found to encode an hTNFα inhibitor, designated as 2L, that bears little homology to endogenous hTNF receptors.
The 2L poxvirus protein was originally isolated as a potential human therapeutic, with the rationale that agents developed over millennia in the struggle between viruses and the vertebrate immune system may be particularly well tuned for modulation of the immune response. However, since even the existing anti-TNFα drugs exhibit limitations in efficacy for treating disease, there is a need for improved human anti-TNFα therapeutics based on the 2L poxvirus protein and methods for obtaining such therapeutics.
According to an aspect of the invention, there is provided a method of creating a therapeutic candidate compound comprising: providing a secreted form of a 2L polypeptide of SEQ ID No. 1, SEQ ID No. 2, or SEQ ID No. 3; modifying at least one amino acid of the 2L polypeptide at a position other than the 2L interface amino acids HIS58, GLU99, GLY101, PHE104, LYS125, GLY157, TYR160, MET161, GLY162, LEU165, LEU168, GLN171, LYS175, GLU225, VAL229, ASN230, GLY231, ARG232, or GLU289 for SEQ ID No.'s 1-2 or HIS57, GLU100, GLY102, PHE105, LYS126, GLY157, TYR161, ALA162, GLY163, LEU166, PHE169, GLN172, LYS176, GLU226, VAL230, ASN231, GLY232, ARG233, or GLU290 for SEQ ID No. 3, to form a candidate compound; and, purifying the candidate compound.
According to another aspect of the invention, there is provided a method of creating a therapeutic candidate compound comprising: providing a sequence of a 2L polypeptide comprising SEQ ID No. 1, SEQ ID No. 2, or SEQ ID No. 3; modifying at least one amino acid of the sequence of the 2L polypeptide at a position other than HIS58, GLU99, GLY101, PHE104, LYS125, GLY157, TYR160, MET161, GLY162, LEU165, LEU168, GLN171, LYS175, GLU225, VAL229, ASN230, GLY231, ARG232, or GLU289 for SEQ ID No.'s 1-2 or at a position other than HIS57, GLU100, GLY102, PHE105, LYS126, GLY157, TYR161, ALA162, GLY163, LEU166, PHE169, GLN172, LYS176, GLU226, VAL230, ASN231, GLY232, ARG233, or GLU290 for SEQ ID No. 3, to form a sequence of a candidate compound; expressing the sequence of the candidate compound from a host cell to create a secreted form of the candidate compound; and, purifying the candidate compound.
These methods may further comprise verifying that the candidate compound binds to human TNFα with a binding affinity Kd of from about 40 picomoles to about 440 picomoles.
According to yet another aspect of the invention, there is provided a method of creating a therapeutic candidate compound comprising: providing a secreted form of a 2L polypeptide of SEQ ID No. 1, SEQ ID No. 2, or SEQ ID No. 3; modifying at least one amino acid of the 2L polypeptide at a position selected from the group consisting of HIS58, GLU99, GLY101, PHE104, LYS125, GLY157, TYR160, MET161, GLY162, LEU165, LEU168, GLN171, LYS175, GLU225, VAL229, ASN230, GLY231, ARG232, and GLU289 for SEQ ID No.'s 1-2 or at a position selected from the group consisting of HIS57, GLU100, GLY102, PHE105, LYS126, GLY157, TYR161, ALA162, GLY163, LEU166, PHE169, GLN172, LYS176, GLU226, VAL230, ASN231, GLY232, ARG233, and GLU290 for SEQ ID No. 3, to form a candidate compound; and, purifying the candidate compound.
According to still another aspect of the invention, there is provided a method of creating a therapeutic candidate compound comprising: providing a sequence of a 2L polypeptide comprising SEQ ID No. 1, SEQ ID No. 2, or SEQ ID No. 3; modifying at least one amino acid of the sequence of the 2L polypeptide at a position selected from the group consisting of HIS58, GLU99, GLY101, PHE104, LYS125, GLY157, TYR160, MET161, GLY162, LEU165, LEU168, GLN171, LYS175, GLU225, VAL229, ASN230, GLY231, ARG232, and GLU289 for SEQ ID No.'s 1-2 or at a position selected from the group consisting of HIS57, GLU100, GLY102, PHE105, LYS126, GLY157, TYR161, ALA162, GLY163, LEU166, PHE169, GLN172, LYS176, GLU226, VAL230, ASN231, GLY232, ARG233, and GLU290 for SEQ ID No. 3, to form a sequence of a candidate compound; expressing the sequence of the candidate compound from a host cell to create a secreted form of the candidate compound; and, purifying the candidate compound.
These methods may further comprise verifying that the candidate compound binds to human TNFα with a binding affinity Kd less than that of the 2L polypeptide.
These methods may further comprise an N-terminal signal sequence.
These methods may be provided wherein the immature sequence is according to SEQ ID No. 15, SEQ ID No. 16, or SEQ ID NO. 17.
The foregoing methods may further comprise confirming in vitro that the candidate compound suppresses signaling via the TNFα cascade. The methods may further comprise confirming in vitro that the candidate compound competitively inhibits human TNFR1 or human TNFR2 from binding to human TNFα. The modification of the at least one amino acid may be selected from the group consisting of substitution, addition and deletion.
According to even another aspect of the present invention, there is provided a method for determining whether or not a test compound is a therapeutic candidate compound for use in treating a TNFα mediated disease or condition in humans, the method comprising: providing the test compound or an electronic representation of the test compound; determining whether the test compound or electronic representation of the test compound binds to at least TNFα interface amino acids TYR87, ARG31, ARG32, ASN30, SER86, ARG82, GLU127, ASN34, VAL91, ALA33, VAL91, GLN21, ARG44, GLU42, LEU37, LEU43, VAL41 and GLN27 of hTNFα, or competitively inhibits binding of hTNFR1 or hTNFR2 to the TNFα interface amino acids, to within a specified confidence interval; for test compounds that bind to the TNFα interface amino acids or competitively inhibit binding of human TNFR1 or human TNFR2 to the TNFα interface amino acids, confirming in vitro that the test compound suppresses signaling via the TNFα cascade, thereby rendering it a therapeutic candidate compound.
In any of the foregoing methods, the method may further comprise verifying that the candidate compound binds to human TNFα with a shape complementarity index of from 0.64 to 0.78. The methods may further comprise verifying that the candidate compound, upon binding to human TNFα, imparts a change in conformation of human TNFα at GLN21, ALA22, GLU23, GLY24, GLN25, ARG31, ARG32, ALA33, ASN34, ALA35, PHE144, ALA145, GLU146, SER147, and GLY148. The methods may further comprise verifying that the modification reduces immunogenicity of the candidate compound as compared with the 2L polypeptide of SEQ ID No.'s 1, 2 or 3. The methods may further comprise verifying that the modification alters the circulating half life of the candidate compound as compared with the 2L polypeptide of SEQ ID No.'s 1, 2 or 3. The methods may further comprise verifying that the candidate compound binds to human TNFα over a surface area of at least 2000 Å2.
