Methods for identifying small molecules that bind specific rna structural motifs

Abstract
The present invention relates to a method for screening and identifying test compounds that bind to a preselected target ribonucleic acid (“RNA”). Direct, non-competitive binding assays are advantageously used to screen bead-based libraries of compounds for those that selectively bind to a preselected target RNA. Binding of target RNA molecules to a particular test compound is detected using any physical method that measures the altered physical property of the target RNA bound to a test compound. The structure of the test compound attached to the labeled RNA is also determined. The methods used will depend, in part, on the nature of the library screened. The methods of the present invention provide a simple, sensitive assay for high-throughput screening of libraries of compounds to identify pharmaceutical leads.
Description
1. INTRODUCTION

The present invention relates to a method for screening and identifying test compounds that bind to a preselected target ribonucleic acid (“RNA”). Direct, non-competitive binding assays are advantageously used to screen bead-based libraries of compounds for those that selectively bind to a preselected target RNA. Binding of target RNA molecules to a particular test compound is detected using any method that measures the altered physical property of the target RNA bound to a test compound. The methods of the present invention provide a simple, sensitive assay for high-throughput screening of libraries of compounds to identify pharmaceutical leads.


2. BACKGROUND OF THE INVENTION

Protein-nucleic acid interactions are involved in many cellular functions, including transcription, RNA splicing, mRNA decay, and mRNA translation. Readily accessible synthetic molecules that can bind with high affinity to specific sequences of single- or double-stranded nucleic acids have the potential to interfere with these interactions in a controllable way, making them attractive tools for molecular biology and medicine. Successful approaches for blocking function of target nucleic acids include using duplex-forming antisense oligonucleotides (Miller, 1996, Progress in Nucl. Acid Res. & Mol. Biol. 52:261-291; Ojwang & Rando, 1999, Achieving antisense inhibition by oligodeoxynucleotides containing N7 modified 2′-deoxyguanosine using tumor necrosis factor receptor type 1, METHODS: A Companion to Methods in Enzymology 18:244-251) and peptide nucleic acids (“PNA”) (Nielsen, 1999, Current Opinion in Biotechnology 10:71-75), which bind to nucleic acids via Watson-Crick base-pairing. Triplex-forming anti-gene oligonucleotides can also be designed (Ping et al., 1997, RNA 3:850-860; Aggarwal et al., 1996, Cancer Res. 56:5156-5164; U.S. Pat. No. 5,650,316), as well as pyrrole-imidazole polyamide oligomers (Gottesfeld et al., 1997, Nature 387:202-205; White et al., 1998, Nature 391:468-471), which are specific for the major and minor grooves of a double helix, respectively.


In addition to synthetic nucleic acids (i.e., antisense, ribozymes, and triplex-forming molecules), there are examples of natural products that interfere with deoxyribonucleic acid (“DNA”) or RNA processes such as transcription or translation. For example, certain carbohydrate-based host cell factors, calicheamicin oligosaccharides, interfere with the sequence-specific binding of transcription factors to DNA and inhibit transcription in vivo (Ho et al., 1994, Proc. Natl. Acad. Sci. USA 91:9203-9207; Liu et al., 1996, Proc. Natl. Acad. Sci. USA 93:940-944). Certain classes of known antibiotics have been characterized and were found to interact with RNA. For example, the antibiotic thiostreptone binds tightly to a 60-mer from ribosomal RNA (Cundliffe et al., 1990, in The Ribosome: Structure, Function & Evolution (Schlessinger et al., eds.) American Society for Microbiology, Washington, D.C. pp. 479-490). Bacterial resistance to various antibiotics often involves methylation at specific rRNA sites (Cundliffe, 1989, Ann. Rev. Microbiol. 43:207-233). Aminoglycosidic aminocyclitol (aminoglycoside) antibiotics and peptide antibiotics are known to inhibit group I intron splicing by binding to specific regions of the RNA (von Ahsen et al., 1991, Nature (London) 353:368-370). Some of these same aminoglycosides have also been found to inhibit hammerhead ribozyme function (Stage et al., 1995, RNA 1:95-101). In addition, certain aminoglycosides and other protein synthesis inhibitors have been found to interact with specific bases in 16S rRNA (Woodcock et al., 1991, EMBO J. 10:3099-3103). An oligonucleotide analog of the 16S rRNA has also been shown to interact with certain aminoglycosides (Purohit et al., 1994, Nature 370:659-662). A molecular basis for hypersensitivity to aminoglycosides has been found to be located in a single base change in mitochondrial rRNA (Hutchin et al., 1993, Nucleic Acids Res. 21:4174-4179). Aminoglycosides have also been shown to inhibit the interaction between specific structural RNA motifs and the corresponding RNA binding protein. Zapp et al. (Cell, 1993, 74:969-978) has demonstrated that the aminoglycosides neomycin B, lividomycin A, and tobramycin can block the binding of Rev, a viral regulatory protein required for viral gene expression, to its viral recognition element in the IIB (or RRE) region of HIV RNA. This blockage appears to be the result of competitive binding of the antibiotics directly to the RRE RNA structural motif.


Single stranded sections of RNA can fold into complex tertiary structures consisting of local motifs such as loops, bulges, pseudoknots, guanosine quartets and turns (Chastain & Tinoco, 1991, Progress in Nucleic Acid Res. & Mol. Biol. 41:131-177; Chow & Bogdan, 1997, Chemical Reviews 97:1489-1514; Rando & Hogan, 1998, Biologic activity of guanosine quartet forming oligonucleotides in “Applied Antisense Oligonucleotide Technology” Stein. & Krieg (eds) John Wiley and Sons, New York, pages 335-352). Such structures can be critical to the activity of the nucleic acid and affect functions such as regulation of mRNA transcription, stability, or translation (Weeks & Crothers, 1993, Science 261:1574-1577). The dependence of these functions on the native three-dimensional structural motifs of single-stranded stretches of nucleic acids makes it difficult to identify or design synthetic agents that bind to these motifs using general, simple-to-use sequence-specific recognition rules for the formation of double- and triple-helical nucleic acids used in the design of antisense and ribozyme type molecules. Approaches to screening generally involve competitive assays designed to identify compounds that disrupt the interaction between a target RNA and a physiological, host cell factor(s) that had been previously identified to specifically interact with that particular target RNA. In general, such assays require the identification and characterization of the host cell factor(s) deemed to be required for the function of the target RNA. Both the target RNA and its preselected host cell binding partner are used in a competitive format to identify compounds that disrupt or interfere with the two components in the assay.


Citation or identification of any reference in Section 2 of this application is not an admission that such reference is available as prior art to the present invention.


3. SUMMARY OF THE INVENTION

The present invention relates to methods for identifying compounds that bind to preselected target elements of nucleic acids including, but not limited to, specific RNA sequences, RNA structural motifs, and/or RNA structural elements. The specific target RNA sequences, RNA structural motifs, and/or RNA structural elements are used as targets for screening small molecules and identifying those that directly bind these specific sequences, motifs, and/or structural elements. For example, methods are described in which a preselected target RNA having a detectable label is used to screen a library of test compounds, preferably under physiologic conditions. Any complexes formed between the target RNA and a member of the library are identified using methods that detect the labeled target RNA bound to a test compound. In particular, the present invention relates to methods for using a target RNA having a detectable label to screen a bead-based library of test compounds. Compounds in the bead-based library that bind to the labeled target RNA will form a bead-based detectably labeled complex, which can be separated from the unbound beads and unbound target RNA in the liquid phase by a number of physical means, including, but not limited to, flow cytometry, affinity chromatography, manual batch mode separation, suspension of beads in electric fields, and microwave of the bead-based detectably labeled complex. The detectably labeled complex can then be identified by the label on the target RNA and removed from the uncomplexed, unlabeled test compounds in the library. The structure of the test compound complexed with the labeled RNA is then ascertained by de novo structure determination of the test compounds using, for example, mass spectrometry or nuclear magnetic resonance (“NMR”). The test compounds identified are useful for any purpose to which a binding reaction may be put, for example in assay methods, diagnostic procedures, cell sorting, as inhibitors of target molecule function, as probes, as sequestering agents and the like. In addition, small organic molecules which interact specifically with target RNA molecules may be useful as lead compounds for the development of therapeutic agents.


The methods described herein for the identification of compounds that directly bind to a particular preselected target RNA are well suited for high-throughput screening. The direct binding method of the invention offers advantages over drug screening systems for competitors that inhibit the formation of naturally-occurring RNA binding protein:target RNA complexes; i.e., competitive assays. The direct binding method of the invention is rapid and can be set up to be readily performed, e.g., by a technician, making it amenable to high throughput screening. The method of the invention also eliminates the bias inherent in the competitive drug screening systems, which require the use of a preselected host cell factor that may not have physiological relevance to the activity of the target RNA. Instead, the methods of the invention are used to identify any compound that can directly bind to specific target RNA sequences, RNA structural motifs, and/or RNA structural elements, preferably under physiologic conditions. As a result, the compounds so identified can inhibit the interaction of the target RNA with any one or more of the native host cell factors (whether known or unknown) required for activity of the RNA in vivo. The present invention may be understood more fully by reference to the detailed description and examples, which are intended to illustrate non-limiting embodiments of the invention.


3.1. Definitions

As used herein, a “target nucleic acid” refers to RNA, DNA, or a chemically modified variant thereof. In a preferred embodiment, the target nucleic acid is RNA. A target nucleic acid also refers to tertiary structures of the nucleic acids, such as, but not limited to loops, bulges, pseudoknots, guanosine quartets and turns. A target nucleic acid also refers to RNA elements such as, but not limited to, the HIV TAR element, internal ribosome entry site, “slippery site”, instability elements, and adenylate uridylate-rich elements, which are described in Section 4.1. Non-limiting examples of target nucleic acids are presented in Section 4.1 and Section 5.


As used herein, a “library” refers to a plurality of test compounds with which a target nucleic acid molecule is contacted. A library can be a combinatorial library, e.g., a collection of test compounds synthesized using combinatorial chemistry techniques, or a collection of unique chemicals of low molecular weight (less than 1000 daltons) that each occupy a unique three-dimensional space.


As used herein, a “label” or “detectable label” is a composition that is detectable, either directly or indirectly, by spectroscopic, photochemical, biochemical, immunochemical, or chemical means. For example, useful labels include radioactive isotopes (e.g., 32P, 35S, and 3H), dyes, fluorescent dyes, electron-dense reagents, enzymes and their substrates (e.g., as commonly used in enzyme-linked immunoassays, e.g., alkaline phosphatase and horse radish peroxidase), biotin, digoxigenin, or haptens and proteins for which antisera or monoclonal antibodies are available. Moreover, a label or detectable moiety can include an “affinity tag” that, when coupled with the target nucleic acid and incubated with a test compound or compound library, allows for the affinity capture of the target nucleic acid along with molecules bound to the target nucleic acid. One skilled in the art will appreciate that a affinity tag bound to the target nucleic acids has, by definition, a complimentary ligand coupled to a solid support that allows for its capture. For example, useful affinity tags and complimentary ligands include, but are not limited to, biotin-streptavidin, complimentary nucleic acid fragments (e.g., oligo dT-oligo dA, oligo T-oligo A, oligo dG-oligo dC, oligo G-oligo C), aptamer complexes, or haptens and proteins for which antisera or monoclonal antibodies are available. The label or detectable moiety is typically bound, either covalently, through a linker or chemical bound, or through ionic, van der Waals or hydrogen bonds to the molecule to be detected.


As used herein, a “dye” refers to a molecule that, when exposed to radiation, emits radiation at a level that is detectable visually or via conventional spectroscopic means. As used herein, a “visible dye” refers to a molecule having a chromophore that absorbs radiation in the visible region of the spectrum (i.e., having a wavelength of between about 400 nm and about 700 nm) such that the transmitted radiation is in the visible region and can be detected either visually or by conventional spectroscopic means. As used herein, an “ultraviolet dye” refers to a molecule having a chromophore that absorbs radiation in the ultraviolet region of the spectrum (i.e., having a wavelength of between about 30 nm and about 400 nm). As used herein, an “infrared dye” refers to a molecule having a chromophore that absorbs radiation in the infrared region of the spectrum (i.e., having a wavelength between about 700 nm and about 3,000 nm). A “chromophore” is the network of atoms of the dye that, when exposed to radiation, emits radiation at a level that is detectable visually or via conventional spectroscopic means. One of skill in the art will readily appreciate that although a dye absorbs radiation in one region of the spectrum, it may emit radiation in another region of the spectrum. For example, an ultraviolet dye may emit radiation in the visible region of the spectrum. One of skill in the art will also readily appreciate that a dye can transmit radiation or can emit radiation via fluorescence or phosphorescence.


The phrase “pharmaceutically acceptable salt(s),” as used herein includes but is not limited to salts of acidic or basic groups that may be present in test compounds identified using the methods of the present invention. Test compounds that are basic in nature are capable of forming a wide variety of salts with various inorganic and organic acids. The acids that can be used to prepare pharmaceutically acceptable acid addition salts of such basic compounds are those that form non-toxic acid addition salts, i.e., salts containing pharmacologically acceptable anions, including but not limited to sulfuric, citric, maleic, acetic, oxalic, hydrochloride, hydrobromide, hydroiodide, nitrate, sulfate, bisulfate, phosphate, acid phosphate, isonicotinate, acetate, lactate, salicylate, citrate, acid citrate, tartrate, oleate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucaronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate and pamoate (i.e., 1,1′-methylene-bis-(2-hydroxy-3-naphthoate)) salts. Test compounds that include an amino moiety may form pharmaceutically or cosmetically acceptable salts with various amino acids, in addition to the acids mentioned above. Test compounds that are acidic in nature are capable of forming base salts with various pharmacologically or cosmetically acceptable cations. Examples of such salts include alkali metal or alkaline earth metal salts and, particularly, calcium, magnesium, sodium lithium, zinc, potassium, and iron salts.


By “substantially one type of test compound,” as used herein, is meant that the assay can be performed in such a fashion that at some point, only one compound need be used in each reaction so that, if the result is indicative of a binding event occurring between the target RNA molecule and the test compound the test compound, can be easily identified.







4. DETAILED DESCRIPTION OF THE INVENTION

The present invention relates to methods for identifying compounds that bind to preselected target elements of nucleic acids, in particular, RNAs, including but not limited to preselected target RNA sequencing structural motifs, or structural elements. Methods are described in which a preselected target RNA having a detectable label is used to screen a library of test compounds. Any complexes formed between the target RNA and a member of the library are identified using methods that detect the labeled target RNA bound to a test compound. In particular, the present invention relates to methods for using a target RNA having a detectable label to screen a bead-based library of test compounds. Compounds in the bead-based library that bind to the labeled target RNA will form a bead-based detectably labeled complex, which can be separated from the unbound target RNA in the liquid phase by a number of physical means, such as, but not limited to, flow cytometry, affinity chromatography, manual batch mode separation, suspension of beads in electric fields, and microwave of the bead-based detectably labeled complex. The detectably labeled complex can then be identified by the label on the target RNA and removed from the uncomplexed, unlabeled test compounds in the library. The structure of the test compound attached to the labeled RNA is then ascertained by de novo structure determination of the test compounds using, for example, mass spectrometry or nuclear magnetic resonance (“NMR”).


Thus, the methods of the present invention provide a simple, sensitive assay for high-throughput screening of libraries of test compounds, in which the test compounds of the library that specifically bind a preselected target nucleic acid are easily distinguished from non-binding members of the library. The structures of the binding molecules are ascertained by de novo structure determination of the test compounds using, for example, mass spectrometry or nuclear magnetic resonance (“NMR”). The test compounds so identified are useful for any purpose to which a binding reaction may be put, for example in assay methods, diagnostic procedures, cell sorting, as inhibitors of target molecule function, as probes, as sequestering agents and lead compounds for development of therapeutics, and the like. Small organic compounds that are identified to interact specifically with the target RNA molecules are particularly attractive candidates as lead compounds for the development of therapeutic agents.


The assay of the invention reduces bias introduced by competitive binding assays which require the identification and use of a host cell factor (presumably essential for modulating RNA function) as a binding partner for the target RNA. The assays of the present invention are designed to detect any compound or agent that binds to the target RNA, preferably under physiologic conditions. Such agents can then be tested for biological activity, without establishing or guessing which host cell factor or factors is required for modulating the function and/or activity of the target RNA.


Section 4.1 describes examples of protein-RNA interactions that are important in a variety of cellular functions and several target RNA elements that can be used to identify test compounds. Compounds that inhibit these interactions by binding to the RNA and successfully competing with the natural protein or host cell factor that endogenously binds to the RNA may be important, e.g., in treating or preventing a disease or abnormal condition, such as an infection or unchecked growth. Section 4.2 describes detectable labels for target nucleic acids that are useful in the methods of the invention. Section 4.3 describes libraries of test compounds. Section 4.4 provides conditions for binding a labeled target RNA to a test compound of a library and detecting RNA binding to a test compound using the methods of the invention. Section 4.5 provides methods for separating complexes of target RNAs bound to a test compound from an unbound RNA. Section 4.6 describes methods for identifying test compounds that are bound to the target RNA. Section 4.7 describes a secondary, biological screen of test compounds identified by the methods of the invention to test the effect of the test compounds in vivo. Section 4.8 describes the use of test compounds identified by the methods of the invention for treating or preventing a disease or abnormal condition in mammals.


4.1. Biologically Important RNA-Host Cell Factor Interactions

Nucleic acids, and in particular RNAs, are capable of folding into complex tertiary structures that include bulges, loops, triple helices and pseudoknots, which can provide binding sites for host cell factors, such as proteins and other RNAs. RNA-protein and RNA-RNA interactions are important in a variety cellular functions, including transcription, RNA splicing, RNA stability and translation. Furthermore, the binding of such host cell factors to RNAs may alter the stability and translational efficiency of such RNAs, and according affect subsequent translation. For example, some diseases are associated with protein overproduction or decreased protein function. In this case, the identification of compounds to modulate RNA stability and translational efficiency will be useful to treat and prevent such diseases.


The methods of the present invention are useful for identifying test compounds that bind to target RNA elements in a high throughput screening assay of libraries of test compounds in solution. In particular, the methods of the present invention are useful for identifying a test compound that binds to a target RNA elements and inhibits the interaction of that RNA with one or more host cell factors in vivo. The molecules identified using the methods of the invention are useful for inhibiting the formation of a specific bound RNA:host cell factor complexes in vivo.


In some embodiments, test compounds identified by the methods of the invention are useful for increasing or decreasing the translation of messenger RNAs (“mRNAs”), e.g., protein production, by binding to one or more regulatory elements in the 5′ untranslated region, the 3′ untranslated region, or the coding region of the mRNA. Compounds that bind to mRNA can, inter alia, increase or decrease the rate of mRNA processing, alter its transport through the cell, prevent or enhance binding of the mRNA to ribosomes, suppressor proteins or enhancer proteins, or alter mRNA stability. Accordingly, compounds that increase or decrease mRNA translation can be used to treat or prevent disease. For example, diseases associated with protein overproduction, such as amyloidosis, or with the production of mutant proteins, such as Ras, can be treated or prevented by decreasing translation of the mRNA that codes for the overproduced protein, thus inhibiting production of the protein. Conversely, the symptoms of diseases associated with decreased protein function, such as hemophelia, may be treated by increasing translation of mRNA coding for the protein whose function is decreased, e.g., factor IX in some forms of hemophilia.


