Methods for identifying compounds that modulate metabotropic glutamate receptor activity

The present invention relates to nucleic acids and receptor proteins encoded thereby. Invention nucleic acids encode novel human metabotropic glutamate receptor subtypes. The invention also relates to methods for making such receptor subtypes and for using the receptor proteins in assays designed to identify and characterize compounds which affect the function of such receptors, e.g., agonists, antagonists, and allosteric modulators of human metabotropic glutamate receptors.
BACKGROUND OF THE INVENTION
The amino acid L-glutamate is a major excitatory neurotransmitter in the mammalian central nervous system. Anatomical, biochemical and electrophysiological analyses suggest that glutamatergic systems are involved in a broad array of neuronal processes, including fast excitatory synaptic transmission, regulation of neurotransmitter releases, long-term potentiation, learning and memory, developmental synaptic plasticity, hypoxic-ischemic damage and neuronal cell death, epileptiform seizures, as well as the pathogenesis of several neurodegenerative disorders. See generally, Monaghan et al., Ann. Rev. Pharmacol. Toxicol. 29:365-402 (1980). This extensive repertoire of functions, especially those related to learning, neurotoxicity and neuropathology, has stimulated recent attempts to describe and define the mechanisms through which glutamate exerts its effects.
Currently, glutamate receptor classification schemes are based on pharmacological criteria. Glutamate has been observed to mediate its effects through receptors that have been categorized into two main groups: ionotropic and metabotropic. Ionotropic glutamate receptors contain integral cation-specific, ligand-gated ion channels, whereas metabotropic glutamate receptors are G-protein-coupled receptors that transduce extracellular signals via activation of intracellular second messenger systems. Ionotropic receptors are further divided into at least two categories based on the pharmacological and functional properties of the receptors. The two main types of ionotropic receptors are NMDA (N-methyl-D-aspartate) receptors and kainate/AMPA (a-amino-3-hydroxy-5-methyl-4-isoxazole propionate, formerly called the quisqualic acid or QUIS receptor), receptors. While the metabotropic receptors bind to some of the same ligands that bind to ionotropic glutamate receptors, the metabotropic receptors alter synaptic physiology via GTP-binding proteins and second messengers such as cyclic AMP, cyclic GMP, diacylglycerol, inositol 1,4,5-triphosphate and calcium �see, for example, Gundersen et al., Proc. R. Soc. London Ser. 221:127 (1984); Sladeczek et al., Nature 317:717 (1985); Nicoletti et al., J. Neurosci. 6:1905 (1986); Sugiyama et al., Nature 325:531 (1987)!.
The electrophysiological and pharmacological properties of metabotropic glutamate receptors have been studied using animal tissues and cell lines as a source of receptors, as well as non-human recombinant receptors. The value of such studies for application to the development of human therapeutics has been limited by the availability of only non-human receptors. Moreover, it is only recently that the characteristics and structure of metabotropic glutamate receptors have been investigated at the molecular level. Such investigation has, however, only been carried out in non-human species. Because of the potential physiological and pathological significance of metabotropic glutamate receptors, it is imperative (particularly for drug screening assays) to have available human sequences (i.e., DNA, RNA, proteins) which encode representative members of the various glutamate receptor classes. The availability of such human sequences will also enable the investigation of receptor distribution in humans, the correlation of specific receptor modification with the occurrence of various disease states, etc.
BRIEF DESCRIPTION OF THE INVENTION
The present invention discloses novel nucleic acids encoding human metabotropic glutamate receptor protein subtypes and the proteins encoded thereby. In a particular embodiment the novel nucleic acids encode full-length mGluR1, mGluR2, mGluR3 and mGluR5 subtypes of human metabotropic glutamate receptors, or portions thereof. In addition to being useful for the production of metabotropic glutamate receptor subtype proteins, these nucleic acids are also useful as probes, thus enabling those skilled in the art, without undue experimentation, to identify and isolate nucleic acids encoding related receptor subtypes.
In addition to disclosing novel metabotropic glutamate receptor protein subtypes, the present invention also comprises methods for using such receptor subtypes to identify and characterize compounds which affect the function of such receptors, e.g., agonists, antagonists, and modulators of glutamate receptor function. The invention also comprises methods for determining whether unknown protein(s) are functional as metabotropic glutamate receptor subtypes.

BRIEF DESCRIPTION OF THE FIGURES
FIG. 1 presents a restriction map of the CMV promoter based vector pCMV-T7-2.
FIG. 2 presents a restriction map of the CMV promoter based vector pCMV-T7-3.