According to yet still another aspect of the invention, there is provided a therapeutic candidate compound obtained according to any of the foregoing methods.
According to yet even another aspect of the invention, there is provided a method of treating a TNFα mediated disease or condition in humans comprising administering a therapeutic candidate compound obtained according to any of the foregoing methods in an amount and for a time sufficient to achieve a therapeutic effect. This can be alternatively described as use of a therapeutic candidate compound according to any of the foregoing methods in an amount and for a time sufficient to achieve a therapeutic effect in treating a TNFα mediated disease or condition in humans. It is contemplated to use the therapeutic candidate compound in the manufacture of a medicament for treating a TNFα mediated disease or condition or in a pharmaceutical composition comprising the purified therapeutic candidate compound with a pharmaceutically acceptable diluent formulated for administration to a patient suffering from or at risk of developing a TNFα mediated disease or condition.
A purified nucleic acid molecule that encodes a polypeptide comprising the sequence of the candidate compound is also provided as part of this invention, along with any purified nucleic acid molecule that hybridizes under high stringency conditions to the aforementioned nucleic acid molecule. A vector comprising the nucleic acid molecule and a host cell comprising the vector are also provided.
According to yet even still another aspect of the invention, there is provided a crystal of the secreted form of Yaba-like disease virus 2L protein bound to human TNFα. The Yaba-like disease virus 2L protein may comprise an amino acid sequence according to SEQ ID No. 1. The crystal may have a three-dimensional structure as defined by the atomic coordinates of Table 4 with a root mean square deviation of 1.0 Å for each atomic coordinate.
These and other features and advantages of the present invention will be better understood by reference to the following detailed description when considered in conjunction with the attached drawings, in which:
Design and development of a therapeutic agent that binds TNFα while evading the immune system can be efficiently realized from the specific binding interface of the poxvirus 2L protein and TNFα. As shown herein, the Yaba-like disease virus (YLDV) 2L protein complexed to TNFα has been isolated and crystallized, and its crystal structure has been determined and analyzed. The crystal structure data includes the three-dimensional molecular and atomic coordinates (Table 4) and computed modeling of the 2L-TNFα complex (
U.S. Pat. Nos. 7,585,507 and 6,894,155 to McFadden et al., are incorporated by reference herein in their entirety. These patents describe immune modulation of TNFα using full length (exclusive of signal sequence) 2L molecules. As described herein, a method is provided for designing candidate TNFα-binding compounds based on the specific 2L and TNFα residues found to interact at the 2L-TNFα interface.
Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by one of ordinary skill in the art relevant to the invention. The definitions below supplement those in the art and are directed to the embodiments described in the current application.
Immature YLDV, TPV and YMTV 2L proteins are represented by SEQ ID NOs. 15, 16 and 17, respectively. Mature untagged YLDV, TPV and YMTV 2L proteins are represented by SEQ ID NOs: 1, 2 and 3, respectively.
As used herein, the “2L-TNFα interface” refers to the amino acid residues of the 2L protein that interact directly with TNFα, and the TNFα amino acid residues that interact directly with 2L. The interface residues are listed in Table 1. Direct interaction is defined by those residues that have at least 2% ASA (accessible surface area) and/or form a salt bridge or hydrogen bond. As used herein, the interface can refer to both the 2L and TNFα amino acids that interact with each other.
The “2L interface” and the “2L interface residues” refer to the 2L amino acids that directly interact with TNFα. The 2L interface residues of YLDV 2L (SEQ ID NO: 1) and TPV 2L (SEQ ID NO: 2) include: HIS58, GLU99, GLY101, PHE104, LYS125, GLY157, TYR160, MET161 or ALA161, GLY162, LEU165, LEU168 or PHE168, GLN171, LYS175, GLU225, VAL229, ASN230, GLY231, ARG232, and GLU289. The 2L interface residues of YMTV 2L (SEQ ID NO: 3) include: HIS57, GLU100, GLY102, PHE105, LYS126, GLY157, TYR161, ALA162, GLY163, LEU166, PHE169, GLN172, LYS176, GLU226, VAL230, ASN231, GLY232, ARG233, and GLU190.
The “TNFα interface” and the “TNFα interface residues” refer to the human TNFα amino acids that directly interact with 2L. The TNFα interface residues include: TYR87, ARG31, ARG32, ASN30, SER86, ARG82, GLU127, ASN34, VAL91, ALA33, VAL91, GLN21, ARG44, GLU42, LEU37, LEU43, VAL41, and GLN27.
“Polypeptide,” “polypeptide fragment,” “peptide,” or “peptide fragment” means a chain of two or more amino acids, regardless of any post-translational modification (e.g., glycosylation, acetylation, or phosphorylation), constituting all or part of a naturally or non-naturally occurring polypeptide. A “protein” can be made up of one or more polypeptides or one or more peptides.
“Post-translational modification” means any change to a polypeptide or polypeptide fragment during or after synthesis. Post-translational modifications can be produced naturally (such as during synthesis within a cell) or generated artificially (such as by recombinant or chemical means). One example of a post-translational modification occurs during secretion from a cell, in which an N-terminal signal sequence is cleaved from an immature intracellular protein to yield a extracellular mature, processed, or secreted form of the protein. The amino acids that make up the N-terminal signal sequence of a protein can be readily determined by persons skilled in the art from the immature protein sequence using, for example, software tools such as SignalP (as originally described by Henrik Nielsen, Jacob Engelbrecht, Søren Brunak and Gunnar von Heijne in “Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites.”, Protein Engineering, 10:1-6, 1997, and available for use at www.cbs.dtu.dk/Services/SignalP)
By “candidate compound” or “compound” is meant a molecule, be it naturally-occurring or artificially-derived, that is assayed for its ability to bind TNFα by employing one of the assay methods described herein. Candidate compounds may include, for example, peptides, polypeptides, aptamers, Fc fusion proteins, antibodies, synthesized organic molecules, naturally occurring organic molecules, nucleic acid molecules, and biologically active fragments thereof.
A “mutation” includes a deletion, a conserved amino acid change and/or non-conserved amino acid change, or an addition of an amino acid.