The methods of the invention can be used to identify compounds that bind to mRNAs coding for a variety of proteins with which the progression of diseases in mammals is associated. These mRNAs include, but are not limited to, those coding for amyloid protein and amyloid precursor protein; anti-angiogenic proteins such as angiostatin, endostatin, METH-1 and METH-2; apoptosis inhibitor proteins such as survivin, clotting factors such as Factor IX, Factor VIII, and others in the clotting cascade; collagens; cyclins and cyclin inhibitors, such as cyclin dependent kinases, cyclin D1, cyclin E, WAF1, cdk4 inhibitor, and MTS1; cystic fibrosis transmembrane conductance regulator gene (CFTR); cytokines such as IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17 and other interleukins; hematopoetic growth factors such as erythropoietin (Epo); colony stimulating factors such as G-CSF, GM-CSF, M-CSF, SCF and thrombopoietin; growth factors such as BNDF, BMP, GGRP, EGF, FGF, GDNF, GGF, HGF, IGF-1, IGF-2, KGF, myotrophin, NGF, OSM, PDGF, somatotrophin, TGF-β, TGF-α and VEGF; antiviral cytokines such as interferons, antiviral proteins induced by interferons, TNF-α, and TNF-β; enzymes such as cathepsin K, cytochrome P-450 and other cytochromes, farnesyl transferase, glutathione-s transferases, heparanase, HMG CoA synthetase, N-acetyltransferase, phenylalanine hydroxylase, phosphodiesterase, ras carboxyl-terminal protease, telomerase and TNF converting enzyme; glycoproteins such as cadherins, e.g., N-cadherin and E-cadherin; cell adhesion molecules; selecting; transmembrane glycoproteins such as CD40; heat shock proteins; hormones such as 5-α reductase, atrial natriuretic factor, calcitonin, corticotrophin releasing factor, diuretic hormones, glucagon, gonadotropin, gonadotropin releasing hormone, growth hormone, growth hormone releasing factor, somatotropin, insulin, leptin, luteinizing hormone, luteinizing hormone releasing hormone, parathyroid hormone, thyroid hormone, and thyroid stimulating hormone; proteins involved in immune responses, including antibodies, CTLA4, hemagglutinin, MHC proteins, VLA-4, and kallikrein-kininogen-kinin system; ligands such as CD4; oncogene products such as sis, hst, protein tyrosine kinase receptors, ras, abl, mos, myc, fos, jun, H-ras, ki-ras, c-fms, bcl-2, L-myc, c-myc, gip, gsp, and HER-2; receptors such as bombesin receptor, estrogen receptor, GABA receptors, growth factor receptors including EGFR, PDGFR, FGFR, and NGFR, GTP-binding regulatory proteins, interleukin receptors, ion channel receptors, leukotriene receptor antagonists, lipoprotein receptors, opioid pain receptors, substance P receptors, retinoic acid and retinoid receptors, steroid receptors, T-cell receptors, thyroid hormone receptors, TNF receptors; tissue plasminogen activator; transmembrane receptors; transmembrane transporting systems, such as calcium pump, proton pump, Na/Ca exchanger, MRP1, MRP2, P170, LRP, and cMOAT; transferrin; and tumor suppressor gene products such as APC, brca1, brca2, DCC, MCC, MTS1, NF1, NF2, nm23, p53 and Rb. In addition to the eukaryotic genes listed above, the invention, as described, can be used to define molecules that interrupt viral, bacterial or fungal transcription or translation efficiencies and therefore form the basis for a novel anti-infectious disease therapeutic. Other target genes include, but are not limited to, those disclosed in Section 4.1 and Section 5.


The methods of the invention can be used to identify mRNA-binding test compounds for increasing or decreasing the production of a protein, thus treating or preventing a disease associated with decreasing or increasing the production of said protein, respectively. The methods of the invention may be useful for identifying test compounds for treating or preventing a disease in mammals, including cats, dogs, swine, horses, goats, sheep, cattle, primates and humans. Such diseases include, but are not limited to, amyloidosis, hemophilia, Alzheimer's disease, atherosclerosis, cancer, giantism, dwarfism, hypothyroidism, hyperthyroidism, inflammation, cystic fibrosis, autoimmune disorders, diabetes, aging, obesity, neurodegenerative disorders, and Parkinson's disease. Other diseases include, but are not limited to, those described in Section 4.1 and diseases caused by aberrant expression of the genes disclosed in Example 5. In addition to the eukaryotic genes listed above, the invention, as described, can be used to define molecules that interrupt viral, bacterial or fungal transcription or translation efficiencies and therefore form the basis for a novel anti-infectious disease therapeutic.


In other embodiments, test compounds identified by the methods of the invention are useful for preventing the interaction of an RNA, such as a transfer RNA (“tRNA”), an enzymatic RNA or a ribosomal RNA (“rRNA”), with a protein or with another RNA, thus preventing, e.g., assembly of an in vivo protein-RNA or RNA-RNA complex that is essential for the viability of a cell. The term “enzymatic RNA,” as used herein, refers to RNA molecules that are either self-splicing, or that form an enzyme by virtue of their association with one or more proteins, e.g., as in RNase P, telomerase or small nuclear ribonuclear protein particles. For example, inhibition of an interaction between rRNA and one or more ribosomal proteins may inhibit the assembly of ribosomes, rendering a cell incapable of synthesizing proteins. In addition, inhibition of the interaction of precursor rRNA with ribonucleases or ribonucleoprotein complexes (such as RNase P) that process the precursor rRNA prevent maturation of the rRNA and its assembly into ribosomes. Similarly, a tRNA:tRNA synthetase complex may be inhibited by test compounds identified by the methods of the invention such that tRNA molecules do not become charged with amino acids. Such interactions include, but are not limited to, rRNA interactions with ribosomal proteins, tRNA interactions with tRNA synthetase, RNase P protein interactions with RNase P RNA, and telomerase protein interactions with telomerase RNA.


In other embodiments, test compounds identified by the methods of the invention are useful for treating or preventing a viral, bacterial, protozoan or fungal infection. For example, transcriptional up-regulation of the genes of human immunodeficiency virus type 1 (“HIV-1”) requires binding of the HIV Tat protein to the HIV trans-activation response region RNA (“TAR RNA”). HIV TAR RNA is a 59-base stem-loop structure located at the 5′-end of all nascent HIV-1 transcripts (Jones & Peterlin, 1994, Annu. Rev. Biochem. 63:717-43). Tat protein is known to interact with uracil 23 in the bulge region of the stem of TAR RNA. Thus, TAR RNA is a potential binding target for test compounds, such as small peptides and peptide analogs that bind to the bulge region of TAR RNA and inhibit formation of a Tat-TAR RNA complex involved in HIV-1 upregulation (see Hwang et al., 1999 Proc. Natl. Acad. Sci. USA 96:12997-13002). Accordingly, test compounds that bind to TAR RNA are useful as anti-HIV therapeutics (Hamy et al., 1997, Proc. Natl. Acad. Sci. USA 94:3548-3553; Hamy et al., 1998, Biochemistry 37:5086-5095; Mei et al., 1998, Biochemistry 37:14204-14212), and therefore, are useful for treating or preventing AIDS.


The methods of the invention can be used to identify test compounds to treat or prevent viral, bacterial, protozoan or fungal infections in a patient. In some embodiments, the methods of the invention are useful for identifying compounds that decrease translation of microbial genes by interacting with mRNA, as described above, or for identifying compounds that inhibit the interactions of microbial RNAs with proteins or other ligands that are essential for viability of the virus or microbe. Examples of microbial target RNAs useful in the present invention for identifying antiviral, antibacterial, anti-protozoan and anti-fungal compounds include, but are not limited to, general antiviral and anti-inflammatory targets such as mRNAs of INFα, INFγ, RNAse L, RNAse L inhibitor protein, PKR, tumor necrosis factor, interleukins 1-15, and IMP dehydrogenase; internal ribosome entry sites; HIV-1 CT rich domain and RNase H mRNA; HCV internal ribosome entry site (required to direct translation of HCV mRNA), and the 3′-untranslated tail of HCV genomes; rotavirus NSP3 binding site, which binds the protein NSP3 that is required for rotavirus mRNA translation; HBV epsilon domain; Dengue virus 5′ and 3′ untranslated regions, including IRES; INFα, INFβ and INFγ; plasmodium falciparum mRNAs; the 16S ribosomal subunit ribosomal RNA and the RNA component of RNase P of bacteria; and the RNA component of telomerase in fungi and cancer cells. Other target viral and bacterial mRNAs include, but are not limited so, those disclosed in Section 5.


One of skill in the art will appreciate that, although such target RNAs are functionally conserved in various species (e.g., from yeast to humans), they exhibit nucleotide sequence and structural diversity. Therefore, inhibition of, for example, yeast telomerase by an anti-fungal compound identified by the methods of the invention might not interfere with human telomerase and normal human cell proliferation.


Thus, the methods of the invention can be used to identify test compounds that interfere with one or more target RNA interactions with host cell factors that are important for cell growth or viability, or essential in the life cycle of a virus, a bacterium, a protozoa or a fungus. Such test compounds and/or congeners that demonstrate desirable biologic and pharmacologic activity can be administered to a patient in need thereof in order to treat or prevent a disease caused by viral, bacterial, protozoan, or fungal infections. Such diseases include, but are not limited to, HIV infection, AIDS, human T-cell leukemia, SIV infection, FIV infection, feline leukemia, hepatitis A, hepatitis B, hepatitis C, Dengue fever, malaria, rotavirus infection, severe acute gastroenteritis, diarrhea, encephalitis, hemorrhagic fever, syphilis, legionella, whooping cough, gonorrhea, sepsis, influenza, pneumonia, tinea infection, candida infection, and meningitis.


Non-limiting examples of RNA elements involved in the regulation of gene expression, i.e., mRNA stability, translational efficiency via translational initiation and ribosome assembly, etc., include the HIV TAR element, internal ribosome entry site, “slippery site”, instability elements, and adenylate uridylate-rich elements, as discussed below.


4.1.1. HIV TAR Element

Transcriptional up-regulation of the genes of human immunodeficiency virus type 1 (“HIV-1”) requires binding of the HIV Tat protein to the HIV trans-activation response region RNA (“TAR RNA”), a 59-base stem-loop structure located at the 5′ end of all nascent HIV-1 transcripts (Jones & Peterlin, 1994, Annu. Rev. Biochem. 63:717-43). Tat protein is known to interact with uracil 23 in the bulge region of the stem of TAR RNA. Thus, TAR RNA is a useful binding target for test compounds, such as small peptides and peptide analogs that bind to the bulge region of TAR RNA and inhibit formation of a Tat-TAR RNA complex involved in HIV-1 up-regulation (see Hwang et al., 1999 Proc. Natl. Acad. Sci. USA 96:12997-13002). Accordingly, test compounds that bind to TAR RNA can be useful as anti-HIV therapeutics (Hamy et al., 1997, Proc. Natl. Acad. Sci. USA 94:3548-3553; Hamy et al., 1998, Biochemistry 37:5086-5095; Mei et al., 1998, Biochemistry 37:14204-14212), and therefore, are useful for treating or preventing AIDS.


4.1.2. Internal Ribosome Entry Site (“IRES”)

Internal ribosome entry sites (“IRES”) are found in the 5′ untranslated regions (“5“UTR”) of several mRNAs, and are thought to be involved in the regulation of translational efficiency. When the IRES element is present on an mRNA downstream of a translational stop codon, it directs ribosomal re-entry (Ghattas et al., 1991, Mol. Cell. Biol. 11:5848-5959), which permits initiation of translation at the start of a second open reading frame.


As reviewed by Jang et al., a large segment of the 5′ nontranslated region, approximately 400 nucleotides in length, promotes internal entry of ribosomes independent of the non-capped 5′ end of picornavirus mRNAs (mammalian plus-strand RNA viruses whose genomes serve as mRNA). This 400 nucleotide segment (IRES), maps approximately 200 nt down-stream from the 5′ end and is highly structured. IRES elements of different picornaviruses, although functionally similar in vitro and in vivo, are not identical in sequence or structure. However, IRES elements of the genera entero- and rhinoviruses, on the one hand, and cardio- and aphthoviruses, on the other hand, reveal similarities corresponding to phylogenetic kinship. All IRES elements contain a conserved Yn-Xm-AUG unit (Y, pyrimidine; X, nucleotide) which appears essential for IRES function. The IRES elements of cardio-, entero- and aphthoviruses bind a cellular protein, p57. In the case of cardioviruses, the interaction between a specific stem-loop of the IREs is essential for translation in vitro. The IRES elements of entero- and cardioviruses also bind the cellular protein, p52, but the significance of this interaction remains to be shown. The function of p57 or p52 in cellular metabolism is unknown. Since picornaviral IRES elements function in vivo in the absence of any viral gene products, is speculated that IRES-like elements may also occur in specific cellular mRNAs releasing them from cap-dependent translation (Jang et al., 1990, Enzyme 44(1-4):292-309).


4.1.3. “Slippery Site”

Programmed, or directed, ribosomal frameshifting, when ribosomes shift from one translation reading frame to another and synthesize two viral proteins from a single viral mRNA, is directed by a unique site in viral mRNAs called the “slippery site.” The slippery site directs ribosomal frameshifting in the −1 or +1 direction that causes the ribosome to slip by one base in the 5′ direction thereby placing the ribosome in the new reading frame to produce a new protein.


Programmed, or directed, ribosomal frameshifting is of particular value to viruses that package their plus strands, as it eliminates the need to splice their mRNAs and reduces the risk of packaging defective genomes and regulates the ratio of viral proteins synthesized. Examples of programmed translational frameshifting (both +1 and −1 shifts) have been identified in ScV systems (Lopinski et al., 2000, Mol. Cell. Biol. 20(4):1095-103, retroviruses (Falk et al., 1993, J. Virol. 67:273-6277; Jacks & Varmus, 1985, Science 230:1237-1242; Morikawa & Bishop, 1992, Virology 186:389-397; Nam et al., 1993, J. Virol. 67:196-203); coronaviruses (Brierley et al., 1987, EMBO J. 6:3779-3785; Herold & Siddell, 1993, Nucleic Acids Res. 21:5838-5842); giardiaviruses, which are also members of the Totiviridae (Wang et al., 1993, Proc. Natl. Acad. Sci. USA 90:8595-8599); two bacterial genes (Blinkowa & Walker, 1990, Nucleic Acids Res., 18:1725-1729; Craigen & Caskey, 1986, Nature 322:273); bacteriophage genes (Condron et al., 1991, Nucleic Acids Res. 19:5607-5612); astroviruses (Marczinke et al., 1994, J. Virol. 68:5588-5595); the yeast EST3 gene (Lundblad & Morris, 1997, Curr. Biol. 7:969-976); and the rat, mouse, Xenopus, and Drosophila ornithine decarboxylase antizymes (Matsufuji et al., 1995, Cell 80:51-60); and a significant number of cellular genes (Herold & Siddell, 1993, Nucleic Acids Res. 21:5838-5842).


Drugs targeted to ribosomal frameshifting minimize the problem of virus drug resistance because this strategy targets a host cellular process rather than one introduced into the cell by the virus, which minimizes the ability of viruses to evolve drug-resistant mutants. Compounds that target the RNA elements involved in regulating programmed frameshifting should have several advantages, including (a) any selective pressure on the host cellular translational machinery to adapt to the drugs would have to occur at the host evolutionary time scale, which is on the order of millions of years, (b) ribosomal frameshifting is not used to express any host proteins, and (c) altering viral frameshifting efficiencies by modulating the activity of a host protein minimizing the likelihood that the virus will acquire resistance to such inhibition by mutations in its own genome.


4.1.4. Instability Elements

“Instability elements” may be defined as specific sequence elements that promote the recognition of unstable mRNAs by cellular turnover machinery. Instability elements have been found within mRNA protein coding regions as well as untranslated regions.


Altering the control of stability of normal mRNAs may lead to disease. The alteration of mRNA stability has been implicated in diseases such as, but not limited to, cancer, immune disorders, heart disease, and fibrotic disorders.


There are several examples of mutations that delete instability elements which then result in stabilization of mRNAs that may be involved in the onset of cancer. In Burkitt's lymphoma, a portion of the c-myc proto-oncogene is translocated to an Ig locus, producing a form of the c-myc mRNA that is five times more stable (see, e.g., Kapstein et al., 1996, J. Biol. Chem. 271(31):18875-84). The highly oncogenic v-fos mRNA lacks the 3′ UTR adenylate uridylate rich element (“ARE”) that is found in the more labile and weakly oncogenic c-fos mRNA (see, e.g., Schiavi et al., 1992, Biochim Biophys Acta. 1114(2-3):95-106). Differences between the benign cervical lesions brought about by nonintegrated circular human papillomavirus type 16 and its integrated form, that lacks the 3′ UTR ARE and correlates with cervical carcinomas, may be a consequence of stabilizing the E6/E7 transcripts encoding oncogenic proteins. Integration of the virus results in deletion of the ARE instability element, resulting in stabilizion of the transcripts and over-expression of the proteins (see, e.g., Jeon & Lambert, 1995, Proc. Natl. Acad. Sci. USA 92(5):1654-8). Deletion of AREs from the 3′ UTR of the IL-2 and IL-3 genes promotes increased stabilization of these mRNAs, high expression of these proteins, and leads to the formation of cancerous cells (see, e.g., Stoecklin et al., 2000, Mol. Cell. Biol. 20(11):3753-63).


Mutations in trans-acting factors involved in mRNA turnover may also promote cancer. In monocytic tumors, the lymphokine GM-CSF mRNA is specifically stabilized as a consequence of an oncogenic lesion in a trans-acting factor that controls mRNA turnover rates. Furthermore, the normally unstable IL-3 transcript is inappropriately long-lived in mast tumor cells. Similarly, the labile GM-CSF mRNA is greatly stabilized in bladder carcinoma cells. See, e.g., Bickel et al., 1990, J. Immunol. 145(3):840-5.


The immune system is regulated by a large number of regulatory molecules that either activate or inhibit the immune response. It has now been clearly demonstrated that stability of the transcripts encoding these proteins are highly regulated. Altered regulation of these molecules leads to mis-regulation of this process and can result in drastic medical consequences. For example, recent results using transgenic mice have shown that mis-regulation of the stability of the important modulator TNFα mRNA leads to diseases such as, but not limited to, rheumatoid arthritis and a Crohn's-like liver disease. See, e.g., Clark, 2000, Arthritis Res. 2(3):172-4.


Smooth muscle in the heart is modulated by the β-adrenergic receptor, which in turn responds to the sympathetic neurotransmitter norepinephrine and the adrenal hormone epinephrine. Chronic heart failure is characterized by impairment of smooth muscle cells, which results, in part, from the more rapid decay of the β-adrenergic receptor mRNA. See, e.g., Ellis & Frielle T., 1999, Biochem. Biophys. Res. Commun. 258(3):552-8.


A large number of diseases result from over-expression of collagen. For example, cirrhosis results from damage to the liver as a consequence of cancer, viral infection, or alcohol abuse. Such damage causes mis-regulation of collagen expression, leading to the formation of large collagen deposits. Recent results indicate that the sizeable increase in collagen expression is largely attributable to stabilization of its mRNA. See, e.g., Lindquist et al., 2000, Am. J. Physiol. Gastrointest. Liver Physiol. 279(3):G471-6.