DETAILED DESCRIPTION OF THE INVENTION
In accordance with the present invention, there are provided isolated nucleic acids encoding human metabotropic glutamate receptor subtypes. In one aspect of the present invention, nucleic acids encoding human metabotropic glutamate receptors of the mGluRl subtype are provided. In another aspect, nucleic acids encoding at least a portion of metabotropic glutamate receptors of the mGluR2 subtype are provided. In yet another aspect, nucleic acids encoding metabotropic glutamate receptors of the mGluR3 subtype are provided. In a further aspect, nucleic acids encoding metabotropic glutamate receptors of the mGluR5 subtype are provided. In a still further aspect, eukaryotic cells containing such nucleic acids, and eukaryotic cells expressing such nucleic acids are provided.
Also provided are protein(s) encoded by the above-described nucleic acids, as well as antibodies generated against the protein(s). In other aspects of the present invention, there are provided nucleic acid probes comprising metabotropic glutamate receptor subtype-selective portions of the above-described nucleic acids.
As employed herein, the phrase "human metabotropic glutamate receptor subtypes" refers to isolated and/or purified proteins which participate in the G-protein-coupled response of cells to glutamatergic ligands. Such receptor subtypes are individually encoded by distinct genes which do not encode other metabotropic glutamate receptor subtypes (i.e., each subtype is encoded by a unique gene). Such receptor subtypes are typically characterized by having seven putative transmembrane domains, preceded by a large putative extracellular amino-terminal domain and followed by a large putative intracellular carboxy-terminal domain. Metabotropic glutamate receptors share essentially no amino acid sequence homology with other G-protein-coupled receptors that are not metabotropic glutamate receptors.
Regarding the inter-relationship between each of the metabotropic glutamate receptor subtypes, the amino acid sequences of mGluRl receptor subtypes are generally less than about 70% identical to the amino acid sequences of other human metabotropic glutamate receptor subtypes, with identities less than about 45% typically observed. The amino acid sequences of mGluR2 receptor subtypes are generally less than 60% identical to the amino acid sequences of other human metabotropic glutamate receptor subtypes, with identities of less than 45% typically observed. The amino acid sequences of mGluR3 receptor subtypes are generally less than 60% identical to the amino acid sequences of other human metabotropic glutamate receptor subtypes, with identities of less than 45% typically observed. The amino acid sequences of mGluR5 receptor subtypes are generally less than 70% identical to the amino acid sequences of other human metabotropic glutamate receptor subtypes, with identities of less than 45% typically observed.
Also included within the above definition are variants thereof encoded by mRNA generated by alternative splicing of a primary transcript, as well as fragments thereof which retain one or more of the above physiological and/or physical properties.
Use of the terms "isolated" or "purified" in the present specification and claims as a modifier of DNA, RNA, polypeptides or proteins means that the DNA, RNA, polypeptides or proteins so designated have been produced in such form by the hand of man, and thus are separated from their native in vivo cellular environment. As a result of this human intervention, the recombinant DNAs, RNAS, polypeptides and proteins of the invention are useful in ways that the DNAs, RNAs, polypeptides or proteins as they naturally occur are not, such as identification of selective drugs or compounds.
The term "functional", when used herein as a modifier of receptor protein(s) of the present invention, means that binding of glutamatergic ligands (such as ACPD or ACPD-like ligands, QUIS, AP4, and the like) to said receptor protein(s) modifies the receptor interaction with G-proteins, which in turn affects the levels of intracellular second messengers, leading to a variety of physiological effects. Stated another way, "functional" means that a response is generated as a consequence of agonist activation of receptor protein(s).
As used herein, a splice variant refers to variant metabotropic glutamate receptor subtype-encoding nucleic acid(s) produced by differential processing of primary transcript(s) of genomic DNA, resulting in the production of more than one type of mRNA. cDNA derived from differentially processed primary transcript will encode metabotropic glutamate receptor subtypes that have regions of complete amino acid identity and regions having different amino acid sequences. Thus, the same genomic sequence can lead to the production of multiple, related mRNAs and proteins. Both the resulting mRNAs and proteins are referred to herein as "splice variants".
Accordingly, also contemplated within the scope of the present invention are nucleic acids that encode metabotropic glutamate receptor subtypes as defined above, but that by virtue of degeneracy of the genetic code do not necessarily hybridize to the disclosed nucleic acids under specified hybridization conditions. Such subtypes also form functional receptors, as assessed by methods described herein or known to those of skill in the art. Typically, unless a metabotropic glutamate receptor subtype is encoded by RNA that arises from alternative splicing (i.e., a splice variant), metabotropic glutamate receptor subtype-encoding nucleic acids and the metabotropic glutamate receptor protein encoded thereby share substantial sequence homology with at least one of the metabotropic glutamate receptor subtype nucleic acids (and proteins encoded thereby) described herein. It is understood that DNA or RNA encoding a splice variant may share less than 90% overall sequence homology with the DNA or RNA provided herein, but include regions of nearly 100% homology to a DNA fragment described herein, and encode an open reading frame that includes start and stop codons and encodes a functional metabotropic glutamate receptor subtype.
Exemplary DNA sequences encoding human mGluR1subtypes are represented by nucleotides which encode substantially the same amino acid sequence as set forth in Sequence ID No. 2. Presently preferred sequences encode the amino acid sequence set forth in Sequence ID No. 2.
Exemplary DNA can alternatively be characterized as those nucleotide sequences which encode an human mGluR1 subtype and hybridize under high-stringency conditions to substantially the entire sequence of Sequence ID No. 1, or substantial portions thereof (i.e., typically at least 25-30 contiguous nucleotides thereof).
Stringency of hybridization is used herein to refer to conditions under which polynucleic acid hybrids are stable. As known to those of skill in the art, the stability of hybrids is reflected in the melting temperature (T.sub.m) of the hybrids. T.sub.m can be approximated by the formula:
81.5.degree. C.-16.6(log.sub.10 �Na.sup.+ !)+0.41(%G+C)-600/1,
where l is the length of the hybrids in nucleotides. T.sub.m decreases approximately 1.degree.-1.5.degree. C. with every 1% decrease in sequence homology. In general, the stability of a hybrid is a function of sodium ion concentration and temperature. Typically, the hybridization reaction is performed under conditions of lower stringency, followed by washes of varying, but higher, stringency. Reference to hybridization stringency relates to such washing conditions. Thus, as used herein:
(1) HIGH STRINGENCY conditions, with respect to fragment hybridization, refer to conditions that permit hybridization of only those nucleic acid sequences that form stable hybrids in 0.018M NaCl at 65.degree. C. (i.e., if a hybrid is not stable in 0.018M NaCl at 65.degree. C., it will not be stable under high stringency conditions, as contemplated herein). High stringency conditions can be provided, for example, by hybridization in 50% formamide, 5.times.Denhart's solution, 5.times.SSPE, 0.2% SDS at 42.degree. C., followed by washing in 0.1.times.SSPE, and 0.1% SDS at 65.degree. C.;
(2) MODERATE STRINGENCY conditions, with respect to fragment hybridization, refer to conditions equivalent to hybridization in 50% formamide, 5.times.Denhart's solution, 5.times.SSPE, 0.2% SDS at 42.degree. C., followed by washing in 0.2.times.SSPE, 0.2% SDS, at 65.degree. C.; and
(3) LOW STRINGENCY conditions, with respect to fragment hybridization, refer to conditions equivalent to hybridization in 10% formamide, 5.times.Denhart's solution, 6.times.SSPE, 0.2% SDS at 42.degree. C., followed by washing in 1.times.SSPE, 0.2% SDS, at 50.degree. C.
(4) HIGH STRINGENCY conditions, with respect to oligonucleotide (i.e., synthetic DNA.ltoreq.about 30 nucleotides in length) hybridization, refer to conditions equivalent to hybridization in 10% formamide, 5.times.Denhart's solution, 6.times.SSPE, 0.2% SDS at 42.degree. C., followed by washing in 1.times.SSPE, and 0.2% SDS at 50.degree. C.
It is understood that these conditions may be duplicated using a variety of buffers and temperatures and that they are not necessarily precise.
Denhart's solution and SSPE (see, e.g., Sambrook, Fritsch, and Maniatis, in: Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1989) are well known to those of skill in the art as are other suitable hybridization buffers. For example, SSPE is pH 7.4 phosphate-buffered 0.18M NaCl. SSPE can be prepared, for example, as a 20.times.stock solution by dissolving 175.3 g of NaCl, 27.6 g of NaH.sub.2 PO.sub.4 and 7.4 g EDTA in 800 ml of water, adjusting the pH to 7.4, and then adding water to 1 liter. Denhart's solution (see, Denhart (1966) Biochem. Biophys. Res. Commun. 23:641) can be prepared, for example, as a 50.times.stock solution by mixing 5 g Ficoll (Type 400, Pharmacia LKB Biotechnology, INC., Piscataway, N.J.), 5 g of polyvinylpyrrolidone, 5 g bovine serum albumin (Fraction V; Sigma, St. Louis, Mo.) water to 500 ml and filtering to remove particulate matter.
Especially preferred sequences encoding human mGluR1 subtypes are those which have substantially the same nucleotide sequence as the coding sequences in Sequence ID No. 1; with polynucleic acid having the same sequence as the coding sequence in Sequence ID No. 1 being most preferred.
As used herein, the phrase "substantial sequence homology" refers to nucleotide sequences which share at least about 90% identity, and amino acid sequences which typically share more than 95% amino acid identity. It is recognized, however, that proteins (and DNA or mRNA encoding such proteins) containing less than the above-described level of homology arising as splice variants or that are modified by conservative amino acid substitutions (or substitution of degenerate codons) are contemplated to be within the scope of the present invention.
The phrase "substantially the same" is used herein in reference to the nucleotide sequence of DNA, the ribonucleotide sequence of RNA, or the amino acid sequence of protein, that have slight and non-consequential sequence variations from the actual sequences disclosed herein. Species that are substantially the same are considered to be equivalent to the disclosed sequences and as such are within the scope of the appended claims. In this regard, "slight and non-consequential sequence variations" mean that sequences that are substantially the same as the DNA, RNA, or proteins disclosed and claimed herein are functionally equivalent to the human-derived sequences disclosed and claimed herein. Functionally equivalent sequences will function in substantially the same manner to produce substantially the same compositions as the human-derived nucleic acid and amino acid compositions disclosed and claimed herein. In particular, functionally equivalent DNAs encode human-derived proteins that are the same as those disclosed herein or that have conservative amino acid variations, such as substitution of a non-polar residue for another non-polar residue or a charged residue for a similarly charged residue. These changes include those recognized by those of skill in the art as those that do not substantially alter the tertiary structure of the protein.
Exemplary DNA sequences encoding a portion of an human mGluR2 receptor subtype are represented by nucleotides which encode substantially the same amino acid sequence as set forth in Sequence ID No. 4 (optionally including some or all of the 343 nucleotides of 3' untranslated sequence set forth in Sequence ID No. 13), or substantially the same amino acid sequence as that encoded by the human mGluR2-encoding portion of clone METAB40, deposited with the ATCC on May 4, 1993, under accession number 75465.
The deposited clone has been deposited on May 4, 1993, at the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, Md., U.S.A. 20852, under the terms of the Budapest Treaty on the International Recognition of Deposits of Microorganisms for Purposes of Patent Procedure and the Regulations promulgated under this Treaty. Samples of the deposited material are and will be available to industrial property offices and other persons legally entitled to receive them under the terms of the Treaty and Regulations and otherwise in compliance with the patent laws and regulations of the United States of America and all other nations or international organizations in which this application, or an application claiming priority of this application, is filed or in which any patent granted on any such application is granted. In particular, upon issuance of a U.S. patent based on this or any application claiming priority to or incorporating this application by reference thereto, all restriction upon availability of the deposited material will be irrevocably removed.
Presently preferred polynucleic acid sequences that encode a portion of an human mGluR2 receptor subtype are those that encode the same amino acid sequence as Sequence ID No. 4, or the same amino acid sequence as that encoded by the human mGluR2-encoding portion of clone METAB40, deposited with the ATCC on May 4, 1993, under accession number 75465.
Exemplary DNAs can alternatively be characterized as those nucleotide sequences which encode a human mGluR2 receptor subtype and hybridize under high-stringency conditions to Sequence ID No. 3, or substantial portions thereof (i.e., typically at least 25-30 contiguous nucleotides thereof), or the human mGluR2-encoding portion of clone METAB40 (ATCC accession No. 75465), or substantial portions thereof. Especially preferred sequence encoding a portion of an human mGluR2 receptor subtype is represented by polynucleic acid which has the same nucleotide sequence as the coding sequence set forth in Sequence ID No. 3, or the nucleotide sequence of the coding sequence in the human mGluR2-encoding portion of clone METAB40.
Exemplary DNA sequences encoding human mGluR3 receptor subtypes are represented by nucleotides which encode substantially the same amino acid sequence as set forth in Sequence ID No. 6. Presently preferred polynucleic acid sequences are those that encode the same sequence as Sequence ID No. 6.
Exemplary DNAs can alternatively be characterized as those nucleotide sequences which encode a human mGluR3 receptor subtype and hybridize under high-stringency conditions to substantially the entire sequence of Sequence ID No. 5, or substantial portions thereof (i.e., typically at least 25-30 contiguous nucleotides thereof). Especially preferred sequences encoding human mGluR3 subtypes are those which have substantially the same nucleotide sequence as the coding sequences in Sequence ID No. 5, with the polynucleic acid having the same nucleotide sequence as the coding sequence set forth in Sequence ID No. 5 being the presently most preferred.
Exemplary DNA sequences encoding human mGluR5 receptor subtypes or portions thereof are represented by nucleotides which encode substantially the same amino acid sequence as set forth in Sequence ID Nos. 8, 10 or 12. Presently preferred polynucleic acid sequences are those that encode the same sequence as Sequence ID Nos. 8, 10 or 12.
Exemplary DNAs can alternatively be characterized as those nucleotide sequences which encode a human mGluR5 receptor subtype and hybridize under high stringency conditions to substantially the entire sequence of Sequence ID Nos. 7, 9 or 11, or substantial portions thereof (i.e., typically at least 25-30 contiguous nucleotides thereof). Especially preferred sequences encoding human mGluR5 subtypes are those which have substantially the same nucleotide sequence as the coding sequences set forth in Sequence ID Nos. 7, 9 or 11; with polynucleic acids having the same sequence as the coding sequence set forth in Sequence ID Nos. 7, 9 or 11 being the presently most preferred.
DNA encoding human metabotropic glutamate receptor subtypes may be isolated by screening suitable human cDNA or human genomic libraries under suitable hybridization conditions with DNA disclosed herein (including nucleotides derived from any of SEQ ID Nos. 1, 3, 5, 7, 9 or 11). Suitable libraries can be prepared from neural tissue samples, e.g., hippocampus and cerebellum tissue, cell lines, and the like. For example, the library can be screened with a portion of DNA including substantially the entire receptor subtype-encoding sequence thereof, or the library may be screened with a suitable oligonucleotide probe based on a portion of the DNA.
As used herein, a probe is single-stranded DNA or RNA that has a sequence of nucleotides that includes at least about 25-30 contiguous bases that are the same as (or the complement of) any 25 or more contiguous bases set forth in any of SEQ ID Nos. 1, 3, 5, 7, 9 or 11. Preferred regions from which to construct probes include 5' and/or 3' coding sequences, sequences predicted to encode transmembrane domains, sequences predicted to encode cytoplasmic loops, signal sequences, ligand binding sites, and the like.
Either the full-length cDNA clones, fragments thereof, or oligonucleotides based on portions of the cDNA clones can be used as probes, preferably labeled with suitable label means for ready detection. When fragments are used as probes, DNA sequences for such probes will preferably be derived from the carboxyl end-encoding portion of the DNA, and most preferably will include predicted transmembrane domain-encoding portions of the DNA sequence (the domains can be predicted based on hydropathy analysis of the deduced amino acid sequence using, for example, the method of Kyte and Doolittle (1982), J. Mol. Biol. Vol. 157:105). These probes can be used, for example, for the identification and isolation of additional members of the glutamate receptor family.
As a particular application of the invention sequences, genetic screening can be carried out using the nucleotide sequences of the invention as probes. Thus, nucleic acid samples from patients having neuropathological conditions suspected of involving alteration/modification of any one or more of the glutamate receptors can be screened with appropriate probes to determine if any abnormalities exist with respect to any of the endogenous glutamate receptors. Similarly, patients having a family history of disease states related to glutamate receptor dysfunction can be screened to determine if they are also predisposed to such disease states.
In accordance with another embodiment of the present invention, there is provided a method for identifying DNA encoding human metabotropic glutamate receptor protein subtypes, said method comprising:
contacting human DNA with a nucleic acid probe as described above, wherein said contacting is carried out under low- to moderate-stringency hybridization conditions when the probe used is a polynucleic acid fragment, or under high-stringency hybridization conditions when the probe used is an oligonucleotide, and
identifying DNA(s) which hybridize to said probe.
After screening the library, positive clones are identified by detecting a hybridization signal; the identified clones are characterized by restriction enzyme mapping and/or DNA sequence analysis, and then examined, by comparison with the sequences set forth herein to ascertain whether they include DNA encoding a complete metabotropic glutamate receptor subtype (i.e., if they include translation initiation and termination codons). If the selected clones are incomplete, they may be used to rescreen the same or a different library to obtain overlapping clones. If the library is genomic, then the overlapping clones may include exons and introns. If the library is a cDNA library, then the overlapping clones will include an open reading frame. In both instances, complete clones may be identified by comparison with the DNA and deduced amino acid sequences provided herein.
Complementary DNA clones encoding various human metabotropic glutamate receptor subtypes (e.g., mGluR1, mGluR2, mGluR3, mGluR5) have been isolated. Each subtype appears to be encoded by a different gene. The DNA clones provided herein may be used to isolate genomic clones encoding each subtype and to isolate any splice variants by screening libraries prepared from different neural tissues. Nucleic acid amplification techniques, which are well known in the art, can be used to locate DNA encoding splice variants of human metabotropic glutamate receptor subtypes. This is accomplished by employing oligonucleotides based on DNA sequences surrounding known or predicted divergent sequence(s) as primers for amplifying human RNA or genomic DNA. Size and sequence determinations of the amplification products can reveal the existence of splice variants. Furthermore, isolation of human genomic DNA sequences by hybridization can yield DNA containing multiple exons, separated by introns, that correspond to different splice variants of transcripts encoding human metabotropic glutamate receptor subtypes.
It has been found that not all metabotropic glutamate receptor subtypes (and variants thereof) are expressed in all neural tissues or in all portions of the brain. Thus, in order to isolate cDNA encoding a particular subtype (or splice variants thereof), it is preferable to screen libraries prepared from different neuronal or neural tissues or cells. Preferred libraries for obtaining DNA encoding each subtype include: cerebellum to isolate human mGluRl-encoding DNAs; hippocampus to isolate human mGluR2-encoding DNAs; hippocampus and cerebellum to isolate mGluR3-encoding DNAs; hippocampus and cerebellum to isolate mGluR5-encoding DNAs; and the like.
Once DNA encoding a particular receptor subtype has been isolated, ribonuclease (RNase) protection assays can be employed to determine which tissues express mRNA encoding such subtype (or splice variant thereof). These assays provide a sensitive means for detecting and quantitating an RNA species in a complex mixture of total cellular RNA. The subtype DNA is labeled and hybridized with cellular RNA. If complementary mRNA is present in the cellular RNA, a DNA-RNA hybrid results. The RNA sample is then treated with RNase, which degrades single-stranded RNA. Any RNA-DNA hybrids are protected from RNase degradation and can be visualized by gel electrophoresis and autoradiography. In situ hybridization techniques can also be used to determine which tissues express mRNAs encoding particular metabotropic glutamate receptor subtypes. Thus, labeled subtype DNAs can be hybridized to different brain region slices to visualize subtype mRNA expression.
It appears that the distribution of expression of some human metabotropic glutamate receptor subtypes differs from the distribution of such receptors in rat. For example, even though RNA encoding the rat mGluR5 subtype is abundant in rat hippocampus, but is not abundant in rat cerebellum �see, e.g., Abe et al., J. Biol. Chem. 267: 13361-13368 (1992)!, human mGluR5-encoding cDNAs were successfully obtained from human cerebellum cDNA libraries. Thus, the distribution of some metabotropic glutamate receptor subtypes in humans and rats appears to be different.
The above-described nucleotide sequences can be incorporated into vectors for further manipulation. As used herein, vector (or plasmid) refers to discrete elements that are used to introduce heterologous DNA into cells for either expression or replication thereof. Selection and use of such vehicles are well within the skill of the artisan.
An expression vector includes vectors capable of expressing DNAs that are operatively linked with regulatory sequences, such as promoter regions, that are capable of regulating expression of such DNA fragments. Thus, an expression vector refers to a recombinant DNA or RNA construct, such as a plasmid, a phage, recombinant virus or other vector that, upon introduction into an appropriate host cell, results in expression of the cloned DNA. Appropriate expression vectors are well known to those of skill in the art and include those that are replicable in eukaryotic cells and/or prokaryotic cells and those that remain episomal or those which integrate into the host cell genome. Presently preferred plasmids for expression of invention metabotropic glutamate receptor subtypes in eukaryotic host cells, particularly mammalian cells, include cytomegalovirus (CMV) promoter-containing vectors such as pCMV-T7-2 and pCMV-T7-3 (see FIGS. 1 and 2), pcDNA1, and the like, as well as SV40 promoter-containing vectors and MMTV LTR promoter-containing vectors, such as pMMTVT7(+) or pMMTVT7(-) (modified versions of pMAMneo (Clontech, Palo Alto, Calif.), prepared as described herein), and the like.
As used herein, a promoter region refers to a segment of DNA that controls transcription of DNA to which it is operatively linked. The promoter region includes specific sequences that are sufficient for RNA polymerase recognition, binding and transcription initiation. This portion of the promoter region is referred to as the promoter. In addition, the promoter region includes sequences that modulate this recognition, binding and transcription initiation activity of RNA polymerase. These sequences may be cis acting or may be responsive to trans acting factors. Promoters, depending upon the nature of the regulation, may be constitutive or regulated. Exemplary promoters contemplated for use in the practice of the present invention include the SV40 early promoter, the cytomegalovirus (CMV) promoter, the mouse mammary tumor virus (MMTV) steroid-inducible promoter, Moloney murine leukemia virus (MMLV) promoter, and the like.