By “analog” is meant any substitution, addition, or deletion in the amino acid sequence of a 2L-derived TNFα-binding candidate compound that exhibits properties that are at least 50%, preferably at least 75%, more preferably at least 90%, and most preferably at least 95% of the immunomodulatory properties of the poxvirus 2L protein from which it is derived. Analogs can differ from the naturally occurring 2L protein by amino acid sequence differences, by amino acid sequence or post-translational modifications, or by both. Modifications include in vivo and in vitro chemical derivatization of polypeptides, e.g., acetylation, carboxylation, phosphorylation, or glycosylation. Such modifications may occur during polypeptide synthesis or processing or following treatment with isolated modifying enzymes. Analogs can also differ from the naturally occurring poxvirus 2L polypeptide by alterations in primary sequence. These include genetic variants, both natural and induced (for example, resulting from random mutagenesis by irradiation or exposure to agents such as ethanemethylsulfate, or by site-specific mutagenesis as described in Sambrook, Fritsch and Maniatis, Molecular Cloning: A Laboratory Manual (2d ed.), CSH Press, 1989, hereby incorporated by reference; or Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1994, hereby incorporated by reference). Also included are polypeptide molecules that contain residue substitutions for L-amino acids, e.g., D-amino acids or non-naturally occurring synthetic amino acids. Fragments and analogs can be generated using standard techniques, for example, solid phase peptide synthesis or polymerase chain reaction (PCR).
“2L-derived TNFα-binding candidate nucleic acid molecule” means a nucleic acid molecule, such as a genomic DNA, cDNA, or RNA (e.g., mRNA) molecule that encodes a 2L-derived TNFα-binding candidate polypeptide having the desired characteristics or biological activities of a poxvirus 2L polypeptide as described herein.
“Immune function” or “immunoreactivity” refers to the ability of the immune system or immune system factors in an in vitro assay, to respond to a foreign antigen as measured by standard assays. “Modulate” or “modulating” means the induction of a quantitative change, either by decrease or increase, in the response of a target cell, sample, or organism, as a result of an interaction with a TNFα protein or nucleic acid molecule or candidate compound. The increase or decrease is by at least 10%, preferably by at least 20%, more preferably by at least 50%, still more preferably by at least 75%, yet more preferably by at least 95% and most preferably by at least 100% relative to an untreated control organism, sample, or molecule.
“Immunomodulation” or “immunomodulatory” refers to an alteration in the overall immunoreactivity of the immune system in a mammal, or alteration in the response of a cell, relative to an untreated control of the same type, upon treatment with an agent, such as a polypeptide or nucleic acid molecule of the present invention, or fragments and analogs thereof. Immunomodulation can be assayed using immune cells, for example, B cells, T cells, antigen-presenting cells, or any other cell that is involved in immune function. Immunomodulation can also be assayed by determining expression and/or activity of immune-related genes and proteins, or immune-related compounds, such as cytokines, cytokine receptors, immunoglobulins, etc.
“Immunosuppression” refers to a decrease in the overall immunoreactivity of the immune system upon administration of an immunomodulator in comparison to the immunoreactivity of an immune system that has not been contacted with the particular immunomodulator. “Immunostimulation” refers to an increase in the overall immunoreactivity of the immune system upon administration of an immunomodulator in comparison to the immunoreactivity of an immune system that has not been contacted with the particular immunomodulator. “Decreasing T cell stimulation” means lowering the level of T cell stimulation as measured by, for example, a chromium release assay. “Decreasing inflammation” means decreasing the number of inflammatory cells (leukocytes, for example eosinophils) in the target tissue by, preferably, two-fold. By “cell proliferation” is meant the growth or reproduction of similar cells. By “apoptosis” is meant the process of cell death where a dying cell displays a set of well-characterized biochemical hallmarks which include cytolemmal blebbing, cell soma shrinkage, chromatin condensation, and DNA laddering.
“Immunomodulator” refers to an agent that induces an immunomodulatory effect or alteration (i.e., immunosuppression, immunostimulation, etc.) as measured, for example, by an alteration of virulence in mutated viruses or a variety of immunoassays well known in the art (for example, chemotaxis assays as described herein). For example, in the present invention, an immunomodulator may elicit an altered level of immune function, such that the alteration in the level of immune function identifies a viral 2L polypeptide. An “anti-inflammatory” agent is an immunomodulatory agent capable of decreasing the overall inflammation or immune function upon administration to an individual.
From the crystal structure and analysis thereof, as described throughout and specifically detailed in Example I and Table 4, the amino acid residues participating in the 2L-TNFαt interface of the 2L-TNFα complex are identified as shown in Table 1.
The analysis and modeling of the atomic coordinates (Table 4) of the 2L-TNFα crystal structure reveal that 2L binds to TNFα using a large and highly complementary interface as represented in
The interface also exhibits a high degree of complementarity as assessed by the shape complementarity index, SC, an index that varies from 0 (not complementary) to 1 (a perfect fit) (Lawrence, 1993, J Mol Biol. 234: 946-950). The SC value for the 2L-TNFα interface is 0.72, indicating a more complementary interface than typical antibody-antigen interfaces with SC values of 0.64-0.68 (Lawrence, 1993, J Mol. Biol. 234: 946-950). By comparison, the TNFR1/TNFβ interface has a lower shape complementarity index (SC=0.64), but buries a similar surface area (2120 Å2, with 1090 Å2 from TNFR1 and 530 Å2 and 510 Å2 from adjacent TNFβ subunits).
Despite sharing only ˜13% sequence identity with human class I MHC heavy chains and lacking the β2m light chain, the 2L protein adopts a class I MHC-like fold including an α1-α2 superdomain, comprising an anti-parallel β-sheet topped by two α-helices, and an α3 domain with an immunoglobulin constant region β-sandwich fold (
In a comparison with structures of classical class I MHC molecules and other class I MHC homologs, including CD1, HFE, FcRn, ZAG, MIC-A, M10.5, T-22, RAE-1 and viral class I homologs (UL18, m144 and m157), the α1-α2 superdomain of 2L was most similar to that of a classical MHC protein, HLA-A2 with a root mean square deviation (RMSD) of 1.4 Å for 104 Cα atoms) (Table 2). However, in common with most class I homologs (HFE, FcRn, MIC-A, T-22, RAE-1, and the viral class I homologs m144 and m157), 2L does not contain a noticeable groove between its α1 and α2 domain helices (groove surface area of 60 Å2) and no unexplained electron density was observed in this region. In this regard, 2L is more similar to HFE and FcRn (groove surface areas of 415 Å2 and 235 Å2, respectively) (Lebron et al., 1998, Cell, 93:111-123), which do not present endogenous peptides, than it is to classical peptide-binding class I MHC molecules (groove surface areas of ˜760 Å2), the peptide-binding viral homolog UL18 (groove surface area of 900 Å2), or the lipid-presenting CD1d1 protein (groove surface area of 1440 Å2) (Yang, 2008, PNAS, 105: 10059-10100; Lebron et al., 1998, Cell, 93:111-123; Olson et al., 2005, PLoS Biol., 3: e257).