4.1.5. Adenylate Uridylate-Rich Elements (“ARE”)

Adenylate uridylate-rich elements (“ARE”) are found in the 3′ untranslated regions (“3′ UTR”) of several mRNAs, and involved in the turnover of mRNAs, such as but not limited to transcription factors, cytokines, and lymphokines. AREs may function both as stabilizing and destabilizing elements. ARE mRNAs are classified into five groups, depending on sequence (Bakheet et al., 2001, Nucl. Acids Res. 29(1):246-254). An ongoing database at the web site http://rc.kfshrc.edu.sa/ared contains ARE-containing mRNAs and their cluster groups, which is incorporated by reference in its entirety. The ARE motifs are classified as follows:

Group I(AUUUAUUUAUUUAUUUAUUUA)SEQ ID NO: 1ClusterGroup II(AUUUAUUUAUUUAUUUA) stretchSEQ ID NO: 2ClusterGroup III(WAUUUAUUUAUUUAW) stretchSEQ ID NO: 3ClusterGroup IV(WWAUUUAUUUAWW) stretchSEQ ID NO: 4ClusterGroup V(WWWWAUUUAWWWW) stretchSEQ ID NO: 5Cluster


The ARE-mRNAs were clustered into five groups containing five, four, three and two pentameric repeats, while the last group contains only one pentamer within the 13-bp ARE pattern. Functional categories were assigned whenever possible according to NCBI-COG functional annotation (Tatusov et al., 2001, Nucleic Acids Research, 29(1): 22-28), in addition to the categories: inflammation, immune response, development/differentiation, using an extensive literature search.


Group I contains many secreted proteins including GM-CSF, IL-1, IL-11, IL-12 and Gro-β that affect the growth of hematopoietic and immune cells (Witsell & Schook, 1992, Proc. Natl. Acad. Sci. USA, 89:4754-4758). Although TNFα is both a pro-inflammatory and anti-tumor protein, there is experimental evidence that it can act as a growth factor in certain leukemias and lymphomas. (Liu et al., 2000, J. Biol. Chem. 275:21086-21093).


Unlike Group I, Groups II-V contain functionally diverse gene families comprising immune response, cell cycle and proliferation, inflammation and coagulation, angiogenesis, metabolism, energy, DNA binding and transcription, nutrient transportation and ionic homeostasis, protein synthesis, cellular biogenesis, signal transduction, and apoptosis (Bakheet et al., 2001, Nucl. Acids Res. 29(1):246-254).


Several groups have described ARE-binding proteins that influence the ARE-mRNA stability. Among the well-characterized proteins are the mammalian homologs of ELAV (embryonic lethal abnormal vision) proteins including AUF1, HuR and He1-N2 (Zhang et al., 1993, Mol. Cell. Biol. 13:7652-7665; Levine et al., 1993, Mol. Cell. Biol. 13:3494-3504: Ma et al., 1996, J. Biol. Chem. 271:8144-8151). The zinc-finger protein tristetraprolin has been identified as another ARE-binding protein with destabilizing activity on TNFα, IL-3 and GM-CSF mRNAs (Stoecklin et al., 2000, Mol. Cell. Biol. 20:3753-3763; Carballo et al., 2000, Blood 95:1891-1899).


Since ARE-containing genes are clearly important in biological systems, including but not limited to a number of the early response genes that regulate cell proliferation and responses to exogenous agents, the identification of compounds that bind to one or more of the ARE clusters and potentially modulate the stability of the target RNA can potentially be of value as a therapeutic.


4.2. Detectably Labeled Target RNAs

Target nucleic acids, including but not limited to RNA and DNA, useful in the methods of the present invention have a label that is detectable via conventional spectroscopic means or radiographic means. Preferably, target nucleic acids are labeled with a covalently attached dye molecule. Useful dye-molecule labels include, but are not limited to, fluorescent dyes, phosphorescent dyes, ultraviolet dyes, infrared dyes, and visible dyes. Preferably, the dye is a visible dye.


Useful labels in the present invention can include, but are not limited to, spectroscopic labels such as fluorescent dyes (e.g., fluorescein and derivatives such as fluorescein isothiocyanate (FITC) and Oregon Green™, rhodamine and derivatives (e.g., Texas red, tetramethylrhodimine isothiocynate (TRITC), bora-3a,4a-diaza-s-indacene (BODIPY®) and derivatives, etc.), digoxigenin, biotin, phycoerythrin, AMCA, CyDye™, and the like), radiolabels (e.g., 3H, 125I, 35S, 14C, 32P, 33P, etc.), enzymes (e.g., horse radish peroxidase, alkaline phosphatase etc.), spectroscopic colorimetric labels such as colloidal gold or colored glass or plastic (e.g. polystyrene, polypropylene, latex, etc.) beads, or nanoparticles—nanoclusters of inorganic ions with defined dimension from 0.1 to 1000 nm. The label may be coupled directly or indirectly to a component of the detection assay (e.g., the detection reagent) according to methods well known in the art. A wide variety of labels may be used, with the choice of label depending on sensitivity required, ease of conjugation with the compound, stability requirements, available instrumentation, and disposal provisions.


In one embodiment, nucleic acids that are labeled at one or more specific locations are chemically synthesized using phosphoramidite or other solution or solid-phase methods. Detailed descriptions of the chemistry used to form polynucleotides by the phosphoramidite method are well known (see, e.g., Caruthers et al., U.S. Pat. Nos. 4,458,066 and 4,415,732; Caruthers et al., 1982, Genetic Engineering 4:1-17; Users Manual Model 392 and 394 Polynucleotide Synthesizers, 1990, pages 6-1 through 6-22, Applied Biosystems, Part No. 901237; Ojwang, et al., 1997, Biochemistry, 36:6033-6045). The phosphoramidite method of polynucleotide synthesis is the preferred method because of its efficient and rapid coupling and the stability of the starting materials. The synthesis is performed with the growing polynucleotide chain attached to a solid support, such that excess reagents, which are generally in the liquid phase, can be easily removed by washing, decanting, and/or filtration, thereby eliminating the need for purification steps between synthesis cycles.


The following briefly describes illustrative steps of a typical polynucleotide synthesis cycle using the phosphoramidite method. First, a solid support to which is attached a protected nucleoside monomer at its 3′ terminus is treated with acid, e.g., trichloroacetic acid, to remove the 5′-hydroxyl protecting group, freeing the hydroxyl group for a subsequent coupling reaction. After the coupling reaction is completed an activated intermediate is formed by contacting the support-bound nucleoside with a protected nucleoside phosphoramidite monomer and a weak acid, e.g., tetrazole. The weak acid protonates the nitrogen atom of the phosphoramidite forming a reactive intermediate. Nucleoside addition is generally complete within 30 seconds. Next, a capping step is performed, which terminates any polynucleotide chains that did not undergo nucleoside addition. Capping is preferably performed using acetic anhydride and 1-methylimidazole. The phosphite group of the internucleotide linkage is then converted to the more stable phosphotriester by oxidation using iodine as the preferred oxidizing agent and water as the oxygen donor. After oxidation, the hydroxyl protecting group of the newly added nucleoside is removed with a protic acid, e.g., trichloroacetic acid or dichloroacetic acid, and the cycle is repeated one or more times until chain elongation is complete. After synthesis, the polynucleotide chain is cleaved from the support using a base, e.g., ammonium hydroxide or t-butyl amine. The cleavage reaction also removes any phosphate protecting groups, e.g., cyanoethyl. Finally, the protecting groups on the exocyclic amines of the bases and any protecting groups on the dyes are removed by treating the polynucleotide solution in base at an elevated temperature, e.g., at about 55° C. Preferably the various protecting groups are removed using ammonium hydroxide or t-butyl amine.


Any of the nucleoside phosphoramidite monomers can be labeled using standard phosphoramidite chemistry methods (Hwang et al., 1999, Proc. Natl. Acad. Sci. USA 96(23):12997-13002; Ojwang et al., 1997, Biochemistry. 36:6033-6045 and references cited therein). Dye molecules useful for covalently coupling to phosphoramidites preferably comprise a primary hydroxyl group that is not part of the dye's chromophore. Illustrative dye molecules include, but are not limited to, disperse dye CAS 4439-31-0, disperse dye CAS 6054-58-6, disperse dye CAS 4392-69-2 (Sigma-Aldrich, St. Louis, Mo.), disperse red, and 1-pyrenebutanol (Molecular Probes, Eugene, Oreg.). Other dyes useful for coupling to phosphoramidites will be apparent to those of skill in the art, such as fluoroscein, cy3, and cy5 fluorescent dyes, and may be purchased from, e.g., Sigma-Aldrich, St. Louis, Mo. or Molecular Probes, Inc., Eugene, Oreg.


In another embodiment, dye-labeled target RNA molecules are synthesized enzymatically using in vitro transcription (Hwang et al., 1999, Proc. Natl. Acad. Sci. USA 96(23): 12997-13002 and references cited therein). In this embodiment, a template DNA is denatured by heating to about 90° C. and an oligonucleotide primer is annealed to the template DNA, for example by slow-cooling the mixture of the denatured template and the primer from about 90° C. to room temperature. A mixture of ribonucleoside-5′-triphosphates capable of supporting template-directed enzymatic extension of the primed template (e.g., a mixture including GTP, ATP, CTP, and UTP), including one or more dye-labeled ribonucleotides (Sigma-Aldrich, St. Louis, Mo.), is added to the primed template. Next, a polymerase enzyme is added to the mixture under conditions where the polymerase enzyme is active, which are well-known to those skilled in the art. A labeled polynucleotide is formed by the incorporation of the labeled ribonucleotides during polymerase-mediated strand synthesis.


In yet another embodiment of the invention, nucleic acid molecules are end-labeled after their synthesis. Methods for labeling the 5′-end of an oligonucleotide include but are by no means limited to: (i) periodate oxidation of a 5′-to-5′-coupled ribonucleotide, followed by reaction with an amine-reactive label (Heller & Morisson, 1985, in Rapid Detection and Identification of Infectious Agents, D. T. Kingsbury and S. Falkow, eds., pp. 245-256, Academic Press); (ii) condensation of ethylenediamine with 5′-phosphorylated polynucleotide, followed by reaction with an amine-reactive label (Morrison, European Patent Application 232 967); (iii) introduction of an aliphatic amine substituent using an aminohexyl phosphite reagent in solid-phase DNA synthesis, followed by reaction with an amine reactive label (Cardullo et al., 1988, Proc. Natl. Acad. Sci. USA 85:8790-8794); and (iv) introduction of a thiophosphate group on the 5′-end of the nucleic acid, using phosphatase treatment followed by end-labeling with ATP-S and kinase, which reacts specifically and efficiently with maleimide-labeled fluorescent dyes (Czworkowski et al., 1991, Biochem. 30:4821-4830).


A detectable label should not be incorporated into a target nucleic acid at the specific binding site at which test compounds are likely to bind, since the presence of a covalently attached label might interfere sterically or chemically with the binding of the test compounds at this site. Accordingly, if the region of the target nucleic acid that binds to a host cell factor is known, a detectable label is preferably incorporated into the nucleic acid molecule at one or more positions that are spatially or sequentially remote from the binding region.


After synthesis, the labeled target nucleic acid can be purified using standard techniques known to those skilled in the art (see Hwang et al., 1999, Proc. Natl. Acad. Sci. USA 96(23): 12997-13002 and references cited therein). Depending on the length of the target nucleic acid and the method of its synthesis, such purification techniques include, but are not limited to, reverse-phase high-performance liquid chromatography (“reverse-phase HPLC”), fast performance liquid chromatography (“FPLC”), and gel purification. After purification, the target RNA is refolded into its native conformation, preferably by heating to approximately 85-95° C. and slowly cooling to room temperature in a buffer, e.g., a buffer comprising about 50 mM Tris-HCl, pH 8 and 100 mM NaCl.


In another embodiment, the target nucleic acid can also be radiolabeled. A radiolabel, such as, but not limited to, an isotope of phosphorus, sulfur, or hydrogen, may be incorporated into a nucleotide, which is added either after or during the synthesis of the target nucleic acid. Methods for the synthesis and purification of radiolabeled nucleic acids are well known to one of skill in the art. See, e.g., Sambrook et al., 1989, in Molecular Cloning: A Laboratory Manual, pp 10.2-10.70, Cold Spring Harbor Laboratory Press, and the references cited therein, which are hereby incorporated by reference in their entireties.


In another embodiment, the target nucleic acid can be attached to an inorganic nanoparticle. A nanoparticle is a cluster of ions with controlled size from 0.1 to 1000 run comprised of metals, metal oxides, or semiconductors including, but not limited to Ag2S, ZnS, CdS, CdTe, Au, or TiO2. Nanoparticles have unique optical, electronic and catalytic properties relative to bulk materials which can be adjusted according to the size of the particle. Methods for the attachment of nucleic acids are well know to one of skill in the art (see, e.g., Niemeyer, 2001, Angew. Chem. Int. Ed. 40: 4129-4158, International Patent Publication WO/0218643, and the references cited therein, the disclosures of which are hereby incorporated by reference in their entireties).


4.3. Libraries of Small Molecules

Libraries screened using the methods of the present invention can comprise a variety of types of test compounds on solid supports. In all of the embodiments described below, all of the libraries can be synthesized on solid supports or the compounds of the library can be attached to solid supports by linkers.


In some embodiments, the test compounds are nucleic acid or peptide molecules. In a non-limiting example, peptide molecules can exist in a phage display library. In other embodiments, types of test compounds include, but are not limited to, peptide analogs including peptides comprising non-naturally occurring amino acids, e.g., D-amino acids, phosphorous analogs of amino acids, such as α-amino phosphoric acids and α-amino phosphoric acids, or amino acids having non-peptide linkages, nucleic acid analogs such as phosphorothioates and PNAs, hormones, antigens, synthetic or naturally occurring drugs, opiates, dopamine, serotonin, catecholamines, thrombin, acetylcholine, prostaglandins, organic molecules, pheromones, adenosine, sucrose, glucose, lactose and galactose. Libraries of polypeptides or proteins can also be used.


In a preferred embodiment, the combinatorial libraries are small organic molecule libraries, such as, but not limited to, benzodiazepines, isoprenoids, thiazolidinones, metathiazanones, pyrrolidines, morpholino compounds, and diazepindiones. In another embodiment, the combinatorial libraries comprise peptoids; random bio-oligomers; benzodiazepines; diversomers such as hydantoins, benzodiazepines and dipeptides; vinylogous polypeptides; nonpeptidal peptidomimetics; oligocarbamates; peptidyl phosphonates; peptide nucleic acid libraries; antibody libraries; or carbohydrate libraries. Combinatorial libraries are themselves commercially available (see, e.g., Advanced ChemTech Europe Ltd., Cambridgeshire, UK; ASINEX, Moscow Russia; BioFocus plc, Sittingbourne, UK; Bionet Research (A division of Key Organics Limited), Camelford, UK; ChemBridge Corporation, San Diego, Calif.; ChemDiv Inc, San Diego, Calif.; ChemRx Advanced Technologies, South San Francisco, Calif.; ComGenex Inc., Budapest, Hungary; Evotec OAI Ltd, Abingdon, UK; IF LAB Ltd., Kiev, Ukraine; Maybridge plc, Cornwall, UK; PharmaCore, Inc., North. Carolina; SIDDCO Inc, Tucson, Ariz.; TimTec Inc, Newark, Del.; Tripos Receptor Research Ltd, Bude, UK; Toslab, Ekaterinburg, Russia).


In one embodiment, the combinatorial compound library for the methods of the present invention may be synthesized. There is a great interest in synthetic methods directed toward the creation of large collections of small organic compounds, or libraries, which could be screened for pharmacological, biological or other activity (Dolle, 2001, J. Comb. Chem. 3:477-517; Hall et al., 2001, ibid. 3:125-150; Dolle, 2000, ibid. 2:383-433; Dolle, 1999, ibid. 1:235-282); The synthetic methods applied to create vast combinatorial libraries are performed in solution or in the solid phase, i.e., on a solid support. Solid-phase synthesis makes it easier to conduct multi-step reactions and to drive reactions to completion with high yields because excess reagents can be easily added and washed away after each reaction step. Solid-phase combinatorial synthesis also tends to improve isolation, purification and screening. However, the more traditional solution phase chemistry supports a wider variety of organic reactions than solid-phase chemistry. Methods and strategies for the synthesis of combinatorial libraries can be found in A Practical Guide to Combinatorial Chemistry, A. W. Czarnik and S. H. Dewitt, eds., American Chemical Society, 1997; The Combinatorial Index, B. A. Bunin, Academic Press, 1998; Organic Synthesis on Solid Phase, F. Z. Dörwald, Wiley-VCH, 2000; and Solid-Phase Organic Syntheses, Vol. 1, A. W. Czarnik, ed., Wiley Interscience, 2001.


Combinatorial compound libraries of the present invention may be synthesized using apparatuses described in U.S. Pat. No. 6,358,479 to Frisina et al., U.S. Pat. No. 6,190,619 to Kilcoin et al., U.S. Pat. No. 6,132,686 to Gallup et al., U.S. Pat. No. 6,126,904 to Zuellig et al., U.S. Pat. No. 6,074,613 to Harness et al., U.S. Pat. No. 6,054,100 to Stanchfield et al., and U.S. Pat. No. 5,746,982 to Saneii et al. which are hereby incorporated by reference in their entirety. These patents describe synthesis apparatuses capable of holding a plurality of reaction vessels for parallel synthesis of multiple discrete compounds or for combinatorial libraries of compounds.


In one embodiment, the combinatorial compound library can be synthesized in solution. The method disclosed in U.S. Pat. No. 6,194,612 to Boger et al., which is hereby incorporated by reference in its entirety, features compounds useful as templates for solution phase synthesis of combinatorial libraries. The template is designed to permit reaction products to be easily purified from unreacted reactants using liquid/liquid or solid/liquid extractions. The compounds produced by combinatorial synthesis using the template will preferably be small organic molecules. Some compounds in the library may mimic the effects of non-peptides or peptides. In contrast to solid phase synthesize of combinatorial compound libraries, liquid phase synthesis does not require the use of specialized protocols for monitoring the individual steps of a multistep solid phase synthesis (Egner et al., 1995, J. Org. Chem. 60:2652; Anderson et al., 1995, J. Org. Chem. 60:2650; Fitch et al., 1994, J. Org. Chem. 59:7955; Look et al., 1994, J. Org. Chem. 49:7588; Metzger et al., 1993, Angew. Chem., Int. Ed. Engl. 32:894; Youngquist et al., 1994, Rapid Commun. Mass Spect. 8:77; Chu et al., 1996, J. Am. Chem. Soc. 117:5419; Brummel et al., 1994, Science 264:399; Stevanovic etal., 1993, Bioorg. Med. Chem. Lett. 3:431).


Combinatorial compound libraries useful for the methods of the present invention can be synthesized on solid supports. In one embodiment, a split synthesis method, a protocol of separating and mixing solid supports during the synthesis, is used to synthesize a library of compounds on solid supports (see Lam et al., 1997, Chem. Rev. 97:41-448; Ohlmeyer et al., 1993, Proc. Natl. Acad. Sci. USA 90:10922-10926 and references cited therein). Each solid support in the final library has substantially one type of test compound attached to its surface. Other methods for synthesizing combinatorial libraries on solid supports, wherein one product is attached to each support, will be known to those of skill in the art (see, e.g., Nefzi et al., 1997, Chem. Rev. 97:449-472 and U.S. Pat. No. 6,087,186 to Cargill et al. which are hereby incorporated by reference in their entirety).