As used herein, the term "operatively linked" refers to the functional relationship of DNA with regulatory and effector sequences of nucleotides, such as promoters, enhancers, transcriptional and translational stop sites, and other signal sequences. For example, operative linkage of DNA to a promoter refers to the physical and functional relationship between the DNA and the promoter such that the transcription of such DNA is initiated from the promoter by an RNA polymerase that specifically recognizes, binds to and transcribes the DNA. In order to optimize expression and/or in vitro transcription, it may be necessary to remove, add or alter 5' and/or 3' untranslated portions of the clones to eliminate extra, potentially inappropriate alternative translation initiation (i.e., start) codons or other sequences that may interfere with or reduce expression, either at the level of transcription or translation. Alternatively, consensus ribosome binding sites (see, for example, Kozak (1991) J. Biol. Chem. 266:19867-19870) can be inserted immediately 5' of the start codon and may enhance expression. Likewise, alternative codons, encoding the same amino acid, can be substituted for coding sequences of the metabotropic glutamate receptor subunits in order to enhance transcription (e.g., the codon preference of the host cells can be adopted, the presence of G-C rich domains can be reduced, and the like). Furthermore, for potentially enhanced expression of metabotropic glutamate receptor subunits in amphibian oocytes, the subunit coding sequence can optionally be incorporated into an expression construct wherein the 5'- and 3'-ends of the coding sequence are contiguous with Xenopus .beta.-globin gene 5' and 3' untranslated sequences, respectively. For example, metabotropic glutamate receptor subunit coding sequences can be incorporated into vector pSP64T (see Krieg and Melton (1984) in Nucleic Acids Research 12:7057-7070), a modified form of pSP64 (available from Promega, Madison, Wis.). The coding sequence is inserted between the 5' end of the P-globin gene and the 3' untranslated sequences located downstream of the SP6 promoter. In vitro transcripts can then be generated from the resulting vector. The desirability of (or need for) such modifications may be empirically determined.
As used herein, expression refers to the process by which polynucleic acids are transcribed into mRNA and translated into peptides, polypeptides, or proteins. If the polynucleic acid is derived from genomic DNA, expression may, if an appropriate eukaryotic host cell or organism is selected, include splicing of the mRNA.
Particularly preferred base vectors which contain regulatory elements that can be linked to human metabotropic receptor-encoding DNAs for transfection of mammalian cells are cytomegalovirus (CMV) promoter-based vectors such as pCMV-T7-2 and pCMV-T7-3 (described herein) or pcDNA1 (Invitrogen, San Diego, Calif.), MMTV promoter-based vectors such as pMMTVT7(+) or pMMTVT7(-) (as described herein), and SV40 promoter-based vectors such as pSVp (Clontech, Palo Alto, Calif.).
Full-length DNAs encoding human metabotropic glutamate receptor subtypes have been inserted into vectors pMMTVT7(+), pMMTVT7(-) pCMV-T7-2 or pCMV-T7-3. pCMV-T7-2 (and pCMV-T7-3) are pUCl9-based mammalian cell expression vectors containing the CMV promoter/enhancer, SV40 splice/donor sites located immediately downstream of the promoter, a T7 bacteriophage RNA polymerase promoter positioned downstream of the splice sites, followed by an SV40 polyadenylation signal and a polylinker between the T7 promoter and the polyadenylation signal. Placement of metabotropic glutamate receptor subtype DNA between the CMV promoter and SV40 polyadenylation signal should provide for constitutive expression of the foreign DNA in a mammalian host cell transfected with the construct.
Vectors pMMTVT7(+) and pMMTVT7(-) were prepared by modifying vector pMAMneo (Clontech, Palo Alto, Calif.). pMAMneo is a mammalian expression vector that contains the Rous Sarcoma Virus (RSV) long terminal repeat (LTR) enhancer, linked to the dexamethasone-inducible mouse mammary tumor virus (MMTV)-LTR promoter, followed by SV40 splicing and polyadenylation sites. pMAMneo also contains the E. coli neo gene for selection of transformants, as well as the .beta.-lactamase gene (encoding a protein which imparts ampicillin-resistance) for propagation in E. coli.
Vector pMMTVT7(+) can be generated by modification of pMAMneo to remove the neo gene and insert the multiple cloning site and T7 and T3 promoters from pBluescript (Stratagene, La Jolla, Calif.). Thus, pMMTVT7(+) contains the RSV-LTR enhancer linked to the MMTV-LTR promoter, a T7 bacteriophage RNA polymerase promoter positioned downstream of the MMTV-LTR promoter, a polylinker positioned downstream of the T7 promoter, a T3 bacteriophage RNA polymerase promoter positioned downstream of the T7 promoter, and SV40 splicing and polyadenylation sites positioned downstream of the T3 promoter. The .beta.-lactamase gene (encoding a protein which imparts ampicillin-resistance) from pMAMneo is retained in pMMTVT7(+), although it is incorporated in the reverse orientation relative to the orientation in pMAMneo.
Vector pMMTVT7(-) is identical to pMMTVT7(+) except that the positions of the T7 and T3 promoters are switched, i.e., the T3 promoter in pMMTVT7(-) is located where the T7 promoter is located in pMMTVT7(+), and the T7 promoter in pMMTVT7(-) is located where the T3 promoter is located in pMMTVT7(+). Therefore, vectors pMMTVT7(+) and pMMTVT7(-) contain all of the regulatory elements required for expression of heterologous DNA in a mammalian host cell, wherein the heterologous DNA has been incorporated into the vectors at the polylinker. In addition, because the T7 and T3 promoters are located on either side of the polylinker, these plasmids can be used for synthesis of in vitro transcripts of heterologous DNA that has been subcloned into the vectors at the polylinker.
For inducible expression of human metabotropic glutamate receptor subtype-encoding DNA in a mammalian cell, the DNA can be inserted into a plasmid such as pMMTVT7(+) or pMMTVT7(-). These plasmids contain the mouse mammary tumor virus (MMTV) LTR promoter for steroid-inducible expression of operatively associated foreign DNA. If the host cell does not express endogenous glucocorticoid receptors required for uptake of glucocorticoids (i.e., inducers of the MMTV LTR promoter) into the cell, it is necessary to additionally transfect the cell with DNA encoding the glucocorticoid receptor (ATCC accession no. 67200). For synthesis of in vitro transcripts, full-length human DNA clones encoding human mGluRl, mGluR3 and mGluR5 can also be subcloned into pIBI24 (International Biotechnologies, Inc., New Haven, Conn.), pCMV-T7-2 or pCMV-T7-3 (see FIGS. 1 and 2), pMMTVT7(+), pMMTVT7(-), pBluescript (Stratagene, La Jolla, Calif.), pGEM7Z (Promega, Madison, Wis.), or the like.
In accordance with another embodiment of the present invention, there are provided cells containing the above-described polynucleic acids (i.e., DNA or mRNA). Such host cells as bacterial, yeast and mammalian cells can be used for replicating DNA and producing metabotropic glutamate receptor subtype(s). Methods for constructing expression vectors, preparing in vitro transcripts, transfecting DNA into mammalian cells, injecting oocytes, and performing electrophysiological and other analyses for assessing receptor expression and function as described herein are also described in PCT Application Nos. PCT/US91/05625 and PCT/US92/11090, and in co-pending U.S. application Ser. Nos. 07/563,751 and 07/812,254. The subject matter of these documents is hereby incorporated by reference herein in their entirety.
Incorporation of cloned DNA into a suitable expression vector, transfection of eukaryotic cells with a plasmid vector or a combination of plasmid vectors, each encoding one or more distinct genes or with linear DNA, and selection of transfected cells are well known in the art (see, e.g., Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press). Heterologous DNA may be introduced into host cells by any method known to those of skill in the art, such as transfection with a vector encoding the heterologous DNA by CaPO.sub.4 precipitation (see, e.g., Wigler et al. (1979) Proc. Natl. Acad. Sci. 76:1373-1376). Recombinant cells can then be cultured under conditions whereby the subtype(s) encoded by the DNA is (are) expressed. Preferred cells include mammalian cells (e.g., HEK293, CHO and Ltk cells), yeast cells (e.g., methylotrophic yeast cells, such as Pichia pastoris), bacterial cells (e.g., Escherichia coli), and the like.
While the DNA provided herein may be expressed in any eukaryotic cell, including yeast cells (such as, for example, P. pastoris (see U.S. Pat. Nos. 4,882,279, 4,837,148, 4,929,555 and 4,855,231), Saccharomyces cerevisiae, Candida tropicalis, Hansenula polymorpha, and the like), mammalian expression systems, including commercially available systems and other such systems known to those of skill in the art which express G-proteins (either endogenously or recombinantly), for expression of DNA encoding the human metabotropic glutamate receptor subtypes provided herein are presently preferred. Xenopus oocytes are preferred for expression of in vitro mRNA transcripts of DNA encoding those human metabotropic receptor subtypes that are coupled to the PI hydrolysis/Ca.sup.++ signalling pathways. An endogenous inositol triphosphate second messenger-mediated pathway in oocytes permits functional expression of human metabotropic receptors in these cells. Oocytes expressing recombinant human metabotropic receptors respond to agonists via the oocyte G-protein-coupled IP.sub.3 generation pathway, which stimulates release of Ca.sup.++ from internal stores, and reportedly activates a chloride channel that can be detected as a delayed oscillatory current by voltage-clamp recording.
Host cells for functional recombinant expression of human metabotropic receptors preferably express endogenous or recombinant guanine nucleotide-binding proteins (i.e., G-proteins). G-proteins are a highly conserved family of membrane-associated proteins composed of .alpha., .beta. and .gamma. subunits. The a subunit, which binds GDP and GTP, differs in different G-proteins. The attached pair of .beta.and .gamma. subunits may or may not be unique; different .alpha. chains may be linked to an identical .beta..sub..gamma. pair or to different pairs �Linder and Gilman, Sci. Am. 267:56-65 (1992)!. More than 30 different cDNAs encoding G protein .alpha. subunits have been cloned �Simon et al., Science 252:802 (1991)!. Four different .beta. polypeptide sequences are known �Simon et al., Science 252:802 (1991)!. Three of five identified .gamma. cDNAs have been cloned �Hurley et al., PNAS U.S.A. 81:6948 (1984); Gautam et al., Science 244:971 (1989); and Gautam et al., PNAS U.S.A. 87:7973 (1990)!. The sequences of a fourth .gamma. cDNA �Kleuss et al., Science 259:832 (1993)! and a fifth cDNA �Fisher and Aronson, Mol. Cell. Bio. 12:1585 (1992)! have been established, and additional .gamma. subtypes may exist �Tamir et al., Biochemistry 30:3929 (1991)!. G-proteins switch between active and inactive states by guanine nucleotide exchange and GTP hydrolysis. Inactive G protein is stimulated by a ligand-activated receptor to exchange GDP for GTP. In the active form, the .alpha. subunit, bound to GTP, dissociates from the .beta..gamma. complex, and the subunits then interact specifically with cellular effector molecules to evoke a cellular response. Because different G-proteins can interact with different effector systems (e.g., phospholipase C, adenyl cyclase systems) and different receptors, it is useful to investigate different host cells for expression of different recombinant human metabotropic receptor subtypes. Alternatively, host cells can be transfected with G-protein subunit-encoding DNAs for heterologous expression of differing G proteins.
In preferred embodiments, human metabotropic glutamate receptor subtype-encoding DNA is ligated into a vector, and introduced into suitable host cells to produce transformed cell lines that express a specific human metabotropic glutamate receptor subtype, or specific combinations of subtypes. The resulting cell lines can then be produced in quantity for reproducible quantitative analysis of the effects of known or potential drugs on receptor function. In other embodiments, mRNA may be produced by in vitro transcription of DNA encoding each subtype. This mRNA, either from a single subtype clone or from a combination of clones, can then be injected into Xenopus oocytes where the mRNA directs the synthesis of functional human metabotropic glutamate receptor subtypes. Alternatively, the subtype-encoding DNA can be directly injected into oocytes for expression of functional human metabotropic glutamate receptor subtypes. The transfected mammalian cells or injected oocytes may then be used in the methods of drug screening provided herein.
Eukaryotic cells in which DNA or RNA may be introduced include any cells that are transfectable by such DNA or RNA or into which such DNA or RNA may be injected and which cells express (endogenously or recombinantly) G-proteins. Preferred cells are those that express little, if any, endogenous metabotropic receptors and can be transiently or stably transfected and also express invention DNA and RNA. Presently most preferred cells are those that can form recombinant or heterologous human metabotropic glutamate receptors comprising one or more subtypes encoded by the heterologous DNA. Such cells may be identified empirically or selected from among those known to be readily transfected or injected.
Exemplary cells for introducing DNA include cells of mammalian origin (e.g., COS cells, mouse L cells, Chinese hamster ovary (CHO) cells, human embryonic kidney (HEK) cells, African green monkey cells and other such cells known to those of skill in the art), amphibian cells (e.g., Xenopus laevis oocytes), yeast cells (e.g., Saccharomyces cerevisiae, Pichia pastoris), and the like. Exemplary cells for expressing injected RNA transcripts include Xenopus laevis oocytes. Cells that are preferred for transfection of DNA are known to those of skill in the art or may be empirically identified, and include HEK293 (which are available from ATCC under accession #CRL 1573); Ltk cells (which are available from ATCC under accession #CCL1.3); COS-7 cells (which are available from ATCC under accession #CRL 1651); CHO cells (which are available from ATCC under accession #CRL9618, CCL61 or CRL9096); DG44 cells (dhfr CHO cells; see, e.g., Urlaub et al. (1986) Cell. Molec. Genet. 12: 555); and BHK cells (see Waechter and Baserga, PNAS U.S.A. 79:1106-1110 (1982); also available from ATCC under accession #CRL10314). Presently preferred cells include CHO cells and HEK293 cells, particularly HEK293 cells that can be frozen in liquid nitrogen and then thawed and regrown (for example, those described in U.S. Patent No. 5,024,939 to Gorman (see, also, Stillman et al. (1985) Mol. Cell. Biol. 5:2051-2060)), DG44, Ltk cells, and the like. Those of skill in the art recognize that comparison experiments should also be carried out with whatever host cells are employed to determine background levels of glutamate production induced by the ligand employed, as well as background levels of glutamate present in the host cell in the absence of ligand.
DNA may be stably incorporated into cells or may be transiently expressed using methods known in the art. Stably transfected mammalian cells may be prepared by transfecting cells with an expression vector having a selectable marker gene (such as, for example, the gene for thymidine kinase, dihydrofolate reductase, neomycin resistance, and the like), and growing the transfected cells under conditions selective for cells expressing the marker gene. To prepare transient transfectants, mammalian cells are transfected with a reporter gene (such as the E. coli .beta.-galactosidase gene) to monitor transfection efficiency. Selectable marker genes are typically not included in the transient transfections because the transfectants are typically not grown under selective conditions, and are usually analyzed within a few days after transfection.
To produce such stably or transiently transfected cells, the cells should be transfected with a sufficient concentration of subtype-encoding nucleic acids to form human metabotropic glutamate receptors indicative of the human subtypes encoded by the heterologous DNA. The precise amounts of DNA encoding the subtypes may be empirically determined and optimized for a particular subtype, cells and assay conditions. Recombinant cells that express metabotropic glutamate receptors containing subtypes encoded only by the heterologous DNA or RNA are especially preferred.
Heterologous DNA may be maintained in the cell as an episomal element or may be integrated into chromosomal DNA of the cell. The resulting recombinant cells may then be cultured or subcultured (or passaged, in the case of mammalian cells) from such a culture or a subculture thereof. Methods for transfection, injection and culturing recombinant cells are known to the skilled artisan. Similarly, the human metabotropic glutamate receptor subtypes may be purified using protein purification methods known to those of skill in the art. For example, antibodies or other ligands that specifically bind to one or more subtypes may be used for affinity purification of a given metabotropic glutamate receptor subtype.
As used herein, heterologous or foreign DNA and RNA are used interchangeably and refer to DNA or RNA that does not occur naturally as part of the genome of the cell in which it is present or to DNA or RNA which is found in a location or locations in the genome that differ from that in which it occurs in nature. Typically, heterologous or foreign DNA and RNA refers to DNA or RNA that is not endogenous to the host cell and has been artificially introduced into the cell. Examples of heterologous DNA include DNA that encodes a human metabotropic glutamate receptor subtype, DNA that encodes RNA or proteins that mediate or alter expression of endogenous DNA by affecting transcription, translation, or other regulatable biochemical processes, and the like. The cell that expresses heterologous DNA may contain DNA encoding the same or different expression products. Heterologous DNA need not be expressed and may be integrated into the host cell genome or maintained episomally.
Those of skill in the art can readily identify a variety of assays which can be used to detect the expression of functional mGluRs. Examples include PI turnover assays �see, e.g., Nakajima et al., J. Biol. Chem. 267:2437-2442 (1992) and Example 3.C.2!, cAMP assays �see, e.g., Nakajima et al., supra and Example 3.C.4.!, calcium ion flux assays �see, e.g., Ito et al., J. Neurochem. 56:531-540 (1991) and Example 3.C.1!, cGMP assays �see, e.g., Steiner et al., J. Biol. Chem 247:1106-1113 (1972)!, arachidonic acid release assays �see, e.g., Felder et al., J. Biol. Chem. 264:20356-20362 (1989)!, and the like. In addition, cation-based assays (as described herein) can be employed for monitoring receptor-induced changes in intracellular cyclic nucleotide levels. Such assays employ host cells expressing cyclic nucleotide-gated ion channels. These channels, which occur in, for example, rod photoreceptor cells, olfactory cells and bovine kidney cells (see, for example, Kaupp et al., in Nature 342:762-766 (1989), Dhallen et al., in Nature 347:184-187 (1990) and Biel et al., in Proc. Natl. Acad. Sci. USA 91:3505-3509 (1994), are permeable to cations upon activation by binding of cAMP or cGMP. Thus, in the invention assay, host cells expressing endogenous or recombinant cyclic nucleotide-gated channels are transfected (or injected) with nucleic acids encoding receptors suspected of influencing cyclic nucleotide levels (e.g., metabotropic glutamate receptor-encoding DNA), and then monitored for changes in the amount of cyclic nucleotide activation of the channels. Measuring changes in cyclic nucleotide activation of channels allows one to indirectly identify as functional those receptors that cause a change in cAMP or cGMP levels when activated. The change in the amount of activation of the cyclic nucleotide-gated channels can be determined by measuring ion flux through the channel either by electrophysiological measurement of currents or by measuring a change in intracellular cation levels (e.g., by fluorescence measurement of intracellular calcium).
In assays of cells expressing receptor species that cause a decrease in cyclic nucleotides upon activation (e.g., some metabotropic glutamate receptors), it may be preferable to expose the cells to agents that increase intracellular levels of cyclic nucleotides (e.g., forskolin and IBMX) prior to adding a receptor-activating compound to the cells in the assay.
Host cells suitable for use in the above-described assay include any host cells suitable for expression of the receptor being studied (e.g., L cells, HEK293 cells, CHO, cells or Xenopus oocytes for assays of metabotropic glutamate receptors). The cells can be sequentially transfected (or injected) with nucleic acids encoding a cyclic nucleotide-gated channel and receptor-encoding nucleic acids, or the cells can be co-transfected with the two nucleic acids. Transient or stable transfection, as described in Examples 3A and 3B, can be carried out.
Cells transfected (or injected) with cyclic nucleotide-gated channel nucleic acid are incubated (typically for .about.24-48 hours) before testing for function. The activity of the channels can be assessed using inside-out membrane patches pulled from the transfected cells (so that the concentration of cAMP reaching the cytoplasmic face can be controlled). The transfectants can also be analyzed by single-cell video imaging of internal calcium levels (�Ca.sup.++ !.sub.i). This method allows analysis of cyclic nucleotide-gated channel activity by measurement of intracellular calcium levels, which change with the amount of calcium influx through the channel, as regulated by cyclic nucleotide activation of the channel. The imaging assay can be conducted essentially as described in Example 3.C.4.b.
The DNA, mRNA, vectors, receptor subtypes, and cells provided herein permit production of selected metabotropic glutamate receptor subtypes, as well as antibodies to said receptor subtypes. This provides a means to prepare synthetic or recombinant receptors and receptor subtypes that are substantially free of contamination from many other receptor proteins whose presence can interfere with analysis of a single metabotropic glutamate receptor subtype. The availability of desired receptor subtypes makes it possible to observe the effect of a drug substance on a particular receptor subtype or combination of metabotropic glutamate receptor subtypes, and to thereby perform initial in vitro screening of the drug substance in a test system that is specific for humans and specific for a human metabotropic glutamate receptor subtype or combination of metabotropic glutamate receptor subtypes. The availability of specific antibodies makes it possible to identify the subtype combinations expressed in vivo. Such specific combinations can then be employed as preferred targets in drug screening.
The ability to screen drug substances in vitro to determine the effect of the drug on specific receptor compositions should permit the development and screening of receptor subtype-specific or disease-specific drugs. Also, testing of single receptor subtypes or specific combinations of various receptor subtypes with a variety of potential agonists or antagonists provides additional information with respect to the function and activity of the individual subtypes and should lead to the identification and design of compounds that are capable of very specific interaction with one or more receptor subtypes. The resulting drugs should exhibit fewer unwanted side effects than drugs identified by screening with cells that express a variety of receptor subtypes.
Further in relation to drug development and therapeutic treatment of various disease states, the availability of DNAs encoding human metabotropic glutamate receptor subtypes enables identification of any alterations in such genes (e.g., mutations) which may correlate with the occurrence of certain disease states. In addition, the creation of animal models of such disease states becomes possible, by specifically introducing such mutations into synthetic DNA sequences which can then be introduced into laboratory animals or in vitro assay systems to determine the effects thereof.
In another aspect, the invention comprises functional peptide fragments, and functional combinations thereof, encoded by the DNAs of the invention. Such functional peptide fragments can be produced by those skilled in the art, without undue experimentation, by eliminating some or all of the amino acids in the sequence not essential for the peptide to function as a glutamate receptor. A determination of the amino acids that are essential for glutamate receptor function is made, for example, by systematic digestion of the DNAs encoding the peptides and/or by the introduction of deletions into the DNAs. The modified (e.g., deleted or digested) DNAs are expressed, for example, by transcribing the DNA and then introducing the resulting mRNA into Xenopus oocytes, where translation of the mRNAs will occur. Functional analysis of the proteins thus expressed in the oocytes is accomplished by exposing the oocytes to ligands known to bind to and functionally activate glutamate receptors, and then monitoring the oocytes to see if endogenous channels are in turn activated. If currents are detected, the fragments are functional as glutamate receptors.
In accordance with still another embodiment of the present invention, there is provided a method for identifying compounds which bind to human metabotropic glutamate receptor subtype(s), said method comprising employing receptor proteins of the invention in a competitive binding assay. Such an assay can accommodate the rapid screening of a large number of compounds to determine which compounds, if any, are capable of displacing specifically bound �.sup.3 H! glutamate, i.e., binding to metabotropic glutamate receptors. Subsequently, more detailed assays can be carried out with those compounds found to bind, to further determine whether such compounds act as modulators, agonists or antagonists of invention receptors.