The structure of the 2L-bound TNFα trimer resembles its counterparts in structures of unliganded TNFα (Eck and Sprang, 1989, J Biol Chem, 264:17595-17605) and TNFR1-bound TNFβ (Banner et al., 1993, Cell, 73: 431-445) (
2L binds to TNFα using residues from all three of its domains to interact with the region surrounding the shallow groove between adjacent TNFα subunits, burying loops D-E and A-A′, which are also critical for TNFα binding to TNFR1 and TNFR2 (Mukai et al., 2009, J Mol. Biol. 385: 1221-1229) and TNFβ binding to TNFR1 (Banner et al., 1993, Cell, 73:431-445) (
Consistent with the observation that poxvirus 2L proteins show varying degrees of specificity for binding TNFα from different species (Rahman et al., 2006, J Biol Chem, 281: 22517-22526, which is incorporated herein by reference), the TNFα binding site on 2L is less conserved than the rest of the protein: 26% (5 of 19) of the binding site residues are conserved in 2L proteins from four or more poxviruses, compared with an overall conservation of 42% (125 of 299 residues) (
In another embodiment, a TNFa-binding candidate compound is a 2L-derived polypeptide wherein the starting 2L protein is YMTV 2L (SEQ ID NO: 3). YMTV 2L binds monkey TNFα with a binding affinity (Kd) of 230 picomoles, and binds human TNFα with a Kd of 440 picomoles (Rahman et al., 2006). The binding affinity of YMTV 2L derived TNFa-binding candidate compounds for human TNFα may therefore be reduced as compared with YLDV 2L or TPV 2L derived compounds, which can be advantageous in the treatment of certain immunomodulatory diseases.
Unlike naturally occurring host TNFRs, 2L does not bind to TNF or other TNF family members (Brunetti et al. 2003, PNAS, 100:4831-4836). To better understand this desirable specificity for binding TNFα, TNFβ was superimposed on the 2L-TNFα structure (
In one aspect of the invention, a method for designing a therapeutic TNFα binding candidate is provided. In one embodiment, the method comprises first providing a 2L protein having an amino acid sequence of SEQ ID NOs: 1, 2, or 3. The method then comprises modifying the 2L protein without modification to any of the 2L interface residues, which are: HIS58, GLU99, GLY101, PHE104, LYS125, GLY157, TYR160, MET161 or ALA161, GLY162, LEU165, LEU168 or PHE168, GLN171, LYS175, GLU225, VAL229, ASN230, GLY231, ARG 232, and GLU289, wherein MET 161 and LEU168 correspond to SEQ ID NOs: 1-2 (YLDV and TPV 2L) and ALA161 and PHE168 correspond to SEQ ID NO: 3 (YMTV 2L).
In another embodiment of the method, similar, or equivalent amino acids may be substituted for those disclosed above at the 2L-TNFα interface. Conservative substitutions include substitutions within the following groups: glycine, alanine, valine, isoleucine, and leucine; aspartic acid, glutamic acid, asparagine, and glutamine; serine and threonine; lysine and arginine; and phenylalanine and tyrosine.
In the foregoing aspect of the invention, it is desirable that the candidate either binds to the TNFα interface residues participating in the 2L-TNFα interface or prevents binding of a TNFR to the TNFα interface residues participating in the 2L-TNFα interface. The TNFR may be TNFR1. The TNFα-binding candidate may include the amino acid residues shown in Table 1, having at least 2% accessible surface area (ASA) or contributing to hydrogen bonds or salt bridges.
In another aspect of the invention, a method for designing a TNFα-binding candidate is provided wherein the method comprises providing a candidate that has a shape complementarity index, (Sc) value that is from 0.64 to 0.78. It should be noted that the Sc for TNFR1/TNFβ is 0.64, and Sc for typical antibody-antigen interfaces is from 0.64 to 0.68 (Lawrence, 1993, J Mol. Biol. 234: 946-950). The candidate compound may have an Sc value that is from 0.64 to 0.72 or about 0.72. The candidate compound may have an Sc value that is from 0.65 to 0.78, from 0.66 to 0.78, from 0.67 to 0.78, from 0.68 to 0.78, from 0.69 to 0.78, from 0.70 to 0.78, from 0.71 to 0.78, from 0.72 to 0.78, from 0.73 to 0.78, from 0.74 to 0.78, from 0.75 to 0.78, from 0.76 to 0.78, or from 0.77 to 0.78.
In one aspect of the invention, a method for designing a candidate TNFα-binding compound is provided wherein the candidate binds to TNFα amino acid residues TYR87, ARG31, ARG32, ASN30, SER86, ARG82, GLU127, ASN34, VAL91, ALA33, VAL91, GLN21, ARG44, GLU42, LEU37, LEU43, VAL41, and GLN27.
In one embodiment, a method for designing a candidate TNFa-binding compound is provided wherein the candidate amino acid sequence is not a 2L protein, but includes the atomic coordinates of the 2L interface of Table 1 and Table 4 within an acceptable 1.0 Angstrom root mean square deviation (RMSD) (Baber et al., 2009, J. Chem. Inf. Model., 49 (8): 1889-1900).
In one embodiment, a method for designing a candidate TNFa-binding compound is provided wherein starting with a 2L protein sequence (e.g. SEQ ID NOs: 1, 2 or 3), the candidate amino acid sequence is provided to a webserver that predicts potential MHC class I epitopes from a peptide sequence (e.g. the SYFPEITHI web server). Of the amino acids predicted to be epitopes, those which participate in the 2L-TNFα interface, or which form part of the scaffold proximal and/or crucial to the interface, can be modified, but modification may not be desired given their critical role for 2L binding to TNFα. Accordingly, modification of the 2L polypeptide may at least initially be guided by modifying those amino acids that are predicted to fall within an MHC I epitope and are not in the 2L interface (Example 1). With respect to epitopes, mutation of one residue can eliminate the epitope (Griffith et al., 1987, J of Immunol., 138: 4480-4483; Smahel et al., 2008, Cancer Immunol, Immunotherapy, 57: 823-831). Similarly, in another embodiment, a 2L peptide sequence is provided to a webserver that predicts MHC II and/or B-cell epitopes.
TNFα binding candidate DNA constructs are made as disclosed (Rahman et al., 2009 Virology 386:462-468, which is incorporated herein by reference). A DNA plasmid, for example, plasmid pcDNA-2L, contains the complete YLDV 2L (SEQ ID NO: 4), TPV 2L (SEQ ID NO: 5) or YMTV 2L (SEQ ID NO: 6) open reading frame. The desired mutated sequences are PCR amplified with specific oligonucleotide primers using a DNA polymerase (e.g. Pfu DNA polymerase, Stratagene, La Jolla, Calif.), and the pcDNA 2L as template.