As used herein, the term “solid support” is not limited to a specific type of solid support. Rather a large number of supports are available and are known to one skilled in the art. Solid supports include silica gels, resins, derivatized plastic films, glass beads, cotton, plastic beads, polystyrene beads, doped polystyrene beads (as described by Fenniri et al., 2000, J. Am. Chem. Soc. 123:8151-8152), alumina gels, and polysaccharides. A suitable solid support may be selected on the basis of desired end use and suitability for various synthetic protocols. For example, for peptide synthesis, a solid support can be a resin such as p-methylbenzhydrylamine (pMBHA) resin (Peptides International, Louisville, Ky.), polystyrenes (e.g., PAM-resin obtained from Bachem Inc., Peninsula Laboratories, etc.), including chloromethylpolystyrene, hydroxymethylpolystyrene and aminomethylpolystyrene, poly(dimethylacrylamide)-grafted styrene co-divinyl-benzene (e.g., POLYHIPE resin, obtained from Aminotech, Canada), polyamide resin (obtained from Peninsula Laboratories), polystyrene resin grafted with polyethylene glycol (e.g., TENTAGEL or ARGOGEL, Bayer, Tubingen, Germany) polydimethylacrylamide resin (obtained from Milligen/Biosearch, California), or Sepharose (Pharmacia, Sweden). In another embodiment, the solid support can be a magnetic bead coated with streptavidin, such as Dynabeads Streptavidin (Dynal Biotech, Oslo, Norway).


In one embodiment, the solid phase support is suitable for in vivo use, i.e., it can serve as a carrier or support for administration of the test compound to a patient (e.g., TENTAGEL, Bayer, Tubingen, Germany). In a particular embodiment, the solid support is palatable and/or orally ingestable.


In some embodiments of the present invention, compounds can be attached to solid supports via linkers. Linkers can be integral and part of the solid support, or they may be nonintegral that are either synthesized on the solid support or attached thereto after synthesis. Linkers are useful not only for providing points of test compound attachment to the solid support, but also for allowing different groups of molecules to be cleaved from the solid support under different conditions, depending on the nature of the linker. For example, linkers can be, inter alia, electrophilically cleaved, nucleophilically cleaved, photocleavable, enzymatically cleaved, cleaved by metals, cleaved under reductive conditions or cleaved under oxidative conditions.


4.4. Library Screening

After a target nucleic acid, such as but not limited to RNA or DNA, is labeled and a test compound library is synthesized or purchased or both, the labeled target nucleic acid is used to screen the library to identify test compounds that bind to the nucleic acid. Screening comprises contacting a labeled target nucleic acid with an individual, or small group, of the components of the compound library. Preferably, the contacting occurs in an aqueous solution, and most preferably, under physiologic conditions. The aqueous solution preferably stabilizes the labeled target nucleic acid and prevents denaturation or degradation of the nucleic acid without interfering with binding of the test compounds. The aqueous solution can be similar to the solution in which a complex between the target RNA and its corresponding host cell factor is formed in vitro. For example, TK buffer, which is commonly used to form Tat protein-TAR RNA complexes in vitro, can be used in the methods of the invention as an aqueous solution to screen a library of test compounds for TAR RNA binding compounds.


The methods of the present invention for screening a library of test compounds preferably comprise contacting a test compound with a target nucleic acid in the presence of an aqueous solution, the aqueous solution comprising a buffer and a combination of salts, preferably approximating or mimicking physiologic conditions. The aqueous solution optionally further comprises non-specific nucleic acids, such as, but not limited to, DNA; yeast tRNA; salmon sperm DNA; homoribopolymers such as, but not limited to, poly IC, polyA, polyU, and polyC; and non-specific RNA. The non-specific RNA may be an unlabeled target nucleic acid having a mutation at the binding site, which renders the unlabeled nucleic acid incapable of interacting with a test compound at that site. For example, if dye-labeled TAR RNA is used to screen a library, unlabeled TAR RNA having a mutation in the uracil 23/cytosine 24 bulge region may also be present in the aqueous solution. Without being bound by any theory, the addition of unlabeled RNA that is essentially identical to the dye-labeled target RNA except for a mutation at the binding site might minimize interactions of other regions of the dye-labeled target RNA with test compounds or with the solid support and prevent false positive results.


The solution further comprises a buffer, a combination of salts, and optionally, a detergent or a surfactant. The pH of the solution typically ranges from about 5 to about 8, preferably from about 6 to about 8, most preferably from about 6.5 to about 8. A variety of buffers may be used to achieve the desired pH. Suitable buffers include, but are not limited to, Tris, Mes, Bis-Tris, Ada, Aces, Pipes, Mopso, Bis-Tris propane, Bes, Mops, Tes, Hepes, Dipso, Mobs, Tapso, Trizma, Heppso, Popso, TEA, Epps, Tricine, Gly-Gly, Bicine, and sodium-potassium phosphate. The buffering agent comprises from about 10 mM to about 100 mM, preferably from about 25 mM to about 75 mM, most preferably from about 40 mM to about 60 mM buffering agent. The pH of the aqeuous solution can be optimized for different screening reactions, depending on the target RNA used and the types of test compounds in the library, and therefore, the type and amount of the buffer used in the solution can vary from screen to screen. In a preferred embodiment, the aqueous solution has pH of about 7.4, which can be achieved using about 50 mM Tris buffer.


In addition to an appropriate buffer, the aqueous solution further comprises a combination of salts, from about 0 mM to about 100 mM KCl, from about 0 mM to about 1 M NaCl, and from about 0 mM to about 200 mM MgCl2. In a preferred embodiment, the combination of salts is about 100 mM KCl, 500 mM NaCl, and 10 mM MgCl2. Without being bound by any theory, Applicant has found that a combination of KCl, NaCl, and MgCl2 stabilizes the target RNA such that most of the RNA is not denatured or digested over the course of the screening reaction. The optional concentration of each salt used in the aqueous solution is dependent on the particular target RNA used and can be determined using routine experimentation.


The solution optionally comprises from about 0.01% to about 0.5% (w/v) of a detergent or a surfactant. Without being bound by any theory, a small amount of detergent or surfactant in the solution might reduce non-specific binding of the target RNA to the solid support and control aggregation and increase stability of target RNA molecules. Typical detergents useful in the methods of the present invention include, but are not limited to, anionic detergents, such as salts of deoxycholic acid, 1-heptanesulfonic acid, N-laurylsarcosine, lauryl sulfate, 1-octane sulfonic acid and taurocholic acid; cationic detergents such as benzalkonium chloride, cetylpyridinium, methylbenzethonium chloride, and decamethonium bromide; zwitterionic detergents such as CHAPS, CHAPSO, alkyl betaines, alkyl amidoalkyl betaines, N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate, and phosphatidylcholine; and non-ionic detergents such as n-decyl a-D-glucopyranoside, n-decyl β-D-maltopyranoside, n-dodecyl β-D-maltoside, n-octyl β-D-glucopyranoside, sorbitan esters, n-tetradecyl β-D-maltoside, octylphenoxy polyethoxyethanol (Nonidet P-40), nonylphenoxypolyethoxyethanol (NP-40), and tritons. Preferably, the detergent, if present, is a nonionic detergent. Typical surfactants useful in the methods of the present invention include, but are not limited to, ammonium lauryl sulfate, polyethylene glycols, butyl glucoside, decyl glucoside, Polysorbate 80, lauric acid, myristic acid, palmitic acid, potassium palmitate, undecanoic acid, lauryl betaine, and lauryl alcohol. More preferably, the detergent, if present, is Triton X-100 and present in an amount of about 0.1% (w/v).


Non-specific binding of a labeled target nucleic acid to test compounds can be further minimized by treating the binding reaction with one or more blocking agents. In one embodiment, the binding reactions are treated with a blocking agent, e.g., bovine serum albumin (“BSA”), before contacting with to the labeled target nucleic acid. In another embodiment, the binding reactions are treated sequentially with at least two different blocking agents. This blocking step is preferably performed at room temperature for from about 0.5 to about 3 hours. In a subsequent step, the reaction mixture is further treated with unlabeled RNA having a mutation at the binding site. This blocking step is preferably performed at about 4° C. for from about 12 hours to about 36 hours before addition of the dye-labeled target RNA. Preferably, the solution used in the one or more blocking steps is substantially similar to the aqueous solution used to screen the library with the dye-labeled target RNA, e.g., in pH and salt concentration.


Once contacted, the mixture of labeled target nucleic acid and the test compound is preferably maintained at 4° C. for from about 1 day to about 5 days, preferably from about 2 days to about 3 days with constant agitation. To identify the reactions in which binding to the labeled target nucleic acid occurred, after the incubation period, bound from free compounds are determined using any of the methods disclosed in Section 4.5 infra.


4.5. Separation Methods for Screening Test Compounds

After the labeled target RNA is contacted with the library of test compounds immobilized on beads, the beads must then be separated from the unbound target RNA in the liquid phase. This can be accomplished by any number of physical means; e.g., sedimentation, centrifugation. Thereafter, a number of methods can be used to separate the library beads that are complexed with the labeled target RNA from uncomplexed beads in order to isolate the test compound on the bead. Alternatively, mass spectroscopy and NMR spectroscopy can be used to simultaneously identify and separate beads complexed to the labeled target RNA from uncomplexed beads.


4.5.1. Flow Cytometry

In a preferred embodiment, the complexed and non-complexed target nucleic acids are separated by flow cytometry methods. Flow cytometers for sorting and examining biological cells are well known in the art; this technology can be applied to separate the labeled library beads from unlabeled beads. Known flow cytometers are described, for example, in U.S. Pat. Nos. 4,347,935; 5,464,581; 5,483,469; 5,602,039; 5,643,796; and 6,211,477; the entire contents of which are incorporated by reference herein. Other known flow cytometers are the FACS Vantage™ system manufactured by Becton Dickinson and Company, and the COPAS™ system manufactured by Union Biometrica.


A flow cytometer typically includes a sample reservoir for receiving a biological sample. The biological sample contains particles (hereinafter referred to as “beads”) that are to be analyzed and sorted by the flow cytometer. Beads are transported from the sample reservoir at high speed (>100 beads/second) to a flow cell in a stream of liquid “sheath fluid. High-frequency vibrations of a nozzle that directs the stream to the flow cell causes the stream to partition and form ordered droplets, with each droplet containing a single bead. Physical properties of beads can be measured as they intersect a laser beam within the cytometer flow cell. As beads move one by one through the interrogation point, they cause the laser light to scatter and fluorescent molecules on the labeled beads (i.e., beads complexed with labeled target RNA) become excited. Alternatively, if the target nucleic acid is labeled with an inorganic nanoparticle, the beads complexed with bound target nucleic acid can be distinguished not only by unique fluorescent properties but also on the basis of spectrometric properties (e.g. including but not limited to increased optical density due to the reduction of Ag+ ions in the presence of gold nanoparticles (see, e.g., Taton et al. Science 2000, 289: 1757-1760)).


An appropriate detection system consisting of photomultiplier tubes, photodiodes or other devices for measuring light are focused onto the interrogation point where the properties are measured. In so doing, information regarding particle size (light scatter) and complex formation (fluorescence intensity) is obtained. Particles with the desired physical properties are then sorted by a variety of physical means. In one embodiment, the beads are sorted by an electrostatic method. To sort beads by an electrostatic method, the droplets containing the beads with the desired physical properties are electrically charged and deflected from the trajectory of uncharged droplets as they pass through an electrostatic field formed by two deflection plates held constant at a high electrical potential difference. In another embodiment, the beads are sorted by an air-diverting method. To sort beads by an air-diverting method, the droplets containing the beads with the desired physical properties are deflected from their trajectory by a focused stream of forced air. Both of these embodiments cause the trajectory of beads with the desired physical properties to become changed, thereby sorting them from other beads. Accordingly, the beads complexed to the labeled target RNA can be collected in an appropriate collecting vessel.


Thus, in one embodiment of the present invention, the complexed and non-complexed target nucleic acids are separated by flow cytometry methods. In a preferred embodiment, the target nucleic acid is labeled with a fluorescent label and the complexed and non-complexed target nucleic acids are separated by fluorescence activated cell sorting (“FACS”). Such methods are well known to one of skill in the art.


4.5.2. Affinity Chromatography

In another embodiment of the invention, the target RNA can be labeled with biotin, an antigen, or a ligand. Library beads complexed to the target RNA can be separated from uncomplexed beads using affinity techniques designed to capture the labeled moiety on the target RNA. For example, a solid support, such as but not limited to, a column or a well in a microwell plate coated with avidin/streptavidin, an antibody to the antigen, or a receptor for the ligand can be used to capture or immobilize the labeled beads. Complexed RNA may or may not be irreversibly bound to the bead by a further transformation between the bound RNA and an additional moiety on the surface of the bead. Such linking methods include, but are not limited to: photochemical crosslinking between RNA and bead-bound molecules such as psoralen, thymidine or uridine derivates either present as monomers, oligomers, or as a partially complementary sequence; or chemical ligation by disulfide exchange, nitrogen mustards, bond formation between an electrophile and a nucleophile, or alkylating reagents. See, e.g., International Patent Publication WO/0146461, the contents of which are hereby incorporated by reference. The unbound library beads can be removed after the binding reaction by washing the solid phase. If the RNA is irreversibly bound to the bead, test compounds can be isolated from the bead following destruction of the bound RNA by preferably, but not limited to, enzymatic or chemical (e.g., alkaline hydrolysis) degradation. The library beads bound to the solid phase can then be eluted with any solution that disrupts the binding between the labeled target RNA and the solid phase. Such solutions include high salt solutions, low pH solutions, detergents, and chaotropic denaturants, and are well known to one of skill in the art. In another embodiment, the test compounds can be eluted from the solid phase by heat.


In one embodiment, the library of test compounds can be prepared on magnetic beads, such as Dynabeads Streptavidin (Dynal Biotech, Oslo, Norway). The magnetic bead library can then be mixed with the labeled target RNA under conditions that allow binding to occur. The separation of the beads from unbound target RNA in the liquid phase can be accomplished using a magnet. After removal of the magnetic field, the bead complexed to the labeled RNA may be separated from uncomplexed library beads via the label used on the target RNA; e.g., biotinylated target RNA can be captured by avidin/streptavidin; target RNA labeled with antigen can be captured by the appropriate antibody; target RNA labeled with ligand can be captured using the appropriate immobilized receptor. The captured library bead can then be eluted with any solution that disrupts the binding between the labeled target RNA and the immobilized surface. Such solutions include high salt solutions, low pH solutions, detergents, and chaotropic denaturants, and are well known to one of skill in the art. Complexed RNA may or may not be irreversibly bound to the bead by a further transformation between the bound RNA and an additional moiety on the surface of the bead. Such linking methods include, but are not limited to: photochemical crosslinking between RNA and bead-bound molecules such as psoralen, thymidine or uridine derivates either present as monomers, oligomers, or as a partially complementary sequence; or chemical ligation by disulfide exchange, nitrogen mustards, bond formation between an electrophile and a nucleophile, or alkylating reagents. See, e.g., International Patent Publication WO/0146461, the contents of which are hereby incorporated by reference. If the RNA is irreversibly bound to the bead, test compounds can be isolated from the bead following destruction of the bound RNA by enzymatic degradation including, but not limited to, ribonucleases A, U2, CL3, T1, Phy M, B. cereus or chemical degradation including, but not limited to, piperidine-promoted backbone cleavage of abasic sites (following treatment with sodium hydroxide, hydrazine, piperidine formate, or dimethyl sulfate), or metal-assisted (e.g. nickel(II), cobalt(II), or iron(II)) oxidative cleavage.


In another embodiment, the preselected target RNA can be labeled with a heavy metal tag and incubated with the library beads to allow binding of the test compounds to the target RNA. The separation of the labeled beads from unlabeled beads can be accomplished using a magnetic field. After removal of the magnetic field, the test compound can be eluted with any solution that disrupts the binding between the preselected target RNA and the test compound. Such solutions include high salt solutions, low pH solutions, detergents, and chaotropic denaturants, and are well known to one of skill in the art. In another embodiment, the test compounds can be eluted from the solid phase by heat.


4.5.3. Manual Batch

In one embodiment, a manual “batch” mode is used for separating complexed beads. To explore a bead-based library within a reasonable time period, the primary screens should be operated with sufficient throughput. To do this, the target nucleic acid is labeled with a dye and then incubated with the combinatorial library. An advantage of such an assay is the fast identification of active library beads by color change. In the lower concentrations of the dye-labeled target molecule, only those library beads that bind the target molecules most tightly are detected because of higher local concentration of the dye. When washed and plated into a liquid monolayer, colored beads are easily separated from non-colored beads with the aid of a dissecting microscope. One of the problems associated with this method could be the interaction between the red dye and library substrates. Control experiments using the dye alone and dye attached to mutant RNA sequences with the libraries are performed to eliminate this possibility.


4.5.4. Suspension of Beads in Electric Fields

In another embodiment of the invention, library beads bound to the target RNA can be separated from unbound beads on the basis of the altered charge properties due to RNA binding. In a preferred embodiment of this technique, beads are separated from unbound nucleic acid and suspended, preferably but not only, in the presence of an electric field where the bound RNA causes the beads bound to the target RNA to migrate toward the anode, or positive, end of the field.


Beads can be preferentially suspended in solution as a colloidal suspension with the aid of detergents or surfactants. Typical detergents useful in the methods of the present invention include, but are not limited to, anionic detergents, such as salts of deoxycholic acid, 1-heptanesulfonic acid, N-laurylsarcosine, lauryl sulfate, 1-octane sulfonic acid, carboxymethylcellulose, carrageenan, and taurocholic acid; cationic detergents such as benzalkonium chloride, cetylpyridinium, methylbenzethonium chloride, and decamethonium bromide; zwitterionic detergents such as CHAPS, CHAPSO, alkyl betaines, alky amidoalkyl betaines, N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate, and phosphatidylcholine; and non-ionic detergents such as n-decyl α-D-glucopyranoside, n-decyl-D-maltopyranoside, n-dodecyl-D-maltoside, n-octyl-D-glucopyranoside, sorbitan esters, n-tetradecyl-D-maltoside and tritons. Preferably, the detergent, if present, is a nonionic detergent. Typical surfactants useful in the methods of the present invention include, but are not limited to, ammonium lauryl sulfate, polyethylene glycols, butyl glucoside, decyl glucoside, Polysorbate 80, lauric acid, myristic acid, palmitic acid, potassium palmitate, undecanoic acid, lauryl betaine, and lauryl alcohol.


Complexed RNA may or may not be irreversibly bound to the bead by a further transformation between the bound RNA and an additional moiety on the surface of the bead. Such linking methods include, but are not limited to: photochemical crosslinking between RNA and bead-bound molecules such as psoralen, thymidine or uridine derivates either present as monomers, oligomers, or as a partially complementary sequence; or chemical ligation by disulfide exchange, nitrogen mustards, bond formation between an electrophile and a nucleophile, or alkylating reagents.


If the RNA is irreversibly bound to the bead, test compounds can be isolated from the bead following destruction of the bound RNA by enzymatic degradation including, but not limited to, ribonucleases A, U2, CL3, T1, Phy M, B. cereus or chemical degradation including, but not limited to, piperidine-promoted backbone cleavage of abasic sites (following treatment with sodium hydroxide, hydrazine, piperidine formate, or dimethyl sulfate), or metal-assisted (e.g. nickel(II), cobalt(II), or iron(II)) oxidative cleavage.