Another application of the binding assay of the invention is the assay of test samples (e.g., biological fluids) for the presence or absence of receptors of the present invention. Thus, for example, serum from a patient displaying symptoms related to glutamatergic pathway dysfunction can be assayed to determine if the observed symptoms are perhaps caused by over- or under-production of such receptor subtype(s).
The binding assays contemplated by the present invention can be carried out in a variety of ways, as can readily be identified by those of skill in the art. For example, competitive binding assays can be employed, such as radioreceptor assays, and the like.
In accordance with a further embodiment of the present invention, there is provided a bioassay for identifying compounds which modulate the activity of human metabotropic glutamate receptor subtypes of the invention, said bioassay comprising:
(a) exposing cells containing DNA encoding human metabotropic glutamate receptor subtype(s), wherein said cells express functional metabotropic glutamate receptors, to at least one compound whose ability to modulate the activity of said receptors is sought to be determined; and thereafter
(b) monitoring said cells for changes in second messenger activity.
The above-described bioassay enables the identification of agonists, antagonists and allosteric modulators of human metabotropic glutamate receptors. According to this method, recombinant metabotropic glutamate receptors are contacted with an "unknown" or test substance (in the further presence of a known metabotropic glutamate agonist, when antagonist activity is being tested), the second messenger activity of the known glutamate receptor is monitored subsequent to the contact with the "unknown" or test substance, and those substances which increase or decrease the second messenger response of the known glutamate receptor(s) are identified as functional ligands (i.e., modulators, agonists or antagonists) for human metabotropic glutamate receptors. Second messenger activities which can be monitored include changes in the concentration of intracellular calcium ions, IP.sub.3, cAMP levels, or monitoring of arachidonic acid release or activation or inhibition of ion current (when the host cell is an oocyte).
In accordance with a particular embodiment of the present invention, recombinant human metabotropic glutamate receptor-expressing mammalian cells or oocytes can be contacted with a test compound, and the modulating effect(s) thereof can then be evaluated by comparing the metabotropic glutamate receptor-mediated response in the presence and absence of test compound, or by comparing the metabotropic glutamate receptor-mediated response of test cells, or control cells (i.e., cells that do not express metabotropic glutamate receptors), to the presence of the compound.
As used herein, a compound or signal that "modulates the activity of a metabotropic glutamate receptor subtype" refers to a compound or signal that alters the activity of metabotropic glutamate receptors so that activity of the metabotropic glutamate receptor is different in the presence of the compound or signal than in the absence of the compound or signal. In particular, such compounds or signals include agonists and antagonists. The term agonist refers to a substance or signal, such as glutamate or ACPD, that activates receptor function; and the term antagonist refers to a substance that blocks agonist-induced receptor activation. Antagonists include competitive and non-competitive antagonists. A competitive antagonist (or competitive blocker) interacts with or near the site specific for the agonist (e.g., ligand or neurotransmitter) for the same or closely situated site. A non-competitive antagonist or blocker inactivates the functioning of the receptor by interacting with a site other than the site that interacts with the agonist.
As understood by those of skill in the art, assay methods for identifying compounds that modulate human metabotropic glutamate receptor activity (e.g., agonists and antagonists) generally require comparison to a control. One type of a "control" cell or "control" culture is a cell or culture that is treated substantially the same as the cell or culture exposed to the test compound, except the control culture is not exposed to test compound. For example, in methods that use voltage clamp electrophysiological procedures, the same cell can be tested in the presence and absence of test compound, by merely changing the external solution bathing the cell. Another type of "control" cell or "control" culture may be a cell or a culture of cells which are identical to the transfected cells, except the cells employed for the control culture do not express the recombinant human metabotropic glutamate receptor subtype(s) expressed in the transfected cells. In this situation, the response of test cell to test compound is compared to the response (or lack of response) of receptor-negative (control) cell to test compound, when cells or cultures of each type of cell are exposed to substantially the same reaction conditions in the presence of compound being assayed.
In accordance with yet another embodiment of the present invention, the second messenger activity of human metabotropic glutamate receptors can be modulated by contacting such receptors with an effective amount of at least one compound identified by the above-described bioassay.
In accordance with yet another embodiment of the present invention, there are provided antibodies generated against the above-described receptor proteins. Such antibodies can be employed for studying receptor tissue localization, subtype composition, structure of functional domains, purification of receptors, as well as in diagnostic applications, therapeutic applications, and the like. Preferably, for therapeutic applications, the antibodies employed will be monoclonal antibodies.
The above-described antibodies can be prepared employing standard techniques, as are well known to those of skill in the art, using the invention receptor proteins or portions thereof as antigens for antibody production. Both anti-peptide and anti-fusion protein antibodies can be used �see, for example, Bahouth et al. (1991) Trends Pharmacol Sci. vol. 12:338-343; Current Protocols in Molecular Biology (Ausubel et al., eds.) John Wiley and Sons, New York (1989)!. Factors to consider in selecting portions of the metabotropic glutamate receptor subtypes for use as immunogen (as either a synthetic peptide or a recombinantly produced bacterial fusion protein) include antigenicity, accessibility (i.e., extracellular and cytoplasmic domains), uniqueness to the particular subtype, etc.
The availability of subtype-specific antibodies makes possible the application of the technique of immunohistochemistry to monitor the distribution and expression density of various subtypes (e.g., in normal vs diseased brain tissue). Such antibodies could also be employed for diagnostic and therapeutic applications.
In accordance with still another embodiment of the present invention, there are provided methods for modulating the ion channel activity of receptor(s) of the invention by contacting said receptor(s) with an effective amount of the above-described antibodies.
The antibodies of the invention can be administered to a subject employing standard methods, such as, for example, by intraperitoneal, intramuscular, intravenous, or subcutaneous injection, implant or transdermal modes of administration, and the like. One of skill in the art can readily determine dose forms, treatment regiments, etc, depending on the mode of administration employed.
In accordance with a still further embodiment of the present invention, there is provided a cation-based bioassay for monitoring receptor-induced changes in intracellular cyclic nucleotide levels, said bioassay comprising:
introducing nucleic acids encoding receptors suspected of influencing intracellular cyclic nucleotide levels into host cells expressing endogenous or recombinant cyclic nucleotide-gated channels, and
monitoring changes in the amount of cyclic nucleotide activation of said cyclic nucleotide-gated channels in the presence and absence of ligand for said receptor suspected of influencing intracellular cyclic nucleotide levels.
The invention will now be described in greater detail by reference to the following non-limiting examples.
EXAMPLE 1
Isolation of DNA Encoding Human Metabotropic Glutamate Receptors
A. mGluR5 Receptor cDNA cDNA Library Screening
RNA isolated from human hippocampus tissue was used as a template for the synthesis of oligo dt-primed, single-stranded cDNA according to standard procedures �see, for example, Gubler and Hoffman (1983) Gene 25:263-269!. The single-stranded cDNA was converted to double-stranded cDNA, and EcoRI/SnaBI/XhoI adaptors were added to the ends of the cDNAs. The cDNAs were separated by size using agarose gel electrophoresis, and those that were >2.5 kb were ligated into EcoRI-digested .lambda.gt10 bacteriophage vectors. The resulting primary human hippocampus cDNA library (.about.2.times.10.sup.5 recombinants) was screened for hybridization to a fragment of the DNA encoding the rat mGluR1 receptor (nucleotides 1 to 1723 plus 5' untranslated sequence; see Masu et al. (1991) Nature 349:760-765). Hybridization was performed in 5.times.SSPE, 5.times.Denhart's solution, 50% formamide, 0.2% SDS, 200 .mu.g/ml denatured, sonicated herring sperm DNA at 42.degree. C. and washes were performed in 1.0.times.SSPE, 0.2% SDS at 65.degree. C. One hybridizing plaque, METAB1, was identified which contains a 3273 bp insert.
To obtain additional human mGluR5-encoding clones, METAB1 was radiolabeled and used to screen two human cerebellum cDNA libraries prepared as follows. cDNA was synthesized using random primers to prime first-strand cDNA synthesis from RNA isolated from human cerebellum tissue. The cDNAs were pooled based on length and two libraries were generated: one with inserts greater than 2.8 kb in length (i.e., a large-insert library) and one with inserts 1-2.8 kb in length (i.e., a medium-insert library). The libraries (1.times.10.sup.6 recombinants in each) were screened for hybridization to the METAB1 probe using the same hybridization conditions as used for screening the hippocampus library for hybridization to the rat mGluR1 DNA fragment. Washes were performed in 1.times.SSPE, 0.2% SDS at 55.degree. C. One hybridizing plaque, METAB2, was identified in the large-insert library, whereas four hybridizing plaques, METAB3-METAB6, were identified in the medium-insert library.
In another round of screening for human mGluR5-encoding DNAs, a randomly primed human hippocampus cDNA library (2.times.10.sup.6 recombinants) containing inserts ranging in size from 1-2 kb and the medium-insert cerebellum cDNA library were screened for hybridization to radiolabeled METAB5 using the same conditions as those used in screening the large- and medium-insert cerebellum libraries with METAB1. Three hybridizing plaques (METAB10-METAB12) were identified in the hippocampus library and five additional hybridizing plaques (METAB13-METAB17) were identified in another primary screening of the cerebellum library. Selected plaques were purified.
Characterization of Isolated Clones
Characterization of the inserts of the purified plaques by restriction enzyme mapping and DNA sequence analysis revealed that at least three apparent splice variants of the human mGluR5 transcript were represented by the isolated clones. Analysis of METAB1 indicated that it contains a translation initiation codon but no translation termination codon. The deduced amino acid sequence is .about.70% identical to the rat mGluRl deduced amino acid sequence, but >90% identical to the rat mGluR5 deduced amino acid sequence �Abe et al. (1992) J. Biol. Chem. 267:13361-13368!.
DNA sequence analysis of METAB5 showed that it overlaps the 3' end of METAB1 at the 5' end and continues for an additional 343 nucleotides in the 3' direction. Comparison of the overlapping regions of METAB1 and METAB5 revealed that METAB1 contains 96 nucleotides that are not present in METAB5 (i.e., METAB1 contains a 96-nucleotide insertion relative to METAB5). METAB5 also does not contain a translation termination codon. The insert of METAB12 overlaps the 3' end of METAB5 at the 5' end, however, and extends farther in the 3' direction to include a translation termination codon.
DNA sequence analysis of METAB2 showed that the first 869 nucleotides at the 5' end overlap, and are identical to a portion of the 3' end of METAB1; however, the sequences of METAB1 and METAB2 diverge at the beginning of the 96-nucleotide insertion of METAB1. METAB2 extends approximately 2700 nucleotides in the 3' direction and contains a putative translation termination codon 4 nucleotides 3' of the point of divergence with METAB1.
Partial DNA sequence analysis of METAB14 indicated that it encodes a portion of another human metabotropic receptor, mGluRl (see Example 1.B.).
Preparation of Full-Length mGluR5 cDNA Constructs
Full-length constructs representing three putative splice variants of the human mGluR5 transcript, designated mGluR5a, mGluR5b and mGluR5c, can be generated and incorporated into expression vectors for use in preparing in vitro transcripts of the cDNAs and/or expression of the cDNAs in mammalian cells. The base expression vector typically used is pCMV-T7-3 or pCMV-T7-2 (see FIGS. 1 and 2). Plasmid pCMV-T7-3 is a pUC19-based vector that contains a cytomegalovirus (CMV) promoter/enhancer, SV40 splice donor/splice acceptor sites located immediately downstream of the promoter, a T7 bacteriophage RNA polymerase promoter positioned downstream of the SV40 splice sites, an SV40 polyadenylation signal downstream of the T7 promoter, and a polylinker between the T7 promoter and the polyadenylation signal. This vector thus contains all the regulatory elements required for expression of heterologous DNA in a mammalian host cell, wherein the heterologous DNA has been incorporated into the vector at the polylinker. In addition, because the T7 promoter is located just upstream of the polylinker, this plasmid can be used for synthesis of in vitro transcripts of heterologous DNA that has been subcloned into the vector at the polylinker. pCMV-T7-3 and pCMV-T7-2 differ only in the orientation of the restriction sites in the polylinker.
To prepare a full-length mGluR5a construct (see Sequence ID No. 7), portions of clones METAB1, METAB5, and METAB12 were ligated together. Initially, the inserts of METAB1, METAB5 and METAB12 were separately transferred from .lambda.gt10 as EcoRI fragments into EcoRI-digested pGEM-7Zf (Promega, Madison, Wis.) for ease of manipulation. The pGEM-7Zf vector containing the METAB1 insert was digested with ScaI/NheI to release a 3.8 kb fragment containing the 5' half of the ampicillin resistance gene and a 5' portion of the METAB1 insert (nucleotides 1-2724 of Sequence ID No. 7). The pGEM-7Zf vector containing the insert of METAB5 was digested with ScaI/NheI to release a 2.6 kb fragment containing the 3' half of the ampicillin resistance gene and a 3' portion of METAB5 (nucleotides 2725-3469 of Sequence ID No. 7), and this fragment was ligated with the 3.8 kb fragment from the pGEM-7Zf vector containing METAB1 to create pGEM-METAB1+5. pGEM-METAB1+5 was digested with ScaI/NotI to release a 4.4 kb fragment containing the 5' half of the ampicillin resistance gene and nucleotides 1-3316 of Sequence ID No. 7. This 4.4 kb fragment was then ligated with a 2.6 kb fragment obtained by ScaI/NotI (partial) digestion of the pGEM-7Zf vector containing the METAB12 insert �the 2.6 kb fragment contains the 3' half of the ampicillin resistance gene and a 3' portion of METAB12 (nucleotides 3317-4085 of Sequence ID No. 7)!. The resulting vector contained the complete mGluR5a coding sequence in pGEM-7Zf. The full-length mGluR5a cDNA was isolated from the vector as an AatII (blunt-ended)-HindIII fragment and subcloned into NotI (blunt-ended)/HindIII-digested pCMV-T7-3 to generate construct mGluR5a1.
In summary, construct mGluR5a1 contains 369 bp of 5' untranslated sequence from METAB1 (nucleotides 1-369 of Sequence ID No. 7) and a complete coding sequence (nucleotides 370-3912 of Sequence ID No. 7) for the mGluR5a variant of the mGluRS receptor, as well as 173 bp of 3' untranslated sequence (nucleotides 3913-4085 of Sequence ID No. 7). The mGluR5a-encoding sequence is operatively linked to the regulatory elements in pCMV-T7-3 for use in expressing the receptor in mammalian host cells and for use in generating in vitro transcripts of the DNA to be expressed in Xenopus oocytes.
Two additional mGluR5a constructs (mGluR5a2 and mGluR5a3) were prepared by modification of the 5' untranslated region of the first mGluR5a construct. The above-described mGluR5a construct contains seven potentially inappropriate ATG translation initiation codons in the 5' untranslated region that precedes the proposed translation initiation codon (nucleotides 370 to 372 of Sequence ID No. 7). The mGluR5al construct was digested with Bal31 to accomplish the following: (1) remove 255 nucleotides of sequence (nucleotides 1-255 of Sequence ID No. 7, containing six of the seven upstream ATG triplets), thereby creating mGluR5a2 and (2) remove 348 nucleotides of sequence (nucleotides 1-348 of Sequence ID No. 7, containing all upstream ATG triplets), thereby creating mGluR5a3. Thus, mGluR5a2 is identical to mGluR5a1 except that it lacks some of the 5' untranslated sequence and thus contains only one ATG triplet upstream of the proposed translation initiation codon. Similarly, mGluR5a3 is identical to mGluR5a1 except that it lacks all of the ATG triplets upstream of the proposed translation initiation codon and contains only 21 nucleotides of 5' untranslated sequence.
A third mGluR5a construct, MMTV-hmGluR5a, was prepared for use in MMTV promoter-regulated expression of mGluR5a as follows. mGluR5a3 was digested with XbaI. The 4.1 kb fragment containing the SV40 splice sites, the full-length mGluR5a coding sequence (plus 21 nucleotides of 5' untranslated sequence and 173 nucleotides of 3' untranslated sequence) and the polyadenylation signal was isolated, blunt-ended and ligated to a 2 kb EcoRI-NdeI (blunt-ended) fragment of pBR322 to create pBR-hmGluR5. Vector pMAMneo (Clontech, Palo Alto, Calif.), which contains the MMTV LTR promoter, and ampicillin and neomycin resistance genes, was digested with BamHI, to remove the neomycin resistance gene, and allowed to religate. The vector was then digested with EcoRI, and the fragment containing the ampicillin resistance gene was religated with the larger vector fragment in the reverse orientation to create pMAMneo ampopp. This vector was digested with PstI/NheI, and the 2.3 kb fragment containing a 5' portion of the ampicillin resistance gene and the MMTV-LTR was isolated. Plasmid pBR-hmGluR5 was digested with PstI/XbaI, and the 5.3 kb fragment containing a 3' portion of the ampicillin resistance gene and the mGluR5a sequence (with SV40 splice sites and polyadenylation signal) was ligated with the 2.3 kb Pst/NheI fragment of pMAMneo ampopp to create MMTV-hmGluR5a.
Thus, pMMTV-hmGluR5a contains the MMTV-LTR followed by SV40 splice sites in operative linkage with the mGluR5a DNA (containing nucleotides 349-4085 of Sequence ID No. 7) followed by a polyadenylation signal.
A fourth mGluR5a construct, pSV-hmGluR5, was prepared for use in SV40 promoter-regulated expression of mGluR5a as follows. mGluR5a3 was partially digested with XhoI, treated with Klenow and allowed to religate to itself, thereby destroying the XhoI site located 3' of the mGluR5a DNA. The plasmid was then digested with ScaI/XhoI, generating a fragment containing the SV40 splice sites, the full-length mGluR5a coding sequence (plus 21 nucleotides of 5' untranslated sequence and 173 nucleotides of 3' untranslated sequence), the polyadenylation signal and a 3' portion of the ampicillin resistance gene. Plasmid pSV.beta. (Clontech, Palo Alto, Calif.) was digested with ScaI/XhoI, and the fragment containing a 5' portion of the ampicillin resistance gene and the SV40 early promoter was ligated to the ScaI/XhoI fragment containing the mGluR5a DNA to create pSV-hmGluR5. Thus, pSV-hmGluR5 contains the SV40 early promoter followed by SV40 splice sites in operative linkage with the mGluR5a DNA (containing nucleotides 349-4085 of Sequence ID No. 7) followed by a polyadenylation signal.
To prepare a full-length mGluR5b construct, an mGluR5a construct (mGluR5al, mGluR5a2 or mGluR5a3) was digested with NheI/PmlI to release a fragment containing nucleotides 2725-3020 of Sequence ID No. 7. The remaining vector fragment was then ligated to the NheI/PmlI fragment isolated from METAB1. The resulting vector, mGluR5b, is identical to the mGluR5a construct from which it was prepared, except that it includes a 96 bp insertion (nucleotides 3000-3095 of Sequence ID No. 9) located between nucleotides 2999 and 3000 of Sequence ID No. 7. Sequence ID No. 9 is the complete nucleotide sequence of the full-length mGluR5b cDNA prepared from vector mGluR5a1.
To prepare a full-length mGluR5c construct, an mGluR5a construct (mGluR5al, mGluR5a2 or mGluR5a3) is digested with NheI/HindIII (the HindIII site is present in the polylinker of the pCMV-T7-3 portion of the mGluR5a vector) to release a fragment containing nucleotides 2725-4085 of Sequence ID No. 7. The remaining vector fragment is then ligated to the NheI/HindIII fragment isolated from METAB2. The resulting full-length cDNA, mGluR5c (Sequence ID No. 11), is identical to the mGluR5a construct from which it was prepared for the first 2630 nucleotides of the coding sequence; however, at nucleotide 2631 of the coding sequence, the coding sequences of mGluR5c and mGluR5a diverge (e.g., beginning at nucleotide 3000 of Sequence ID No. 7) with the mGluR5c coding sequence having a guanine nucleotide as nucleotide 2631 of the coding sequence followed immediately by a translation termination codon (nucleotides 3001-3003 of Sequence ID No. 11).
B. mGluRl Receptor cDNA
cDNA Library Screening
The medium-insert cerebellum library was screened for hybridization to a fragment of the DNA encoding the rat mGluR1 receptor (nucleotides 1 to 3031 plus 5' untranslated sequence; see Masu et al. (1991) Nature 349:760-765). Hybridization was performed in 5.times.SSPE, 5.times.Denhart's solution, 50% formamide, 0.2% SDS, 200 .mu.g/ml denatured, sonicated herring sperm DNA at 42.degree. C. and washes were performed in 1.times.SSPE, 0.2% SDS at 55.degree. C. Three hybridizing plaques, METAB7-METAB9, were identified.
In a subsequent round of screening, an independent plating of 1.times.10.sup.6 recombinants of the human medium-insert cerebellum cDNA library was probed for additional human mGluRl clones. This plating was screened sequentially for hybridization first to a DNA fragment containing nucleotides 1-1256 (plus 5' untranslated sequence) of the rat mGluRl cDNA (i.e., a 5' probe) and then to a DNA fragment containing nucleotides 2075-3310 of the rat mGluRla cDNA (i.e., a 3' probe) using the same hybridization and wash conditions as those used in the previous screening that identified clones METAB7-METAB9. Three clones (METAB18, METAB21 and METAB22) were identified by hybridization to the 5' probe, and four clones (METAB14, METAB20, METAB32 and METAB35) were identified by hybridization to the 3' probe.
The 5' rat mGluRl fragment was used as a probe to screen the large-insert human cerebellum cDNA library for further mGluRl clones. Hybridization and wash conditions were essentially identical to those used in isolating the six mGluRl clones from the medium-insert cerebellum library(except 20% formamide was used in the hybridization solution). Three plaques, METAB58, METAB59 and METAB60, hybridized to the probe.
Characterization of Isolated Clones
The inserts of the purified plaques were characterized by restriction enzyme mapping and DNA sequence analysis. METAB58 is .about.2.8 kb and contains 5' untranslated sequence, a translation initiation codon and .about.2.3 kb of coding sequence. The 3' end of METAB58 overlaps the 5' end of METAB14. METAB14 extends .about.700 bp in the 3' direction and contains a translation termination codon. Thus, METAB58 and METAB14 overlap to encode a full-length mGluR1 receptor (see Sequence ID No. 1). The other clones are also partial mGluRl cDNAs that contain nucleotide sequences from the portion of the mGluRl coding sequence located between the translation initiation and termination codons.
To determine if additional clones encoding the 3' end of the human mGluRl transcript were present in human cDNA libraries, the cDNAs from the hippocampus/basal ganglia and cerebellum libraries were subjected to nucleic acid amplification. The 5' primer consisted of nucleotides 2218 to 2240 of Sequence ID No. 1 whereas the 3' primer was a degenerate oligonucleotide based on amino acids 890-897 of the rat mGluR1a coding sequence (see Pin et al. (1992) Neurobiology 89:10331-10335). The products of the amplification were analyzed by gel electrophoresis. A single product (i.e., a 500 bp fragment) was detected in only the hippocampus/basal ganglia library.
To obtain additional clones representing the 3' end of the mGluRl transcript, the hippocampus and cerebellum cDNA libraries can be screened (using conditions similar to those used for obtaining human mGluR1 cDNAs described above) with a fragment from the 3' end of the rat mGluR1a cDNA (e.g., the .about.2 kb NcoI/ClaI fragment of the rat mGluR1a cDNA). This probe corresponds to a portion of the 3' region of the mGluRl cDNA that does not appear to be alternatively spliced. Hybridizing clones are then analyzed by restriction mapping and DNA sequence analysis to determine if different 3' ends are represented.
Preparation of Full-Length mGluRl cDNA Constructs