The TNFα candidate plasmids are transferred into an expression vector for transfection and expression in an expression system. For example, the pcDNA plasmid is transferred into pFastBacI plasmid, (Invitrogen, Carlsbad, Calif.) and recombinant baculoviruses are produced using the Bac-to-Bac expression system following the manufacturer protocols. In brief, the plasmids are transformed into competent DH10Bac bacteria where a transposition event generated the corresponding recombinant bacmids. The purified bacmid DNA are transfected into Sf21 insect cells and the recombinant baculoviruses are harvested from the cell culture supernatant 3-5 days after transfection.
Screening for Compounds that Bind to TNFα Interface Residues
The 2L-TNFα crystal structure as disclosed herein is useful in methods of creating or identifying candidate compounds using a structure-based approach. As is known in the art, screens to identify agonist and antagonist molecules for TNFα can be used. Accordingly, using the methods as disclosed, for example, in Kolb et al., 2009, PNAS, 106: 6843-6848 and Casey et al., 2009, J Chem Inf Model, 49: 2708-2717, a test compound that binds to TNFα at the TNFα interface residues or prevents binding of h′TNFR1 and/or hTNFR2 to the TNFα interface residues can be identified as a therapeutic candidate compound. The test compound can optionally confer a desired conformational change an/or have a desired binding affinity. The test compound may be a small molecule, polypeptide, protein, aptamer, antibody, fusion protein or nucleic acid comprised of naturally occurring or artificial constituents. In one embodiment, a test compound is screened for its ability to bind the TNFα interface residues TYR87, ARG31, ARG32, ASN30, SER86, ARG82, GLU127, ASN34, VAL91, ALA33, VAL91, GLN21, ARG44, GLU42, LEU37, LEU43, VAL41, and GLN27.
In one embodiment, a modification is made to a 2L-derived TNFa-binding candidate comprising modifying one or more of any residue of a 2L protein (SEQ ID NOs: 1-3) that is not in the 2L interface. The modification may cause the candidate to have increased or decreased TNFα binding activity compared to the original 2L protein, wherein the reduction or increase in the activity is a direct result of the modification to the amino acid residues not in the 2L interface.
In one embodiment, a candidate compound designed in accordance with the present invention may be made by any means known in the art. For example, PCR can be used to generate a polynucleotide comprising codons that result in a mutation in one or more of the corresponding non-interface 2L amino acid residues. Commercial kits are also available for producing mutants, such as QuikChange™ (Stratagene, La Jolla, Calif.). In addition, site directed mutagenesis may be employed, as well as chemical synthesis. The skilled artisan is well versed in the methods available for producing the polynucleotides and polypeptides of the present invention.
The affinity of the candidate compound to TNFα is measured using one of several methods known in the art. For example, (Rahman et al., 2006, J Biol Chem 281:22517-22526) recombinant candidate proteins are immobilized at low densities of ˜500 RU on CM5 chips and varying concentrations of TNF alpha protein is applied to the chips. Following an association period of 120 seconds, running buffer HBS-EP is injected to monitor the dissociation phase of binding. In one embodiment, the candidate binding compound has an affinity to TNFα of from about 43 picomoles (pm) to 440 pm (Rahman et al. 2006, J Biol Chem, 281: 22517-22526). In one embodiment, the candidate binding compound of the present invention has a binding affinity to TNFα of from about 40 pm to about 445 pm. Alternatively, the candidate TNFα-binding compound has a IQ value that is from 40 pm to 440 pm, from 40 pm to 430 pm, from 40 pm to 420 pm, from 40 pm to 410 pm, from 40 pm to 400 pm, from 40 pm to 390 pm, from 40 pm to 380 pm, from 40 pm to 370 pm, from 40 pm to 360 pm, from 40 pm to 350 pm, from 40 pm to 340 pm, from 40 pm to 330 pm, from 40 pm to 320 pm, from 40 pm to 310 pm, from 40 pm to 300 pm, from 40 pm to 290 pm, from 40 pm to 280 pm, from 40 pm to 270 pm, from 40 pm to 260 pm, from 40 pm to 250 pm, from 40 pm to 240 pm, from 40 pm to 230 pm, from 40 pm to 220 pm, from 40 pm to 210 pm, from 40 pm to 200 pm, from 40 pm to 190 pm, from 40 pm to 180 pm, from 40 pm to 170 pm, from 40 pm to 160 pm, from 40 pm to 150 pm, from 40 pm to 140 pm, from 40 pm to 130 pm, from 40 pm to 120 pm, from 40 pm to 110 pm, from 40 pm to 100 pm, from 40 pm to 90 pm, from 40 pm to 80 pm, from 40 pm to 70 pm, from 40 pm to 60 pm, or from 40 pm to 50 pm.
In an alternative embodiment, the candidate binding compound of the present invention decreases the binding affinity to TNFα. For example, a method for decreasing affinity to TNFα compared to any of the full length 2L proteins may be desired in order to attenuate binding. As such, in one embodiment, a method for a 2L-derived candidate compound is provided comprising modifying one or more amino acid residues of a 2L protein within the 2L interface residues. In another embodiment, a 2L-derived candidate compound that has decreased binding to TNFα compared to 2L, has a modification in one more amino acid residues of the 2L interface in addition to one or more amino acid residues that do not participate in the 2L interface.
To determine the binding preference for a candidate TNFα binding compound with respect to known TNFα binding proteins, e.g. 2L, TNFR2, etc, a competitive binding assay is used. Competitive/inhibition binding assays are known in the art. A preferred ELISA method for determining candidate TNFα binding compounds and their affinity by competitive inhibition is disclosed in Brunetti et al. 2003, PNAS, 100:4831-4836. In one embodiment, the candidate TNFα-binding compound of the present invention competitively inhibits the binding of TNFα to TNFR2. In one embodiment, the competitive binding of the candidate compound inhibits the binding of TNFα to TNFR1 at least 30%, preferably at least 50%, more preferably at least 75%, and most preferably at least 95% compared to 2L polypeptide.
The invention includes methods of treating or preventing immunological disorders by using immunomodulatory agents. 2L-derived TNFα binding polypeptides identified in the present invention that exhibit anti-cytokine activity, anti-inflammatory activity, and/or exhibit a decrease in leukocyte chemotaxis activity are considered particularly useful in the invention; such polypeptides may be used, for example, as therapeutics to decrease the immunoreactivity in an individual with rheumatoid arthritis. Other immunological disorders that may be treated using an immunosuppressive agent, or an agent that reduces the immune function, include acute inflammation, allergic reactions, asthmatic reactions, inflammatory bowel diseases (i.e., Crohn's Disease and ulcerative colitis), transplant rejection, and restenosis. Alternatively, a polypeptide that enhances or induces apoptosis may be used in the treatment of tumors.