4.5.5. Microwave

In another embodiment, the complexed beads are separated from uncomplexed beads by microwave. For example, as described in U.S. Pat. Nos. 6,340,568; 6,338,968; and 6,287,874 to Hefti, the disclosures of which are hereby incorporated by reference, a system which is sensitive to the unique dielectric properties of molecules and binding complexes, such as hybridization complexes formed between a nucleic acid probe and a nucleic acid target, molecular binding events, and protein/ligand complexes, can be used to analyze nucleic acids. In this system, the different hybridization complexes can be directly distinguished without the use of labels. The method involves contacting a nucleic acid probe that is electromagnetically coupled to a portion of a signal path with a sample containing a target nucleic acid. The portion of the signal path to which the nucleic acid probe is coupled typically is a continuous transmission line. A response signal is detected for a hybridization complex formed between the nucleic acid probe and the nucleic acid target. Detection may involve propagating a test signal along the signal path and then detecting a response signal formed through modulation of the test signal by the hybridization complex.


4.6. Methods for Identifying Test Compounds

If the library is a peptide or nucleic acid library, the sequence of the test compound on the isolated bead can be determined by direct sequencing of the peptide or nucleic acid. Such methods are well known to one of skill in the art.


4.6.1. Mass Spectrometry

Mass spectrometry (e.g., electrospray ionization (“ESI”) and matrix-assisted laser desorption-ionization (“MALDI”), Fourier-transform ion cyclotron resonance (“FT-ICR”)) can be used both for high-throughput screening of test compounds that bind to a target RNA and elucidating the structure of the test compound on the isolated bead.


MALDI uses a pulsed laser for desorption of the ions and a time-of-flight analyzer, and has been used for the detection of noncovalent tRNA:amino-acyl-tRNA synthetase complexes (Gruic-Sovulj et al., 1997, J. Biol. Chem. 272:32084-32091). However, covalent cross-linking between the target nucleic acid and the test compound is required for detection, since a non-covalently bound complex may dissociate during the MALDI process.


ESI mass spectrometry (“ESI-MS”) has been of greater utility for studying non-covalent molecular interactions because, text missing or illegible when filedke the MALDI process, ESI-MS generates molecular ions with little to no fragmentation (Xavier et al., 2000, Trends Biotechnol. 18(8):349-356). ESI-MS has been used to study the complexes formed by HIV Tat peptide and protein with the TAR RNA (Sannes-Lowery et al., 1997, Anal. Chem. 69:5130-5135).


Fourier-transform ion cyclotron resonance (“FT-ICR”) mass spectrometry provides high-resolution spectra, isotope-resolved precursor ion selection, and accurate mass assignments (Xavier et al., 2000, Trends Biotechnol. 18(8):349-356). FT-ICR has been used to study the interaction of aminoglycoside antibiotics with cognate and non-cognate RNAs (Hofstadler et al., 1999, Anal. Chem. 71:3436-3440; Griffey et al., 1999, Proc. Natl. Acad. Sci. USA 96:10129-10133). As true for all of the mass spectrometry methods discussed herein, FT-ICR does not require labeling of the target RNA or a test compound.


An advantage of mass spectroscopy is not only the elucidation of the structure of the test compound, but also the determination of the structure of the test compound bound to the preselected target RNA. Such information can enable the discovery of a consensus structure of a test compound that specifically binds to a preselected target RNA.


In a preferred embodiment, the structure of the test compound is determined by time of flight mass spectroscopy (“TOF-MS”). In time of flight methods of mass spectrometry, charged (ionized) molecules are produced in a vacuum and accelerated by an electric field into a time of flight tube or drift tube. The velocity to which the molecules may be accelerated is proportional to the accelerating potential, proportional to the charge of the molecule, and inversely proportional to the square of the mass of the molecule. The charged molecules travel, i.e., “drift” down the TOF tube to a detector. The time taken for the molecules to travel down the tube may be interpreted as a measure of their molecular weight. Time-of-flight mass spectrometers have been developed for all of the major ionization techniques such as, but limited to, electron impact (“EI”), infrared laser desorption (“IRLD”), plasma desorption (“PD”), fast atom bombardment (“FAB”), secondary ion mass spectrometry (“SIMS”), matrix-assisted laser desorption/ionization (“MALDI”), and electrospray ionization (“ESI”).


4.6.2. NMR Spectroscopy

NMR spectroscopy can be used for elucidating the structure of the test compound on the isolated bead. NMR spectroscopy is a technique for identifying binding sites in target nucleic acids by qualitatively determining changes in chemical shift, specifically from distances measured using relaxation effects. Examples of NMR that can be used for the invention include, but are not limited to, one-dimentional NMR, two-dimentional NMR, correlation spectroscopy (“COSY”), and nuclear Overhauser effect (“NOE”) spectroscopy. Such methods of structure determination of test compounds are well known to one of skill in the art.


Similar to mass spectroscopy, an advantage of NMR is the not only the elucidation of the structure of the test compound, but also the determination of the structure of the test compound bound to the preselected target RNA. Such information can enable the discovery of a consensus structure of a test compound that specifically binds to a preselected target RNA.


4.6.3. Edman Degradation

In an embodiment wherein the library is a peptide library or a derivative thereof, Edman degradation can be used to determine the structure of the test compound. In one embodiment, a modified Edman degradation process is used to obtain compositional tags for proteins, which is described in U.S. Pat. No. 6,277,644 to Farnsworth et al., which is hereby incorporated by reference in its entirety. The Edman degradation chemistry is separated from amino acid analysis, circumventing the serial requirement of the conventional Edman process. Multiple cycles of coupling and cleavage are performed prior to extraction and compositional analysis of amino acids. The amino acid composition information is then used to search a database of known protein or DNA sequences to identify the sample protein. An apparatus for performing this method comprises a sample holder for holding the sample, a coupling agent supplier for supplying at least one coupling agent, a cleavage agent supplier for supplying a cleavage agent, a controller for directing the sequential supply of the coupling agents, cleavage agents, and other reagents necessary for performing the modified Edman degradation reactions, and an analyzer for analyzing amino acids.


In another embodiment, the method can be automated as described in U.S. Pat. No. 5,565,171 to Dovichi et al., which is hereby incorporated by reference in its entirety. The apparatus includes a continuous capillary connected between two valves that control fluid flow in the capillary. One part of the capillary forms a reaction chamber where the sample may be immobilized for subsequent reaction with reagents supplied through the valves. Another part of the capillary passes through or terminates in the detector portion of an analyzer such as an electrophoresis apparatus, liquid chromatographic apparatus or mass spectrometer. The apparatus may form a peptide or protein sequencer for carrying out the Edman degradation reaction and analyzing the reaction product produced by the reaction. The protein or peptide sequencer includes a reaction chamber for carrying out coupling and cleavage on a peptide or protein to produce derivatized amino acid residue, a conversion chamber for carrying out conversion and producing a coverted amino acid residue and an analyzer for identifying the converted amino acid residue. The reaction chamber may be contained within one arm of a capillary and the conversion chamber is located in another arm of the capillary. An electrophoresis length of capillary is directly capillary coupled to the conversion chamber to allow electrophoresis separation of the converted amino acid residue as it leaves the conversion chamber. Identification of the converted amino acid residue takes place at one end of the electrophoresis length of the capillary.


4.6.4. Vibrational Spectroscopy

Vibrational spectroscopy (e.g. infrared (IR) spectroscopy or Raman spectroscopy) can be used for elucidating the structure of the test compound on the isolated bead.


Infrared spectroscopy measures the frequencies of infrared light (wavelengths from 100 to 10,000 nm) absorbed by the test compound as a result of excitation of vibrational modes according to quantum mechanical selection rules which require that absorption of light cause a change in the electric dipole moment of the molecule. The infrared spectrum of any molecule is a unique pattern of absorption wavelengths of varying intensity that can be considered as a molecular fingerprint to identify any compound.


Infrared spectra can be measured in a scanning mode by measuring the absorption of individual frequencies of light, produced by a grating which separates frequencies from a mixed-frequency infrared light source, by the test compound relative to a standard intensity (double-beam instrument) or pre-measured (‘blank’) intensity (single-beam instrument). In a preferred embodiment, infrared spectra are measured in a pulsed mode (FT-IR) where a mixed beam, produced by an interferometer, of all infrared light frequencies is passed through or reflected off the test compound. The resulting interferogram, which may or may not be added with the resulting interferograms from subsequent pulses to increase the signal strength while averaging random noise in the electronic signal, is mathematically transformed into a spectrum using Fourier Transform or Fast Fourier Transform algorithms.


Raman spectroscopy measures the difference in frequency due to absorption of infrared frequencies of scattered visible or ultraviolet light relative to the incident beam. The incident monochromatic light beam, usually a single laser frequency, is not truly absorbed by the test compound but interacts with the electric field transiently. Most of the light scattered off the sample with be unchanged (Rayleigh scattering) but a portion of the scatter light will have frequencies that are the sum or difference of the incident and molecular vibrational frequencies. The selection rules for Raman (inelastic) scattering require a change in polarizability of the molecule. While some vibrational transitions are observable in both infrared and Raman spectrometry, must are observable only with one or the other technique. The Raman spectrum of any molecule is a unique pattern of absorption wavelengths of varying intensity that can be considered as a molecular fingerprint to identify any compound.


Raman spectra are measured by submitting monochromatic light to the sample, either passed through or preferably reflected off, filtering the Rayleigh scattered light, and detecting the frequency of the Raman scattered light. An improved Raman spectrometer is described in U.S. Pat. No. 5,786,893 to Fink et al., which is hereby incorporated by reference.


Vibrational microscopy can be measured in a spatially resolved fashion to address single beads by integration of a visible microscope and spectrometer. A microscopic infrared spectrometer is described in U.S. Pat. No. 5,581,085 to Reffner et al., which is hereby incorporated by reference in its entirety. An instrument that simultaneously performs a microscopic infrared and microscopic Raman analysis on a sample is described in U.S. Pat. No. 5,841,139 to Sostek et al., which is hereby incorporated by reference in its entirety.


In one embodiment of the method, test compounds are synthesized on polystyrene beads doped with chemically modified styrene monomers such that each resulting bead has a characteristic pattern of absorption lines in the vibrational (IR or Raman) spectrum, by methods including but not limited to those described by Fenniri et al., 2000, J. Am. Chem. Soc. 123:8151-8152. Using methods of split-pool synthesis familiar to one of skill in the art, the library of compounds is prepared so that the spectroscopic pattern of the bead identifies one of the components of the test compound on the bead. Beads that have been separated according to their ability to bind target RNA can be identified by their vibrational spectrum. In one embodiment of the method, appropriate sorting and binning of the beads during synthesis then allows identification of one or more further components of the test compound on any one bead. In another embodiment of the method, partial identification of the compound on a bead is possible through use of the spectroscopic pattern of the bead with or without the aid of further sorting during synthesis, followed by partial resynthesis of the possible compounds aided by doped beads and appropriate sorting during synthesis.


In another embodiment, the IR or Raman spectra of test compounds are examined while the compound is still on a bead, preferably, or after cleavage from bead, using methods including but not limited to photochemical, acid, or heat treatment. The test compound can be identified by comparison of the IR or Raman spectral pattern to spectra previously acquired for each test compound in the combinatorial library.


4.7. Secondary Biological Screens

The test compounds identified in the binding assay (for convenience referred to herein as a “lead” compound) can be tested for biological activity using host cells containing or engineered to contain the target RNA element coupled to a functional readout system. For example, the lead compound can be tested in a host cell engineered to contain the target RNA element controlling the expression of a reporter gene. In this example, the lead compounds are assayed in the presence or absence of the target RNA. Alternatively, a phenotypic or physiological readout can be used to assess activity of the target RNA in the presence and absence of the lead compound.


In one embodiment, the lead compound can be tested in a host cell engineered to contain the target RNA element controlling the expression of a reporter gene, such as, but not limited to, β-galactosidase, green fluorescent protein, red fluorescent protein, luciferase, chloramphenicol acetyltransferase, alkaline phosphatase, and β-lactamase. In a preferred embodiment, a cDNA encoding the target element is fused upstream to a reporter gene wherein translation of the reporter gene is repressed upon binding of the lead compound to the target RNA. In other words, the steric hindrance caused by the binding of the lead compound to the target RNA repressed the translation of the reporter gene. This method, termed the translational repression assay procedure (“TRAP”) has been demonstrated in E. coli and S. cerevisiae (Jain & Belasco, 1996, Cell 87(1):115-25; Huang & Schreiber, 1997, Proc. Natl. Acad. Sci. USA 94:13396-13401).


In another embodiment, a phenotypic or physiological readout can be used to assess activity of the target RNA in the presence and absence of the lead compound. For example, the target RNA may be overexpressed in a cell in which the target RNA is endogenously expressed. Where the target RNA controls expression of a gene product involved in cell growth or viability, the in vivo effect of the lead compound can be assayed by measuring the cell growth or viability of the target cell. Alternatively, a reporter gene can also be fused downstream of the target RNA sequence and the effect of the lead compound on reporter gene expression can be assayed.


Alternatively, the lead compounds identified in the binding assay can be tested for biological activity using animal models for a disease, condition, or syndrome of interest. These include animals engineered to contain the target RNA element coupled to a functional readout system, such as a transgenic mouse. Animal model systems can also be used to demonstrate safety and efficacy.


Compounds displaying the desired biological activity can be considered to be lead compounds, and will be used in the design of congeners or analogs possessing useful pharmacological activity and physiological profiles. Following the identification of a lead compound, molecular modeling techniques can be employed, which have proven to be useful in conjunction with synthetic efforts, to design variants of the lead that can be more effective. These applications may include, but are not limited to, Pharmacophore Modeling (cf Lamothe, et al. 1997, J. Med. Chem. 40: 3542; Mottola et al. 1996, J. Med. Chem. 39: 285; Beusen et al. 1995, Biopolymers 36: 181; P. Fossa et al. 1998, Comput. Aided Mol. Des. 12: 361), QSAR development (cf. Siddiqui et al. 1999, J. Med. Chem. 42: 4122; Barreca et al. 1999 Bioorg. Med. Chem. 7: 2283; Kroemer et al. 1995, J. Med. Chem. 38: 4917; Schaal et al. 2001, J. Med. Chem. 44: 155; Buolamwini & Assefa 2002, J. Mol. Chem. 45: 84), Virtual docking and screening/scoring (cf Anzini et al. 2001, J. Med. Chem. 44: 1134; Faaland et al. 2000, Biochem. Cell. Biol. 78: 415; Silvestri et al. 2000, Bioorg. Med. Chem. 8: 2305; J. Lee et al. 2001, Bioorg. Med. Chem. 9: 19), and Structure Prediction using RNA structural programs including, but not limited to mFold (as described by Zuker et al. Algorithms and Thermodynamics for RNA Secondary Structure Prediction: A Practical Guide in RNA Biochemistry and Biotechnology pp. 11-43, J. Barciszewski & B. F. C. Clark, eds. (NATO ASI Series, Kluwer Academic Publishers, 1999) and Mathews et al. 1999 J. Mol. Biol. 288: 911-940); RNAmotif (Macke et al. 2001, Nucleic Acids Res. 29: 4724-4735; and the Vienna RNA package (Hofacker et al. 1994, Monatsh. Chem. 125: 167-188).


Further examples of the application of such techniques can be found in several review articles, such as Rotivinen et al., 1988, Acta Pharmaceutical Fennica 97:159-166; Ripka, 1998, New Scientist 54-57; McKinaly & Rossmann, 1989, Annu. Rev. Pharmacol. Toxiciol. 29:111-122; Perry & Davies, QSAR: Quantitative Structure-Activity Relationships in Drug Design pp. 189-193 (Alan R. Liss, Inc. 1989); Lewis & Dean, 1989, Proc. R. Soc. Lond. 236:125-140 and 141-162; Askew et al., 1989, J. Am. Chem. Soc. 111: 1082-1090. Molecular modeling tools employed may include those from Tripos, Inc., St. Louis, Mo. (e.g., Sybyl/UNITY, CONCORD, DiverseSolutions), Accelerys, San Diego, Calif. (e.g., Catalyst, Wisconsin Package {BLAST, etc.}), Schrodinger, Portland, Oreg. (e.g., QikProp, QikFit, Jaguar) or other such vendors as BioDesign, Inc. (Pasadena, Calif.), Allelix, Inc. (Mississauga, Ontario, Canada), and Hypercube, Inc. (Cambridge, Ontario, Canada), and may include privately designed and/or “academic” software (e.g. RNAMotif, mFOLD). These application suites and programs include tools for the atomistic construction and analysis of structural models for drug-like molecules, proteins, and DNA or RNA and their potential interactions. They also provide for the calculation of important physical properties, such as solubility estimates, permeability metrics, and empirical measures of molecular “druggability” (e.g., Lipinski “Rule of 5” as described by Lipinski et al. 1997, Adv. Drug Delivery Rev. 23: 3-25). Most importantly, they provide appropriate metrics and statistical modeling power (such as the patented CoMFA technology in Sybyl as described in U.S. Pat. Nos. 6,240,374 and 6,185,506) to develop Quantitative Structural Activity Relationships (QSARs) which are used to guide the synthesis of more efficacious clinical development candidates while improving desirable physical properties, as determined by results from the aforementioned secondary screening protocols.


4.8. Use of Identified Compounds that Bind RNA to Treat/Prevent Disease

Biologically active compounds identified using the methods of the invention or a pharmaceutically acceptable salt thereof can be administered to a patient, preferably a mammal, more preferably a human, suffering from a disease whose progression is associated with a target RNA:host cell factor interaction in vivo. In certain embodiments, such compounds or a pharmaceutically acceptable salt thereof is administered to a patient, preferably a mammal, more preferably a human, as a preventative measure against a disease associated with an RNA:host cell factor interaction in vivo.


In one embodiment, “treatment” or “treating” refers to an amelioration of a disease, or at least one discernible symptom thereof. In another embodiment, “treatment” or “treating” refers to an amelioration of at least one measurable physical parameter, not necessarily discernible by the patient. In yet another embodiment, “treatment” or “treating” refers to inhibiting the progression of a disease, either physically, e.g., stabilization of a discernible symptom, physiologically, e.g., stabilization of a physical parameter, or both. In yet another embodiment, “treatment” or “treating” refers to delaying the onset of a disease.


In certain embodiments, the compound or a pharmaceutically acceptable salt thereof is administered to a patient, preferably a mammal, more preferably a human, as a preventative measure against a disease associated with an RNA:host cell factor interaction in vivo. As used herein, “prevention” or “preventing” refers to a reduction of the risk of acquiring a disease. In one embodiment, the compound or a pharmaceutically acceptable salt thereof is administered as a preventative measure to a patient. According to this embodiment, the patient can have a genetic predisposition to a disease, such as a family history of the disease, or a non-genetic predisposition to the disease. Accordingly, the compound and pharmaceutically acceptable salts thereof can be used for the treatment of one manifestation of a disease and prevention of another.


When administered to a patient, the compound or a pharmaceutically acceptable salt thereof is preferably administered as component of a composition that optionally comprises a pharmaceutically acceptable vehicle. The composition can be administered orally, or by any other convenient route, for example, by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal, and intestinal mucosa, etc.) and may be administered together with another biologically active agent. Administration can be systemic or local. Various delivery systems are known, e.g., encapsulation in liposomes, microparticles, microcapsules, capsules, etc., and can be used to administer the compound and pharmaceutically acceptable salts thereof.