To prepare a full-length construct encoding the B form of the human mGluRl receptor, portions of clones METAB58 and METAB14 are ligated. METAB58 is digested with EcoRI/AccI and the 2459 bp fragment containing nucleotides 154-2612 of Sequence ID No. 1 is isolated. The 704 bp fragment of METAB14 (containing nucleotides 2613-3321 of Sequence ID No. 1) is isolated by digestion of METAB14 with AccI/XhoI. This fragment is then ligated to the 2459 bp fragment of METAB58 and to EcoRI/SalI-digested vector pCMV-T7-3. The resulting construct encoding human mGluR1B contains 234 nucleotides of 5' untranslated sequence (nucleotides 154-387 of Sequence ID No. 1), the entire mGluR1B coding sequence (nucleotides 388-3108 of Sequence ID No. 1), and 213 nucleotides of 3' untranslated sequence (nucleotides 3109-3321 of Sequence ID No. 1). The mGluR1B-encoding sequence is operatively linked to the regulatory elements in pCMV-T7-3 for expression in mammalian cells.
Several methods can be employed to determine which mGluR5 and mGluRl receptor variants are actually expressed in various human tissues. For example, oligonucleotides specific for the nucleotide sequences located 5' and 3' of the insertions/deletions (i.e., regions of divergence) of mGluR transcripts described herein can be used to prime nucleic acid amplifications of RNA isolated from various tissues and/or cDNA libraries prepared from various tissues. The presence or absence of amplification products and the sizes of the products indicate which variants are expressed in the tissues. The products can also be characterized more thoroughly by DNA sequence analysis.
RNase protection assays can also be used to determine which variant transcripts are expressed in various tissues. These assays are a sensitive method for detecting and quantitating an RNA species in a complex mixture of total cellular RNA. A portion of the mGluR DNA is labeled and hybridized with cellular RNA. If complementary mRNA is present in the cellular RNA, a DNA-RNA hybrid results. The RNA sample is then treated with RNase, which degrades single-stranded RNA. Any RNA-DNA hybrids are protected from RNase degradation and can be visualized by gel electrophoresis and autoradiography.
Isolation of genomic clones containing human metabotropic receptor-encoding sequences by, for example, hybridization to the human mGluR cDNAs disclosed herein and subsequent characterization of the clones provides further information on possible splice variants of the mGluR primary transcripts.
C. mGluR3 Receptor cDNA
cDNA Library Screening
A human hippocampus cDNA library (generated using random primers to prime cDNA synthesis and then selecting cDNAs that were 1.0-2.8 kb for ligation to .lambda.gt10 vectors) was screened for hybridization to a 500 bp SmaI/XbaI fragment of the rat mGluR2 cDNA and a 3 kb AccI-BamHI fragment of the rat mGluR3 cDNA �see Tanabe et al. (1992) Neuron 8:169-179!. Hybridization was performed in 5.times.SSPE, 5.times.Denhart's solution, 50% formamide, 0.2% SDS, 200 g/ml denatured, sonicated herring sperm DNA at 42.degree. C. and washes were performed in 0.5.times.SSPE, 0.2% SDS at 65.degree. C. Three hybridizing plaques, METAB40, METAB41 and METAB45, were identified.
A portion of the 5' end of METAB45 (i.e., the first 244 bp; nucleotides 2634-2877 of Sequence ID No. 5) was then used to screen an amplified cerebellum library (generated using random primers to prime cDNA synthesis and then selecting cDNAs that were >2.8 kb for ligation to .lambda.gt10 vectors) and an amplified hippocampus cDNA library (generated using random primers to prime cDNA synthesis and then selecting cDNAs that were >2.0 kb for ligation to .lambda.gt10 vectors) for additional mGluR3 clones. One million clones from each library were screened. Hybridization and wash conditions were identical to those used in isolating METAB40, METAB41 and METAB45 from the hippocampus library. Three hybridizing plaques were identified in each library: METAB46, METAB49 and METAB50 in the cerebellum library and METAB47, METAB48 and METAB51B in the hippocampus library.
Characterization of Isolated Clones
The inserts of the purified plaques were characterized by restriction enzyme mapping and DNA sequence analysis. Each of the isolated clones are partial cDNAs encoding portions of the human mGluR3 receptor, except for clone METAB40, which encodes a portion of the human mGluR2 receptor (see Example l.D.). Clones METAB41, METAB45 and METAB47-49 contain sequence from the 3' end of the mGluR3 coding sequence as well as a translation termination codon. Clones METAB46, METAB50 and METAB51B contain sequence from the 5' end of the mGluR3 cDNA, including a translation initiation codon, and varying amounts of 5' untranslated sequence.
Preparation of Full-Length mGluR3 cDNA Constructs
Four constructs containing the full-length human mGluR3 coding sequence were prepared by ligating portions of METAB48 and METAB46 or METAB51B. The full-length coding sequence is provided in Sequence ID No. 5 (nucleotides 1064-3703). The inserts of clones METAB46 and METAB51B were separately subcloned into pCMV-T7-3 as EcoRI fragments. The insert of clone METAB48 was subcloned as an EcoRI fragment into pCMV-T7-2.
To generate construct mGluR3B, the pCMV-T7-3 plasmid containing the METAB51B insert was digested with ScaI/BglII, and the 2.6 kb fragment containing the 5' half of the ampicillin resistance gene and a 5' portion of the METAB51B insert (nucleotides 748-1671 of Sequence ID No. 5) was isolated. This fragment was ligated to a 4.3 kb fragment isolated from a ScaI/BglII digest of the pCMV-T7-2 plasmid harboring the insert of METAB48 �the 4.3 kb fragment contains the 3' half of the ampicillin resistance gene and a 3' portion of METAB48 (nucleotides 1672-3919 of Sequence ID No. 5)). The resulting construct, mGluR3B, contains 316 nucleotides of 5' untranslated sequence (nucleotides 748-1063 of Sequence ID No. 5), the entire mGluR3 coding sequence (nucleotides 1064-3703 of Sequence ID No. 5), and 216 nucleotides of 3' untranslated sequence (nucleotides 3704-3919 of Sequence ID No. 5). The mGluR3B-encoding sequence is operatively linked to the regulatory elements from vectors pCMV-T7-3 and pCMV-T7-2 for expression in mammalian cells.
To generate construct mGluR3C, the pCMV-T7-3 plasmid harboring the insert of METAB46 was digested with ScaI/BglII and the 3.4 kb fragment containing the 5' half of the ampicillin resistance gene and a 5' portion of METAB46 (nucleotides 1-1671 of Sequence ID No. 5) was isolated. This fragment was ligated to the same ScaI/BglII fragment of METAB48 as was used in construct mGluR3B. The resulting construct, mGluR3C, contains 1063 nucleotides of 5' untranslated sequence (nucleotides 1-1063 of Sequence ID No. 5), the entire mGluR3 coding sequence (nucleotides 1064-3703 of Sequence ID No. 5), and 216 nucleotides of 3' untranslated sequence (nucleotides 3704-3919 of Sequence ID No. 5). The mGluR3C-encoding sequence is operatively linked to the regulatory elements from vectors pCMV-T7-2 and pCMV-T7-3 for expression in mammalian cells.
Construct mGluR3A was generated by digesting mGluR3C with EcoRV and NotI to remove a fragment containing nucleotides 1-1035 of Sequence ID No. 5, making the NotI site blunt-ended and then allowing the larger vector fragment to re-ligate. Construct mGluR3A contains 28 nucleotides of 5' untranslated sequence (nucleotides 1036-1063 of Sequence ID No. 5), the entire mGluR3 coding sequence (nucleotides 1064-3703 of Sequence ID No. 5) and 216 nucleotides of 3' untranslated sequence (nucleotides 3704-3919 of Sequence ID No. 5). The mGluR3A-encoding sequence is operatively linked to the regulatory elements from vectors pCMV-T7-3 and pCMV-T7-2 for expression in mammalian cells.
To generate construct pSV-hmGluR3C (for use in SV40 promoter-regulated expression of mGluR3), the pCMV-T7-3 plasmid harboring the insert of METAB46 was digested with ScaI/NotI, and the fragment containing the 3' portion of the ampicillin resistance gene and the entire METAB46 insert was isolated. Plasmid pSV.beta. was digested with ScaI/NotI, and the fragment containing the 5' portion of the ampicillin resistance gene and the SV40 early promoter and splice sites was ligated to the ScaI/NotI fragment from the pCMV-T7-3 vector harboring METAB46 to create pSV-METAB46. Plasmid pSV-METAB46 was digested with ScaI/BglII and the fragment containing the 5' portion of the ampicillin resistance gene, the SV40 early promoter and splice sites and a 5' portion of METAB46 (nucleotides 1-1671 of Sequence ID No. 5) was isolated. This fragment was ligated to the same ScaI/BglII fragment of METAB48 as was used in constructs mGluR3B and mGluR3C. The resulting construct, pSV-hmGluR3C, contains the SV40 promoter followed by SV40 splice sites in operative linkage with the mGluR3 DNA (containing nucleotides 1-3919 of Sequence ID No. 5) followed by a polyadenylation signal.
D. mGluR2 Receptor cDNA
Clone METAB40 was isolated from a human hippocampus cDNA library as described in Example 1.C. The insert cDNA of METAB40 is 1100 bp in length and encodes the 3' end of a human mGluR2 receptor, including a translation termination codon and 3' untranslated sequence. The first 355 nucleotides of METAB40 are provided in Sequence ID No. 3; the last 343 nucleotides of METAB40 (which are all from the 3' untranslated sequence) are provided in Sequence ID No. 13).
To isolate clones containing DNA representing the 5' portion of the mGluR2 transcript, the human hippocampus cDNA library can be screened for hybridization to an oligonucleotide corresponding to the 5' end of METAB40. Hybridizing plaques are purified and characterized by DNA sequence analysis. Clones that overlap with METAB40 and contain a translation initiation codon can be ligated to METAB40 at appropriate restriction sites to generate a full-length mGluR2-encoding cDNA construct.
EXAMPLE 2
Expression of Recombinant Human Metabotropic Glutamate Receptors in Oocytes
Xenopus oocytes were injected with in vitro transcripts prepared from constructs containing DNA encoding human metabotropic receptors. Electrophysiological measurements of the oocyte transmembrane currents were made using the two-electrode voltage clamptechnique (see e.g., Stuhmer (1992) Meth. Enzymol. 207:319-339).
A. Preparation of In Vitro Transcripts
Recombinant capped transcripts of metabotropic receptor cDNAs contained in construct mGluR5a3 were synthesized from linearized plasmids using the Megascript Kit (Cat. #1334, Ambion, Inc., Austin, Tex.). The mass of each synthesized transcript was determined by UV absorbance and the integrity of each transcript was determined by electrophoresis through an agarose gel.
B. ElectroPhysiology
Xenopus oocytes were injected with 10-50 ng of metabotropic receptor transcripts per oocyte. The preparation and injection of oocytes were carried out as described by Dascal �(1987) Crit. Rev. Biochem. 22:317-387!. Two-to-six days following mRNA injection, the oocytes were examined using the two-electrode voltage clamp technique. The cells were bathed in Ringer's solution (115 mM NaCl, 2.5 mM KCl, 1.8 mM CaCl.sub.2, 10 mM HEPES, pH 7.3), and the membrane potential was clamped at -80 to -100 mV. Drugs were applied by pipetting 60 .mu.l aliquots of drug-containing solution directly into the bath. Data were sampled at 2-5 Hz with a Labmaster data acquisition board in PC-386 using AXOTAPE version 1.2 (Axon Instruments, Foster City, Calif.) software. Data were exported to a laser printer or plotted using Sigmaplot version 5.0.
Metabotropic receptor-modulating compounds, i.e., 0.001-0.1 .mu.M quisqualate, 0.1-10 .mu.M glutamate and 0.1-300 .mu.M 1S,3R-ACPD (l-amino-cyclopentyl-1,3-dicarboxylic acid), were applied to the bath and the transmembrane currents were recorded. Significant currents were detected after application of the compounds. Dose-response studies in which the currents measured after application of varying amounts of each compound were compared revealed that the current magnitude increased with increasing concentration of each compound. Analysis of these data enabled a calculation of EC.sub.50 values for each compound which were used in determining the relative potencies of the compounds.
EXAMPLE 3
Recombinant Expression of Human Metabotropic Glutamate Receptor Subunits in Mammalian Cells
Human embryonic kidney (HEK 293) and Chinese hamster ovary (CHO) cells (i.e, DG44 cells; see Urlaub et al. (1986) Som. Cell. Molec. Genet. 12:555) were transfected with DNA encoding human metabotropic receptors. Transfectants were analyzed for expression of metabotropic receptors using various assays, e.g., inositol phosphate (IP.sub.1) assays, Ca.sup.++ -sensitive fluorescent indicator-based assays, and �.sup.3 H!-glutamate binding assays.
A. Transient Transfection of HEK 293 Cells
HEK 293 cells were transiently transfected with DNA encoding mGluR5a (constructs mGluR5a2 and mGluR5a3 and construct MMTV-hmGluR5a) receptors. Approximately 2.times.10.sup.6 HEK cells were transiently transfected with 5-18 .mu.g (or 0.18 .mu.g in some transfections, see Example 3.C.2.) of the indicated plasmid according to standard CaPO.sub.4 transfection procedures �see Wigler et al. (1979) Proc. Natl. Acad. Sci. USA 76:1373-1376!. In addition, 0.5-2 .mu.g (or 0.18 .mu.g in some transfections, see Example 3.C.2) of plasmid pCMV.beta.gal (Clontech Laboratories, Palo Alto, Calif.), which contains the Escherichia coli .beta.-galactosidase gene fused to the CMV promoter, were co-transfected as a reporter gene for monitoring the efficiency of transfection. The transfectants were analyzed for .beta.-galactosidase expression by direct staining of the product of a reaction involving .beta.-galactosidase and the X-gal substrate �Jones (1986) EMBO 5:3133-3142!. Transfectants can also be analyzed for .beta.-galactosidase expression by measurement of .beta.-galactosidase activity �Miller (1972) in Experiments in Molecular Genetics, pp.352-355, Cold Spring Harbor Press!.
HEK 293 cells that were transiently transfected with 5 .mu.g of MMTV-hmGluR5A were co-transfected with 5 .mu.g of pRShGR (ATCC accession no. 67200) which contains DNA encoding a glucocorticoid receptor operatively linked to the Rous Sarcoma virus (RSV) LTR promoter. Co-expression of glucocorticoid receptors in these cells should insure that induction of expression of the MMTV promoter-mGluR5a DNA occurs upon addition of glucocorticoid (e.g., dexamethasone) to the cells.
The efficiency of these transfections of HEK cells was typical of standard efficiencies (i.e., .about.50%).
B. Stable Transfection of Mammalian Cells
Mammalian cells, such as HEK 293, Ltk.sup.- and CHO cells (e.g., DG44 cells), can be stably transfected using the calcium phosphate transfection procedure �Current Protocols in Molecular Biology, Vol. 1, Wiley Inter-Science, Supplement 14, Unit 9.1.1-9.1.9 (1990)!. When CHO cells are used as hosts, it is generally preferable to use the SV40 promoter to regulate expression of the human metabotropic receptor-encoding cDNA. Ten-cm plates, each containing 1-2.times.10.sup.6 cells, are transfected with 1 ml of DNA/calcium phosphate precipitate containing approximately 5-10 .mu.g of metabotropic receptor-encoding DNA and 0.5-1 .mu.g of DNA encoding a selectable marker, for example, the neomycin-resistance gene (i.e., pSV2neo) for selection of HEK 293 transformants, the thymidine kinase gene for Ltk.sup.- cell transfectants, or the dihydrofolate reductase (dhfr) gene for selection of DG44 cell transformants. After .about.14 days of growth in the appropriate selective media, colonies form and are individually isolated using cloning cylinders. The isolates are then subjected to limiting dilution and screened to identify those that express metabotropic receptors using, for example, methods described below.
C. Analysis of Transfectants
1. Fluorescent indicator-based assays
Activation of G-protein-coupled metabotropic receptors by agonists leads to stimulation of the phosphatidylinositol (PI) hydrolysis/intracellular Ca.sup.++ signalling pathway and/or the inhibitory cAMP cascade. Methods of detecting transient increases in intracellular calcium concentration can be applied to the analysis of functional expression of metabotropic receptors that are coupled to the PI hydrolysis/Ca.sup.++ mobilization pathway or to both the PI hydrolysis/Ca.sup.++ mobilization pathway and the inhibitory cAMP cascade. One method for measuring intracellular calcium levels relies on calcium-sensitive fluorescent indicators.
Calcium-sensitive indicators, such as fluo-3 and fura-2 (Molecular Probes, Inc., Eugene, Oreg.) are available as acetoxymethyl esters which are membrane permeable. When the acetoxymethyl ester form of the indicator enters a cell, the ester group is removed by cytosolic esterases, thereby trapping the free indicator in the cytosol. Interaction of the free indicator with calcium results in increased fluorescence of the indicator; therefore, an increase in the intracellular Ca.sup.+ concentration of cells containing the indicator can be expressed directly as an increase in fluorescence (or an increase in the ratio of the fluorescence at two wavelengths when fura-2 is used). An automated fluorescence detection system for assaying metabotropic receptors has been described in commonly assigned pending U.S. patent application Ser. No. 07/812,254 and corresponding PCT Patent Application No. US92/11090, both of which are hereby incorporated by reference herein. Additionally, fluorescence imaging techniques can be utilized to visualize intracellular Ca.sup.++ oscillations.
HEK cells that were transiently transfected with DNA encoding a human mGluR5a receptor were analyzed for expression of functional recombinant metabotropic receptors using the automated fluorescent indicator-based assay and the fluorescence imaging assay. Likewise, cells stably transfected with metabotropic receptor DNAs can also be analyzed for functional metabotropic receptors using these assay systems.
a. Automated fluorescence assay
Untransfected HEK 293 cells (or HEK 293 cells transiently transfected with pCMV-T7-3) and HEK 293 cells that had been transfected with mGluR5a-encoding DNA were plated in the wells of a 96-well microtiter dish (Nunc Catalog No. 1-6708, distributed by Alameda Industries, Escondido, Calif.) that had been precoated with poly-L-lysine at a density of 2.times.10.sup.5 cells/well and loaded with fluo-3 by incubation for 2 hours at 20.degree. C. in a medium containing 20 .mu.M fluo-3, 0.2% Pluronic F-127 in HBS (125 mM NaCl, 5 mM KCl, 1.8 mM CaCl.sub.2, 0.62 mM MgCl.sub.2, 20 mM glucose, 20 mM HEPES, pH 7.4). The cells were then washed with assay buffer (i.e. HBS). The microtiter dish was then placed into a fluorescence plate reader (e.g., Fluoroskan II, Lab Products International, Ltd., Raleigh, N.C.), and the basal fluorescence of each well was measured and recorded before addition of metabotropic receptor-modulating compounds such as quisqualate, glutamate, trans-ACPD (1-amino-cyclopentane-1,3-dicarboxylic acid), 1S,3R-ACPD, AP3 (2-amino-3-phosphonopropionate) AP5 (2-amino-5-phosphonopentanoate), and CNQX (6-cyano-7-nitroquinoxaline-2,3-dione) to the wells. The fluorescence of the wells was monitored repeatedly (75 readings at 0.63-sec intervals) following addition of agonist.
In general, the fluorescence of the untransfected HEK 293 cells did not change after addition of any of these compounds. The fluorescence of HEK 293 cells transiently transfected with either the mGluR5a3 or MMTV-hmGluR5a constructs increased in response to application of glutamate, quisqualate, trans-ACPD, or 1S,3R-ACPD. The fluorescence increased to a peak value, then decreased over time to the basal level of fluorescence in cells prior to application of the compounds. The effects of AP3, AP5 or CNQX on glutamate-, quisqualate- or trans-ACPD-stimulated fluorescence increases in cells transfected with mGluR5a2 were also investigated. Neither of these compounds (AP3, AP5 or CNQX) inhibited the agonist-induced fluorescence increases in these cells.
Dose-response studies in which the peak fluorescence values measured after application of varying amounts of glutamate, quisqualate or 1S,3R-ACPD to cells transfected with mGluR5a3 were compared revealed that the magnitude of the peak fluorescence increased with increasing concentration of each compound. Analysis of these data enabled a calculation of EC.sub.50 values for each compound which were used in determining the relative potencies of the compounds.
HEK 293 cells transiently co-transfected with MMTV-hmGluR5a and pRShGR (a glucocorticoid receptor construct) were also analyzed in the fluorescence assay. The fluorescence of these cells increased in response to 100 .mu.M quisqualate; the peak response was greater when the cells were preincubated with dexamethasone (.about.1M) for 16 hrs at 37.degree. C. before being assayed.
b. Fluorescence imaging assay
HEK 293 cells that had been transiently transfected with mGluR5a3 and untransfected HEK 293 cells (control) were analyzed by digital video imaging in order to visualize metabotropic receptor-mediated changes in intracellular Ca.sup.++ concentration. Transfectants (4.times.10.sup.5 cells per 35-mm culture dish with glass-insert bottom) were loaded with fura-2 by exposing the cells to 1 .mu.M fura-2 (acetoxymethyl ester) for 25 min at room temperature in the dark. The cells were then washed three times with DMEM and four times with Ringer's (160 mM NaCl, 5 mM KCl, 2 mM CaCl.sub.2, 1 MM MgCl.sub.2, 11 mM glucose, 5 mM HEPES, pH 7.3) solution.
The transfectants and untransfected cells were then placed on the stage of an Axiovert 100 TV inverted microscope (Zeiss, Oberkochren, Germany) equipped with a 150 W xenon lamp as the UV light source. An Image 1 Fluor System (Universal Imaging, West Chester, Pa.) was used to control the alternate excitation of the cells at 340 and 380 nm (typically every 3 sec) through a 40.times.1.3 N.A. oil immersion objective. Light emitted at greater than 510 nm was collected by a CCD 72 intensified CCD camera (MTI Dage, Michigan City, Ind.) and digitized. The background emitted light was subtracted from the 340 and 380 nm excitation images. The corrected values were used in calculating the 340/380 intensity ratio. These uncalibrated fura-2 ratio values were reliable indicators of changes in the intracellular Ca.sup.++ concentration.
The uncalibrated fura-2 ratios were used to generate pseudocolor images with purple corresponding to resting intracellular Ca.sup.++ concentration (.about.100 nM) and red to high intracellular Ca.sup.++ concentration (.about.1 .mu.M). For quantitative analysis, the average ratio value in a 12-by-12 pixel region over each cell was calculated by the software for each ratio image in an experiment and imported into a spreadsheet for further analysis and graphing.
To demonstrate that HEK 293 cells express the intracellular components required in receptor-mediated activation of the PI hydrolysis/Ca.sup.++ mobilization pathway, transfectants and untransfected cells (which express endogenous G-protein-coupled muscarinic acetylcholine receptors) were exposed to 1 mM carbamylcholine (CCh; a muscarinic acetylcholine receptor agonist), and the cells were monitored for increases in intracellular Ca.sup.++ concentration. Typically, a detectable increase in the intracellular Ca.sup.++ concentration of the majority of the cells was observed in response to CCh addition in the imaging studies.
Both transfected and untransfected HEK 293 cells were also monitored for increases in intracellular Ca.sup.++ concentration in response to 100 .mu.M quisqualate. On average, the intracellular Ca concentration of the untransfected cells did not change after exposure to quisqualate. In contrast, the intracellular Ca.sup.++ concentration of 26.7.+-.22.3% of the transfected cells increased in response to application of 100 AM quisqualate.
2. Phosphatidylinositol hydrolyis (IP.sub.1) assays
Because activation of G-protein-coupled metabotropic receptors by agonists can lead to stimulation of the phosphatidylinositol (PI) hydrolysis pathway, methods of detecting increases in the products of PI hydrolysis (e.g., IP.sub.3, IPZ or IP.sub.1) can be applied to the analysis of functional expression of metabotropic receptors that are coupled to the PI hydrolysis/Ca.sup.++ mobilization pathway or to both the PI hydrolysis/Ca.sup.++ mobilization pathway and the inhibitory cAMP cascade. One method for measuring IP.sub.1 and/or IP.sub.2 and/or IP.sub.3 generated by hydrolysis of PI involves incorporation of (H!-myo-inositol into cell membrane phospholipids and subsequent separation of �.sup.3 H!-IP.sub.1, �.sup.3 H)-IP.sub.2 and �.sup.3 H!-IP.sub.3, followed by quantitation of the radioactivity in each fraction, as follows.
HEK 293 cells that had been transiently transfected with mGluR5a3 were plated in 24-well microtiter plates at a density of 8.times.10.sup.5 cells/well. After the cells were allowed to settle and adhere to the bottom of the plate for a few hours, 2 .mu.Ci of �.sup.3 H!-myo-inositol (Amersham catalog # PT6-271, Arlington Heights, Ill.; specific activity=17.7 Ci/mmol) was added to each well and incubated overnight at 37.degree. C. The next day, the cells were examined under a Nikon Diaphot inverted microscope to assess the health of the cells morphologically as well as to determine if the wells contained a confluent layer of cells. Media was then aspirated and the cells were washed twice with 0.5 ml Krebs bicarbonate buffer (117.9 mM NaCl, 4.72 mM KCl, 2.54 mM CaCl.sub.2, 1.18 mM MgSO.sub.4, 1.19 mM KH.sub.2 PO.sub.4, 25 mM NaHCO.sub.3, 11.1 mM dextrose (equilibrated with 95% O.sub.2, 5% CO.sub.2, pH 7.4)!. The cells were incubated for 45 min. at room temperature. The buffer was then aspirated from each well and the cells were washed and incubated in 0.5 ml/well for 45 min at room temperature. The buffer was aspirated from each well, and the cells were then incubated for 20 min at 37.degree. C. with 450 .mu.l Krebs-bicarbonate buffer containing 10 mM LiCl instead of 10 mM NaCl (to block hydrolysis of IP.sub.1 to inositol and inorganic phosphate) and 10 mM unlabeled myo-inositol.
To begin treatment of the cells with metabotropic receptor-modulating compounds, 50 .mu.l of Krebs-bicarbonate buffer (control) or 10.times. the final concentration of the compound was added to each well and the incubation was continued for 40 min. Incubation was terminated by addition of 1 ml ice-cold methanol to each well.