Treatment or prevention of diseases resulting from an immunomodulatory disorder is accomplished, for example, by modulating the function of an immunoregulatory protein by delivering a 2L-derived TNFα candidate protein to the appropriate cells. It is also possible to correct an immune defect by modifying the physiological pathway (e.g., a signal transduction pathway), in which the immunoregulatory protein participates, by delivering a TNFα candidate protein or nucleic acid molecule to the appropriate cells.
Direct administration of a recombinant TNFα protein, nucleic acid molecule, antibody, or compound, either to the site of a potential or actual disease-affected tissue (for example, by injection), or systemically for treatment of, for example, an autoimmune or inflammatory disorder, can be performed accordingly to any conventional recombinant protein administration technique known in the art or described herein. The actual dosage depends on a number of factors known to those of ordinary skill in the art, including the size and health of the individual patient, but generally, between 0.1 mg and 100 mg inclusive are administered per day to an adult in any pharmaceutically-acceptable formulation.
A TNFα immunomodulator, antiflammatory agent, or anticarcinogen may be administered with a pharmaceutically-acceptable diluent, carrier, or excipient, at a pharmaceutically effective dose. Conventional pharmaceutical practice may be employed to provide suitable formulations or compositions to administer TNFα candidate compounds to patients suffering from an immunomodulatory disorder. Any appropriate route of administration may be employed, for example, parenteral, intravenous, subcutaneous, intramuscular, intracranial, intraorbital, ophthalmic, intraventricular, intracapsular, intraspinal, intracisternal, intraperitoneal, intranasal, aerosol, or oral administration. Therapeutic formulations may be in the form of liquid solutions or suspensions; for oral administration, formulations may be in the form of tablets or capsules; and for intranasal formulations, in the form of powders, nasal drops, or aerosols.
Methods well known in the art for making formulations are found in, for example, “Remington's Pharmaceutical Sciences, supra.” Formulations for parenteral administration may, for example, contain excipients, sterile water, or saline, polyalkylene glycols such as polyethylene glycol, oils of vegetable origin, or hydrogenated napthalenes. Biocompatible, biodegradable lactide polymer, lactide/glycolide copolymer, or polyoxyethylene-polyoxypropylene copolymers may be used to control the release of the compounds. Other potentially useful parenteral delivery systems for TNFα candidate immunomodulatory compounds include ethylene-vinyl acetate copolymer particles, osmotic pumps, implantable infusion systems, and liposomes. Formulations for inhalation may contain excipients, for example, lactose, or may be aqueous solutions containing, for example, polyoxyethylene-9-lauryl ether, glycocholate and deoxycholate, or may be oily solutions for administration in the form of nasal drops, or as a gel.
2L-derived TNFα binding immunomodulators of this invention and other compounds found to be effective at the level of protein expression or activity are tested in animal models, for efficacy in treating, for example, autoimmune and inflammatory diseases and cancer. In one embodiment, a method of testing a candidate TNFα-binding compound is provided, comprising: selecting a candidate compound that binds to TNFα; assaying the compound for a disease in an animal model for the disease; and, determining if the compound decreases the disease in the animal model in comparison to known compounds (i.e. control inhibitors)—e.g. TNFα antibodies, as described (U.S. Pat. No. 7,070,775) and etanercept, (Enbrel™) (U.S. Pat. No. 5,712,155).
Animal models for testing the immunomodulatory effects of candidate compounds are well known in the art. Therefore, the present invention refers to a selection of animal models that can be used to test the candidate compounds of the invention. Animal models proposed for use in the present invention to test candidate compounds for their efficacy in treating autoimmune and inflammatory disorders include, but are not limited to:
Animal models of acute inflammation are targeted for initial and rapid drug efficacy screening, and for their potential predicative value of outcomes in chronic inflammatory diseases. The following animal models can be used to test the candidate compounds of the present invention for their efficacy in treating acute inflammation: 1) carrageenin-induced inflammation model; 2) turpentine-induced inflammation model; 3) transgenic HLAB-27 inflammation model; and 4) ear-scratch model of inflammation.
Efficacy in Rheumatoid Arthritis evaluated in: 1) various antigen-induced arthritis models in rabbit, rat, and mouse; and 2) in transgenic rheumatological models.
The molecular and cellular mechanisms of action of the candidate compounds are evaluated by testing their efficacy in influencing key intracellular mechanisms that regulate degradative processes involved in joint disease. Important molecular and cellular mechanisms that receive particular attention include signaling events regulating disease processes such as increased angiogenesis, synovial hyperplasia, and matrix metalloprotease expression. These processes have been implicated in cartilage degradation in arthritic diseases.
1. Collagen-induced Arthritis: Rat, Mouse, Rabbit
Autoimmune-mediated polyarthritis can be induced in certain strains of rodents (rat, mouse and rabbit) and non-human primates by immunizing them with native type II collagen. The collagen-induced arthritis model is widely used and well characterized. Collagen-induced arthritis is mediated by susceptibility to autoantibodies which bind to a particular region of type II collagen. The mechanism of induction is linked to MHC-class II molecules but also depends on the species of type II collagen used for immunization.
2. Ovalbumin-induced Arthritis; Rabbit
Candidate compounds are tested for efficacy in decreasing signs and symptoms of ovalbumin arthritis. Polyarthritis is induced in rabbits by immunizing them with Ovalbumin.
3. Adjuvant-induced Arthritis: Rat, Mouse, Rabbit
Candidate compounds are tested for the efficacy in decreasing signs and symptoms of adjuvant-induced arthritis. Polyarthritis is induced in certain strains of rodents by immunizing them with Freud's Adjuvant.
4. Streptococcal Cell Wall-induced Arthritis: Rat
Candidate compounds are tested for efficacy in decreasing signs and symptoms of streptococcal cell wall-induced arthritis. Chronic, erosive polyarthritis is induced by intraperitoneal injection of an aqueous suspension of cell wall fragments isolated from group A streptococci.
Transplant Rejection (Acute and Chronic)
Efficacy in transplant rejection is evaluated in various models of graft vascular disease (GVD). GVD is the most common cause of late graft failure in solid organ transplantation. GVD or graft atherosclerosis is characterized by plaque formation and fibrosis in small vessels. The development of graft vascular disease has been associated with acute allograft rejection, ischemia-reperfusion injury, and bacterial or viral infections. The common pathway of these postoperative insults results in perivascular inflammation which triggers migration of mesenchymal cells into the vessel wall, eventually resulting in occlusion or partial occlusion of the vessel lumen.
1. Aortic Allograft Model: Rat, Rabbit, Monkey
Candidate compounds are tested for efficacy in reducing graft atherosclerosis and transplant rejection in a model of vascular injury after transplantation of aortic segments performed in certain strains of MHC mismatched rats, monkeys, and rabbits.
2. Tracheal Allograft Model: Rat, Rabbit, Monkey
Candidate compounds are tested for efficacy in reducing graft atherosclerosis and transplant rejection in a model of vascular injury after transplantation of tracheal segments performed in certain strains of MHC mismatched rats, rabbits, and monkeys.