Methods of administration include but are not limited to intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, oral, sublingual, intranasal, intracerebral, intravaginal, transdermal, rectally, by inhalation, or topically, particularly to the ears, nose, eyes, or skin. The mode of administration is left to the discretion of the practitioner. In most instances, administration will result in the release of the compound or a pharmaceutically acceptable salt thereof into the bloodstream.


In specific embodiments, it may be desirable to administer the compound or a pharmaceutically acceptable salt thereof locally This may be achieved, for example, and not by way of limitation, by local infusion during surgery, topical application, e.g., in conjunction with a wound dressing after surgery, by injection, by means of a catheter, by means of a suppository, or by means of an implant, said implant being of a porous, non-porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers.


In certain embodiments, it may be desirable to introduce the compound or a pharmaceutically acceptable salt thereof into the central nervous system by any suitable route, including intraventricular, intrathecal and epidural injection. Intraventricular injection may be facilitated by an intraventricular catheter, for example, attached to a reservoir, such as an Ommaya reservoir.


Pulmonary administration can also be employed, e.g., by use of an inhaler or nebulizer, and formulation with an aerosolizing agent, or via perfusion in a fluorocarbon or synthetic pulmonary surfactant. In certain embodiments, the compound and pharmaceutically acceptable salts thereof can be formulated as a suppository, with traditional binders and vehicles such as triglycerides.


In another embodiment, the compound and pharmaceutically acceptable salts thereof can be delivered in a vesicle, in particular a liposome (see Langer, 1990, Science 249:1527-1533; Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 353-365 (1989); Lopez-Berestein, ibid., pp. 317-327; see generally ibid.).


In yet another embodiment, the compound and pharmaceutically acceptable salts thereof can be delivered in a controlled release system (see, e.g., Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115-138 (1984)). Other controlled-release systems discussed in the review by Langer, 1990, Science 249:1527-1533) may be used. In one embodiment, a pump may be used (see Langer, supra; Sefton, 1987, CRC Crit. Ref. Biomed. Eng. 14:201; Buchwald et al., 1980, Surgery 88:507 Saudek et al., 1989, N. Engl. J. Med. 321:574). In another embodiment, polymeric materials can be used (see Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Fla. (1974); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, 1983, J. Macromol. Sci. Rev. Macromol. Chem. 23:61; see also Levy et al., 1985, Science 228:190; During et al., 1989, Ann. Neurol. 25:351; Howard et al., 1989, J. Neurosurg. 71:105). In yet another embodiment, a controlled-release system can be placed in proximity of a target RNA of the compound or a pharmaceutically acceptable salt thereof, thus requiring only a fraction of the systemic dose.


Compositions comprising the compound or a pharmaceutically acceptable salt thereof (“compound compositions”) can additionally comprise a suitable amount of a pharmaceutically acceptable vehicle so as to provide the form for proper administration to the patient.


In a specific embodiment, the term “pharmaceutically acceptable” means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, mammals, and more particularly in humans. The term “vehicle” refers to a diluent, adjuvant, excipient, or carrier with which a compound of the invention is administered. Such pharmaceutical vehicles can be liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. The pharmaceutical vehicles can be saline, gum acacia, gelatin, starch paste, talc, keratin, colloidal silica, urea, and the like. In addition, auxiliary, stabilizing, thickening, lubricating and coloring agents may be used. When administered to a patient, the pharmaceutically acceptable vehicles are preferably sterile. Water is a preferred vehicle when the compound of the invention is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid vehicles, particularly for injectable solutions. Suitable pharmaceutical vehicles also include excipients such as starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. Compound compositions, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents.


Compound compositions can take the form of solutions, suspensions, emulsion, tablets, pills, pellets, capsules, capsules containing liquids, powders, sustained-release formulations, suppositories, emulsions, aerosols, sprays, suspensions, or any other form suitable for use. In one embodiment, the pharmaceutically acceptable vehicle is a capsule (see e.g., U.S. Pat. No. 5,698,155). Other examples of suitable pharmaceutical vehicles are described in Remington's Pharmaceutical Sciences, Alfonso R. Gennaro, ed., Mack Publishing Co. Easton, Pa., 19th ed., 1995, pp. 1447 to 1676, incorporated herein by reference.


In a preferred embodiment, the compound or a pharmaceutically acceptable salt thereof is formulated in accordance with routine procedures as a pharmaceutical composition adapted for oral administration to human beings. Compositions for oral delivery may be in the form of tablets, lozenges, aqueous or oily suspensions, granules, powders, emulsions, capsules, syrups, or elixirs, for example. Orally administered compositions may contain one or more agents, for example, sweetening agents such as fructose, aspartame or saccharin; flavoring agents such as peppermint, oil of wintergreen, or cherry; coloring agents; and preserving agents, to provide a pharmaceutically palatable preparation. Moreover, where in tablet or pill form, the compositions can be coated to delay disintegration and absorption in the gastrointestinal tract thereby providing a sustained action over an extended period of time. Selectively permeable membranes surrounding an osmotically active driving compound are also suitable for orally administered compositions. In these later platforms, fluid from the environment surrounding the capsule is imbibed by the driving compound, which swells to displace the agent or agent composition through an aperture. These delivery platforms can provide an essentially zero order delivery profile as opposed to the spiked profiles of immediate release formulations. A time delay material such as glycerol monostearate or glycerol stearate may also be used. Oral compositions can include standard vehicles such as mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, and the like. Such vehicles are preferably of pharmaceutical grade. Typically, compositions for intravenous administration comprise sterile isotonic aqueous buffer. Where necessary, the compositions may also include a solubilizing agent.


In another embodiment, the compound or a pharmaceutically acceptable salt thereof can be formulated for intravenous administration. Compositions for intravenous administration may optionally include a local anesthetic such as lignocaine to lessen pain at the site of the injection. Generally, the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water-free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent. Where the compound or a pharmaceutically acceptable salt thereof is to be administered by infusion, it can be dispensed, for example, with an infusion bottle containing sterile pharmaceutical grade water or saline. Where the compound or a pharmaceutically acceptable salt thereof is administered by injection, an ampoule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration.


The amount of a compound or a pharmaceutically acceptable salt thereof that will be effective in the treatment of a particular disease will depend on the nature of the disease, and can be determined by standard clinical techniques. In addition, in vitro or in vivo assays may optionally be employed to help identify optimal dosage ranges. The precise dose to be employed will also depend on the route of administration, and the seriousness of the disease, and should be decided according to the judgment of the practitioner and each patient's circumstances. However, suitable dosage ranges for oral administration are generally about 0.001 milligram to about 200 milligrams of a compound or a pharmaceutically acceptable salt thereof per kilogram body weight per day. In specific preferred embodiments of the invention, the oral dose is about 0.01 milligram to about 100 milligrams per kilogram body weight per day, more preferably about 0.1 milligram to about 75 milligrams per kilogram body weight per day, more preferably about 0.5 milligram to 5 milligrams per kilogram body weight per day. The dosage amounts described herein refer to total amounts administered; that is, if more than one compound is administered, or if a compound is administered with a therapeutic agent, then the preferred dosages correspond to the total amount administered. Oral compositions preferably contain about 10% to about 95% active ingredient by weight.


Suitable dosage ranges for intravenous (i.v.) administration are about 0.01 milligram to about 100 milligrams per kilogram body weight per day, about 0.1 milligram to about 35 milligrams per kilogram body weight per day, and about 1 milligram to about 10 milligrams per kilogram body weight per day. Suitable dosage ranges for intranasal administration are generally about 0.01 pg/kg body weight per day to about 1 mg/kg body weight per day. Suppositories generally contain about 0.01 milligram to about 50 milligrams of a compound of the invention per kilogram body weight per day and comprise active ingredient in the range of about 0.5% to about 10% by weight.


Recommended dosages for intradermal, intramuscular, intraperitoneal, subcutaneous, epidural, sublingual, intracerebral, intravaginal, transdermal administration or administration by inhalation are in the range of about 0.001 milligram to about 200 milligrams per kilogram of body weight per day. Suitable doses for topical administration are in the range of about 0.001 milligram to about 1 milligram, depending on the area of administration. Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model test systems. Such animal models and systems are well known in the art.


The compound and pharmaceutically acceptable salts thereof are preferably assayed in vitro and in vivo, for the desired therapeutic or prophylactic activity, prior to use in humans. For example, in vitro assays can be used to determine whether it is preferable to administer the compound, a pharmaceutically acceptable salt thereof, and/or another therapeutic agent. Animal model systems can be used to demonstrate safety and efficacy.


A variety of compounds can be used for treating or preventing diseases in mammals. Types of compounds include, but are not limited to, peptides, peptide analogs including peptides comprising non-natural amino acids, e.g., D-amino acids, phosphorous analogs of amino acids, such as α-amino phosphonic acids and c-amino phosphinic acids, or amino acids having non-peptide linkages, nucleic acids, nucleic acid analogs such as phosphorothioates or peptide nucleic acids (“PNAs”), hormones, antigens, synthetic or naturally occurring drugs, opiates, dopamine, serotonin, catecholamines, thrombin, acetylcholine, prostaglandins, organic molecules, pheromones, adenosine, sucrose, glucose, lactose and galactose.


5. EXAMPLE
Therapeutic Targets

The therapeutic targets presented herein are by way of example, and the present invention is not to be limited by the targets described herein. The therapeutic targets presented herein as DNA sequences are understood by one of skill in the art that the sequences can be converted to RNA sequences.


5.1. Tumor Necrosis Factor Alpha (“TNF-α”)

GenBank Accession # X01394:

(SEQ ID NO: 6)1gcagaggacc agctaagagg gagagaagca actacagaccccccctgaaa acaaccctca61gacgccacat cccctgacaa gctgccaggc aggttctcttcctctcacat actgacccac121ggctccaccc tctctcccct ggaaaggaca ccatgagcactgaaagcatg atccgggacg181tggagctggc cgaggaggcg ctccccaaga agacaggggggccccagggc tccaggcggt241gcttgttcct cagcctcttc tccttcctga tcgtggcaggcgccaccacg ctcttctgcc301tgctgcactt tggagtgatc ggcccccaga gggaagagttccccagggac ctctctctaa361tcagccctct ggcccaggca gtcagatcat cttctcgaaccccgagtgac aagcctgtag421cccatgttgt agcaaaccct caagctgagg ggcagctccagtggctgaac cgccgggcca481atgccctcct ggccaatggc gtggagctga gagataaccagctggtggtg ccatcagagg541gcctgtacct catctactcc caggtcctct tcaagggccaaggctgcccc tccacccatg601tgctcctcac ccacaccatc agccgcatcg ccgtctcctaccagaccaag gtcaacctcc661tctctgccat caagagcccc tgccagaggg agaccccagagggggctgag gccaagccct721ggtatgagcc catctatctg ggaggggtct tccagctggagaagggtgac cgactcagcg781ctgagatcaa tcggcccgac tatctcgact ttgccgagtctgggcaggtc tactttggga841tcattgccct gtgaggagga cgaacatcca accttcccaaacgcctcccc tgccccaatc901cctttattac cccctccttc agacaccctc aacctcttctggctcaaaaa gagaattggg961ggcttagggt cggaacccaa gcttagaact ttaagcaacaagaccaccac ttcgaaacct1021gggattcagg aatgtgtggc ctgcacagtg aattgctggcaaccactaag aattcaaact1081ggggcctcca gaactcactg gggcctacag ctttgatccctgacatctgg aatctggaga1141ccagggagcc tttggttctg gccagaatgc tgcaggacttgagaagacct cacctagaaa1201ttgacacaag tggaccttag gccttcctct ctccagatgtttccagactt ccttgagaca1261cggagcccag ccctccccat ggagccagct ccctctatttatgtttgcac ttgtgattat1321ttattattta tttattattt atttatttac agatgaatgtatttatttgg gagaccgggg1381tatcctgggg gacccaatgt aggagctgcc ttggctcagacatgttttcc gtgaaaacgg1441agctgaacaa taggctgttc ccatgtagcc ccctggcctctgtgccttct tttgattatg1501ttttttaaaa tatttatctg attaagttgt ctaaacaatgctgatttggt gaccaactgt1561cactcattgc tgagcctctg ctccccaggg gagttgtgtctgtaatcgcc ctactattca1621gtggcgagaa ataaagtttg ctt


General Target Regions:
    • (1) 5′ Untranslated Region—nts 1-152
    • (2) 3′ Untranslated Region—nts 852-1643


      Initial Specific Target Motif:
    • Group I AU-Rich Element (ARE) Cluster in 3′ untranslated region 5′ AUUUAUUUAUUUAUUUAUUUA 3′ (SEQ ID NO: 1)


5.2. Granulocyte-Macrophage Colony Stimulating Factor (“GM-CSF”)

GenBank Accession # NM000758:

(SEQ ID NO: 7)1gctggaggat gtggctgcag agcctgctgc tcttgggcactgtggcctgc agcatctctg61cacccgcccg ctcgcccagc cccagcacgc agccctgggagcatgtgaat gccatccagg121aggcccggcg tctcctgaac ctgagtagag acactgctgctgagatgaat gaaacagtag181aagtcatctc agaaatgttt gacctccagg agccgacctgcctacagacc cgcctggagc241tgtacaagca gggcctgcgg ggcagcctca ccaagctcaagggccccttg accatgatgg301ccagccacta caagcagcac tgccctccaa ccccggaaacttcctgtgca acccagacta361tcacctttga aagtttcaaa gagaacctga aggactttctgcttgtcatc ccctttgact421gctgggagcc agtccaggag tgagaccggc cagatgaggctggccaagcc ggggagctgc481tctctcatga aacaagagct agaaactcag gatggtcatcttggagggac caaggggtgg541gccacagcca tggtgggagt ggcctggacc tgccctgggccacactgacc ctgatacagg601catggcagaa gaatgggaat attttatact gacagaaatcagtaatattt atatatttat661atttttaaaa tatttattta tttatttatt taagttcatattccatattt attcaagatg721ttttaccgta ataattatta ttaaaaatat gcttct


GenBank Accession # XM003751:

(SEQ ID NO: 8)1tctggaggat gtggctgcag agcctgctgc tcttgggcactgtggcctgc agcatctctg61cacccgcccg ctcgcccagc cccagcacgc agccctgggagcatgtgaat gccatccagg121aggcccggcg tctcctgaac ctgagtagag acactgctgctgagatgaat gaaacagtag181aagtcatctc agaaatgttt gacctccagg agccgacctgcctacagacc cgcctggagc241tgtacaagca gggcctgcgg ggcagcctca ccaagctcaagggccccttg accatgatgg301ccagccacta caagcagcac tgccctccaa ccccggaaacttcctgtgca acccagacta361tcacctttga aagtttcaaa gagaacctga aggactttctgcttgtcatc ccctttgact421gctgggagcc agtccaggag tgagaccggc cagatgaggctggccaagcc ggggagctgc481tctctcatga aacaagagct agaaactcag gatggtcatcttggagggac caaggggtgg541gccacagcca tggtgggagt ggcctggacc tgccctgggccacactgacc ctgatacagg601catggcagaa gaatgggaat attttatact gacagaaatcagtaatattt atatatttat661atttttaaaa tatttattta tttatttatt taagttcatattccatattt attcaagatg721ttttaccgta ataattatta ttaaaaatat gcttct


General Target Regions:
    • (1) 5′ Untranslated Region—nts 1-32
    • (2) 3′ Untranslated Region—nts 468-789


      Initial Specific Target Motif:


Group I AU-Rich Element (ARE) Cluster in 3′ untranslated region

5′ AUUUAUUUAUUUAUUUAUUUA 3′(SEQ ID NO: 1)


5.3. Interleukin 2 (“IL-2”)

GenBank Accession # U25676:

(SEQ ID NO: 9)1atcactctct ttaatcacta ctcacattaa cctcaactcctgccacaatg tacaggatgc61aactcctgtc ttgcattgca ctaattcttg cacttgtcacaaacagtgca cctacttcaa121gttcgacaaa gaaaacaaag aaaacacagc tacaactggagcatttactg ctggatttac181agatgatttt gaatggaatt aataattaca agaatcccaaactcaccagg atgctcacat241ttaagtttta catgcccaag aaggccacag aactgaaacagcttcagtgt ctagaagaag301aactcaaacc tctggaggaa gtgctgaatt tagctcaaagcaaaaacttt cacttaagac361ccagggactt aatcagcaat atcaacgtaa tagttctggaactaaaggga tctgaaacaa421cattcatgtg tgaatatgca gatgagacag caaccattgtagaatttctg aacagatgga481ttaccttttg tcaaagcatc atctcaacac taacttgataattaagtgct tcccacttaa541aacatatcag gccttctatt tatttattta aatatttaaattttatattt attgttgaat601gtatggttgc tacctattgt aactattatt cttaatcttaaaactataaa tatggatctt661ttatgattct ttttgtaagc cctaggggct ctaaaatggtttaccttatt tatcccaaaa721atatttatta ttatgttgaa tgttaaatat agtatctatgtagattggtt agtaaaacta781tttaataaat ttgataaata taaaaaaaaa aaacaaaaaaaaaaa


General Target Regions:
    • (1) 5′ Untranslated Region—nts 1-47
    • (2) 3′ Untranslated Region—nts 519-825


      Initial Specific Target Motifs:


Group III AU-Rich Element (ARE) Cluster in 3′ untranslated region

5′ NAUUUAUUUAUUUAN 3′(SEQ ID NO: 10)


5.4. Interleukin 6 (“IL-6”)

GenBank Accession # NM000600:

(SEQ ID NO: 11)1ttctgccctc gagcccaccg ggaacgaaag agaagctctatctcgcctcc aggagcccag61ctatgaactc cttctccaca agcgccttcg gtccagttgccttctccctg gggctgctcc121tggtgttgcc tgctgccttc cctgccccag tacccccaggagaagattcc aaagatgtag181ccgccccaca cagacagcca ctcacctctt cagaacgaattgacaaacaa attcggtaca241tcctcgacgg catctcagcc ctgagaaagg agacatgtaacaagagtaac atgtgtgaaa301gcagcaaaga ggcactggca gaaaacaacc tgaaccttccaaagatggct gaaaaagatg361gatgcttcca atctggattc aatgaggaga cttgcctggtgaaaatcatc actggtcttt421tggagtttga ggtataccta gagtacctcc agaacagatttgagagtagt gaggaacaag481ccagagctgt gcagatgagt acaaaagtcc tgatccagttcctgcagaaa aaggcaaaga541atctagatgc aataaccacc cctgacccaa ccacaaatgccagcctgctg acgaagctgc601aggcacagaa ccagtggctg caggacatga caactcatctcattctgcgc agctttaagg661agttcctgca gtccagcctg agggctcttc ggcaaatgtagcatgggcac ctcagattgt721tgttgttaat gggcattcct tcttctggtc agaaacctgtccactgggca cagaacttat781gttgttctct atggagaact aaaagtatga gcgttaggacactattttaa ttatttttaa841tttattaata tttaaatatg tgaagctgag ttaatttatgtaagtcatat ttatattttt901aagaagtacc acttgaaaca ttttatgtat tagttttgaaataataatgg aaagtggcta961tgcagtttga atatcctttg tttcagagcc agatcatttcttggaaagtg taggcttacc1021tcaaataaat ggctaactta tacatatttt taaagaaatatttatattgt atttatataa1081tgtataaatg gtttttatac caataaatgg cattttaaaaaattc