In order to isolate IP.sub.1 from the cells, the cells were removed from the plates by scraping with plastic pipette tips, and the cell suspension was transferred to 12.times.75 mm glass tubes. The tubes were thoroughly vortexed, and a 150-.mu.l aliquot, i.e., one-tenth of the total volume, of each reaction mixture was transferred to another tube for protein determination. The water-soluble inositol phosphates were separated from the radiolabelled membrane phospholipids by extraction in 1 ml chloroform. The tubes were incubated at room temperature for 30 min before centrifugation at 500.times.g for 5 min at 4.degree. C. The aqueous (top) layer containing the �.sup.3 H!-inositol phosphates was transferred to 10-ml syringes connected to Accell QMA SEP-PAK columns (Millipore; Calif.), which were attached to an Amersham Superseparator apparatus that was modified to allow collection into 20-ml scintillation vials. Water (10 ml) was added to the cartridge to remove �.sup.3 H!-inositol precursor, followed by 4 ml 0.02M triethylammonium hydrogen carbonated buffer (TEAB, Fluka; N.Y.). To separately remove �.sup.3 H!-IP.sub.1, �.sup.3 H!-IP.sub.2 and � H)-IP.sub.3 from the cartridge, 4 ml of 0.1M TEAB, 4 ml of 0.3M TEAB and 4 ml of 0.4M TEAB were sequentially added to the cartridge and the separate eluate fractions were collected in large scintillation vials. Ecolume cocktail (15 ml; ICN; California) was added to each vial for subsequent scintillation counting to determine the amount of each IP in the separate fractions. Protein concentration was determined using the Bio-Rad Protein Micro-Assay (Bio-Rad, Richmond, Calif.).
HEK 293 cells transiently transfected with 18 .mu.g of mGluR5a3 displayed relatively high basal levels of IP.sub.1 when analyzed in this assay. However, HEK 293 cells transiently transfected with 0.18 .mu.g of mGluR5a3 exhibited lower basal IP.sub.1 levels and detectable increases in IP.sub.1 levels when treated with 1 mM glutamate, 1 mM quisqualate or 1 mM lS,3R-ACPD. The quisqualate-induced increase in IP.sub.1 levels was not affected by 1 mM AP3.
Dose-response studies which compared the IP.sub.1 levels measured after application of varying amounts of glutamate, quisqualate or 1S,3R-ACPD to cells transfected with mGluR5a3 revealed that IP.sub.1 levels increased with increasing concentration of each compound. Analysis of these data enabled calculation of EC.sub.50 values for each compound which were used in determining the relative potencies of the compounds.
3. Metabotropic Receptor Ligand Binding Assays
HEK cells transiently transfected with mGluR5a3 or with pUC19 (negative control) were analyzed for 3 H!-glutamate binding. Rat brain membranes were included in the binding assays as a positive control.
a. Preparation of Membranes
i. Rat forebrain membranes
Rat forebrain membranes were prepared from rat brains as described by Schoepp et al. ((1992) Neurosci. Lett. 145:100). Briefly, forebrains, consisting essentially of cerebral cortex, striatum and hippocampus, from ten rat brains were homogenized in 50 volumes of 30 mM ice-cold Tris-HCl containing 2.5 mM CaCl.sub.2, pH 7.6 using a Polytron (Brinkman, Westbury, N.Y.). The homogenate was centrifuged at 30,000.times.g for 15 minutes at 4.degree. C. The supernatant was discarded, the pellet was resuspended in 50 volumes of buffer using a Polytron and the suspension was centrifuged at 30,000.times.g for 15 min. This step was repeated twice. The pellet was resuspended in buffer and incubated at 37.degree. C. for 30 min. The suspension was then centrifuged at 30,000.times.g for 15 min. at 4.degree. C. This step was repeated three times. The final pellet was resuspended in 15 volumes of 50 mM Tris-HCl, pH 7.6, buffer, aliquoted, quick frozen and stored at -70.degree. C.
ii. Membranes from Transfected and Untransfected HEK293 Cells
In order to prepare membranes from HEK 293 cells transfected with mGluR5a-encoding DNA or pUC19 (negative control), cells were scraped from the tissue culture plates, and the plates rinsed with 5 ml of PBS (phosphate-buffered saline: 137 mM NaCl, 2.7 mM KCl, 10 mM Na.sub.2 HPO.sub.4, 1.7 mM KH.sub.2 PO.sub.4). The cells were centrifuged at low speed in a table-top centrifuge, and the cell pellet was rinsed with PBS. The cell pellet was resuspended in 20 volumes of 50 mM Tris-HCl containing 0.5 mM PMSF, pH 7.6. The cells were homogenized on ice in a Dounce (teflon/glass) homogenizer using 10-20 strokes. The homogenate was centrifuged at 120,000.times.g for 30 min. at 4.degree. C. The final membrane pellet was resuspended in 50 mM Tris-HCl containing 0.5 mM PMSF, pH 7.6. The membrane preparations were aliquoted, quick-frozen, and stored at -70.degree. C. The protein concentration was determined using the method of Bradford �(1976) Anal. Biochem. 72:248).
b. �.sup.3 H!-Glutamate binding assays
Specific binding of �.sup.3 H!-glutamate to metabotropic receptors in rat forebrain membranes was determined basically as described by Schoepp et al. (supra). On the day of the assay, frozen homogenate was thawed and washed three times with 50 mM Tris-HCl, pH 7.6. The final pellet was resuspended in 50 mM Tris-HCl, pH 7.6. The protein concentration was determined using the method of Bradford �(1976) Anal. Biochem. 72:248!. The suspension was centrifuged at 30,000.times.g for 15 min. in order to be able to resuspend the pellet in the assay buffer (50 mM Tris-HCl, 0.5 mM PMSF, 0.1% BSA, pH 7.6) at a concentration of 1 mg/ml. The membrane suspension was incubated in triplicate with 10 or 100 nM �.sup.3 H!-glutamate (New England Nuclear, Boston, Mass.; catalog no. NET-490, specific activity=57.4 Ci/mmol) in a total volume of 0.5 ml assay buffer containing 100 AM NMDA (Sigma, St. Louis, Mo.), 100 .mu.M AMPA and 100 .mu.M kainate (Research Biochemicals Inc., Natick, Mass.) to block �.sup.3 H!-glutamate binding to ionotropic glutamate receptors and 100 .mu.M SITS (Sigma, St. Louis, Mo.) to inhibit .sup.3 H!-glutamate binding to chloride-dependent uptake sites for 45 min on ice. Bound radioactivity was separated from free radioactivity by centrifugation for 5 min. at 20,000.times.g (4.degree. C.) in an SM-24 rotor (Sorvall, Wilmington, Del.). The pellets were washed twice with 5-6 ml of ice-cold 50 mM Tris-HCl buffer, pH 7.6. The pellets were solubilized by vortexing in 5 ml of Ecolume scintillation cocktail. The radioactivity was measured in a Beckman scintillation counter. The nonspecific binding observed in the presence of 1 mM glutamate was subtracted from the total binding in order to determine specific binding.
Specific binding of �.sup.3 H!-glutamate to membranes prepared from HEK 293 cells transfected with mGluR5-encoding DNA or pUCl9 was determined essentially as described for measuring binding to rat brain membranes with minor modifications. On the day of the assay, frozen homogenate was thawed and centrifuged in a MR-150 high-speed refrigerated microcentrifuge (Peninsula Laboratories, Inc., Belmont, Calif.). The pellet was washed twice with assay buffer (50 mM Tris-HCl, 0.5 mM PMSF, 0.1% BSA, pH 7.6), and the final pellet was resuspended in assay buffer at a concentration of 1 mg/ml. NMDA, AMPA and kainate were excluded from the assay mixture when HEK 293 cell membranes were being analyzed for �.sup.3 H!-glutamate binding.
Specific binding of �.sup.3 H!-glutamate to rat brain membranes was measured using 200 .mu.g of membrane and 100 nM .sup.3 H)-glutamate. The ratio of total-to-nonspecific binding was approximately 2:1.
Specific binding of �.sup.3 H!-glutamate to membranes prepared from HEK 293 cells transfected with mGluR5a3 or pUC19 was measured using 200 .mu.g of membranes and 100 nM �.sup.3 H!-glutamate. The amount of specific binding to membranes prepared from HEK 293 cells transfected with mGluR5a3 was significantly higher than that to membranes prepared from HEK 293 cells transfected with pUC19. Competitive binding studies were conducted in which the amount of specific binding of �.sup.3 H!-glutamate to membranes prepared from HEK 293 cells transfected with mGluR5a3 in the presence of various concentrations of unlabeled glutamate was determined. IC.sub.50 values were calculated from the data obtained in these studies.
4. Cyclic AMP (cAMP) Assays
a. RIA-based assays
Because activation of some G-protein-coupled receptors results in decreases (as opposed to increases) in cAMP, assays that measure intracellular cAMP levels can also be used to evaluate recombinant human metabotropic receptors expressed in mammalian host cells. Mammalian cells transiently or stably transfected with human metabotropic receptor-encoding DNA or pUC19 (negative control) are plated in 24-well microtiter plates at a density of 5.times.10.sup.5 cells/well and allowed to incubate overnight. The following day, cells are examined under a Nikon Diaphot inverted microscope to assess the health of the cells morphologically as well as to determine if the wells contain a confluent layer of cells. Media is then aspirated and the cells are washed twice with 0.5 ml Krebs bicarbonate buffer (same buffer used in the PI hydrolysis assay; see Example 3.C.2) containing 1 mM IBMX (3-isobutyl-1-methylxanthine; Sigma, St. Louis, Mo.) and 0.1% BSA. Alternatively, 1.times.PBS can be used in place of Krebs bicarbonate buffer. Each wash is followed with a 30-min incubation at 37.degree. C. The buffer is aspirated from each well and the cells are then incubated for 20 min at 37.degree. C. with 0.2 ml Krebs-bicarbonate buffer containing 1 mM IBMX and 0.1% BSA.
To begin treatment of the cells with metabotropic receptor-modulating compounds, 50 .mu.l of Krebs-bicarbonate buffer, with or without 5.times.the final concentration of forskolin, is added to some of the cells (basal control) and 5.times.the final concentration of the compound plus 5.times.the final concentration of forskolin is added to some cells (test cells) and the incubation is continued for 15 min at 37.degree. C. At the end of this 15-min period, the reaction is terminated by adding 25 .mu.l of 1% Triton X-100 solution and the incubation is continued for another 10 min. The lysed cells plus the cell suspension are transferred to 12.times.75 mm polypropylene tubes with plastic pipette tips. Each well is rinsed with 75 .mu.l of Krebs-bicarbonate buffer containing 1 mM IBMX and 0.1% BSA. The rinse is combined with the cell lysate. The cell lysate suspension is centrifuged at 2300.times.g for 5 min and the supernatant is assayed for cAMP levels using an RIA kit (Amersham Life Sciences catalog #TRK 432; Arlington Heights, Ill.).
b. Cyclic nucleotide-gated channel-based assay
HEK293 cells were grown in monolayers (approximately 2.times.10.sup.6 cells per 10 cm poly-D-lysine-coated plate) in Dulbecco's modified Eagle's medium (DMEM; Gibco) containing 5% defined supplemented calf serum (Hyclone) including 100 U/ml penicillin and 100 .mu.g/ml streptomycin sulfate. The cells were transiently transfected by the calcium phosphate method (see Ausubel, et al., supra, pp 9.1.1-9.1.7) with 5 .mu.g of pCMV-OCNA (containing DNA encoding the olfactory cyclic nucleotide-gated channel (see Dhallen et al., supra) linked to the CMV promoter, 2 .mu.g pCMV-.beta.gal (Clontech, Palo Alto, Calif.), and 13 .mu.g pUC19 as a control plasmid. Vector pCMV-OCNA was constructed by isolating the olfactory cyclic nucleotide-gated channel-encoding DNA as .about.3.0 kb EcoRI fragment from pBluescript KS and ligating the resulting fragment to EcoRI-digested pCMV-T7-3. Six hours after transfection, the calcium phosphate precipitate was washed off and cells fed with DMEM containing 10% dialyzed fetal bovine serum (Hyclone), 100 U/ml penicillin, 100 .mu.g/ml streptomycin, and supplemented with 2 mM glutamine. Transfection efficiencies, as determined by measuring .beta.-galactosidase activity, were 50-70%.
HEK cells transfected with olfactory cyclic nucleotide-gated channel DNA were incubated 24-48 hours before testing for function. The activity of the channels was first assessed electrophysiologically using inside-out membrane patches pulled from the transfected cells so that the concentration of cAMP reaching the cytoplasmic face could be controlled (see, e.g., Single-Channel Recording, Sakmann and Neher, eds., Plenum Press, N.Y. (1983)). The patch was exposed to Ca.sup.++ /Mg.sup.++ -free Ringer's solution on both surfaces. In one patch, a current was elicited by ramping the membrane potential from -100 to +100 mV in 2 seconds, in the presence of 1 mM cAMP. This result suggested that the channel was functionally expressed.
The transfectants were also analyzed by single-cell video imaging of internal calcium levels (�Ca.sup.++ !.sub.i). This method allows analysis of cyclic nucleotide-gated channel activity by measurement of intracellular calcium levels, which change with the amount of calcium influx through the channel, as regulated by cyclic nucleotide activation of the channel. The imaging assay was conducted essentially as described in Example 3.C.1.b., with some modifications. After dye loading, the cells were examined using a Zeiss Axiovert microscope and 100 W mercury lamp, a Dage intensified CCD camera, and Image-l hardware and software for image processing. The software controlled the alternate excitation of the cells at 350 and 385 nm (typically every 5 seconds) through a 20.times.1.3 N.A. oil immersion objective. Light emitted at greater than 510 nm was collected by the CCD camera, digitized, and 350 and 385 nm excitation images were background-subtracted before calculating the 350/385 nm intensity ratio.
For quantitative analysis, the average 350/385 ratio value in a 12 by 12 pixel region over each cell was calculated by the software for each ratio image in an experiment and imported into a spreadsheet for further analysis and graphing. Fura-2 signals were calibrated with an intact cell in which R.sub.min was obtained by exposing the cells to Ringer's solution containing 10 .mu.M ionomycin, 10 mM EGTA and no added Ca.sup.++. R.sub.max was next obtained by exposing the cells to Ringer's solution containing 10 .mu.M ionomycin and 10 mM Ca.sup.++, with three washes. Using a K.sub.d of 250 nM for fura-2 inside living cells and the equation of Grynkiewicz et al. (J. Biol. Chem. 260:3440 (1985)), the resting �Ca.sup.++ !.sub.i was typically 100 nM.
In these experiments, the HEK293 cell transfectants were exposed to agents which increase intracellular cAMP levels and monitored for subsequent changes in �Ca.sup.++ !.sub.i. There was a small increase in �Ca.sup.++ !.sub.i in the averaged results from 64 cells, and in individual cells in response to addition of 100 .mu.M forskolin (activator of adenyl cyclase). A more significant increase was observed after addition of 1 mM IBMX (inhibitor of cAMP phosphodiesterase). In a control experiment, only 1 out of 64 untransfected HEK293 cells showed an increase in �Ca.sup.++ !.sub.i in response to elevation of intracellular cAMP levels. This response was transient and clearly different from the sustained response seen in HEK293 cells transfected with the cyclic nucleotide-gated channel DNA.
These results demonstrate that HEK cells expressing cyclic nucleotide-gated channels may be used as host cells in assays of receptors that cause a change in intracellular cyclic nucleotide levels when activated (e.g., metabotropic receptors).
5. Northern Blot Hybridization Analysis
Cells transfected with human metabotropic receptor-encoding DNA can also be analyzed for expression of the corresponding transcript by northern blot analysis. Total RNA was isolated from .about.1.times.10.sup.7 cells that have been transfected with the human metabotropic receptor-encoding DNA, and 10-15 .mu.g of RNA is used for northern hybridization analysis. The inserts from human metabotropic receptor-encoding plasmids are nick-translated and used as probes. Typical conditions for northern blot hybridization and washing are as follows:
hybridization in 5.times.SSPE, 5.times.Denhart's solution, 50% formamide, at 42.degree. C. followed by washing in 0.2.times.SSPE, 0.1% SDS, at 65.degree. C.
While the invention has been described in detail with reference to certain preferred embodiments thereof, it will be understood that modifications and variations are within the spirit and scope of that which is described and claimed.
SUMMARY OF SEQUENCES
Sequence ID No. 1 is the nucleic acid sequence (and the deduced amino acid sequence) of a DNA encoding a metabotropic glutamate receptor subtype (mGluRlB) of the present invention.
Sequence ID No. 2 is the deduced amino acid sequence of the nucleotide sequence of Sequence ID No. 1.
Sequence ID No. 3 is a nucleotide sequence (and the deduced amino acid sequence) of a partial clone encoding a portion of an human mGluR2 receptor subtype.
Sequence ID No. 4 is the amino acid sequence of a portion of an human mGluR2 receptor subunit as encoded by the nucleotide sequence of Sequence ID No. 3.
Sequence ID No. 5 is the nucleic acid sequence (and the deduced amino acid sequence) of a DNA encoding a metabotropic glutamate receptor subtype (mGluR3) of the present invention.
Sequence ID No. 6 is the deduced amino acid sequence of the nucleotide sequence of Sequence ID No. 5.
Sequence ID No. 7 is the nucleic acid sequence (and the deduced amino acid sequence) of a DNA encoding a metabotropic glutamate receptor (mGluR5al) of the present invention.
Sequence ID No. 8 is the deduced amino acid sequence of the nucleotide sequence of Sequence ID No. 7.
Sequence ID No. 9 is the nucleic acid sequence (and the deduced amino acid sequence) of a DNA encoding an mGluR5 variant metabotropic glutamate receptor (mGluR5b) of the present invention.
Sequence ID No. 10 is the deduced amino acid sequence of the nucleotide sequence of Sequence ID No. 9.
Sequence ID No. 11 is the nucleic acid sequence (and the deduced amino acid sequence) of a DNA encoding an mGluR5 variant metabotropic glutamate receptor (mGluR5c) of the present invention.
Sequence ID No. 12 is the deduced amino acid sequence of the nucleotide sequence of Sequence ID No. 11.
Sequence ID No. 13 is 343 nucleotides of 3' untranslated sequence of an human mGluR2 receptor subtype.
__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 13(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 3321 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: both(D) TOPOLOGY: both(ii) MOLECULE TYPE: cDNA(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 388..3108(D) OTHER INFORMATION: /product="HUMAN MGLUR1B"(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:GCCGAGCGTGGCCACGGYCCTCTGGCCCCGGGACCATAGCGCTGTCTACCCCGACTCAGG60TACTCAGCATCTAGCTCACCGCTGCCAACACGACTTCCACTGTACTCTTGATCAATTTAC120CTTGATGCACTACCGGTGAAGAACGGGGACTCGAATTCCCTTACAAACGCCTCCAGCTTG180TAGAGGCGGTCGTGGAGGACCCAGAGGAGGAGACGAAGGGGAAGGAGGCGGTGGTGGAGG240AGGCAAAGGCCTTGGACGACCATTGTTGGCGAGGGGCACCACTCCGGGAGAGGCGGCGCT300GGGCGTCTTGGGGGTGCGCGCCGGGAGCCTGCAGCGGGACCAGCGTGGGAACGCGGCTGG360CAGGCTGTGGACCTCGTCCTCACCACCATGGTCGGGCTCCTTTTGTTTTTT411MetValGlyLeuLeuLeuPhePhe15TTCCCAGCGATCTTTTTGGAGGTGTCCCTTCTCCCCAGAAGCCCCGGC459PheProAlaIlePheLeuGluValSerLeuLeuProArgSerProGly101520AGGAAAGTGTTGCTGGCAGGAGCGTCGTCTCAGCGCTCGGTGGCCAGA507ArgLysValLeuLeuAlaGlyAlaSerSerGlnArgSerValAlaArg25303540ATGGACGGAGATGTCATCATTGGAGCCCTCTTCTCAGTCCATCACCAG555MetAspGlyAspValIleIleGlyAlaLeuPheSerValHisHisGln455055CCTCCGGCCGAGAAAGTGCCCGAGAGGAAGTGTGGGGAGATCAGGGAG603ProProAlaGluLysValProGluArgLysCysGlyGluIleArgGlu606570CAGTATGGCATCCAGAGGGTGGAGGCCATGTTCCACACGTTGGATAAG651GlnTyrGlyIleGlnArgValGluAlaMetPheHisThrLeuAspLys758085ATCAACGCGGACCCGGTCCTCCTGCCCAACATCACCCTGGGCAGTGAG699IleAsnAlaAspProValLeuLeuProAsnIleThrLeuGlySerGlu9095100ATCCGGGACTCCTGCTGGCACTCTTCCGTGGCTCTGGAACAGAGCATT747IleArgAspSerCysTrpHisSerSerValAlaLeuGluGlnSerIle105110115120GAGTTCATTAGGGACTCTCTGATTTCCATTCGAGATGAGAAGGATGGG795GluPheIleArgAspSerLeuIleSerIleArgAspGluLysAspGly125130135ATCAACCGGTGTCTGCCTGACGGCCAGTCCCTCCCCCCAGGCAGGACT843IleAsnArgCysLeuProAspGlyGlnSerLeuProProGlyArgThr140145150AAGAAGCCCATTGCGGGAGTGATCGGTCCCGGCTCCAGCTCTGTAGCC891LysLysProIleAlaGlyValIleGlyProGlySerSerSerValAla155160165ATTCAAGTGCAGAACCTGCTCCAGCTCTTCGACATCCCCCAGATCGCT939IleGlnValGlnAsnLeuLeuGlnLeuPheAspIleProGlnIleAla170175180TATTCAGCCACAAGCATCGACCTGAGTGACAAAACTTTGTACAAATAC987TyrSerAlaThrSerIleAspLeuSerAspLysThrLeuTyrLysTyr185190195200TTCCTGAGGGTTGTCCCTTCTGACACTTTGCAGGCAAGGGCCATGCTT1035PheLeuArgValValProSerAspThrLeuGlnAlaArgAlaMetLeu205210215GACATAGTCAAACGTTACAATTGGACCTATGTCTCTGCAGTCCACACG1083AspIleValLysArgTyrAsnTrpThrTyrValSerAlaValHisThr220225230GAAGGGAATTATGGGGAGAGCGGAATGGACGCTTTCAAAGAGCTGGCT1131GluGlyAsnTyrGlyGluSerGlyMetAspAlaPheLysGluLeuAla235240245GCCCAGGAAGGCCTCTGTATCGCCCATTCTGACAAAATCTACAGCAAC1179AlaGlnGluGlyLeuCysIleAlaHisSerAspLysIleTyrSerAsn250255260GCTGGGGAGAAGAGCTTTGACCGACTCTTGCGCAAACTCCGAGAGAGG1227AlaGlyGluLysSerPheAspArgLeuLeuArgLysLeuArgGluArg265270275280CTTCCCAAGGCTAGAGTGGTGGTCTGCTTCTGTGAAGGCATGACAGTG1275LeuProLysAlaArgValValValCysPheCysGluGlyMetThrVal285290295CGAGGACTCCTGAGCGCCATGCGGCGCCTTGGCGTCGTGGGCGAGTTC1323ArgGlyLeuLeuSerAlaMetArgArgLeuGlyValValGlyGluPhe300305310TCACTCATTGGAAGTGATGGATGGGCAGACAGAGATGAAGTCATTGAA1371SerLeuIleGlySerAspGlyTrpAlaAspArgAspGluValIleGlu315320325GGTTATGAGGTGGAAGCCAACGGGGGAATCACGATAAAGCTGCAGTCT1419GlyTyrGluValGluAlaAsnGlyGlyIleThrIleLysLeuGlnSer330335340CCAGAGGTCAGGTCATTTGATGATTATTTCCTGAAACTGAGGCTGGAC1467ProGluValArgSerPheAspAspTyrPheLeuLysLeuArgLeuAsp345350355360ACTAACACGAGGAATCCCTGGTTCCCTGAGTTCTGGCAACATCGGTTC1515ThrAsnThrArgAsnProTrpPheProGluPheTrpGlnHisArgPhe365370375CAGTGCCGCCTTCCAGGACACCTTCTGGAAAATCCCAACTTTAAACGA1563GlnCysArgLeuProGlyHisLeuLeuGluAsnProAsnPheLysArg380385390ATCTGCACAGGCAATGAAAGCTTAGAAGAAAACTATGTCCAGGACAGT1611IleCysThrGlyAsnGluSerLeuGluGluAsnTyrValGlnAspSer395400405AAGATGGGGTTTGTCATCAATGCCATCTATGCCATGGCACATGGGCTG1659LysMetGlyPheValIleAsnAlaIleTyrAlaMetAlaHisGlyLeu410415420CAGAACATGCACCATGCCCTCTGCCCTGGCCACGTGGGCCTCTGCGAT1707GlnAsnMetHisHisAlaLeuCysProGlyHisValGlyLeuCysAsp425430435440GCCATGAAGCCCATCGACGGCAGCAAGCTGCTGGACTTCCTCATCAAG1755AlaMetLysProIleAspGlySerLysLeuLeuAspPheLeuIleLys445450455TCCTCATTCATTGGAGTATCTGGAGAGGAGGTGTGGTTTGATGAGAAA1803SerSerPheIleGlyValSerGlyGluGluValTrpPheAspGluLys460465470GGAGACGCTCCTGGAAGGTATGATATCATGAATCTGCAGTACACTGAA1851GlyAspAlaProGlyArgTyrAspIleMetAsnLeuGlnTyrThrGlu475480485GCTAATCGCTATGACTATGTGCACGTTGGAACCTGGCATGAAGGAGTG1899AlaAsnArgTyrAspTyrValHisValGlyThrTrpHisGluGlyVal490495500CTGAACATTGATGATTACAAAATCCAGATGAACAAGAGTGGAGTGGTG1947LeuAsnIleAspAspTyrLysIleGlnMetAsnLysSerGlyValVal505510515520CGGTCTGTGTGCAGTGAGCCTTGCTTAAAGGGCCAGATTAAGGTTATA1995ArgSerValCysSerGluProCysLeuLysGlyGlnIleLysValIle525530535CGGAAAGGAGAAGTGAGCTGCTGCTGGATTTGCGCGGCCTGCAAAGAG2043ArgLysGlyGluValSerCysCysTrpIleCysAlaAlaCysLysGlu540545550AATGAATATGTGCAAGATGAGTTCACCTGCAAAGCTTGTGACTTGGGA2091AsnGluTyrValGlnAspGluPheThrCysLysAlaCysAspLeuGly555560565TGGTGGCCCAATGCAGATCTAACAGGCTGTGAGCCCATTCCTGTGCGC2139TrpTrpProAsnAlaAspLeuThrGlyCysGluProIleProValArg570575580TATCTTGAGTGGAGCAACATCGAATCCATTATAGCCATCGCCTTTTCA2187TyrLeuGluTrpSerAsnIleGluSerIleIleAlaIleAlaPheSer585590595600TGCCTGGGAATCCTTGTTACCTTGTTTGTCACCCTAATCTTTGTACTG2235CysLeuGlyIleLeuValThrLeuPheValThrLeuIlePheValLeu605610615TACCGGGACACACCAGTGGTCAAATCCTCCAGTCGGGAGCTCTGCTAC2283TyrArgAspThrProValValLysSerSerSerArgGluLeuCysTyr620625630ATCATCCTAGCTGGCATCTTCCTTGGTTATGTGTGCCCATTCACTCTC2331IleIleLeuAlaGlyIlePheLeuGlyTyrValCysProPheThrLeu635640645ATTGCCAAACCTACTACCACCTCCTGCTACCTCCAGCGCCTCTTGGTT2379IleAlaLysProThrThrThrSerCysTyrLeuGlnArgLeuLeuVal650655660GGCCTCTCCTCTGCGATGTGCTACTCTGCTTTAGTGACTAAAACCAAT2427GlyLeuSerSerAlaMetCysTyrSerAlaLeuValThrLysThrAsn665670675680CGTATTGCACGCATCCTGGCTGGCAGCAAGAAGAAGATCTGCACCCGG2475ArgIleAlaArgIleLeuAlaGlySerLysLysLysIleCysThrArg685690695AAGCCCAGGTTCATGAGTGCCTGGGCTCAGGTGATCATTGCCTCAATT2523LysProArgPheMetSerAlaTrpAlaGlnValIleIleAlaSerIle700705710CTGATTAGTGTGCAACTAACCCTGGTGGTAACCCTGATCATCATGGAA2571LeuIleSerValGlnLeuThrLeuValValThrLeuIleIleMetGlu715720725CCCCCTATGCCCATTCTGTCCTACCCAAGTATCAAGGAAGTCTACCTT2619ProProMetProIleLeuSerTyrProSerIleLysGluValTyrLeu730735740ATCTGCAATACCAGCAACCTGGGTGTGGTGGCCCCTTTGGGCTACAAT2667IleCysAsnThrSerAsnLeuGlyValValAlaProLeuGlyTyrAsn745750755760GGACTCCTCATCATGAGCTGTACCTACTATGCCTTCAAGACCCGCAAC2715GlyLeuLeuIleMetSerCysThrTyrTyrAlaPheLysThrArgAsn765770775GTGCCCGCCAACTTCAACGAGGCCAAATATATCGCGTTCACCATGTAC2763ValProAlaAsnPheAsnGluAlaLysTyrIleAlaPheThrMetTyr780785790ACCACCTGTATCATCTGGCTAGCTTTTGTGCCCATTTACTTTGGGAGC2811ThrThrCysIleIleTrpLeuAlaPheValProIleTyrPheGlySer795800805AACTACAAGATCATCACAACTTGCTTTGCAGTGAGTCTCAGTGTAACA2859AsnTyrLysIleIleThrThrCysPheAlaValSerLeuSerValThr810815820GTGGCTCTGGGGTGCATGTTCACTCCCAAGATGTACATCATTATTGCC2907ValAlaLeuGlyCysMetPheThrProLysMetTyrIleIleIleAla825830835840AAGCCTGAGAGGAATGTCCGCAGTGCCTTCACCACCTCTGATGTTGTC2955LysProGluArgAsnValArgSerAlaPheThrThrSerAspValVal845850855CGCATGCATGTTGGCGATGGCAAGCTGCCCTGCCGCTCCAACACTTTC3003ArgMetHisValGlyAspGlyLysLeuProCysArgSerAsnThrPhe860865870CTCAACATCTTCCGAAGAAAGAAGGCAGGGGCAGGGAATGCCAAGAAG3051LeuAsnIlePheArgArgLysLysAlaGlyAlaGlyAsnAlaLysLys875880885AGGCAGCCAGAATTCTCGCCCACCAGCCAATGTCCGTCGGCACATGTG3099ArgGlnProGluPheSerProThrSerGlnCysProSerAlaHisVal890895900CAGCTTTGAAAACCCCCACACTGCAGTGAATGTTTCTAATGGCAAGTCTGTGTCAT3155GlnLeu905GGTCTGAACCAGGTGGAGGACAGGTGCCCAAGGGACAGCATATGTGGCACCGCCTCTCTG3215TGCACGTGAAGACCAATGAGACGGCCTGCAACCAAACAGCCGTCATCAAACCCCTCACTA3275AAAGTTACCAAGGCTCTGGCAAGAGCCTGACCTTTTCAGATACCAG3321(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 906 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:MetValGlyLeuLeuLeuPhePhePheProAlaIlePheLeuGluVal151015SerLeuLeuProArgSerProGlyArgLysValLeuLeuAlaGlyAla202530SerSerGlnArgSerValAlaArgMetAspGlyAspValIleIleGly354045AlaLeuPheSerValHisHisGlnProProAlaGluLysValProGlu505560ArgLysCysGlyGluIleArgGluGlnTyrGlyIleGlnArgValGlu65707580AlaMetPheHisThrLeuAspLysIleAsnAlaAspProValLeuLeu859095ProAsnIleThrLeuGlySerGluIleArgAspSerCysTrpHisSer100105110SerValAlaLeuGluGlnSerIleGluPheIleArgAspSerLeuIle115120125SerIleArgAspGluLysAspGlyIleAsnArgCysLeuProAspGly130135140GlnSerLeuProProGlyArgThrLysLysProIleAlaGlyValIle145150155160GlyProGlySerSerSerValAlaIleGlnValGlnAsnLeuLeuGln165170175LeuPheAspIleProGlnIleAlaTyrSerAlaThrSerIleAspLeu180185190SerAspLysThrLeuTyrLysTyrPheLeuArgValValProSerAsp195200205ThrLeuGlnAlaArgAlaMetLeuAspIleValLysArgTyrAsnTrp210215220ThrTyrValSerAlaValHisThrGluGlyAsnTyrGlyGluSerGly225230235240MetAspAlaPheLysGluLeuAlaAlaGlnGluGlyLeuCysIleAla245250255HisSerAspLysIleTyrSerAsnAlaGlyGluLysSerPheAspArg260265270LeuLeuArgLysLeuArgGluArgLeuProLysAlaArgValValVal275280285CysPheCysGluGlyMetThrValArgGlyLeuLeuSerAlaMetArg290295300ArgLeuGlyValValGlyGluPheSerLeuIleGlySerAspGlyTrp305310315320AlaAspArgAspGluValIleGluGlyTyrGluValGluAlaAsnGly325330335GlyIleThrIleLysLeuGlnSerProGluValArgSerPheAspAsp340345350TyrPheLeuLysLeuArgLeuAspThrAsnThrArgAsnProTrpPhe355360365ProGluPheTrpGlnHisArgPheGlnCysArgLeuProGlyHisLeu370375380LeuGluAsnProAsnPheLysArgIleCysThrGlyAsnGluSerLeu385390395400GluGluAsnTyrValGlnAspSerLysMetGlyPheValIleAsnAla405410415IleTyrAlaMetAlaHisGlyLeuGlnAsnMetHisHisAlaLeuCys420425430ProGlyHisValGlyLeuCysAspAlaMetLysProIleAspGlySer435440445LysLeuLeuAspPheLeuIleLysSerSerPheIleGlyValSerGly450455460GluGluValTrpPheAspGluLysGlyAspAlaProGlyArgTyrAsp465470475480IleMetAsnLeuGlnTyrThrGluAlaAsnArgTyrAspTyrValHis485490495ValGlyThrTrpHisGluGlyValLeuAsnIleAspAspTyrLysIle500505510GlnMetAsnLysSerGlyValValArgSerValCysSerGluProCys515520525LeuLysGlyGlnIleLysValIleArgLysGlyGluValSerCysCys530535540TrpIleCysAlaAlaCysLysGluAsnGluTyrValGlnAspGluPhe545550555560ThrCysLysAlaCysAspLeuGlyTrpTrpProAsnAlaAspLeuThr565570575GlyCysGluProIleProValArgTyrLeuGluTrpSerAsnIleGlu580585590SerIleIleAlaIleAlaPheSerCysLeuGlyIleLeuValThrLeu595600605PheValThrLeuIlePheValLeuTyrArgAspThrProValValLys610615620SerSerSerArgGluLeuCysTyrIleIleLeuAlaGlyIlePheLeu625630635640GlyTyrValCysProPheThrLeuIleAlaLysProThrThrThrSer645650655CysTyrLeuGlnArgLeuLeuValGlyLeuSerSerAlaMetCysTyr660665670SerAlaLeuValThrLysThrAsnArgIleAlaArgIleLeuAlaGly675680685SerLysLysLysIleCysThrArgLysProArgPheMetSerAlaTrp690695700AlaGlnValIleIleAlaSerIleLeuIleSerValGlnLeuThrLeu705710715720ValValThrLeuIleIleMetGluProProMetProIleLeuSerTyr725730735ProSerIleLysGluValTyrLeuIleCysAsnThrSerAsnLeuGly740745750ValValAlaProLeuGlyTyrAsnGlyLeuLeuIleMetSerCysThr755760765TyrTyrAlaPheLysThrArgAsnValProAlaAsnPheAsnGluAla770775780LysTyrIleAlaPheThrMetTyrThrThrCysIleIleTrpLeuAla785790795800PheValProIleTyrPheGlySerAsnTyrLysIleIleThrThrCys805810815PheAlaValSerLeuSerValThrValAlaLeuGlyCysMetPheThr820825830ProLysMetTyrIleIleIleAlaLysProGluArgAsnValArgSer835840845AlaPheThrThrSerAspValValArgMetHisValGlyAspGlyLys850855860LeuProCysArgSerAsnThrPheLeuAsnIlePheArgArgLysLys865870875880AlaGlyAlaGlyAsnAlaLysLysArgGlnProGluPheSerProThr885890895SerGlnCysProSerAlaHisValGlnLeu900905(2) INFORMATION