3. Heterotopic Heart Transplant: Mouse, Rat, Monkey
A heterotropic heart transplantation is performed in MHC mismatched animals. In this model, animals are treated with cyclosporine A for only the first 7 days after transplantation are allowed to develop graft vascular disease, and are then analyzed after sacrifice at postoperative day 90.
4. Orthotopic Kidney Transplant: Mouse, Rat, Monkey
An orthotopic kidney transplantation is performed in MHC mismatched animals. In this model, animals receiving subtherapeutic doses of cyclosporine A for the first 10 days after transplantation are allowed to exhibit features of chronic renal allograft rejection in 70% of cases, and are then analyzed after sacrifice at postoperative day 90.
5. Orthotopic Lung Transplant: Rat, Monkey
Candidate compounds are tested for effectiveness in delaying or reducing signs and symptoms of organ rejection after lung whole organ transplantation in rats and monkeys.
6. Reperfusion Injury: Rat
The immediate postoperative course in clinical lung transplantation is often severely impaired by delayed graft function as a result of ischemia and reperfusion injury. Preventive efficacy of drug candidates in ischemia-reperfusion injury is evaluated using a model of acute in vivo double lung transplantation in the rat (Hausen et al., Ann. Thorac. Surg. 61:1714-9, 1996 incorporated herein by reference).
Restenosis
Candidate compounds are tested for efficacy in reducing atherosclerotic plaque deposition in a model of coronary restenosis after balloon angioplasty. Atherosclerotic plaque formation is critically involved in vascular occlusion and has been linked to excessive inflammatory and thrombotic response to arterial injury.
Asthma: Rodent
The effectiveness of candidate compounds in reduction of signs and symptoms of asthma is evaluated in rodent models of antigen-induced experimental airways inflammation. The models include:
1. Ovalbumin-Induced Experimental Airways Inflammation: Rodent
Candidate compounds are tested for efficacy in reducing inflammatory cell components in the bronchoalveolar lavage of the lungs after aerosol challenge in ovalbumin-sensitized rodent models of experimental airways inflammation.
2. Ovalbumin-induced Allergic Sensitization in Presence of GM-CSF Transgene Expression: Mice
Candidate compounds are tested for efficacy in reducing inflammatory cell components in the bronchoalveolar lavage of the lungs of mice after ovalbumin aerosol challenge in the context of local expression of GM-CSF (Staempfli et al., J. Clin. Invest., Vol. 102:9, 1704-1714).
Inflammatory Bowel Disease (IBD): Mice and Rats
Drug candidates are evaluated for their potential therapeutic efficacy in ulcerative colitis or Crohn's disease utilizing various models of antigen-induced and genetically-mediated spontaneous chronic intestinal inflammation in mice and rats. Examples include:
1. Dextran Sulfate Sodium Induced IBD: Mice
Chronic, irreversible clinical symptoms of IBD are induced by treating mice with an oral administration of dextran sulfate sodium.
2. Gene Deletion and Transgenic Models for IBD: Rodent
Compound efficacy will be tested in transgenic rodent lines which develop symptoms closely resembling the human elements of inflammatory bowel disease. Models include, the targeted deletion of the genes encoding IL-2, IL-10, TGF beta, T-cell receptor alpha/beta, keratin 8, Gi2 alpha. In addition, animals expressing transgenes for the human WA-B27 and HLA-B27 as well as a dominant negative construct which functionally blocks N-cadherin will be tested.
Uveitis
Drug candidates will be evaluated for efficacy in various animal models of uveitis. Key models include both, experimental autoimmune uveitis and adoptively transferred experimental autoimmune uveitis.
1. Experimental Autoimmune Uveitis (EAU)
EAU is a T-cell mediated inflammatory eye disease that can be induced in several mammalian species by immunization with ocular-specific antigens (Gery et al., Invest. Opthalmol. Vis. Sci., 27: 1296-1300, 1986. Sanui et al., J. Exp. Med., 169:1947-1989, incorporated herein by reference). This experimental disease is considered a model for a family of inflammatory eye diseases in humans and has been used to examine numerous modalities before their human testing.
2. Adoptively Transferred Experimental Autoimmune Uveitis
Adoptively transferred EAU is induced through injection of lymphocytes presensitized against the retinal antigen are injected into naive syngenic recipients (McAllister et al., J. Immunol., 138:1416-1420, 1987 incorporated herein by reference).
YLDV 2L amino acid sequence (SEQ ID NO: 1) was provided to the SYFPEITHI webserver. YLDV 2L residues 218-226 (ESEHFKGEY) are predicted to bind to MHC class 1 molecule HLA-A*01. The amino acids in positions 3 and 9 of this peptide fragment, E220 and Y226, respectively, are important to binding to HLA-A*01 (Falk et al., 1994, Immunogenetics, 40: 238-241). Examining the 2L-TNF crystal structure (Table 1 and Table 4), one can determine that changing TYR226 may be problematic since it appears to form part of a hydrophobic core stabilizing the 2L protein. On the other hand, GLU220 does not appear to have any structural role and does not contact TNFα. Thus one could predict that the mutant 2L protein E220S wherein a serine (SER) is substituted for the glutamic acid (GLU), would be stable, bind strongly to TNF-alpha, and have one less potential epitope for HLA-A*01.
Materials and Methods for purification of complexed 2L-TNFα protein crystal.
The gene for 2L was isolated by PCR from the Yaba-like disease virus (ATCC number VR-937) using a forward primer 2LF (SEQ ID NO: 7):
CATGGATAAGTTACTATTATTTAGCAC and reverse primer 2LR (SEQ ID NO: 8): TCAGTCTTCTTCATCCTCTTCACCTTCC. A C-terminally His-tagged version of 2L lacking six C-terminal residues (residues 1-316 of the mature protein) (SEQ ID NO: 18) was amplified by PCR using a forward primer JY152 (forward primer, with kozaq sequence and BamHI site) (SEQ ID NO: 9): CGCGGATCCCCTATAAATATGGATAAGTTACTATTATTTAGC and the reverse primer, JY154 (reverse primer stops at aa 332, with XhoI site) (SEQ ID NO: 10) CCGCTCGAGACCTTCTCCTTCTTCTGTTTTTCTATATAG. This C-terminally His-tagged 2L protein was subcloned into a dicistronic baculovirus transfer vector, pAcUW31 (PharMingen) subcloned with the human β2m gene. His-tagged 2L and β2m (both included native hydrophobic leader sequences) were expressed together in baculovirus-infected insect cells (Hi5 cells). In the numbering system used herein for 2L, the first amino acid of the mature 2L chain is residue 1; a previous numbering system, which started at the initial methionine of the signal peptide, refers to this residue as 17 (Brunetti et al., 2003, PNAS, 100: 4831-4836; Rahman et al., 2006, J Biol Chem, 281:22517-22526; Rahman et al., 2009, Virology, 386: 462-468). 2L was purified by nickel-NTA and gel filtration chromatography as a monomer lacking detectable β2m. An N-terminally His-tagged form of human TNFα (residues 6-157, numbered as in PDB entry 1TNF) (SEQ ID NO: 11) was amplified from an IMAGE TNFα cDNA clone using the TNF forward primer, (SEQ ID NO: 12) GACCATATGGGCAGCCATCATCATCATCATCACCGAACCCCGAGTGACAAGCCT G and TNR reverse primer, (SEQ ID NO: 13) GACCTCGAGTCACAGGGCAATGATCCCAAAG was expressed in the E. Coli cytoplasm using the expression vector pET23a (Novagen, EMD, Gibbstown, N.J.), and soluble TNFα (SEQ ID NO: 14) was purified from bacterial lysates by nickel-NTA and gel filtration chromatography.