General Target Regions:
    • (1) 5′ Untranslated Region—nts 1-62
    • (2) 3′ Untranslated Region—nts 699-1125


      Initial Specific Target Motifs:


Group III AU-Rich Element (ARE) Cluster in 3′ untranslated region

5′ NAUUUAUUUAUUUAN 3′(SEQ ID NO: 10)


5.5. Vascular Endothelial Growth Factor (“VEGF”)

GenBank Accession # AF022375:

(SEQ ID NO: 12)1aagagctcca gagagaagtc gaggaagaga gagacggggtcagagagagc gcgcgggcgt61gcgagcagcg aaagcgacag gggcaaagtg agtgacctgcttttgggggt gaccgccgga121gcgcggcgtg agccctcccc cttgggatcc cgcagctgaccagtcgcgct gacggacaga181cagacagaca ccgcccccag ccccagttac cacctcctccccggccggcg gcggacagtg241gacgcggcgg cgagccgcgg gcaggggccg gagcccgcccccggaggcgg ggtggagggg301gtcggagctc gcggcgtcgc actgaaactt ttcgtccaacttctgggctg ttctcgcttc361ggaggagccg tggtccgcgc gggggaagcc gagccgagcggagccgcgag aagtgctagc421tcgggccggg aggagccgca gccggaggag ggggaggaggaagaagagaa ggaagaggag481agggggccgc agtggcgact cggcgctcgg aagccgggctcatggacggg tgaggcggcg541gtgtgcgcag acagtgctcc agcgcgcgcg ctccccagccctggcccggc ctcgggccgg601gaggaagagt agctcgccga ggcgccgagg agagcgggccgccccacagc ccgagccgga661gagggacgcg agccgcgcgc cccggtcggg cctccgaaaccatgaacttt ctgctgtctt721gggtgcattg gagccttgcc ttgctgctct acctccaccatgccaagtgg tcccaggctg781cacccatggc agaaggagga gggcagaatc atcacgaagtggtgaagttc atggatgtct841atcagcgcag ctactgccat ccaatcgaga ccctggtggacatcttccag gagtaccctg901atgagatcga gtacatcttc aagccatcct gtgtgcccctgatgcgatgc gggggctgct961ccaatgacga gggcctggag tgtgtgccca ctgaggagtccaacatcacc atgcagatta1021tgcggatcaa acctcaccaa ggccagcaca taggagagatgagcttccta cagcacaaca1081aatgtgaatg cagaccaaag aaagatagag caagacaagaaaatccctgt gggccttgct1141cagagcggag aaagcatttg tttgtacaag atccgcagacgtgtaaatgt tcctgcaaaa1201acacacactc gcgttgcaag gcgaggcagc ttgagttaaacgaacgtact tgcagatgtg1261acaagccgag gcggtgagcc gggcaggagg aaggagcctccctcagggtt tcgggaacca1321gatctctctc caggaaagac tgatacagaa cgatcgatacagaaaccacg ctgccgccac1381cacaccatca ccatcgacag aacagtcctt aatccagaaacctgaaatga aggaagagga1441gactctgcgc agagcacttt gggtccggag ggcgagactccggcggaagc attcccgggc1501gggtgaccca gcacggtccc tcttggaatt ggattcgccattttattttt cttgctgcta1561aatcaccgag cccggaagat tagagagttt tatttctgggattcctgtag acacacccac1621ccacatacat acatttatat atatatatat tatatatatataaaaataaa tatctctatt1681ttatatatat aaaatatata tattcttttt ttaaattaacagtgctaatg ttattggtgt1741cttcactgga tgtatttgac tgctgtggac ttgagttgggaggggaatgt tcccactcag1801atcctgacag ggaagaggag gagatgagag actctggcatgatctttttt ttgtcccact1861tggtggggcc agggtcctct cccctgccca agaatgtgcaaggccagggc atgggggcaa1921atatgaccca gttttgggaa caccgacaaa cccagccctggcgctgagcc tctctacccc1981aggtcagacg gacagaaaga caaatcacag gttccgggatgaggacaccg gctctgacca2041ggagtttggg gagcttcagg acattgctgt gctttggggattccctccac atgctgcacg2101cgcatctcgc ccccaggggc actgcctgga agattcaggagcctgggcgg ccttcgctta2161ctctcacctg cttctgagtt gcccaggagg ccactggcagatgtcccggc gaagagaaga2221gacacattgt tggaagaagc agcccatgac agcgccccttcctgggactc gccctcatcc2281tcttcctgct ccccttcctg gggtgcagcc taaaaggacctatgtcctca caccattgaa2341accactagtt ctgtcccccc aggaaacctg gttgtgtgtgtgtgagtggt tgaccttcct2401ccatcccctg gtccttccct tcccttcccg aggcacagagagacagggca ggatccacgt2461gcccattgtg gaggcagaga aaagagaaag tgttttatatacggtactta tttaatatcc2521ctttttaatt agaaattaga acagttaatt taattaaagagtagggtttt ttttcagtat2581tcttggttaa tatttaattt caactattta tgagatgtatcttttgctct ctcttgctct2641cttatttgta ccggtttttg tatataaaat tcatgtttccaatctctctc tccctgatcg2701gtgacagtca ctagcttatc ttgaacagat atttaattttgctaacactc agctctgccc2761tccccgatcc cctggctccc cagcacacat tcctttgaaagagggtttca atatacatct2821acatactata tatatattgg gcaacttgta tttgtgtgtatatatatata tatatgttta2881tgtatatatg tgatcctgaa aaaataaaca tcgctattctgttttttata tgttcaaacc2941aaacaagaaa aaatagagaa ttctacatac taaatctctctcctttttta attttaatat3001ttgttatcat ttatttattg gtgctactgt ttatccgtaataattgtggg gaaaagatat3061taacatcacg tctttgtctc tagtgcagtt tttcgagatattccgtagta catatttatt3121tttaaacaac gacaaagaaa tacagatata tcttaaaaaaaaaaaa


General Target Regions:
    • (1) 5′ Untranslated Region—nts 1-701
    • (2) 3′ Untranslated Region—nts 1275-3166


      Initial Specific Target Motifs:


(1) Internal Ribosome Entry Site (IRES) in 5′ untranslated region nts 513-704

(SEQ ID NO: 13)5′CCGGGCUCAUGGACGGGUGAGGCGGCGGUGUGCGCAGACAGUGCUCCAGCGCGCGCGCUCCCCAGCCCUGGCCCGGCCUCGGGCCGGGAGGAAGAGUAGCUCGCCGAGGCGCCGAGGAGAGCGGGCCGCCCCACAGCCCGAGCCGGAGAGGGACGCGACCCGCGCGCCCCGGUCGGGCCUCCGAAACCAUGAACUUUCUGCUGUCUUGGGUGCAUUGGAGCCUUGCCUUGCUGCUCUACCUCCACCAUG 3′


(2) Group III AU-Rich Element (ARE) Cluster in 3′ untranslated region

5′ NAUUUAUUUAUUUAN 3′(SEQ ID NO: 10)


5.6. Human Immunodeficiency Virus I (“HIV-1”)

GenBank Accession # NC001802:

(SEQ ID NO: 14)1ggtctctctg gttagaccag atctgagcct gggagctctctggctaacta gggaacccac61tgcttaagcc tcaataaagc ttgccttgag tgcttcaagtagtgtgtgcc cgtctgttgt121gtgactctgg taactagaga tccctcagac ccttttagtcagtgtggaaa atctctagca181gtggcgcccg aacagggacc tgaaagcgaa agggaaaccagaggagctct ctcgacgcag241gactcggctt gctgaagcgc gcacggcaag aggcgaggggcggcgactgg tgagtacgcc301aaaaattttg actagcggag gctagaagga gagagatgggtgcgagagcg tcagtattaa361gcgggggaga attagatcga tgggaaaaaa ttcggttaaggccaggggga aagaaaaaat421ataaattaaa acatatagta tgggcaagca gggagctagaacgattcgca gttaatcctg481gcctgttaga aacatcagaa ggctgtagac aaatactgggacagctacaa ccatcccttc541agacaggatc agaagaactt agatcattat ataatacagtagcaaccctc tattgtgtgc601atcaaaggat agagataaaa gacaccaagg aagctttagacaagatagag gaagagcaaa661acaaaagtaa gaaaaaagca cagcaagcag cagctgacacaggacacagc aatcaggtca721gccaaaatta ccctatagtg cagaacatcc aggggcaaatggtacatcag gccatatcac781ctagaacttt aaatgcatgg gtaaaagtag tagaagagaaggctttcagc ccagaagtga841tacccatgtt ttcagcatta tcagaaggag ccaccccacaagatttaaac accatgctaa901acacagtggg gggacatcaa gcagccatgc aaatgttaaaagagaccatc aatgaggaag961ctgcagaatg ggatagagtg catccagtgc atgcagggcctattgcacca ggccagatga1021gagaaccaag gggaagtgac atagcaggaa ctactagtacccttcaggaa caaataggat1081ggatgacaaa taatccacct atcccagtag gagaaatttataaaagatgg ataatcctgg1141gattaaataa aatagtaaga atgtatagcc ctaccagcattctggacata agacaaggac1201caaaggaacc ctttagagac tatgtagacc ggttctataaaactctaaga gccgagcaag1261cttcacagga ggtaaaaaat tggatgacag aaaccttgttggtccaaaat gcgaacccag1321attgtaagac tattttaaaa gcattgggac cagcggctacactagaagaa atgatgacag1381catgtcaggg agtaggagga cccggccata aggcaagagttttggctgaa gcaatgagcc1441aagtaacaaa ttcagctacc ataatgatgc agagaggcaattttaggaac caaagaaaga1501ttgttaagtg tttcaattgt ggcaaagaag ggcacacagccagaaattgc agggccccta1561ggaaaaaggg ctgttggaaa tgtggaaagg aaggacaccaaatgaaagat tgtactgaga1621gacaggctaa ttttttaggg aagatctggc cttcctacaagggaaggcca gggaattttc1681ttcagagcag accagagcca acagccccac cagaagagagcttcaggtct ggggtagaga1741caacaactcc ccctcagaag caggagccga tagacaaggaactgtatcct ttaacttccc1801tcaggtcact ctttggcaac gacccctcgt cacaataaagataggggggc aactaaagga1861agctctatta gatacaggag cagatgatac agtattagaagaaatgagtt tgccaggaag1921atggaaacca aaaatgatag ggggaattgg aggttttatcaaagtaagac agtatgatca1981gatactcata gaaatctgtg gacataaagc tataggtacagtattagtag gacctacacc2041tgtcaacata attggaagaa atctgttgac tcagattggttgcactttaa attttcccat2101tagccctatt gagactgtac cagtaaaatt aaagccaggaatggatggcc caaaagttaa2161acaatggcca ttgacagaag aaaaaataaa agcattagtagaaatttgta cagagatgga2221aaaggaaggg aaaatttcaa aaattgggcc tgaaaatccatacaatactc cagtatttgc2281cataaagaaa aaagacagta ctaaatggag aaaattagtagatttcagag aacttaataa2341gagaactcaa gacttctggg aagttcaatt aggaataccacatcccgcag ggttaaaaaa2401gaaaaaatca gtaacagtac tggatgtggg tgatgcatatttttcagttc ccttagatga2461agacttcagg aagtatactg catttaccat acctagtataaacaatgaga caccagggat2521tagatatcag tacaatgtgc ttccacaggg atggaaaggatcaccagcaa tattccaaag2581tagcatgaca aaaatcttag agccttttag aaaacaaaatccagacatag ttatctatca2641atacatggat gatttgtatg taggatctga cttagaaatagggcagcata gaacaaaaat2701agaggagctg agacaacatc tgttgaggtg gggacttaccacaccagaca aaaaacatca2761gaaagaacct ccattccttt ggatgggtta tgaactccatcctgataaat ggacagtaca2821gcctatagtg ctgccagaaa aagacagctg gactgtcaatgacatacaga agttagtggg2881gaaattgaat tgggcaagtc agatttaccc agggattaaagtaaggcaat tatgtaaact2941ccttagagga accaaagcac taacagaagt aataccactaacagaagaag cagagctaga3001actggcagaa aacagagaga ttctaaaaga accagtacatggagtgtatt atgacccatc3061aaaagactta atagcagaaa tacagaagca ggggcaaggccaatggacat atcaaattta3121tcaagagcca tttaaaaatc tgaaaacagg aaaatatgcaagaatgaggg gtgcccacac3181taatgatgta aaacaattaa cagaggcagt gcaaaaaataaccacagaaa gcatagtaat3241atggggaaag actcctaaat ttaaactgcc catacaaaaggaaacatggg aaacatggtg3301gacagagtat tggcaagcca cctggattcc tgagtgggagtttgttaata cccctccctt3361agtgaaatta tggtaccagt tagagaaaga acccatagtaggagcagaaa ccttctatgt3421agatggggca gctaacaggg agactaaatt aggaaaagcaggatatgtta ctaatagagg3481aagacaaaaa gttgtcaccc taactgacac aacaaatcagaagactgagt tacaagcaat3541ttatctagct ttgcaggatt cgggattaga agtaaacatagtaacagact cacaatatgc3601attaggaatc attcaagcac aaccagatca aagtgaatcagagttagtca atcaaataat3661agagcagtta ataaaaaagg aaaaggtcta tctggcatgggtaccagcac acaaaggaat3721tggaggaaat gaacaagtag ataaattagt cagtgctggaatcaggaaag tactattttt3781agatggaata gataaggccc aagatgaaca tgagaaatatcacagtaatt ggagagcaat3841ggctagtgat tttaacctgc cacctgtagt agcaaaagaaatagtagcca gctgtgataa3901atgtcagcta aaaggagaag ccatgcatgg acaagtagactgtagtccag gaatatggca3961actagattgt acacatttag aaggaaaagt tatcctggtagcagttcatg tagccagtgg4021atatatagaa gcagaagtta ttccagcaga aacagggcaggaaacagcat attttctttt4081aaaattagca ggaagatggc cagtaaaaac aatacatactgacaatggca gcaatttcac4141cggtgctacg gttagggccg cctgttggtg ggcgggaatcaagcaggaat ttggaattcc4201ctacaatccc caaagtcaag gagtagtaga atctatgaataaagaattaa agaaaattat4261aggacaggta agagatcagg ctgaacatct taagacagcagtacaaatgg cagtattcat4321ccacaatttt aaaagaaaag gggggattgg ggggtacagtgcaggggaaa gaatagtaga4381cataatagca acagacatac aaactaaaga attacaaaaacaaattacaa aaattcaaaa4441ttttcgggtt tattacaggg acagcagaaa tccactttggaaaggaccag caaagctcct4501ctggaaaggt gaaggggcag tagtaataca agataatagtgacataaaag tagtgccaag4561aagaaaagca aagatcatta gggattatgg aaaacagatggcaggtgatg attgtgtggc4621aagtagacag gatgaggatt agaacatgga aaagtttagtaaaacaccat atgtatgttt4681cagggaaagc taggggatgg ttttatagac atcactatgaaagccctcat ccaagaataa4741gttcagaagt acacatccca ctaggggatg ctagattggtaataacaaca tattggggtc4801tgcatacagg agaaagagac tggcatttgg gtcagggagtctccatagaa tggaggaaaa4861agagatatag cacacaagta gaccctgaac tagcagaccaactaattcat ctgtattact4921ttgactgttt ttcagactct gctataagaa aggccttattaggacacata gttagcccta4981ggtgtgaata tcaagcagga cataacaagg taggatctctacaatacttg gcactagcag5041cattaataac accaaaaaag ataaagccac ctttgcctagtgttacgaaa ctgacagagg5101atagatggaa caagccccag aagaccaagg gccacagagggagccacaca atgaatggac5161actagagctt ttagaggagc ttaagaatga agctgttagacattttccta ggatttggct5221ccatggctta gggcaacata tctatgaaac ttatggggatacttgggcag gagtggaagc5281cataataaga attctgcaac aactgctgtt tatccattttcagaattggg tgtcgacata5341gcagaatagg cgttactcga cagaggagag caagaaatggagccagtaga tcctagacta5401gagccctgga agcatccagg aagtcagcct aaaactgcttgtaccaattg ctattgtaaa5461aagtgttgct ttcattgcca agtttgtttc ataacaaaagccttaggcat ctcctatggc5521aggaagaagc ggagacagcg acgaagagct catcagaacagtcagactca tcaagcttct5581ctatcaaagc agtaagtagt acatgtaatg caacctataccaatagtagc aatagtagca5641ttagtagtag caataataat agcaatagtt gtgtggtccatagtaatcat agaatatagg5701aaaatattaa gacaaagaaa aatagacagg ttaattgatagactaataga aagagcagaa5761gacagtggca atgagagtga aggagaaata tcagcacttgtggagatggg ggtggagatg5821gggcaccatg ctccttggga tgttgatgat ctgtagtgctacagaaaaat tgtgggtcac5881agtctattat ggggtacctg tgtggaagga agcaaccaccactctatttt gtgcatcaga5941tgctaaagca tatgatacag aggtacataa tgtttgggccacacatgcct gtgtacccac6001agaccccaac ccacaagaag tagtattggt aaatgtgacagaaaatttta acatgtggaa6061aaatgacatg gtagaacaga tgcatgagga tataatcagtttatgggatc aaagcctaaa6121gccatgtgta aaattaaccc cactctgtgt tagtttaaagtgcactgatt tgaagaatga6181tactaatacc aatagtagta gcgggagaat gataatggagaaaggagaga taaaaaactg6241ctctttcaat atcagcacaa gcataagagg taaggtgcagaaagaatatg cattttttta6301taaacttgat ataataccaa tagataatga tactaccagctataagttga caagttgtaa6361cacctcagtc attacacagg cctgtccaaa ggtatcctttgagccaattc ccatacatta6421ttgtgccccg gctggttttg cgattctaaa atgtaataataagacgttca atggaacagg6481accatgtaca aatgtcagca cagtacaatg tacacatggaattaggccag tagtatcaac6541tcaactgctg ttaaatggca gtctagcaga agaagaggtagtaattagat ctgtcaattt6601cacggacaat gctaaaacca taatagtaca gctgaacacatctgtagaaa ttaattgtac6661aagacccaac aacaatacaa gaaaaagaat ccgtatccagagaggaccag ggagagcatt6721tgttacaata ggaaaaatag gaaatatgag acaagcacattgtaacatta gtagagcaaa6781atggaataac actttaaaac agatagctag caaattaagagaacaatttg gaaataataa6841aacaataatc tttaagcaat cctcaggagg ggacccagaaattgtaacgc acagttttaa6901ttgtggaggg gaatttttct actgtaattc aacacaactgtttaatagta cttggtttaa6961tagtacttgg agtactgaag ggtcaaataa cactgaaggaagtgacacaa tcaccctccc7021atgcagaata aaacaaatta taaacatgtg gcagaaagtaggaaaagcaa tgtatgcccc7081tcccatcagt ggacaaatta gatgttcatc aaatattacagggctgctat taacaagaga7141tggtggtaat agcaacaatg agtccgagat cttcagacctggaggaggag atatgaggga7201caattggaga agtgaattat ataaatataa agtagtaaaaattgaaccat taggagtagc7261acccaccaag gcaaagagaa gagtggtgca gagagaaaaaagagcagtgg gaataggagc7321tttgttcctt gggttcttgg gagcagcagg aagcactatgggcgcagcct caatgacgct7381gacggtacag gccagacaat tattgtctgg tatagtgcagcagcagaaca atttgctgag7441ggctattgag gcgcaacagc atctgttgca actcacagtctggggcatca agcagctcca7501ggcaagaatc ctggctgtgg aaagatacct aaaggatcaacagctcctgg ggatttgggg7561ttgctctgga aaactcattt gcaccactgc tgtgccttggaatgctagtt ggagtaataa7621atctctggaa cagatttgga atcacacgac ctggatggagtgggacagag aaattaacaa7681ttacacaagc ttaatacact ccttaattga agaatcgcaaaaccagcaag aaaagaatga7741acaagaatta ttggaattag ataaatgggc aagtttgtggaattggttta acataacaaa7801ttggctgtgg tatataaaat tattcataat gatagtaggaggcttggtag gtttaagaat7861agtttttgct gtactttcta tagtgaatag agttaggcagggatattcac cattatcgtt7921tcagacccac ctcccaaccc cgaggggacc cgacaggcccgaaggaatag aagaagaagg7981tggagagaga gacagagaca gatccattcg attagtgaacggatccttgg cacttatctg8041ggacgatctg cggagcctgt gcctcttcag ctaccaccgcttgagagact tactcttgat8101tgtaacgagg attgtggaac ttctgggacg cagggggtgggaagccctca aatattggtg8161gaatctccta cagtattgga gtcaggaact aaagaatagtgctgttagct tgctcaatgc8221cacagccata gcagtagctg aggggacaga tagggttatagaagtagtac aaggagcttg8281tagagctatt cgccacatac ctagaagaat aagacagggcttggaaagga ttttgctata8341agatgggtgg caagtggtca aaaagtagtg tgattggatggcctactgta agggaaagaa8401tgagacgagc tgagccagca gcagataggg tgggagcagcatctcgagac ctggaaaaac8461atggagcaat cacaagtagc aatacagcag ctaccaatgctgcttgtgcc tggctagaag8521cacaagagga ggaggaggtg ggttttccag tcacacctcaggtaccttta agaccaatga8581cttacaaggc agctgtagat cttagccact ttttaaaagaaaagggggga ctggaagggc8641taattcactc ccaaagaaga caagatatcc ttgatctgtggatctaccac acacaaggct8701acttccctga ttagcagaac tacacaccag ggccaggggtcagatatcca ctgacctttg8761gatggtgcta caagctagta ccagttgagc cagataagatagaagaggcc aataaaggag8821agaacaccag cttgttacac cctgtgagcc tgcatgggatggatgacccg gagagagaag8881tgttagagtg gaggtttgac agccgcctag catttcatcacgtggcccga gagctgcatc8941cggagtactt caagaactgc tgacatcgag cttgctacaagggactttcc gctggggact9001ttccagggag gcgtggcctg ggcgggactg gggagtggcgagccctcaga tcctgcatat9061aagcagctgc tttttgcctg tactgggtct ctctggttagaccagatctg agcctgggag9121ctctctggct aactagggaa cccactgctt aagcctcaataaagcttgcc ttgagtgctt9181c