FOR SEQ ID NO:3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 355 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: both(D) TOPOLOGY: both(ii) MOLECULE TYPE: cDNA(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 1..354(D) OTHER INFORMATION: /product="HUMAN MGLUR2 FRAGMENT"(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:GCCAAGCCATCCACGGCAGTGTGTACCTTACGGCGTCTTGGTTTGGGC48AlaLysProSerThrAlaValCysThrLeuArgArgLeuGlyLeuGly151015ACTGCCTTCTCTGTCTGCTACTCAGCCCTGCTCACCAAGACCAACCGC96ThrAlaPheSerValCysTyrSerAlaLeuLeuThrLysThrAsnArg202530ATTGCACGCATCTTCGGTGGGGCCCGGGAGGGTGCCCAGCGGCCACGC144IleAlaArgIlePheGlyGlyAlaArgGluGlyAlaGlnArgProArg354045TTCATCAGTCCTGCCTCACAGGTGGCCATCTGCCTGGAACTTATCTCG192PheIleSerProAlaSerGlnValAlaIleCysLeuGluLeuIleSer505560GGCCAGCTGCTCATCGTGGTCGCCTGGCTGGTGGTGGAGGCACCGGGC240GlyGlnLeuLeuIleValValAlaTrpLeuValValGluAlaProGly65707580ACAGGCAAGGAGACAGCCCCCGAACGGCGGGAGGTGGTGACACTGCGC288ThrGlyLysGluThrAlaProGluArgArgGluValValThrLeuArg859095TGCAACCACCGCGATGCAAGTATGTTGGGCTCGCTGGCCTACAATGTG336CysAsnHisArgAspAlaSerMetLeuGlySerLeuAlaTyrAsnVal100105110CTCCTCATCGCGCTCTGCA355LeuLeuIleAlaLeuCys115(2) INFORMATION FOR SEQ ID NO:4:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 118 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:AlaLysProSerThrAlaValCysThrLeuArgArgLeuGlyLeuGly151015ThrAlaPheSerValCysTyrSerAlaLeuLeuThrLysThrAsnArg202530IleAlaArgIlePheGlyGlyAlaArgGluGlyAlaGlnArgProArg354045PheIleSerProAlaSerGlnValAlaIleCysLeuGluLeuIleSer505560GlyGlnLeuLeuIleValValAlaTrpLeuValValGluAlaProGly65707580ThrGlyLysGluThrAlaProGluArgArgGluValValThrLeuArg859095CysAsnHisArgAspAlaSerMetLeuGlySerLeuAlaTyrAsnVal100105110LeuLeuIleAlaLeuCys115(2) INFORMATION FOR SEQ ID NO:5:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 3919 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: both(D) TOPOLOGY: both(ii) MOLECULE TYPE: cDNA(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 1064..3703(D) OTHER INFORMATION: /product="HUMAN MGLUR3"(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:CGGCCTCCCTGGCTCTCACACTCCCTCTCTGCTCCCGCTCTCCTAATCTCCTCTGGCATG60CGGTCAGCCCCCTGCCCAGGGACCACAGGAGAGTTCTTGTAAGGACTGTTAGTCCCTGCT120TACCTGAAAGCCAAGCGCTCTAGCAGAGCTTTAAAGTTGGAGCCGCCACCCTCCCTACCG180CCCCATGCCCCTTCACCCCACTCCGAAATTCACCGACCTTTGCATGCACTGCCTAAGGAT240TTCAGAGTGAGGCAAAGCAGTCGGCAAATCTACCCTGGCTTTTCGTATAAAAATCCTCTC300GTCTAGGTACCCTGGCTCACTGAAGACTCTGCAGATATACCCTTATAAGAGGGAGGGTGG360GGGAGGGAAAAGAACGAGAGAGGGAGGAAAGAATGAAAAGGAGAGGATGCCAGGAGGTCC420GTGCTTCTGCCAAGAGTCCCAATTAGATGCGACGGCTTCAGCCTGGTCAAGGTGAAGGAA480AGTTGCTTCCGCGCCTAGGAAGTGGGTTTGCCTGATAAGAGAAGGAGGAGGGGACTCGGC540TGGGAAGAGCTCCCCTCCCCTCCGCGGAAGACCACTGGGTCCCCTCTTTCGGCAACCTCC600TCCCTCTCTTCTACTCCACCCCTCCGTTTTCCCACTCCCCACTGACTCGGATGCCTGGAT660GTTCTGCCACCGGGCAGTGGTCCAGCGTGCAGCCGGGAGGGGGCAGGGGCAGGGGGCACT720GTGACAGGAAGCTGCGCGCACAAGTTGGCCATTTCGAGGGCAAAATAAGTTCTCCCTTGG780ATTTGGAAAGGACAAAGCCAGTAAGCTACCTCTTTTGTGTCGGATGAGGAGGACCAACCA840TGAGCCAGAGCCCGGGTGCAGGCTCACCGCCGCCGCTGCCACCGCGGTCAGCTCCAGTTC900CTGCCAGGAGTTGTCGGTGCGAGGAATTTTGTGACAGGCTCTGTTAGTCTGTTCCTCCCT960TATTTGAAGGACAGGCCAAAGATCCAGTTTGGAAATGAGAGAGGACTAGCATGACACATT1020GGCTCCACCATTGATATCTCCCAGAGGTACAGAAACAGGATTCATGAAGATGTTG1075MetLysMetLeuACAAGACTGCAAGTTCTTACCTTAGCTTTGTTTTCAAAGGGATTTTTA1123ThrArgLeuGlnValLeuThrLeuAlaLeuPheSerLysGlyPheLeu5101520CTCTCTTTAGGGGACCATAACTTTCTAAGGAGAGAGATTAAAATAGAA1171LeuSerLeuGlyAspHisAsnPheLeuArgArgGluIleLysIleGlu253035GGTGACCTTGTTTTAGGGGGCCTGTTTCCTATTAACGAAAAAGGCACT1219GlyAspLeuValLeuGlyGlyLeuPheProIleAsnGluLysGlyThr404550GGAACTGAAGAATGTGGGCGAATCAATGAAGACCGAGGGATTCAACGC1267GlyThrGluGluCysGlyArgIleAsnGluAspArgGlyIleGlnArg556065CTGGAAGCCATGTTGTTTGCTATTGATGAAATCAACAAAGATGATTAC1315LeuGluAlaMetLeuPheAlaIleAspGluIleAsnLysAspAspTyr707580TTGCTACCAGGAGTGAAGTTGGGTGTTCACATTTTGGATACATGTTCA1363LeuLeuProGlyValLysLeuGlyValHisIleLeuAspThrCysSer859095100AGGGATACCTATGCATTGGAGCAATCACTGGAGTTTGTCAGGGCATCT1411ArgAspThrTyrAlaLeuGluGlnSerLeuGluPheValArgAlaSer105110115TTGACAAAAGTGGATGAAGCTGAGTATATGTGTCCTGATGGATCCTAT1459LeuThrLysValAspGluAlaGluTyrMetCysProAspGlySerTyr120125130GCCATTCAAGAAAACATCCCACTTCTCATTGCAGGGGTCATTGGTGGC1507AlaIleGlnGluAsnIleProLeuLeuIleAlaGlyValIleGlyGly135140145TCTTATAGCAGTGTTTCCATACAGGTGGCAAACCTGCTGCGGCTCTTC1555SerTyrSerSerValSerIleGlnValAlaAsnLeuLeuArgLeuPhe150155160CAGATCCCTCAGATCAGCTACGCATCCACCAGCGCCAAACTCAGTGAT1603GlnIleProGlnIleSerTyrAlaSerThrSerAlaLysLeuSerAsp165170175180AAGTCGCGCTATGATTACTTTGCCAGGACCGTGCCCCCCGACTTCTAC1651LysSerArgTyrAspTyrPheAlaArgThrValProProAspPheTyr185190195CAGGCCAAAGCCATGGCTGAGATCTTGCGCTTCTTCAACTGGACCTAC1699GlnAlaLysAlaMetAlaGluIleLeuArgPhePheAsnTrpThrTyr200205210GTGTCCACAGTAGCCTCCGAGGGTGATTACGGGGAGACAGGGATCGAG1747ValSerThrValAlaSerGluGlyAspTyrGlyGluThrGlyIleGlu215220225GCCTTCGAGCAGGAAGCCCGCCTGCGCAACATCTGCATCGCTACGGCG1795AlaPheGluGlnGluAlaArgLeuArgAsnIleCysIleAlaThrAla230235240GAGAAGGTGGGCCGCTCCAACATCCGCAAGTCCTACGACAGCGTGATC1843GluLysValGlyArgSerAsnIleArgLysSerTyrAspSerValIle245250255260CGAGAACTGTTGCAGAAGCCCAACGCGCGCGTCGTGGTCCTCTTCATG1891ArgGluLeuLeuGlnLysProAsnAlaArgValValValLeuPheMet265270275CGCAGCGACGACTCGCGGGAGCTCATTGCAGCCGCCAGCCGCGCCAAT1939ArgSerAspAspSerArgGluLeuIleAlaAlaAlaSerArgAlaAsn280285290GCCTCCTTCACCTGGGTGGCCAGCGACGGTTGGGGCGCGCAGGAGAGC1987AlaSerPheThrTrpValAlaSerAspGlyTrpGlyAlaGlnGluSer295300305ATCATCAAGGGCAGCGAGCATGTGGCCTACGGCGACATCACCCTGGAG2035IleIleLysGlySerGluHisValAlaTyrGlyAspIleThrLeuGlu310315320CTGGCCTCCCAGCCTGTCCGCCAGTTCGGCCGCTACTTCCAGAGCCTC2083LeuAlaSerGlnProValArgGlnPheGlyArgTyrPheGlnSerLeu325330335340AACCCCTACAACAACCACCGCAACCCCTGGTTCCGGGACTTCTGGGAG2131AsnProTyrAsnAsnHisArgAsnProTrpPheArgAspPheTrpGlu345350355CAAAAGTTTCAGTGCAGCCTCCAGAACAAACGCAACCACAGGCGCGTC2179GlnLysPheGlnCysSerLeuGlnAsnLysArgAsnHisArgArgVal360365370TGCGAAAAGCACCTGGCCATCGACAGCAGCAACTACGAGCAAGAGTCC2227CysGluLysHisLeuAlaIleAspSerSerAsnTyrGluGlnGluSer375380385AAGATCATGTTTGTGGTGAACGCGGTGTATGCCATGGCCCACGCTTTG2275LysIleMetPheValValAsnAlaValTyrAlaMetAlaHisAlaLeu390395400CACAAAATGCAGCGCACCCTCTGTCCCAACACTACCAAGCTTTGTGAT2323HisLysMetGlnArgThrLeuCysProAsnThrThrLysLeuCysAsp405410415420GCTATGAAGATCCTGGATGGGAAGAAGTTGTACAAGGATTACTTGCTG2371AlaMetLysIleLeuAspGlyLysLysLeuTyrLysAspTyrLeuLeu425430435AAAATCAACTTCACGGCTCCATTCAACCCAAATAAAGATGCAGATAGC2419LysIleAsnPheThrAlaProPheAsnProAsnLysAspAlaAspSer440445450ATAGTCAAGTTTGACACTTTTGGAGATGGAATGGGGCGATACAACGTG2467IleValLysPheAspThrPheGlyAspGlyMetGlyArgTyrAsnVal455460465TTCAATTTCCAAAATGTAGGTGGGAAGTATTCCTACTTGAAAGTTGGT2515PheAsnPheGlnAsnValGlyGlyLysTyrSerTyrLeuLysValGly470475480CACTGGGCAGAAACCTTATCGCTAGATGTCAACTCTATCCACTGGTCC2563HisTrpAlaGluThrLeuSerLeuAspValAsnSerIleHisTrpSer485490495500CGGAACTCAGTCCCCACTTCCCAGTGCAGCGACCCCTGTGCCCCCAAT2611ArgAsnSerValProThrSerGlnCysSerAspProCysAlaProAsn505510515GAAATGAAGAATATGCAACCAGGGGATGTCTGCTGCTGGATTTGCATC2659GluMetLysAsnMetGlnProGlyAspValCysCysTrpIleCysIle520525530CCCTGTGAACCCTACGAATACCTGGCTGATGAGTTTACCTGTATGGAT2707ProCysGluProTyrGluTyrLeuAlaAspGluPheThrCysMetAsp535540545TGTGGGTCTGGACAGTGGCCCACTGCAGACCTAACTGGATGCTATGAC2755CysGlySerGlyGlnTrpProThrAlaAspLeuThrGlyCysTyrAsp550555560CTTCCTGAGGACTACATCAGGTGGGAAGACGCCTGGGCCATTGGCCCA2803LeuProGluAspTyrIleArgTrpGluAspAlaTrpAlaIleGlyPro565570575580GTCACCATTGCCTGTCTGGGTTTTATGTGTACATGCATGGTTGTAACT2851ValThrIleAlaCysLeuGlyPheMetCysThrCysMetValValThr585590595GTTTTTATCAAGCACAACAACACACCCTTGGTCAAAGCATCGGGCCGA2899ValPheIleLysHisAsnAsnThrProLeuValLysAlaSerGlyArg600605610GAACTCTGCTACATCTTATTGTTTGGGGTTGGCCTGTCATACTGCATG2947GluLeuCysTyrIleLeuLeuPheGlyValGlyLeuSerTyrCysMet615620625ACATTCTTCTTCATTGCCAAGCCATCACCAGTCATCTGTGCATTGCGC2995ThrPhePhePheIleAlaLysProSerProValIleCysAlaLeuArg630635640CGACTCGGGCTGGGGAGTTCCTTCGCTATCTGTTACTCAGCCCTGCTG3043ArgLeuGlyLeuGlySerSerPheAlaIleCysTyrSerAlaLeuLeu645650655660ACCAAGACAAACTGCATTGCCCGCATCTTCGATGGGGTCAAGAATGGC3091ThrLysThrAsnCysIleAlaArgIlePheAspGlyValLysAsnGly665670675GCTCAGAGGCCAAAATTCATCAGCCCCAGTTCTCAGGTTTTCATCTGC3139AlaGlnArgProLysPheIleSerProSerSerGlnValPheIleCys680685690CTGGGTCTGATCCTGGTGCAAATTGTGATGGTGTCTGTGTGGCTCATC3187LeuGlyLeuIleLeuValGlnIleValMetValSerValTrpLeuIle695700705CTGGAGGCCCCAGGCACCAGGAGGTATACCCTTGCAGAGAAGCGGGAA3235LeuGluAlaProGlyThrArgArgTyrThrLeuAlaGluLysArgGlu710715720ACAGTCATCCTAAAATGCAATGTCAAAGATTCCAGCATGTTGATCTCT3283ThrValIleLeuLysCysAsnValLysAspSerSerMetLeuIleSer725730735740CTTACCTACGATGTGATCCTGGTGATCTTATGCACTGTGTACGCCTTC3331LeuThrTyrAspValIleLeuValIleLeuCysThrValTyrAlaPhe745750755AAAACGCGGAAGTGCCCAGAAAATTTCAACGAAGCTAAGTTCATAGGT3379LysThrArgLysCysProGluAsnPheAsnGluAlaLysPheIleGly760765770TTTACCATGTACACCACGTGCATCATCTGGTTGGCCTTCCTCCCTATA3427PheThrMetTyrThrThrCysIleIleTrpLeuAlaPheLeuProIle775780785TTTTATGTGACATCAAGTGACTACAGAGTGCAGACGACAACCATGTGC3475PheTyrValThrSerSerAspTyrArgValGlnThrThrThrMetCys790795800ATCTCTGTCAGCCTGAGTGGCTTTGTGGTCTTGGGCTGTTTGTTTGCA3523IleSerValSerLeuSerGlyPheValValLeuGlyCysLeuPheAla805810815820CCCAAGGTTCACATCATCCTGTTTCAACCCCAGAAGAATGTTGTCACA3571ProLysValHisIleIleLeuPheGlnProGlnLysAsnValValThr825830835CACAGACTGCACCTCAACAGGTTCAGTGTCAGTGGAACTGGGACCACA3619HisArgLeuHisLeuAsnArgPheSerValSerGlyThrGlyThrThr840845850TACTCTCAGTCCTCTGCAAGCACGTATGTGCCAACGGTGTGCAATGGG3667TyrSerGlnSerSerAlaSerThrTyrValProThrValCysAsnGly855860865CGGGAAGTCCTCGACTCCACCACCTCATCTCTGTGATTGTGAATTGCAGTTCA3720ArgGluValLeuAspSerThrThrSerSerLeu870875880GTTCTTGTGTTTTTAGACTGTTAGACAAAAGTGCTCACGTGCAGCTCCAGAATATGGAAA3780CAGAGCAAAAGAACAACCCTAGTACCTTTTTTTAGAAACAGTACGATAAATTATTTTTGA3840GGACTGTATATAGTGATGTGCTAGAACTTTCTAGGCTGAGTCTAGTGCCCCTATTATTAA3900CAGTCCGAGTGTACGTACC3919(2) INFORMATION FOR SEQ ID NO:6:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 879 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:MetLysMetLeuThrArgLeuGlnValLeuThrLeuAlaLeuPheSer151015LysGlyPheLeuLeuSerLeuGlyAspHisAsnPheLeuArgArgGlu202530IleLysIleGluGlyAspLeuValLeuGlyGlyLeuPheProIleAsn354045GluLysGlyThrGlyThrGluGluCysGlyArgIleAsnGluAspArg505560GlyIleGlnArgLeuGluAlaMetLeuPheAlaIleAspGluIleAsn65707580LysAspAspTyrLeuLeuProGlyValLysLeuGlyValHisIleLeu859095AspThrCysSerArgAspThrTyrAlaLeuGluGlnSerLeuGluPhe100105110ValArgAlaSerLeuThrLysValAspGluAlaGluTyrMetCysPro115120125AspGlySerTyrAlaIleGlnGluAsnIleProLeuLeuIleAlaGly130135140ValIleGlyGlySerTyrSerSerValSerIleGlnValAlaAsnLeu145150155160LeuArgLeuPheGlnIleProGlnIleSerTyrAlaSerThrSerAla165170175LysLeuSerAspLysSerArgTyrAspTyrPheAlaArgThrValPro180185190ProAspPheTyrGlnAlaLysAlaMetAlaGluIleLeuArgPhePhe195200205AsnTrpThrTyrValSerThrValAlaSerGluGlyAspTyrGlyGlu210215220ThrGlyIleGluAlaPheGluGlnGluAlaArgLeuArgAsnIleCys225230235240IleAlaThrAlaGluLysValGlyArgSerAsnIleArgLysSerTyr245250255AspSerValIleArgGluLeuLeuGlnLysProAsnAlaArgValVal260265270ValLeuPheMetArgSerAspAspSerArgGluLeuIleAlaAlaAla275280285SerArgAlaAsnAlaSerPheThrTrpValAlaSerAspGlyTrpGly290295300AlaGlnGluSerIleIleLysGlySerGluHisValAlaTyrGlyAsp305310315320IleThrLeuGluLeuAlaSerGlnProValArgGlnPheGlyArgTyr325330335PheGlnSerLeuAsnProTyrAsnAsnHisArgAsnProTrpPheArg340345350AspPheTrpGluGlnLysPheGlnCysSerLeuGlnAsnLysArgAsn355360365HisArgArgValCysGluLysHisLeuAlaIleAspSerSerAsnTyr370375380GluGlnGluSerLysIleMetPheValValAsnAlaValTyrAlaMet385390395400AlaHisAlaLeuHisLysMetGlnArgThrLeuCysProAsnThrThr405410415LysLeuCysAspAlaMetLysIleLeuAspGlyLysLysLeuTyrLys420425430AspTyrLeuLeuLysIleAsnPheThrAlaProPheAsnProAsnLys435440445AspAlaAspSerIleValLysPheAspThrPheGlyAspGlyMetGly450455460ArgTyrAsnValPheAsnPheGlnAsnValGlyGlyLysTyrSerTyr465470475480LeuLysValGlyHisTrpAlaGluThrLeuSerLeuAspValAsnSer485490495IleHisTrpSerArgAsnSerValProThrSerGlnCysSerAspPro500505510CysAlaProAsnGluMetLysAsnMetGlnProGlyAspValCysCys515520525TrpIleCysIleProCysGluProTyrGluTyrLeuAlaAspGluPhe530535540ThrCysMetAspCysGlySerGlyGlnTrpProThrAlaAspLeuThr545550555560GlyCysTyrAspLeuProGluAspTyrIleArgTrpGluAspAlaTrp565570575AlaIleGlyProValThrIleAlaCysLeuGlyPheMetCysThrCys580585590MetValValThrValPheIleLysHisAsnAsnThrProLeuValLys595600605AlaSerGlyArgGluLeuCysTyrIleLeuLeuPheGlyValGlyLeu610615620SerTyrCysMetThrPhePhePheIleAlaLysProSerProValIle625630635640CysAlaLeuArgArgLeuGlyLeuGlySerSerPheAlaIleCysTyr645650655SerAlaLeuLeuThrLysThrAsnCysIleAlaArgIlePheAspGly660665670ValLysAsnGlyAlaGlnArgProLysPheIleSerProSerSerGln675680685ValPheIleCysLeuGlyLeuIleLeuValGlnIleValMetValSer690695700ValTrpLeuIleLeuGluAlaProGlyThrArgArgTyrThrLeuAla705710715720GluLysArgGluThrValIleLeuLysCysAsnValLysAspSerSer725730735MetLeuIleSerLeuThrTyrAspValIleLeuValIleLeuCysThr740745750ValTyrAlaPheLysThrArgLysCysProGluAsnPheAsnGluAla755760765LysPheIleGlyPheThrMetTyrThrThrCysIleIleTrpLeuAla770775780PheLeuProIlePheTyrValThrSerSerAspTyrArgValGlnThr785790795800ThrThrMetCysIleSerValSerLeuSerGlyPheValValLeuGly805810815CysLeuPheAlaProLysValHisIleIleLeuPheGlnProGlnLys820825830AsnValValThrHisArgLeuHisLeuAsnArgPheSerValSerGly835840845ThrGlyThrThrTyrSerGlnSerSerAlaSerThrTyrValProThr850855860ValCysAsnGlyArgGluValLeuAspSerThrThrSerSerLeu865870875(2) INFORMATION FOR SEQ ID NO:7:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 4085 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: both(D) TOPOLOGY: both(ii) MOLECULE TYPE: cDNA(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 370..3912(D) OTHER INFORMATION: /product="HUMAN MGLUR5A"(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:CAGCTCGGCTGTTCTGCGCACGCTGAGCGGAGGGAATGAGCTTGAGATCATCTTGGGGGG60GAAGCCGGGGACTGGAGAGGCCGGCTCTGCCCTGCTGATCCCCGTGGCCCAACTTTTCGG120GGGGCTAGCTAGACCGAGTCTCACTGCTCGCAGCGCAGCCAACAGGGGGGTTTAGAAGAT180CATGACCACATGGATCATCTAACTAAATGGTACATGGGGACAAAATGGTCCTTTAGAAAA240TACATCTGAATTGCTGGCTAATTTCTTGATTTGCGACTCAACGTAGGACATCGCTTGTTC300GTAGCTATCAGAACCCTCCTGAATTTTCCCCACCATGCTATCTTTATTGGCTTGAACTCC360TTTCCTAAAATGGTCCTTCTGTTGATCCTGTCAGTCTTACTTTGGAAA408MetValLeuLeuLeuIleLeuSerValLeuLeuTrpLys1510GAAGATGTCCGTGGGAGTGCACAGTCCAGTGAGAGGAGGGTGGTGGCT456GluAspValArgGlySerAlaGlnSerSerGluArgArgValValAla152025CACATGCCGGGTGACATCATTATTGGAGCTCTCTTTTCTGTTCATCAC504HisMetProGlyAspIleIleIleGlyAlaLeuPheSerValHisHis30354045CAGCCTACTGTGGACAAAGTTCATGAGAGGAAGTGTGGGGCGGTCCGT552GlnProThrValAspLysValHisGluArgLysCysGlyAlaValArg505560GAACAGTATGGCATTCAGAGAGTGGAGGCCATGCTGCATACCCTGGAA600GluGlnTyrGlyIleGlnArgValGluAlaMetLeuHisThrLeuGlu657075AGGATCAATTCAGACCCCACACTCTTGCCCAACATCACACTGGGCTGT648ArgIleAsnSerAspProThrLeuLeuProAsnIleThrLeuGlyCys808590GAGATAAGGGACTCCTGCTGGCATTCGGCTGTGGCCCTAGAGCAGAGC696GluIleArgAspSerCysTrpHisSerAlaValAlaLeuGluGlnSer95100105ATTGAGTTCATAAGAGATTCCCTCATTTCTTCAGAAGAGGAAGAAGGC744IleGluPheIleArgAspSerLeuIleSerSerGluGluGluGluGly110115120125TTGGTACGCTGTGTGGATGGCTCCTCCTCTTCCTTCCGCTCCAAGAAG792LeuValArgCysValAspGlySerSerSerSerPheArgSerLysLys130135140CCCATAGTAGGGGTCATTGGGCCTGGCTCCAGTTCTGTAGCCATTCAG840ProIleValGlyValIleGlyProGlySerSerSerValAlaIleGln145150155GTCCAGAATTTGCTCCAGCTTTTCAACATACCTCAGATTGCTTACTCA888ValGlnAsnLeuLeuGlnLeuPheAsnIleProGlnIleAlaTyrSer160165170GCAACCAGCATGGATCTGAGTGACAAGACTCTGTTCAAATATTTCATG936AlaThrSerMetAspLeuSerAspLysThrLeuPheLysTyrPheMet175180185AGGGTTGTGCCTTCAGATGCTCAGCAGGCAAGGGCCATGGTGGACATA984ArgValValProSerAspAlaGlnGlnAlaArgAlaMetValAspIle190195200205GTGAAGAGGTACAACTGGACCTATGTATCAGCCGTGCACACAGAAGGC1032ValLysArgTyrAsnTrpThrTyrValSerAlaValHisThrGluGly210215220AACTATGGAGAAAGTGGGATGGAAGCCTCCAAAGATATGTCAGCGAAG1080AsnTyrGlyGluSerGlyMetGluAlaSerLysAspMetSerAlaLys225230235GAAGGGATTTGCATCGCCCACTCTTACAAAATCTACAGTAATGCAGGG1128GluGlyIleCysIleAlaHisSerTyrLysIleTyrSerAsnAlaGly240245250GAGCAGAGCTTTGATAAGCTGCTGAAGAAGCTCACAAGTCACTTGCCC1176GluGlnSerPheAspLysLeuLeuLysLysLeuThrSerHisLeuPro255260265AAGGCCCGGGTGGTGGCCTGCTTCTGTGAGGGCATGACGGTGAGAGGT1224LysAlaArgValValAlaCysPheCysGluGlyMetThrValArgGly270275280285CTGCTGATGGCCATGAGGCGCCTGGGTCTAGCGGGAGAATTTCTGCTT1272LeuLeuMetAlaMetArgArgLeuGlyLeuAlaGlyGluPheLeuLeu290295300CTGGGCAGTGATGGCTGGGCTGACAGGTATGATGTGACAGATGGATAT1320LeuGlySerAspGlyTrpAlaAspArgTyrAspValThrAspGlyTyr305310315CAGCGAGAAGCTGTTGGTGGCATCACAATCAAGCTCCAATCTCCCGAT1368GlnArgGluAlaValGlyGlyIleThrIleLysLeuGlnSerProAsp320325330GTCAAGTGGTTTGATGATTATTATCTGAAGCTCCGGCCAGAAACAAAC1416ValLysTrpPheAspAspTyrTyrLeuLysLeuArgProGluThrAsn335340345CACCGAAACCCTTGGTTTCAAGAATTTTGGCAGCATCGTTTTCAGTGC1464HisArgAsnProTrpPheGlnGluPheTrpGlnHisArgPheGlnCys350355360365CGACTGGAAGCGTTTCCACAGGAGAACAGCAAATACAACAAGACTTGC1512ArgLeuGluAlaPheProGlnGluAsnSerLysTyrAsnLysThrCys370375380AATAGTTCTCTGACTCTGAAAACACATCATGTTCAGGATTCCAAAATG1560AsnSerSerLeuThrLeuLysThrHisHisValGlnAspSerLysMet385390395GGATTTGTGATCAACGCCATCTATTCGATGGCCTATGGGCTCCACAAC1608GlyPheValIleAsnAlaIleTyrSerMetAlaTyrGlyLeuHisAsn400405410ATGCAGATGTCCCTCTGCCCAGGCTATGCAGGACTCTGTGATGCCATG1656MetGlnMetSerLeuCysProGlyTyrAlaGlyLeuCysAspAlaMet415420425AAGCCAATTGATGGACGGAAACTTTTGGAGTCCCTGATGAAAACCAAT1704LysProIleAspGlyArgLysLeuLeuGluSerLeuMetLysThrAsn430435440445TTTACTGGGGTTTCTGGAGATACGATCCTATTCGATGAGAATGGAGAC1752PheThrGlyValSerGlyAspThrIleLeuPheAspGluAsnGlyAsp450455460TCTCCAGGAAGGTATGAAATAATGAATTTCAAGGAAATGGGAAAAGAT1800SerProGlyArgTyrGluIleMetAsnPheLysGluMetGlyLysAsp465470475TACTTTGATTATATCAACGTTGGAAGTTGGGACAATGGAGAATTAAAA1848TyrPheAspTyrIleAsnValGlySerTrpAspAsnGlyGluLeuLys480485490ATGGATGATGATGAAGTATGGTCCAAGAAAAGCAACATCATCAGATCT1896MetAspAspAspGluValTrpSerLysLysSerAsnIleIleArgSer495500505GTGTGCAGTGAACCATGTGAGAAAGGCCAGATCAAGGTGATCCGAAAG1944ValCysSerGluProCysGluLysGlyGlnIleLysValIleArgLys510515520525GGAGAAGTCAGCTGTTGTTGGACCTGTACACCTTGTAAGGAGAATGAG1992GlyGluValSerCysCysTrpThrCysThrProCysLysGluAsnGlu530535540TATGTCTTTGATGAGTACACATGCAAGGCATGCCAACTGGGGTCTTGG2040TyrValPheAspGluTyrThrCysLysAlaCysGlnLeuGlySerTrp545550555CCCACTGATGATCTCACAGGTTGTGACTTGATCCCAGTACAGTATCTT2088ProThrAspAspLeuThrGlyCysAspLeuIleProValGlnTyrLeu560565570CGATGGGGTGACCCTGAACCCATTGCAGCTGTGGTGTTTGCCTGCCTT2136ArgTrpGlyAspProGluProIleAlaAlaValValPheAlaCysLeu575580585GGCCTCCTGGCCACCCTGTTTGTTACTGTAGTCTTCATCATTTACCGT2184GlyLeuLeuAlaThrLeuPheValThrValValPheIleIleTyrArg590595600605GATACACCAGTAGTCAAGTCCTCAAGCAGGGAACTCTGCTACATTATC2232AspThrProValValLysSerSerSerArgGluLeuCysTyrIleIle610615620CTTGCTGGCATCTGCCTGGGCTACTTATGTACCTTCTGCCTCATTGCG2280LeuAlaGlyIleCysLeuGlyTyrLeuCysThrPheCysLeuIleAla625630635AAGCCCAAACAGATTTACTGCTACCTTCAGAGAATTGGCATTGGTCTC2328LysProLysGlnIleTyrCysTyrLeuGlnArgIleGlyIleGlyLeu640645650TCCCCAGCCATGAGCTACTCAGCCCTTGTAACAAAGACCAACCGTATT2376SerProAlaMetSerTyrSerAlaLeuValThrLysThrAsnArgIle655660665GCAAGGATCCTGGCTGGCAGCAAGAAGAAGATCTGTACCCCCAAGCCC2424AlaArgIleLeuAlaGlySerLysLysLysIleCysThrProLysPro670675680685AGATTCATGAGTGCCTGTGCCCAGCTAGTGATTGCTTTCATTCTCATA2472ArgPheMetSerAlaCysAlaGlnLeuValIleAlaPheIleLeuIle690695700TGCATCCAGTTGGGCATCATCGTTGCCCTCTTTATAATGGAGCCTCCT2520CysIleGlnLeuGlyIleIleValAlaLeuPheIleMetGluProPro705710715GACATAATGCATGACTACCCAAGCATTCGAGAAGTCTACCTGATCTGT2568AspIleMetHisAspTyrProSerIleArgGluValTyrLeuIleCys720725730AACACCACCAACCTAGGAGTTGTCACTCCACTTGGAAACAATGGATTG2616AsnThrThrAsnLeuGlyValValThrProLeuGlyAsnAsnGlyLeu735740745TTGATTTTGAGCTGCACCTTCTATGCGTTCAAGACCAGAAATGTTCCA2664LeuIleLeuSerCysThrPheTyrAlaPheLysThrArgAsnValPro750755760765GCTAACTTCCCCGAGGCCAAGTATATCGCCTTCACAATGTACACGACC2712AlaAsnPheProGluAlaLysTyrIleAlaPheThrMetTyrThrThr770775780TGCATTATATGGCTAGCTTTTGTTCCAATCTACTTTGGCAGCAACTAC2760CysIleIleTrpLeuAlaPheValProIleTyrPheGlySerAsnTyr785790795AAAATCATCACCATGTGTTTCTCGGTCAGCCTCAGTGCCACAGTGGCC2808LysIleIleThrMetCysPheSerValSerLeuSerAlaThrValAla800805810CTAGGCTGCATGTTTGTGCCGAAGGTGTACATCATCCTGGCCAAACCA2856LeuGlyCysMetPheValProLysValTyrIleIleLeuAlaLysPro815820825GAGAGAAACGTGCGCAGCGCCTTCACCACATCTACCGTGGTGCGCATG2904GluArgAsnValArgSerAlaPheThrThrSerThrValValArgMet830835840845CATGTAGGGGATGGCAAGTCATCCTCCGCAGCCAGCAGATCCAGCAGC2952HisValGlyAspGlyLysSerSerSerAlaAlaSerArgSerSerSer850855860CTAGTCAACCTGTGGAAGAGAAGGGGCTCCTCTGGGGAAACCTTAAGT3000LeuValAsnLeuTrpLysArgArgGlySerSerGlyGluThrLeuSer865870875TCCAATGGAAAATCCGTCACGTGGGCCCAGAATGAGAAGAGCAGCCGG3048SerAsnGlyLysSerValThrTrpAlaGlnAsnGluLysSerSerArg880885890GGGCAGCACCTGTGGCAGCGCCTGTCCATCCACATCAACAAGAAAGAA3096GlyGlnHisLeuTrpGlnArgLeuSerIleHisIleAsnLysLysGlu895900905AACCCCAACCAAACGGCCGTCATCAAGCCCTTCCCCAAGAGCACGGAG3144AsnProAsnGlnThrAlaValIleLysProPheProLysSerThrGlu910915920925AGCCGTGGCCTGGGCGCTGGCGCTGGCGCAGGCGGGAGCGCTGGGGGC3192SerArgGlyLeuGlyAlaGlyAlaGlyAlaGlyGlySerAlaGlyGly930935940GTGGGGGCCACGGGCGGTGCGGGCTGCGCAGGCGCCGGCCCAGGCGGG3240ValGlyAlaThrGlyGlyAlaGlyCysAlaGlyAlaGlyProGlyGly945950955CCCGAGTCCCCAGACGCCGGCCCCAAGGCGCTGTATGATGTGGCCGAG3288ProGluSerProAspAlaGlyProLysAlaLeuTyrAspValAlaGlu960965970GCTGAGGAGCACTTCCCGGCGCCCGCGCGGCCGCGCTCACCGTCGCCC3336AlaGluGluHisPheProAlaProAlaArgProArgSerProSerPro975980985ATCAGCACGCTGAGCCACCGCGCGGGCTCGGCCAGCCGCACGGACGAC3384IleSerThrLeuSerHisArgAlaGlySerAlaSerArgThrAspAsp99099510001005GATGTGCCGTCGCTGCACTCGGAGCCTGTGGCGCGCAGCAGCTCCTCG3432AspValProSerLeuHisSerGluProValAlaArgSerSerSerSer101010151020CAGGGCTCCCTCATGGAGCAGATCAGCAGTGTGGTCACCCGCTTCACG3480GlnGlySerLeuMetGluGlnIleSerSerValValThrArgPheThr102510301035GCCAACATCAGCGAGCTCAACTCCATGATGCTGTCCACCGCGGCCCCC3528AlaAsnIleSerGluLeuAsnSerMetMetLeuSerThrAlaAlaPro104010451050AGCCCCGGCGTCGGCGCCCCGCTCTGCTCGTCCTACCTGATCCCCAAA3576SerProGlyValGlyAlaProLeuCysSerSerTyrLeuIleProLys105510601065GAGATCCAGTTGCCCACGACCATGACGACCTTTGCCGAAATCCAGCCT3624GluIleGlnLeuProThrThrMetThrThrPheAlaGluIleGlnPro1070107510801085CTGCCGGCCATCGAAGTCACGGGCGGCGCTCAGCCCGCGGCAGGGGCG3672LeuProAlaIleGluValThrGlyGlyAlaGlnProAlaAlaGlyAla109010951100CAGGCGGCTGGGGACGCGGCCCGGGAGAGCCCCGCGGCCGGTCCCGAG3720GlnAlaAlaGlyAspAlaAlaArgGluSerProAlaAlaGlyProGlu110511101115GCTGCGGCCGCCAAGCCAGACCTGGAGGAGCTGGTGGCTCTCACCCCG3768AlaAlaAlaAlaLysProAspLeuGluGluLeuValAlaLeuThrPro112011251130CCGTCCCCCTTCAGAGACTCGGTGGACTCGGGGAGCACAACCCCCAAC3816ProSerProPheArgAspSerValAspSerGlySerThrThrProAsn113511401145TCGCCAGTGTCCGAGTCGGCCCTCTGTATCCCGTCGTCTCCCAAATAT3864SerProValSerGluSerAlaLeuCysIleProSerSerProLysTyr1150115511601165GACACTCTTATCATAAGAGATTACACTCAGAGCTCCAspThrLeuIleIleArgAspTyrThrGlnSerSer11701175TCGTCGTTGTGAATGTCCC3919SerSerLeu1180TGGAAAGCACGCCGGCCTGCGCGTGCGGAGCGGAGCCCCCCGTGTTCACACACACACAAT3979GGCAAGCATAGTCGCCTGGTTACGGCCCAGGGGGAAGATGCCAAGGGCACCCCTTAATGG4039AAACACGAGATCAGTAGTGCTATCTCATGACAACCGACGAAGAAAC4085(2) INFORMATION FOR SEQ ID NO:8:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1180 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:MetValLeuLeuLeuIleLeuSerValLeuLeuTrpLysGluAspVal151015ArgGlySerAlaGlnSerSerGluArgArgValValAlaHisMetPro202530GlyAspIleIleIleGlyAlaLeuPheSerValHisHisGlnProThr354045ValAspLysValHisGluArgLysCysGlyAlaValArgGluGlnTyr505560GlyIleGlnArgValGluAlaMetLeuHisThrLeuGluArgIleAsn65707580SerAspProThrLeuLeuProAsnIleThrLeuGlyCysGluIleArg859095AspSerCysTrpHisSerAlaValAlaLeuGluGlnSerIleGluPhe100105110IleArgAspSerLeuIleSerSerGluGluGluGluGlyLeuValArg115120125CysValAspGlySerSerSerSerPheArgSerLysLysProIleVal130135140GlyValIleGlyProGlySerSerSerValAlaIleGlnValGlnAsn145150155160LeuLeuGlnLeuPheAsnIleProGlnIleAlaTyrSerAlaThrSer165170175MetAspLeuSerAspLysThrLeuPheLysTyrPheMetArgValVal180185190ProSerAspAlaGlnGlnAlaArgAlaMetValAspIleValLysArg195200205TyrAsnTrpThrTyrValSerAlaValHisThrGluGlyAsnTyrGly210215220GluSerGlyMetGluAlaSerLysAspMetSerAlaLysGluGlyIle225230235240CysIleAlaHisSerTyrLysIleTyrSerAsnAlaGlyGluGlnSer245250255PheAspLysLeuLeuLysLysLeuThrSerHisLeuProLysAlaArg260265270ValValAlaCysPheCysGluGlyMetThrValArgGlyLeuLeuMet275280285AlaMetArgArgLeuGlyLeuAlaGlyGluPheLeuLeuLeuGlySer290295300AspGlyTrpAlaAspArgTyrAspValThrAspGlyTyrGlnArgGlu305310315320AlaValGlyGlyIleThrIleLysLeuGlnSerProAspValLysTrp325330335PheAspAspTyrTyrLeuLysLeuArgProGluThrAsnHisArgAsn340345350ProTrpPheGlnGluPheTrpGlnHisArgPheGlnCysArgLeuGlu355360365AlaPheProGlnGluAsnSerLysTyrAsnLysThrCysAsnSerSer370375380LeuThrLeuLysThrHisHisValGlnAspSerLysMetGlyPheVal385390395400IleAsnAlaIleTyrSerMetAlaTyrGlyLeuHisAsnMetGlnMet405410415SerLeuCysProGlyTyrAlaGlyLeuCysAspAlaMetLysProIle420425430AspGlyArgLysLeuLeuGluSerLeuMetLysThrAsnPheThrGly435440445ValSerGlyAspThrIleLeuPheAspGluAsnGlyAspSerProGly450455460ArgTyrGluIleMetAsnPheLysGluMetGlyLysAspTyrPheAsp465470475480TyrIleAsnValGlySerTrpAspAsnGlyGluLeuLysMetAspAsp485490495AspGluValTrpSerLysLysSerAsnIleIleArgSerValCysSer500505510GluProCysGluLysGlyGlnIleLysValIleArgLysGlyGluVal515520525SerCysCysTrpThrCysThrProCysLysGluAsnGluTyrValPhe530535540AspGluTyrThrCysLysAlaCysGlnLeuGlySerTrpProThrAsp545550555560AspLeuThrGlyCysAspLeuIleProValGlnTyrLeuArgTrpGly565570575AspProGluProIleAlaAlaValValPheAlaCysLeuGlyLeuLeu580585590AlaThrLeuPheValThrValValPheIleIleTyrArgAspThrPro595600605ValValLysSerSerSerArgGluLeuCysTyrIleIleLeuAlaGly610615620IleCysLeuGlyTyrLeuCysThrPheCysLeuIleAlaLysProLys625630635640GlnIleTyrCysTyrLeuGlnArgIleGlyIleGlyLeuSerProAla645650655MetSerTyrSerAlaLeuValThrLysThrAsnArgIleAlaArgIle660665670LeuAlaGlySerLysLysLysIleCysThrProLysProArgPheMet675680685SerAlaCysAlaGlnLeuValIleAlaPheIleLeuIleCysIleGln690695700LeuGlyIleIleValAlaLeuPheIleMetGluProProAspIleMet705710715720HisAspTyrProSerIleArgGluValTyrLeuIleCysAsnThrThr725730735AsnLeuGlyValValThrProLeuGlyAsnAsnGlyLeuLeuIleLeu740745750SerCysThrPheTyrAlaPheLysThrArgAsnValProAlaAsnPhe755760765ProGluAlaLysTyrIleAlaPheThrMetTyrThrThrCysIleIle770775780TrpLeuAlaPheValProIleTyrPheGlySerAsnTyrLysIleIle785790795800ThrMetCysPheSerValSerLeuSerAlaThrValAlaLeuGlyCys805810815MetPheValProLysValTyrIleIleLeuAlaLysProGluArgAsn820825830ValArgSerAlaPheThrThrSerThrValValArgMetHisValGly835840845AspGlyLysSerSerSerAlaAlaSerArgSerSerSerLeuValAsn850855860LeuTrpLysArgArgGlySerSerGlyGluThrLeuSerSerAsnGly865870875880LysSerValThrTrpAlaGlnAsnGluLysSerSerArgGlyGlnHis885890895LeuTrpGlnArgLeuSerIleHisIleAsnLysLysGluAsnProAsn900905910GlnThrAlaValIleLysProPheProLysSerThrGluSerArgGly915920925LeuGlyAlaGlyAlaGlyAlaGlyGlySerAlaGlyGlyValGlyAla930935940ThrGlyGlyAlaGlyCysAlaGlyAlaGlyProGlyGlyProGluSer945950955960ProAspAlaGlyProLysAlaLeuTyrAspValAlaGluAlaGluGlu965970975HisPheProAlaProAlaArgProArgSerProSerProIleSerThr980985990LeuSerHisArgAlaGlySerAlaSerArgThrAspAspAspValPro99510001005SerLeuHisSerGluProValAlaArgSerSerSerSerGlnGlySer101010151020LeuMetGluGlnIleSerSerValValThrArgPheThrAlaAsnIle1025103010351040SerGluLeuAsnSerMetMetLeuSerThrAlaAlaProSerProGly104510501055ValGlyAlaProLeuCysSerSerTyrLeuIleProLysGluIleGln106010651070LeuProThrThrMetThrThrPheAlaGluIleGlnProLeuProAla107510801085IleGluValThrGlyGlyAlaGlnProAlaAlaGlyAlaGlnAlaAla109010951100GlyAspAlaAlaArgGluSerProAlaAlaGlyProGluAlaAlaAla1105111011151120AlaLysProAspLeuGluGluLeuValAlaLeuThrProProSerPro112511301135PheArgAspSerValAspSerGlySerThrThrProAsnSerProVal114011451150SerGluSerAlaLeuCysIleProSerSerProLysTyrAspThrLeu115511601165IleIleArgAspTyrThrGlnSerSerSerSerLeu117011751180(2) INFORMATION FOR SEQ ID NO:9:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 4181 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: both(D) TOPOLOGY: both(ii) MOLECULE TYPE: cDNA(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 370..4008(D) OTHER INFORMATION: /product="HUMAN MGLUR5B"/note= "Variant of MGLUR5A with 96 base pairinsertion between nucleotides 2998 and 2999."