Purified 2L and TNFα trimer were mixed at a 3:1 molar ratio and passed over a S200 16/60 gel filtration column in 20 mM Tris pH 7.5, 150 mM NaCl. The 2L-TNFα complex was isolated and then concentrated to 14 mg/ml and used to set up crystallization trials by hanging drop vapor diffusion. Crystals were obtained in 7-12% PEG 6K, sodium citrate pH 5.0-5.5, 0.2 M NaBr in monoclinic space group P21 (a=101.7, b=170.3, c=122.0, β=92.04°) with two 3:1 2L:TNFα complexes per asymmetric unit. The crystal used for data collections had been soaked in 0.5 mM methylmercury chloride, but no heavy atoms were found in the refined structure.
Structure Analysis. Data were processed using HKL2000 (Otwinowski et al., 1997, Meth Enzymol, 276: 307). The structure was determined by molecular replacement using a TNFα (Eck and Sprang, 1989, J Biol Chem, 264: 17595-17605) search model followed by location of 2L molecules using the coordinates of the α1-α2 platform of ZAG (PDB code 1T7V) (Delker et al., 2004, J Struct Biol, 148: 205-213) in a real space search (Sanchez et al., 1999, Science, 283: 1914-1919) (Table 3). After rigid-body refinement McCoy et al., 2007, J Appl Cryst, 40: 658), rebuilding was done using the program O (Jones et al., 1997, Methods Enzymol, 277: 173) and 2Fo-Fc annealed omit maps, alternating with refinement using CNS (Brunger et al., 1998, Acta Crystallogr D Biol Crystallogr, 54: 905-921). Non-crystallographic symmetry (NCS) restraints (300 kcal/mol) and group B factor refinement were used during refinement. The final model consisted of six NCS-related sets of atoms: 2L residues 1-299, TNFα residues 6-157, 16 water molecules, and 42 atoms of carbohydrate (ordered carbohydrate attached to 2L residues Asn6, Asn52, and Asn83, but not to Asn197, the final potential N-linked glycosylation site in the 2L sequence). The following cysteine pairs were disulfide bonded: 2L 97-163 (difference Fourier maps indicated some radiation-induced breakage of this bond (Burmeister, 2000, Acta Crystallogr D Biol Crystallogr, 56: 328-341), 202-281, 295-299, and TNFα 69-101. 2L residues 300-316, its C-terminal His-tag, and the N-terminal His-tag of TNFα were disordered.
For analysis of contacts and buried surface areas, the 2L α1-α2 platform was defined as residues 1-179 and the α3 domain was defined as residues 180-299. The CCP4 program AREAIMOL (CCP4, 1994, Acta Crystallogr D Biol Crystallogr, D50: 760-763) was used to calculate buried surface areas using a 1.4 Å probe. To identify interacting residues, a maximum distance of 4.0 Å for van der Waals interactions was used. Shape complementarity indices (SC) were calculated as described (Lawrence, 1993, J Mol. Biol. 234: 946-950) using the SC program in CCP4 (CCP4, 1994, Acta Crystallogr D Biol Crystallogr, D50: 760-763). Groove surface area calculations were performed as previously described (Lebron et al., 1998, Cell, 93: 111-123; Zeng et al., 1997, Science, 277: 339-345). Structural superpositions were performed using LSQMAN (Kleywegt, 1996, Acta Cryst D Biol Crystallogr, 52: 842-857). Figures were prepared with MOLSCRIPT (Kraulis, 1991, J Appl Crystallogr, 24: 946), RASTER-3D (Merritt et al., 1994, Acta Crystallogr D Biol Crystallogr, 50:869-873), and PyMOL (DeLano, 2002, The PyMOL Molecular Graphics System, Delano Scientific, San Carlos, Ca). The domain angle displacement for the 2L a3 domain relative to the HLA-A2 α3 domain (˜42° was calculated by measuring the angle between the long axes of each domain after alignment of the α1-α2 platforms of both molecules. The long axes of the α3 domains were defined using the coordinates of 2L residues G1y176 and Asn191 and HLA-A2 residues Glu177 and His192. The second rotation angle (˜40° relating the α3 domains was estimated using the angle defined by 2L Arg270 and Asn191 and HLA-A2 Va1248.
‡Rmerge (I) = (Σ|I(i) − <I(h)>|/ΣI(i)), where I(i) is the ith observation of the intensity of the hkl reflection and <I> is the mean intensity from multiple measurements of the h, k, l reflection.
¶Rcryst (F) = Σh||Fobs(h)| − |Fcalc(h)||/Σh||Fobs(h)|, where |Fobs(h)| and |Fcalc(h)| are the observed and calculated structure factor amplitudes for the h, k, l reflection.
In summary, methods are disclosed for identifying a candidate TNFa-binding compound utilizing the structure, specifications and amino acid residues elucidated from the 2L-TNFα crystal structure. Methods are disclosed for assaying candidate TNFa-binding compounds for decreasing TNFα-mediated disease.
While the present invention has been illustrated and described with reference to certain exemplary embodiments, those of ordinary skill in the art will understand that various modifications and changes may be made to the described embodiments without departing from the spirit and scope of the present invention, as defined in the following claims.
This application claims priority to and the benefit of U.S. Provisional Application Ser. No. 61/168,133, filed Apr. 9, 2009, and titled “Crystal Structure of Poxvirus Tumor Necrosis Factor-alpha (TNFα)-Binding Protein 2L in Complex with TNFα, Useful for the Design and Development of Anti-Inflammatory Pharmaceuticals,” the entire content of which is incorporated herein by reference.
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/US2010/030649 | 4/9/2010 | WO | 00 | 12/20/2011 |
| Number | Date | Country | |
|---|---|---|---|
| 61168133 | Apr 2009 | US |