(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:CAGCTCGGCTGTTCTGCGCACGCTGAGCGGAGGGAATGAGCTTGAGATCATCTTGGGGGG60GAAGCCGGGGACTGGAGAGGCCGGCTCTGCCCTGCTGATCCCCGTGGCCCAACTTTTCGG120GGGGCTAGCTAGACCGAGTCTCACTGCTCGCAGCGCAGCCAACAGGGGGGTTTAGAAGAT180CATGACCACATGGATCATCTAACTAAATGGTACATGGGGACAAAATGGTCCTTTAGAAAA240TACATCTGAATTGCTGGCTAATTTCTTGATTTGCGACTCAACGTAGGACATCGCTTGTTC300GTAGCTATCAGAACCCTCCTGAATTTTCCCCACCATGCTATCTTTATTGGCTTGAACTCC360TTTCCTAAAATGGTCCTTCTGTTGATCCTGTCAGTCTTACTTTGGAAA408MetValLeuLeuLeuIleLeuSerValLeuLeuTrpLys1510GAAGATGTCCGTGGGAGTGCACAGTCCAGTGAGAGGAGGGTGGTGGCT456GluAspValArgGlySerAlaGlnSerSerGluArgArgValValAla152025CACATGCCGGGTGACATCATTATTGGAGCTCTCTTTTCTGTTCATCAC504HisMetProGlyAspIleIleIleGlyAlaLeuPheSerValHisHis30354045CAGCCTACTGTGGACAAAGTTCATGAGAGGAAGTGTGGGGCGGTCCGT552GlnProThrValAspLysValHisGluArgLysCysGlyAlaValArg505560GAACAGTATGGCATTCAGAGAGTGGAGGCCATGCTGCATACCCTGGAA600GluGlnTyrGlyIleGlnArgValGluAlaMetLeuHisThrLeuGlu657075AGGATCAATTCAGACCCCACACTCTTGCCCAACATCACACTGGGCTGT648ArgIleAsnSerAspProThrLeuLeuProAsnIleThrLeuGlyCys808590GAGATAAGGGACTCCTGCTGGCATTCGGCTGTGGCCCTAGAGCAGAGC696GluIleArgAspSerCysTrpHisSerAlaValAlaLeuGluGlnSer95100105ATTGAGTTCATAAGAGATTCCCTCATTTCTTCAGAAGAGGAAGAAGGC744IleGluPheIleArgAspSerLeuIleSerSerGluGluGluGluGly110115120125TTGGTACGCTGTGTGGATGGCTCCTCCTCTTCCTTCCGCTCCAAGAAG792LeuValArgCysValAspGlySerSerSerSerPheArgSerLysLys130135140CCCATAGTAGGGGTCATTGGGCCTGGCTCCAGTTCTGTAGCCATTCAG840ProIleValGlyValIleGlyProGlySerSerSerValAlaIleGln145150155GTCCAGAATTTGCTCCAGCTTTTCAACATACCTCAGATTGCTTACTCA888ValGlnAsnLeuLeuGlnLeuPheAsnIleProGlnIleAlaTyrSer160165170GCAACCAGCATGGATCTGAGTGACAAGACTCTGTTCAAATATTTCATG936AlaThrSerMetAspLeuSerAspLysThrLeuPheLysTyrPheMet175180185AGGGTTGTGCCTTCAGATGCTCAGCAGGCAAGGGCCATGGTGGACATA984ArgValValProSerAspAlaGlnGlnAlaArgAlaMetValAspIle190195200205GTGAAGAGGTACAACTGGACCTATGTATCAGCCGTGCACACAGAAGGC1032ValLysArgTyrAsnTrpThrTyrValSerAlaValHisThrGluGly210215220AACTATGGAGAAAGTGGGATGGAAGCCTCCAAAGATATGTCAGCGAAG1080AsnTyrGlyGluSerGlyMetGluAlaSerLysAspMetSerAlaLys225230235GAAGGGATTTGCATCGCCCACTCTTACAAAATCTACAGTAATGCAGGG1128GluGlyIleCysIleAlaHisSerTyrLysIleTyrSerAsnAlaGly240245250GAGCAGAGCTTTGATAAGCTGCTGAAGAAGCTCACAAGTCACTTGCCC1176GluGlnSerPheAspLysLeuLeuLysLysLeuThrSerHisLeuPro255260265AAGGCCCGGGTGGTGGCCTGCTTCTGTGAGGGCATGACGGTGAGAGGT1224LysAlaArgValValAlaCysPheCysGluGlyMetThrValArgGly270275280285CTGCTGATGGCCATGAGGCGCCTGGGTCTAGCGGGAGAATTTCTGCTT1272LeuLeuMetAlaMetArgArgLeuGlyLeuAlaGlyGluPheLeuLeu290295300CTGGGCAGTGATGGCTGGGCTGACAGGTATGATGTGACAGATGGATAT1320LeuGlySerAspGlyTrpAlaAspArgTyrAspValThrAspGlyTyr305310315CAGCGAGAAGCTGTTGGTGGCATCACAATCAAGCTCCAATCTCCCGAT1368GlnArgGluAlaValGlyGlyIleThrIleLysLeuGlnSerProAsp320325330GTCAAGTGGTTTGATGATTATTATCTGAAGCTCCGGCCAGAAACAAAC1416ValLysTrpPheAspAspTyrTyrLeuLysLeuArgProGluThrAsn335340345CACCGAAACCCTTGGTTTCAAGAATTTTGGCAGCATCGTTTTCAGTGC1464HisArgAsnProTrpPheGlnGluPheTrpGlnHisArgPheGlnCys350355360365CGACTGGAAGCGTTTCCACAGGAGAACAGCAAATACAACAAGACTTGC1512ArgLeuGluAlaPheProGlnGluAsnSerLysTyrAsnLysThrCys370375380AATAGTTCTCTGACTCTGAAAACACATCATGTTCAGGATTCCAAAATG1560AsnSerSerLeuThrLeuLysThrHisHisValGlnAspSerLysMet385390395GGATTTGTGATCAACGCCATCTATTCGATGGCCTATGGGCTCCACAAC1608GlyPheValIleAsnAlaIleTyrSerMetAlaTyrGlyLeuHisAsn400405410ATGCAGATGTCCCTCTGCCCAGGCTATGCAGGACTCTGTGATGCCATG1656MetGlnMetSerLeuCysProGlyTyrAlaGlyLeuCysAspAlaMet415420425AAGCCAATTGATGGACGGAAACTTTTGGAGTCCCTGATGAAAACCAAT1704LysProIleAspGlyArgLysLeuLeuGluSerLeuMetLysThrAsn430435440445TTTACTGGGGTTTCTGGAGATACGATCCTATTCGATGAGAATGGAGAC1752PheThrGlyValSerGlyAspThrIleLeuPheAspGluAsnGlyAsp450455460TCTCCAGGAAGGTATGAAATAATGAATTTCAAGGAAATGGGAAAAGAT1800SerProGlyArgTyrGluIleMetAsnPheLysGluMetGlyLysAsp465470475TACTTTGATTATATCAACGTTGGAAGTTGGGACAATGGAGAATTAAAA1848TyrPheAspTyrIleAsnValGlySerTrpAspAsnGlyGluLeuLys480485490ATGGATGATGATGAAGTATGGTCCAAGAAAAGCAACATCATCAGATCT1896MetAspAspAspGluValTrpSerLysLysSerAsnIleIleArgSer495500505GTGTGCAGTGAACCATGTGAGAAAGGCCAGATCAAGGTGATCCGAAAG1944ValCysSerGluProCysGluLysGlyGlnIleLysValIleArgLys510515520525GGAGAAGTCAGCTGTTGTTGGACCTGTACACCTTGTAAGGAGAATGAG1992GlyGluValSerCysCysTrpThrCysThrProCysLysGluAsnGlu530535540TATGTCTTTGATGAGTACACATGCAAGGCATGCCAACTGGGGTCTTGG2040TyrValPheAspGluTyrThrCysLysAlaCysGlnLeuGlySerTrp545550555CCCACTGATGATCTCACAGGTTGTGACTTGATCCCAGTACAGTATCTT2088ProThrAspAspLeuThrGlyCysAspLeuIleProValGlnTyrLeu560565570CGATGGGGTGACCCTGAACCCATTGCAGCTGTGGTGTTTGCCTGCCTT2136ArgTrpGlyAspProGluProIleAlaAlaValValPheAlaCysLeu575580585GGCCTCCTGGCCACCCTGTTTGTTACTGTAGTCTTCATCATTTACCGT2184GlyLeuLeuAlaThrLeuPheValThrValValPheIleIleTyrArg590595600605GATACACCAGTAGTCAAGTCCTCAAGCAGGGAACTCTGCTACATTATC2232AspThrProValValLysSerSerSerArgGluLeuCysTyrIleIle610615620CTTGCTGGCATCTGCCTGGGCTACTTATGTACCTTCTGCCTCATTGCG2280LeuAlaGlyIleCysLeuGlyTyrLeuCysThrPheCysLeuIleAla625630635AAGCCCAAACAGATTTACTGCTACCTTCAGAGAATTGGCATTGGTCTC2328LysProLysGlnIleTyrCysTyrLeuGlnArgIleGlyIleGlyLeu640645650TCCCCAGCCATGAGCTACTCAGCCCTTGTAACAAAGACCAACCGTATT2376SerProAlaMetSerTyrSerAlaLeuValThrLysThrAsnArgIle655660665GCAAGGATCCTGGCTGGCAGCAAGAAGAAGATCTGTACCCCCAAGCCC2424AlaArgIleLeuAlaGlySerLysLysLysIleCysThrProLysPro670675680685AGATTCATGAGTGCCTGTGCCCAGCTAGTGATTGCTTTCATTCTCATA2472ArgPheMetSerAlaCysAlaGlnLeuValIleAlaPheIleLeuIle690695700TGCATCCAGTTGGGCATCATCGTTGCCCTCTTTATAATGGAGCCTCCT2520CysIleGlnLeuGlyIleIleValAlaLeuPheIleMetGluProPro705710715GACATAATGCATGACTACCCAAGCATTCGAGAAGTCTACCTGATCTGT2568AspIleMetHisAspTyrProSerIleArgGluValTyrLeuIleCys720725730AACACCACCAACCTAGGAGTTGTCACTCCACTTGGAAACAATGGATTG2616AsnThrThrAsnLeuGlyValValThrProLeuGlyAsnAsnGlyLeu735740745TTGATTTTGAGCTGCACCTTCTATGCGTTCAAGACCAGAAATGTTCCA2664LeuIleLeuSerCysThrPheTyrAlaPheLysThrArgAsnValPro750755760765GCTAACTTCCCCGAGGCCAAGTATATCGCCTTCACAATGTACACGACC2712AlaAsnPheProGluAlaLysTyrIleAlaPheThrMetTyrThrThr770775780TGCATTATATGGCTAGCTTTTGTTCCAATCTACTTTGGCAGCAACTAC2760CysIleIleTrpLeuAlaPheValProIleTyrPheGlySerAsnTyr785790795AAAATCATCACCATGTGTTTCTCGGTCAGCCTCAGTGCCACAGTGGCC2808LysIleIleThrMetCysPheSerValSerLeuSerAlaThrValAla800805810CTAGGCTGCATGTTTGTGCCGAAGGTGTACATCATCCTGGCCAAACCA2856LeuGlyCysMetPheValProLysValTyrIleIleLeuAlaLysPro815820825GAGAGAAACGTGCGCAGCGCCTTCACCACATCTACCGTGGTGCGCATG2904GluArgAsnValArgSerAlaPheThrThrSerThrValValArgMet830835840845CATGTAGGGGATGGCAAGTCATCCTCCGCAGCCAGCAGATCCAGCAGC2952HisValGlyAspGlyLysSerSerSerAlaAlaSerArgSerSerSer850855860CTAGTCAACCTGTGGAAGAGAAGGGGCTCCTCTGGGGAAACCTTAAGG3000LeuValAsnLeuTrpLysArgArgGlySerSerGlyGluThrLeuArg865870875TACAAAGACAGGAGACTGGCCCAGCACAAGTCGGAAATAGAGTGTTTC3048TyrLysAspArgArgLeuAlaGlnHisLysSerGluIleGluCysPhe880885890ACCCCCAAAGGGAGTATGGGGAATGGTGGGAGAGCAACAATGAGCAGT3096ThrProLysGlySerMetGlyAsnGlyGlyArgAlaThrMetSerSer895900905TCCAATGGAAAATCCGTCACGTGGGCCCAGAATGAGAAGAGCAGCCGG3144SerAsnGlyLysSerValThrTrpAlaGlnAsnGluLysSerSerArg910915920925GGGCAGCACCTGTGGCAGCGCCTGTCCATCCACATCAACAAGAAAGAA3192GlyGlnHisLeuTrpGlnArgLeuSerIleHisIleAsnLysLysGlu930935940AACCCCAACCAAACGGCCGTCATCAAGCCCTTCCCCAAGAGCACGGAG3240AsnProAsnGlnThrAlaValIleLysProPheProLysSerThrGlu945950955AGCCGTGGCCTGGGCGCTGGCGCTGGCGCAGGCGGGAGCGCTGGGGGC3288SerArgGlyLeuGlyAlaGlyAlaGlyAlaGlyGlySerAlaGlyGly960965970GTGGGGGCCACGGGCGGTGCGGGCTGCGCAGGCGCCGGCCCAGGCGGG3336ValGlyAlaThrGlyGlyAlaGlyCysAlaGlyAlaGlyProGlyGly975980985CCCGAGTCCCCAGACGCCGGCCCCAAGGCGCTGTATGATGTGGCCGAG3384ProGluSerProAspAlaGlyProLysAlaLeuTyrAspValAlaGlu99099510001005GCTGAGGAGCACTTCCCGGCGCCCGCGCGGCCGCGCTCACCGTCGCCC3432AlaGluGluHisPheProAlaProAlaArgProArgSerProSerPro101010151020ATCAGCACGCTGAGCCACCGCGCGGGCTCGGCCAGCCGCACGGACGAC3480IleSerThrLeuSerHisArgAlaGlySerAlaSerArgThrAspAsp102510301035GATGTGCCGTCGCTGCACTCGGAGCCTGTGGCGCGCAGCAGCTCCTCG3528AspValProSerLeuHisSerGluProValAlaArgSerSerSerSer104010451050CAGGGCTCCCTCATGGAGCAGATCAGCAGTGTGGTCACCCGCTTCACG3576GlnGlySerLeuMetGluGlnIleSerSerValValThrArgPheThr105510601065GCCAACATCAGCGAGCTCAACTCCATGATGCTGTCCACCGCGGCCCCC3624AlaAsnIleSerGluLeuAsnSerMetMetLeuSerThrAlaAlaPro1070107510801085AGCCCCGGCGTCGGCGCCCCGCTCTGCTCGTCCTACCTGATCCCCAAA3672SerProGlyValGlyAlaProLeuCysSerSerTyrLeuIleProLys109010951100GAGATCCAGTTGCCCACGACCATGACGACCTTTGCCGAAATCCAGCCT3720GluIleGlnLeuProThrThrMetThrThrPheAlaGluIleGlnPro110511101115CTGCCGGCCATCGAAGTCACGGGCGGCGCTCAGCCCGCGGCAGGGGCG3768LeuProAlaIleGluValThrGlyGlyAlaGlnProAlaAlaGlyAla112011251130CAGGCGGCTGGGGACGCGGCCCGGGAGAGCCCCGCGGCCGGTCCCGAG3816GlnAlaAlaGlyAspAlaAlaArgGluSerProAlaAlaGlyProGlu113511401145GCTGCGGCCGCCAAGCCAGACCTGGAGGAGCTGGTGGCTCTCACCCCG3864AlaAlaAlaAlaLysProAspLeuGluGluLeuValAlaLeuThrPro1150115511601165CCGTCCCCCTTCAGAGACTCGGTGGACTCGGGGAGCACAACCCCCAAC3912ProSerProPheArgAspSerValAspSerGlySerThrThrProAsn117011751180TCGCCAGTGTCCGAGTCGGCCCTCTGTATCCCGTCGTCTCCCAAATAT3960SerProValSerGluSerAlaLeuCysIleProSerSerProLysTyr118511901195GACACTCTTATCATAAGAGATTACACTCAGAGCTCCTCGTCGTTGTGAATGTC4015AspThrLeuIleIleArgAspTyrThrGlnSerSerSerSerLeu120012051210TGGAAAGCACGCCGGCCTGCGCGTGCGGAGCGGAGCCCCCCGTGTTCACACACACACAAT4075GGCAAGCATAGTCGCCTGGTTACGGCCCAGGGGGAAGATGCCAAGGGCACCCCTTAATGG4135AAACACGAGATCAGTAGTGCTATCTCATGACAACCGACGAAGAAAC4181(2) INFORMATION FOR SEQ ID NO:10:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1212 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:MetValLeuLeuLeuIleLeuSerValLeuLeuTrpLysGluAspVal151015ArgGlySerAlaGlnSerSerGluArgArgValValAlaHisMetPro202530GlyAspIleIleIleGlyAlaLeuPheSerValHisHisGlnProThr354045ValAspLysValHisGluArgLysCysGlyAlaValArgGluGlnTyr505560GlyIleGlnArgValGluAlaMetLeuHisThrLeuGluArgIleAsn65707580SerAspProThrLeuLeuProAsnIleThrLeuGlyCysGluIleArg859095AspSerCysTrpHisSerAlaValAlaLeuGluGlnSerIleGluPhe100105110IleArgAspSerLeuIleSerSerGluGluGluGluGlyLeuValArg115120125CysValAspGlySerSerSerSerPheArgSerLysLysProIleVal130135140GlyValIleGlyProGlySerSerSerValAlaIleGlnValGlnAsn145150155160LeuLeuGlnLeuPheAsnIleProGlnIleAlaTyrSerAlaThrSer165170175MetAspLeuSerAspLysThrLeuPheLysTyrPheMetArgValVal180185190ProSerAspAlaGlnGlnAlaArgAlaMetValAspIleValLysArg195200205TyrAsnTrpThrTyrValSerAlaValHisThrGluGlyAsnTyrGly210215220GluSerGlyMetGluAlaSerLysAspMetSerAlaLysGluGlyIle225230235240CysIleAlaHisSerTyrLysIleTyrSerAsnAlaGlyGluGlnSer245250255PheAspLysLeuLeuLysLysLeuThrSerHisLeuProLysAlaArg260265270ValValAlaCysPheCysGluGlyMetThrValArgGlyLeuLeuMet275280285AlaMetArgArgLeuGlyLeuAlaGlyGluPheLeuLeuLeuGlySer290295300AspGlyTrpAlaAspArgTyrAspValThrAspGlyTyrGlnArgGlu305310315320AlaValGlyGlyIleThrIleLysLeuGlnSerProAspValLysTrp325330335PheAspAspTyrTyrLeuLysLeuArgProGluThrAsnHisArgAsn340345350ProTrpPheGlnGluPheTrpGlnHisArgPheGlnCysArgLeuGlu355360365AlaPheProGlnGluAsnSerLysTyrAsnLysThrCysAsnSerSer370375380LeuThrLeuLysThrHisHisValGlnAspSerLysMetGlyPheVal385390395400IleAsnAlaIleTyrSerMetAlaTyrGlyLeuHisAsnMetGlnMet405410415SerLeuCysProGlyTyrAlaGlyLeuCysAspAlaMetLysProIle420425430AspGlyArgLysLeuLeuGluSerLeuMetLysThrAsnPheThrGly435440445ValSerGlyAspThrIleLeuPheAspGluAsnGlyAspSerProGly450455460ArgTyrGluIleMetAsnPheLysGluMetGlyLysAspTyrPheAsp465470475480TyrIleAsnValGlySerTrpAspAsnGlyGluLeuLysMetAspAsp485490495AspGluValTrpSerLysLysSerAsnIleIleArgSerValCysSer500505510GluProCysGluLysGlyGlnIleLysValIleArgLysGlyGluVal515520525SerCysCysTrpThrCysThrProCysLysGluAsnGluTyrValPhe530535540AspGluTyrThrCysLysAlaCysGlnLeuGlySerTrpProThrAsp545550555560AspLeuThrGlyCysAspLeuIleProValGlnTyrLeuArgTrpGly565570575AspProGluProIleAlaAlaValValPheAlaCysLeuGlyLeuLeu580585590AlaThrLeuPheValThrValValPheIleIleTyrArgAspThrPro595600605ValValLysSerSerSerArgGluLeuCysTyrIleIleLeuAlaGly610615620IleCysLeuGlyTyrLeuCysThrPheCysLeuIleAlaLysProLys625630635640GlnIleTyrCysTyrLeuGlnArgIleGlyIleGlyLeuSerProAla645650655MetSerTyrSerAlaLeuValThrLysThrAsnArgIleAlaArgIle660665670LeuAlaGlySerLysLysLysIleCysThrProLysProArgPheMet675680685SerAlaCysAlaGlnLeuValIleAlaPheIleLeuIleCysIleGln690695700LeuGlyIleIleValAlaLeuPheIleMetGluProProAspIleMet705710715720HisAspTyrProSerIleArgGluValTyrLeuIleCysAsnThrThr725730735AsnLeuGlyValValThrProLeuGlyAsnAsnGlyLeuLeuIleLeu740745750SerCysThrPheTyrAlaPheLysThrArgAsnValProAlaAsnPhe755760765ProGluAlaLysTyrIleAlaPheThrMetTyrThrThrCysIleIle770775780TrpLeuAlaPheValProIleTyrPheGlySerAsnTyrLysIleIle785790795800ThrMetCysPheSerValSerLeuSerAlaThrValAlaLeuGlyCys805810815MetPheValProLysValTyrIleIleLeuAlaLysProGluArgAsn820825830ValArgSerAlaPheThrThrSerThrValValArgMetHisValGly835840845AspGlyLysSerSerSerAlaAlaSerArgSerSerSerLeuValAsn850855860LeuTrpLysArgArgGlySerSerGlyGluThrLeuArgTyrLysAsp865870875880ArgArgLeuAlaGlnHisLysSerGluIleGluCysPheThrProLys885890895GlySerMetGlyAsnGlyGlyArgAlaThrMetSerSerSerAsnGly900905910LysSerValThrTrpAlaGlnAsnGluLysSerSerArgGlyGlnHis915920925LeuTrpGlnArgLeuSerIleHisIleAsnLysLysGluAsnProAsn930935940GlnThrAlaValIleLysProPheProLysSerThrGluSerArgGly945950955960LeuGlyAlaGlyAlaGlyAlaGlyGlySerAlaGlyGlyValGlyAla965970975ThrGlyGlyAlaGlyCysAlaGlyAlaGlyProGlyGlyProGluSer980985990ProAspAlaGlyProLysAlaLeuTyrAspValAlaGluAlaGluGlu99510001005HisPheProAlaProAlaArgProArgSerProSerProIleSerThr101010151020LeuSerHisArgAlaGlySerAlaSerArgThrAspAspAspValPro1025103010351040SerLeuHisSerGluProValAlaArgSerSerSerSerGlnGlySer104510501055LeuMetGluGlnIleSerSerValValThrArgPheThrAlaAsnIle106010651070SerGluLeuAsnSerMetMetLeuSerThrAlaAlaProSerProGly107510801085ValGlyAlaProLeuCysSerSerTyrLeuIleProLysGluIleGln109010951100LeuProThrThrMetThrThrPheAlaGluIleGlnProLeuProAla1105111011151120IleGluValThrGlyGlyAlaGlnProAlaAlaGlyAlaGlnAlaAla112511301135GlyAspAlaAlaArgGluSerProAlaAlaGlyProGluAlaAlaAla114011451150AlaLysProAspLeuGluGluLeuValAlaLeuThrProProSerPro115511601165PheArgAspSerValAspSerGlySerThrThrProAsnSerProVal117011751180SerGluSerAlaLeuCysIleProSerSerProLysTyrAspThrLeu1185119011951200IleIleArgAspTyrThrGlnSerSerSerSerLeu12051210(2) INFORMATION FOR SEQ ID NO:11:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 3282 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: both(D) TOPOLOGY: both(ii) MOLECULE TYPE: cDNA(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 370..3003(D) OTHER INFORMATION: /product="HUMAN MGLUR5C"/note= "Variant of MGLUR5A with truncated 3'end."(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:CAGCTCGGCTGTTCTGCGCACGCTGAGCGGAGGGAATGAGCTTGAGATCATCTTGGGGGG60GAAGCCGGGGACTGGAGAGGCCGGCTCTGCCCTGCTGATCCCCGTGGCCCAACTTTTCGG120GGGGCTAGCTAGACCGAGTCTCACTGCTCGCAGCGCAGCCAACAGGGGGGTTTAGAAGAT180CATGACCACATGGATCATCTAACTAAATGGTACATGGGGACAAAATGGTCCTTTAGAAAA240TACATCTGAATTGCTGGCTAATTTCTTGATTTGCGACTCAACGTAGGACATCGCTTGTTC300GTAGCTATCAGAACCCTCCTGAATTTTCCCCACCATGCTATCTTTATTGGCTTGAACTCC360TTTCCTAAAATGGTCCTTCTGTTGATCCTGTCAGTCTTACTTTGGAAA408MetValLeuLeuLeuIleLeuSerValLeuLeuTrpLys1510GAAGATGTCCGTGGGAGTGCACAGTCCAGTGAGAGGAGGGTGGTGGCT456GluAspValArgGlySerAlaGlnSerSerGluArgArgValValAla152025CACATGCCGGGTGACATCATTATTGGAGCTCTCTTTTCTGTTCATCAC504HisMetProGlyAspIleIleIleGlyAlaLeuPheSerValHisHis30354045CAGCCTACTGTGGACAAAGTTCATGAGAGGAAGTGTGGGGCGGTCCGT552GlnProThrValAspLysValHisGluArgLysCysGlyAlaValArg505560GAACAGTATGGCATTCAGAGAGTGGAGGCCATGCTGCATACCCTGGAA600GluGlnTyrGlyIleGlnArgValGluAlaMetLeuHisThrLeuGlu657075AGGATCAATTCAGACCCCACACTCTTGCCCAACATCACACTGGGCTGT648ArgIleAsnSerAspProThrLeuLeuProAsnIleThrLeuGlyCys808590GAGATAAGGGACTCCTGCTGGCATTCGGCTGTGGCCCTAGAGCAGAGC696GluIleArgAspSerCysTrpHisSerAlaValAlaLeuGluGlnSer95100105ATTGAGTTCATAAGAGATTCCCTCATTTCTTCAGAAGAGGAAGAAGGC744IleGluPheIleArgAspSerLeuIleSerSerGluGluGluGluGly110115120125TTGGTACGCTGTGTGGATGGCTCCTCCTCTTCCTTCCGCTCCAAGAAG792LeuValArgCysValAspGlySerSerSerSerPheArgSerLysLys130135140CCCATAGTAGGGGTCATTGGGCCTGGCTCCAGTTCTGTAGCCATTCAG840ProIleValGlyValIleGlyProGlySerSerSerValAlaIleGln145150155GTCCAGAATTTGCTCCAGCTTTTCAACATACCTCAGATTGCTTACTCA888ValGlnAsnLeuLeuGlnLeuPheAsnIleProGlnIleAlaTyrSer160165170GCAACCAGCATGGATCTGAGTGACAAGACTCTGTTCAAATATTTCATG936AlaThrSerMetAspLeuSerAspLysThrLeuPheLysTyrPheMet175180185AGGGTTGTGCCTTCAGATGCTCAGCAGGCAAGGGCCATGGTGGACATA984ArgValValProSerAspAlaGlnGlnAlaArgAlaMetValAspIle190195200205GTGAAGAGGTACAACTGGACCTATGTATCAGCCGTGCACACAGAAGGC1032ValLysArgTyrAsnTrpThrTyrValSerAlaValHisThrGluGly210215220AACTATGGAGAAAGTGGGATGGAAGCCTCCAAAGATATGTCAGCGAAG1080AsnTyrGlyGluSerGlyMetGluAlaSerLysAspMetSerAlaLys225230235GAAGGGATTTGCATCGCCCACTCTTACAAAATCTACAGTAATGCAGGG1128GluGlyIleCysIleAlaHisSerTyrLysIleTyrSerAsnAlaGly240245250GAGCAGAGCTTTGATAAGCTGCTGAAGAAGCTCACAAGTCACTTGCCC1176GluGlnSerPheAspLysLeuLeuLysLysLeuThrSerHisLeuPro255260265AAGGCCCGGGTGGTGGCCTGCTTCTGTGAGGGCATGACGGTGAGAGGT1224LysAlaArgValValAlaCysPheCysGluGlyMetThrValArgGly270275280285CTGCTGATGGCCATGAGGCGCCTGGGTCTAGCGGGAGAATTTCTGCTT1272LeuLeuMetAlaMetArgArgLeuGlyLeuAlaGlyGluPheLeuLeu290295300CTGGGCAGTGATGGCTGGGCTGACAGGTATGATGTGACAGATGGATAT1320LeuGlySerAspGlyTrpAlaAspArgTyrAspValThrAspGlyTyr305310315CAGCGAGAAGCTGTTGGTGGCATCACAATCAAGCTCCAATCTCCCGAT1368GlnArgGluAlaValGlyGlyIleThrIleLysLeuGlnSerProAsp320325330GTCAAGTGGTTTGATGATTATTATCTGAAGCTCCGGCCAGAAACAAAC1416ValLysTrpPheAspAspTyrTyrLeuLysLeuArgProGluThrAsn335340345CACCGAAACCCTTGGTTTCAAGAATTTTGGCAGCATCGTTTTCAGTGC1464HisArgAsnProTrpPheGlnGluPheTrpGlnHisArgPheGlnCys350355360365CGACTGGAAGCGTTTCCACAGGAGAACAGCAAATACAACAAGACTTGC1512ArgLeuGluAlaPheProGlnGluAsnSerLysTyrAsnLysThrCys370375380AATAGTTCTCTGACTCTGAAAACACATCATGTTCAGGATTCCAAAATG1560AsnSerSerLeuThrLeuLysThrHisHisValGlnAspSerLysMet385390395GGATTTGTGATCAACGCCATCTATTCGATGGCCTATGGGCTCCACAAC1608GlyPheValIleAsnAlaIleTyrSerMetAlaTyrGlyLeuHisAsn400405410ATGCAGATGTCCCTCTGCCCAGGCTATGCAGGACTCTGTGATGCCATG1656MetGlnMetSerLeuCysProGlyTyrAlaGlyLeuCysAspAlaMet415420425AAGCCAATTGATGGACGGAAACTTTTGGAGTCCCTGATGAAAACCAAT1704LysProIleAspGlyArgLysLeuLeuGluSerLeuMetLysThrAsn430435440445TTTACTGGGGTTTCTGGAGATACGATCCTATTCGATGAGAATGGAGAC1752PheThrGlyValSerGlyAspThrIleLeuPheAspGluAsnGlyAsp450455460TCTCCAGGAAGGTATGAAATAATGAATTTCAAGGAAATGGGAAAAGAT1800SerProGlyArgTyrGluIleMetAsnPheLysGluMetGlyLysAsp465470475TACTTTGATTATATCAACGTTGGAAGTTGGGACAATGGAGAATTAAAA1848TyrPheAspTyrIleAsnValGlySerTrpAspAsnGlyGluLeuLys480485490ATGGATGATGATGAAGTATGGTCCAAGAAAAGCAACATCATCAGATCT1896MetAspAspAspGluValTrpSerLysLysSerAsnIleIleArgSer495500505GTGTGCAGTGAACCATGTGAGAAAGGCCAGATCAAGGTGATCCGAAAG1944ValCysSerGluProCysGluLysGlyGlnIleLysValIleArgLys510515520525GGAGAAGTCAGCTGTTGTTGGACCTGTACACCTTGTAAGGAGAATGAG1992GlyGluValSerCysCysTrpThrCysThrProCysLysGluAsnGlu530535540TATGTCTTTGATGAGTACACATGCAAGGCATGCCAACTGGGGTCTTGG2040TyrValPheAspGluTyrThrCysLysAlaCysGlnLeuGlySerTrp545550555CCCACTGATGATCTCACAGGTTGTGACTTGATCCCAGTACAGTATCTT2088ProThrAspAspLeuThrGlyCysAspLeuIleProValGlnTyrLeu560565570CGATGGGGTGACCCTGAACCCATTGCAGCTGTGGTGTTTGCCTGCCTT2136ArgTrpGlyAspProGluProIleAlaAlaValValPheAlaCysLeu575580585GGCCTCCTGGCCACCCTGTTTGTTACTGTAGTCTTCATCATTTACCGT2184GlyLeuLeuAlaThrLeuPheValThrValValPheIleIleTyrArg590595600605GATACACCAGTAGTCAAGTCCTCAAGCAGGGAACTCTGCTACATTATC2232AspThrProValValLysSerSerSerArgGluLeuCysTyrIleIle610615620CTTGCTGGCATCTGCCTGGGCTACTTATGTACCTTCTGCCTCATTGCG2280LeuAlaGlyIleCysLeuGlyTyrLeuCysThrPheCysLeuIleAla625630635AAGCCCAAACAGATTTACTGCTACCTTCAGAGAATTGGCATTGGTCTC2328LysProLysGlnIleTyrCysTyrLeuGlnArgIleGlyIleGlyLeu640645650TCCCCAGCCATGAGCTACTCAGCCCTTGTAACAAAGACCAACCGTATT2376SerProAlaMetSerTyrSerAlaLeuValThrLysThrAsnArgIle655660665GCAAGGATCCTGGCTGGCAGCAAGAAGAAGATCTGTACCCCCAAGCCC2424AlaArgIleLeuAlaGlySerLysLysLysIleCysThrProLysPro670675680685AGATTCATGAGTGCCTGTGCCCAGCTAGTGATTGCTTTCATTCTCATA2472ArgPheMetSerAlaCysAlaGlnLeuValIleAlaPheIleLeuIle690695700TGCATCCAGTTGGGCATCATCGTTGCCCTCTTTATAATGGAGCCTCCT2520CysIleGlnLeuGlyIleIleValAlaLeuPheIleMetGluProPro705710715GACATAATGCATGACTACCCAAGCATTCGAGAAGTCTACCTGATCTGT2568AspIleMetHisAspTyrProSerIleArgGluValTyrLeuIleCys720725730AACACCACCAACCTAGGAGTTGTCACTCCACTTGGAAACAATGGATTG2616AsnThrThrAsnLeuGlyValValThrProLeuGlyAsnAsnGlyLeu735740745TTGATTTTGAGCTGCACCTTCTATGCGTTCAAGACCAGAAATGTTCCA2664LeuIleLeuSerCysThrPheTyrAlaPheLysThrArgAsnValPro750755760765GCTAACTTCCCCGAGGCCAAGTATATCGCCTTCACAATGTACACGACC2712AlaAsnPheProGluAlaLysTyrIleAlaPheThrMetTyrThrThr770775780TGCATTATATGGCTAGCTTTTGTTCCAATCTACTTTGGCAGCAACTAC2760CysIleIleTrpLeuAlaPheValProIleTyrPheGlySerAsnTyr785790795AAAATCATCACCATGTGTTTCTCGGTCAGCCTCAGTGCCACAGTGGCC2808LysIleIleThrMetCysPheSerValSerLeuSerAlaThrValAla800805810CTAGGCTGCATGTTTGTGCCGACGGTGTACATCATCCTGGCCAAACCA2856LeuGlyCysMetPheValProThrValTyrIleIleLeuAlaLysPro815820825GAGAGAAACGTGCGCAGCGCCTTCACCACATCTACCGTGGTGCGCATG2904GluArgAsnValArgSerAlaPheThrThrSerThrValValArgMet830835840845CATGTAGGGGATGGCAAGTCATCCTCCGCAGCCAGCAGATCCAGCAGC2952HisValGlyAspGlyLysSerSerSerAlaAlaSerArgSerSerSer850855860CTAGTCAACCTGTGGAAGAGAAGGGGCTCCTCTGGGGAAACCTTAAGG3000LeuValAsnLeuTrpLysArgArgGlySerSerGlyGluThrLeuArg865870875TAAAAGTTGTGGGGGCTTACAGGGATGCTGGCCCCTAAAACTGGAGCAGAGGCATGTGTT3060TCCTGGGTCTTTTAAATGGGAGAAATCTGGGTAAATGACACCATCTGAGGCAGGGTGACT3120TACGGCATGGACCTCCTCATAAAATGGTATTTATGGGGTTAATGGGATGTGGCTCCACTT3180ACTTAGCCCAAGTCTAGAAACATGGAAGTCAAACTCTCTAATAAAGCAGAGCTACAGCGT3240CGGGGGAGTGACGTTTGACAGGGCAGACAGACCAGAGTTCAG3282(2) INFORMATION FOR SEQ ID NO:12:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 877 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:MetValLeuLeuLeuIleLeuSerValLeuLeuTrpLysGluAspVal151015ArgGlySerAlaGlnSerSerGluArgArgValValAlaHisMetPro202530GlyAspIleIleIleGlyAlaLeuPheSerValHisHisGlnProThr354045ValAspLysValHisGluArgLysCysGlyAlaValArgGluGlnTyr505560GlyIleGlnArgValGluAlaMetLeuHisThrLeuGluArgIleAsn65707580SerAspProThrLeuLeuProAsnIleThrLeuGlyCysGluIleArg859095AspSerCysTrpHisSerAlaValAlaLeuGluGlnSerIleGluPhe100105110IleArgAspSerLeuIleSerSerGluGluGluGluGlyLeuValArg115120125CysValAspGlySerSerSerSerPheArgSerLysLysProIleVal130135140GlyValIleGlyProGlySerSerSerValAlaIleGlnValGlnAsn145150155160LeuLeuGlnLeuPheAsnIleProGlnIleAlaTyrSerAlaThrSer165170175MetAspLeuSerAspLysThrLeuPheLysTyrPheMetArgValVal180185190ProSerAspAlaGlnGlnAlaArgAlaMetValAspIleValLysArg195200205TyrAsnTrpThrTyrValSerAlaValHisThrGluGlyAsnTyrGly210215220GluSerGlyMetGluAlaSerLysAspMetSerAlaLysGluGlyIle225230235240CysIleAlaHisSerTyrLysIleTyrSerAsnAlaGlyGluGlnSer245250255PheAspLysLeuLeuLysLysLeuThrSerHisLeuProLysAlaArg260265270ValValAlaCysPheCysGluGlyMetThrValArgGlyLeuLeuMet275280285AlaMetArgArgLeuGlyLeuAlaGlyGluPheLeuLeuLeuGlySer290295300AspGlyTrpAlaAspArgTyrAspValThrAspGlyTyrGlnArgGlu305310315320AlaValGlyGlyIleThrIleLysLeuGlnSerProAspValLysTrp325330335PheAspAspTyrTyrLeuLysLeuArgProGluThrAsnHisArgAsn340345350ProTrpPheGlnGluPheTrpGlnHisArgPheGlnCysArgLeuGlu355360365AlaPheProGlnGluAsnSerLysTyrAsnLysThrCysAsnSerSer370375380LeuThrLeuLysThrHisHisValGlnAspSerLysMetGlyPheVal385390395400IleAsnAlaIleTyrSerMetAlaTyrGlyLeuHisAsnMetGlnMet405410415SerLeuCysProGlyTyrAlaGlyLeuCysAspAlaMetLysProIle420425430AspGlyArgLysLeuLeuGluSerLeuMetLysThrAsnPheThrGly435440445ValSerGlyAspThrIleLeuPheAspGluAsnGlyAspSerProGly450455460ArgTyrGluIleMetAsnPheLysGluMetGlyLysAspTyrPheAsp465470475480TyrIleAsnValGlySerTrpAspAsnGlyGluLeuLysMetAspAsp485490495AspGluValTrpSerLysLysSerAsnIleIleArgSerValCysSer500505510GluProCysGluLysGlyGlnIleLysValIleArgLysGlyGluVal515520525SerCysCysTrpThrCysThrProCysLysGluAsnGluTyrValPhe530535540AspGluTyrThrCysLysAlaCysGlnLeuGlySerTrpProThrAsp545550555560AspLeuThrGlyCysAspLeuIleProValGlnTyrLeuArgTrpGly565570575AspProGluProIleAlaAlaValValPheAlaCysLeuGlyLeuLeu580585590AlaThrLeuPheValThrValValPheIleIleTyrArgAspThrPro595600605ValValLysSerSerSerArgGluLeuCysTyrIleIleLeuAlaGly610615620IleCysLeuGlyTyrLeuCysThrPheCysLeuIleAlaLysProLys625630635640GlnIleTyrCysTyrLeuGlnArgIleGlyIleGlyLeuSerProAla645650655MetSerTyrSerAlaLeuValThrLysThrAsnArgIleAlaArgIle660665670LeuAlaGlySerLysLysLysIleCysThrProLysProArgPheMet675680685SerAlaCysAlaGlnLeuValIleAlaPheIleLeuIleCysIleGln690695700LeuGlyIleIleValAlaLeuPheIleMetGluProProAspIleMet705710715720HisAspTyrProSerIleArgGluValTyrLeuIleCysAsnThrThr725730735AsnLeuGlyValValThrProLeuGlyAsnAsnGlyLeuLeuIleLeu740745750SerCysThrPheTyrAlaPheLysThrArgAsnValProAlaAsnPhe755760765ProGluAlaLysTyrIleAlaPheThrMetTyrThrThrCysIleIle770775780TrpLeuAlaPheValProIleTyrPheGlySerAsnTyrLysIleIle785790795800ThrMetCysPheSerValSerLeuSerAlaThrValAlaLeuGlyCys805810815MetPheValProThrValTyrIleIleLeuAlaLysProGluArgAsn820825830ValArgSerAlaPheThrThrSerThrValValArgMetHisValGly835840845AspGlyLysSerSerSerAlaAlaSerArgSerSerSerLeuValAsn850855860LeuTrpLysArgArgGlySerSerGlyGluThrLeuArg865870875(2) INFORMATION FOR SEQ ID NO:13:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 343 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: both(D) TOPOLOGY: both(ii) MOLECULE TYPE: cDNA(ix) FEATURE:(A) NAME/KEY: misc.sub.-- feature(B) LOCATION: 1..343(D) OTHER INFORMATION: /note= "Partial sequence of MGLUR23'untranslated sequence."(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:TGGAGACGCCATACTGCCGCGCTGACACAGCTGCTCCTGGGCACCTAGTGCAGACCCACG60TCCAGGGCCAGGAGGAAGTTGGCTGGAGCACTGCAATAATTTATTACCCAGCCTATGTCT120GCCCCCCGAGTCACTTACCCACCTCCTTACCCCAGCTCTTCAGACTCAGAAGTCAGGAGC180CTTGGCCAGGAGCCTCTGCAGTGGCCACTAACTGCCCTTGTAGCTGTGTTTCCTCCTGGC240CAGGCCCAGGGCTCAGAGAGGAGCAAGCCAGGGTTCACTCTGCCCTGGACCCGGGTGGCT300GAGGACGGCAGGCCCCAGTCCTAACCAGCAAAGGTGCTTCCAG343__________________________________________________________________________

Number	Name	Date	Kind
5385831	Mulvhill et al.	Jan 1995
5500420	Maiese	Mar 1996

Methods for identifying compounds that modulate metabotropic glutamate receptor activity

Information

Patent Number

Date Filed

Date Issued

Inventors

Original Assignees

Examiners

Agents

CPC

US Classifications

Field of Search

US

International Classifications

Abstract

Description

Claims

RELATED APPLICATIONS

US Referenced Citations (2)

Non-Patent Literature Citations (2)

Divisions (1)

Continuation in Parts (1)

Entry
Abe et al., J. Biol. Chem. 262(19):13361-13368 (Feb. 5, 1992).
Masu et al., Nature 349:760-765 (Feb. 28, 1991).