Initial Specific Target Motifs:
    • (1) Trans-activation response region/Tat protein binding site—TAR RNA—nts 1-60


“Minimal” TAR RNA Element

5′GGCAGAUCUGAGCCUGGGAGCUCUCUGCC 3′(SEQ ID NO: 15)


(2) Gag/Pol Frameshifting Site—“Minimal” frameshifting element

(SEQ ID NO: 16)5′ UUUUUUAGGGAAGAUCUGGCCUUCCUACAAGGGAAGGCCAGGGAAUUUUCUU 3′


5.7. Hepatitis C Virus (“HCV”—Genotypes 1a & 1b)

GenBank Accession # NC001433:

(SEQ ID NO: 17)1ttgggggcga cactccacca tagatcactc ccctgtgaggaactactgtc ttcacgcaga61aagcgtctag ccatggcgtt agtatgagtg ttgtgcagcctccaggaccc cccctcccgg121gagagccata gtggtctgcg gaaccggtga gtacaccggaattgccagga cgaccgggtc181ctttcttgga tcaacccgct caatgcctgg agatttgggcgtgcccccgc gagactgcta241gccgagtagt gttgggtcgc gaaaggcctt gtggtactgcctgatagggt gcttgcgagt301gccccgggag gtctcgtaga ccgtgcatca tgagcacaaatcctaaacct caaagaaaaa361ccaaacgtaa caccaaccgc cgcccacagg acgttaagttcccgggcggt ggtcagatcg421ttggtggagt ttacctgttg ccgcgcaggg gccccaggttgggtgtgcgc gcgactagga481agacttccga gcggtcgcaa cctcgtggaa ggcgacaacctatccccaag gctcgccggc541ccgagggtag gacctgggct cagcccgggt acccttggcccctctatggc aacgagggta601tggggtgggc aggatggctc ctgtcacccc gtggctctcggcctagttgg ggccccacag661acccccggcg taggtcgcgt aatttgggta aggtcatcgatacccttaca tgcggcttcg721ccgacctcat ggggtacatt ccgcttgtcg gcgcccccctagggggcgct gccagggccc781tggcacatgg tgtccgggtt ctggaggacg gcgtgaactatgcaacaggg aatctgcccg841gttgctcttt ctctatcttc ctcttagctt tgctgtcttgtttgaccatc ccagcttccg901cttacgaggt gcgcaacgtg accgggatat accatgtcacgaacgactgc tccaactcaa961gtattgtgta tgaggcagcg tccatgatca tgcacacccccgggtgcgtg ccctgcgtcc1021gggagagtaa tttctcccgt tgctgggtag cgctcactcccacgctcgcg gccaggaaca1081gcagcatccc caccacgaca atacgacgcc acgtcgatttgctcgttggg gcggctgctc1141tctgttccgc tatgtacgtt ggggatctct gcggatccgtttttctcgtc tcccagctgt1201tcaccttctc acctcgccgg tatgagacgg tacaagattgcaattgctca atctatcccg1261gccacgtatc aggtcaccgc atggcttggg atatgatgatgaactggtca cctacaacgg1321ccctagtggt atcgcagcta ctccggatcc cacaagccgtcgtggacatg gtggcggggg1381cccactgggg tgtcctagcg ggccttgcct actattccatggtggggaac tgggctaagg1441tcttgattgt gatgctactc tttgctggcg ttgacgggcacacccacgtg acagggggaa1501gggtagcctc cagcacccag agcctcgtgt cctggctctcacaaggccca tctcagaaaa1561tccaactcgt gaacaccaac ggcagctggc acatcaacaggaccgctctg aattgcaatg1621actccctcca aactgggttc attgctgcgc tgttctacgcacacaggttc aacgcgtccg1681ggtgcccaga gcgcatggct agctgccgcc ccatcgatgagttcgctcag gggtggggtc1741ccatcactca tgatatgcct gagagctcgg accagaggccatattgctgg cactacgcgc1801ctcgaccgtg cgggatcgtg cctgcgtcgc aggtgtgtggtccagtgtat tgcttcactc1861cgagccctgt tgtagtgggg acgaccgatc gtttcggcgctcctacgtat agctgggggg1921agaatgagac agacgtgctg ctacttagca acacgcggccgcctcaaggc aactggtttg1981ggtgcacgtg gatgaacagc actgggttca ccaagacgtgcgggggccct ccgtgcaaca2041tcgggggggt cggcaacaac accttggtct gccccacggattgcttccgg aagcaccccg2101aggccactta cacaaagtgt ggctcggggc cctggttgacacccaggtgc atggttgact2161acccatacag gctctggcac tacccctgca ctgttaactttaccgtcttt aaggtcagga2221tgtatgtggg gggcgtggag cacaggctca atgctgcatgcaattggact cgaggagagc2281gctgtgactt ggaggacagg gataggtcag aactcagcccgctgctgctg tctacaacag2341agtggcagat actgccctgt tccttcacca ccctaccggccctgtccact ggcttgatcc2401atcttcaccg gaacatcgtg gacgtgcaat acctgtacggtatagggtcg gcagttgtct2461cctttgcaat caaatgggag tatatcctgt tgcttttccttcttctggcg gacgcgcgcg2521tctgtgcctg cttgtggatg atgctgctga tagcccaggctgaggccacc ttagagaacc2581tggtggtcct caatgcggcg tctgtggccg gagcgcatggccttctctcc ttcctcgtgt2641tcttctgcgc cgcctggtac atcaaaggca ggctggtccctggggcggca tatgctctct2701atggcgtatg gccgttgctc ctgctcttgc tggccttaccaccacgagct tatgccatgg2761accgagagat ggctgcatcg tgcggaggcg cggtttttgtaggtctggta ctcttgacct2821tgtcaccata ctataaggtg ttcctcgcta ggctcatatggtggttacaa tattttatca2881ccagagccga ggcgcacttg caagtgtggg tcccccctctcaatgttcgg ggaggccgcg2941atgccatcat cctccttaca tgcgcggtcc atccagagctaatctttgac atcaccaaac3001tcctgctcgc catactcggt ccgctcatgg tgctccaggctggcataact agagtgccgt3061actttgtacg cgctcagggg ctcatccgtg catgcatgttagtgcggaag gtcgctggag3121gccactatgt ccaaatggcc ttcatgaagc tggccgcgctgacaggtacg tacgtatatg3181accatcttac tccactgcgg gattgggccc acgcgggcctacgagacctt gcggtggcag3241tagagcccgt cgtcttctct gacatggaga ctaaactcatcacctggggg gcagacaccg3301cggcgtgtgg ggacatcatc tcgggtctac cagtctccgcccgaaggggg aaggagatac3361ttctaggacc ggccgatagt tttggagagc aggggtggcggctccttgcg cctatcacgg3421cctattccca acaaacgcgg ggcctgcttg gctgtatcatcactagcctc acaggtcggg3481acaagaacca ggtcgatggg gaggttcagg tgctctccaccgcaacgcaa tctttcctgg3541cgacctgcgt caatggcgtg tgttggaccg tctaccatggtgccggctcg aagaccctgg3601ccggcccgaa gggtccaatc acccaaatgt acaccaatgtagaccaggac ctcgtcggct3661ggccggcgcc ccccggggcg cgctccatga caccgtgcacctgcggcagc tcggaccttt3721acttggtcac gaggcatgct gatgtcgttc cggtgcgccggcggggcgac agcaggggga3781gcctgctttc ccccaggccc atctcctacc tgaagggctcctcgggtgga ccactgcttt3841gcccttcggg gcacgttgta ggcatcttcc gggctgctgtgtgcacccgg ggggttgcga3901aggcggtgga cttcataccc gttgagtcta tggaaactaccatgcggtct ccggtcttca3961cagacaactc atcccctccg gccgtaccgc aaacattccaagtggcacat ttacacgctc4021ccactggcag cggcaagagc accaaagtgc cggctgcatatgcagcccaa gggtacaagg4081tgctcgtcct aaacccgtcc gttgccgcca cattgggctttggagcgtat atgtccaagg4141cacatggcat cgagcctaac atcagaactg gggtaaggaccatcaccacg ggcggcccca4201tcacgtactc cacctattgc aagttccttg ccgacggtggatgctccggg ggcgcctatg4261acatcataat atgtgatgaa tgccactcaa ctgactcgactaccatcttg ggcatcggca4321cagtcctgga tcaggcagag acggctggag cgcggctcgtcgtgctcgcc accgccacgc4381ctccgggatc gatcaccgtg ccacacccca acatcgaggaagtggccctg tccaacactg4441gagagattcc cttctatggc aaagccatcc ccattgaggccatcaagggg ggaaggcatc4501tcatcttctg ccattccaag aagaagtgtg acgagctcgccgcaaagctg acaggcctcg4561gactcaatgc tgtagcgtat taccggggtc tcgatgtgtccgtcataccg actagcggag4621acgtcgttgt cgtggcaaca gacgctctaa tgacgggttttaccggcgac tttgactcag4681tgatcgactg caacacatgt gtcacccaga cagtcgatttcagcttggat cccaccttca4741ccattgagac gacaacgctg ccccaagacg cggtgtcgcgtgcgcagcgg cgaggtagga4801ctggcagggg caggagtggc atctacaggt ttgtgactccaggagaacgg ccctcaggca4861tgttcgactc ctcggtcctg tgtgagtgct atgacgcaggctgcgcttgg tatgagctca4921cgcccgctga gacctcggtt aggttgcggg cttacctaaatacaccaggg ttgcccgtct4981gccaggacca cctagagttc tgggagagcg tcttcacaggcctcacccac atagatgccc5041acttcttgtc ccagaccaaa caggcaggag acaacctcccctacctggta gcataccaag5101ccacagtgtg cgccagggct caggctccac ctccatcgtgggaccaaatg tggaagtgtc5161tcatacggct aaagcccaca ctgcatgggc caacgcccctgctgtacagg ctaggagccg5221ttcaaaatga ggtcactctc acacacccca taaccaaatacatcatggca tgcatgtcgg5281ctgacctgga ggtcgtcact agcacctggg tgctagtaggcggagtcctt gcggctctgg5341ccgcgtactg cctgacgaca ggcagcgtgg tcattgtgggcaggatcatc ttgtccggga5401ggccagctgt tattcccgac agggaagtcc tctaccaggagttcgatgag atggaagagt5461gtgcttcaca cctcccttac atcgagcaag gaatgcagctcgccgagcaa ttcaaacaga5521aggcgctcgg attgctgcaa acagccacca agcaagcggaggctgctgct cccgtggtgg5581agtccaagtg gcgagccctt gaggtcttct gggcgaaacacatgtggaac ttcatcagcg5641ggatacagta cttggcaggc ctatccactc tgcctggaaaccccgcgata gcatcattga5701tggcttttac agcctctatc accagcccgc tcaccacccaaaataccctc ctgtttaaca5761tcttgggggg atgggtggct gcccaactcg ctccccccagcgctgcttcg gctttcgtgg5821gcgccggcat tgccggtgcg gccgttggca gcataggtctcgggaaggta cttgtggaca5881ttctggcggg ctatggggcg ggggtggctg gcgcactcgtggcctttaag gtcatgagcg5941gcgagatgcc ctccactgag gatctggtta atttactccctgccatcctt tctcctggcg6001ccctggttgt cggggtcgtg tgcgcagcaa tactgcgtcggcacgtgggc ccgggagagg6061gggctgtgca gtggatgaac cggctgatag cgttcgcttcgcggggtaac cacgtctccc6121ccacgcacta tgtgcccgag agcgacgccg cggcgcgtgttactcagatc ctctccagcc6181ttaccatcac tcagttgctg aagaggcttc atcagtggattaatgaggac tgctccacgc6241cttgttccgg ctcgtggcta aaggatgttt gggactggatatgcacggtg ttgagtgact6301tcaagacttg gctccagtcc aagctcctgc cgcggttaccgggactccct ttcctgtcat6361gccaacgcgg gtacaaggga gtctggcggg gggatggcatcatgcaaacc acctgcccat6421gtggagcaca gatcaccgga catgtcaaaa atggctccatgaggattgtt gggccaaaaa6481cctgcagcaa cacgtggcat ggaacattcc ccatcaacgcatacaccacg ggcccctgca6541cgccctcccc agcgccgaac tattccaggg cgctgtggcgggtggctgct gaggagtacg6601tggaggttac gcgggtgggg gatttccact acgtgacgggcatgaccact gacaacgtga6661aatgcccatg ccaggttcca gcccctgaat ttttcacggaggtggatgga gtacggttgc6721acaggtatgc tccagtgtgc aaacctctcc tacgagaggaggtcgtattc caggtcgggc6781tcaaccagta cctggtcggg tcacagctcc catgtgagcccgaaccggat gtggcagtgc6841tcacttccat gctcaccgac ccctctcata ttacagcagagacggccaag cgtaggctgg6901ccagggggtc tcccccctcc ttggccagct cttcagctagccagttgtct gcgccttctt6961tgaaggcgac atgtactacc catcatgact ccccggacgctgacctcatc gaggccaacc7021tcctgtggcg gcaggagatg ggcgggaaca tcacccgtgtggagtcagaa aataaggtgg7081taatcctgga ctctttcgat ccgattcggg cggtggaggatgagagggaa atatccgtcc7141cggcggagat cctgcgaaaa cccaggaagt tccccccagcgttgcccata tgggcacgcc7201cggattacaa ccctccactg ctagagtcct ggaaggacccggactacgtc cccccggtgg7261tacacgggtg ccctttgcca tctaccaagg cccccccaataccacctcca cggaggaaga7321ggacggttgt cctgacagag tccaccgtgt cttctgccttggcggagctc gctactaaga7381cctttggcag ctccgggtcg tcggccgttg acagcggcacggcgactggc cctcccgatc7441aggcctccga cgacggcgac aaaggatccg acgttgagtcgtactcctcc atgccccccc7501tcgagggaga gccaggggac cccgacctca gcgacgggtcttggtctacc gtgagcgggg7561aagctggtga ggacgtcgtc tgctgctcaa tgtcctatacatggacaggt gccttgatca7621cgccatgcgc tgcggaggag agcaagttgc ccatcaatccgttgagcaac tctttgctgc7681gtcaccacag tatggtctac tccacaacat ctcgcagcgcaagtctgcgg cagaagaagg7741tcacctttga cagactgcaa gtcctggacg accactaccgggacgtgctc aaggagatga7801aggcgaaggc gtccacagtt aaggctaggc ttctatctatagaggaggcc tgcaaactga7861cgcccccaca ttcggccaaa tccaaatttg gctacggggcgaaggacgtc cggagcctat7921ccagcagggc cgtcaaccac atccgctccg tgtgggaggacttgctggaa gacactgaaa7981caccaattga taccaccatc atggcaaaaa atgaggttttctgcgtccaa ccagagaaag8041gaggccgcaa gccagctcgc cttatcgtat tcccagacctgggggtacgt gtatgcgaga8101agatggccct ttacgacgtg gtctccaccc ttcctcaggccgtgatgggc ccctcatacg8161gattccagta ctctcctggg cagcgggtcg agttcctggtgaatacctgg aaatcaaaga8221aatgccctat gggcttctca tatgacaccc gctgctttgactcaacggtc actgagaatg8281acatccgtac tgaggaatca atttaccaat gttgtgacttggcccccgaa gccaggcagg8341ccataaggtc gctcacagag cggctttatg tcgggggtcccctgactaat tcgaaggggc8401agaactgcgg ttatcgccgg tgccgcgcaa gtggcgtgctgacgactagc tgcggcaaca8461ccctcacatg ttacttgaag gccactgcgg cctgtcgagctgcaaagctc caggactgca8521cgatgctcgt gaacggagac gaccttgtcg ttatctgtgagagtgcggga acccaggagg8581atgcggcggc cctacgagcc ttcacggagg ctatgactaggtattccgcc ccccccgggg8641acccgcccca accagaatac gacttggagc tgataacgtcatgctcctcc aatgtgtcgg8701tcgcgcacga tgcatccggc aaaagggtgt actacctcacccgtgacccc accacccccc8761tcgcacgggc tgcgtgggag acagttagac acactccagtcaactcctgg ctaggcaata8821tcatcatgta tgcgcccacc ctatgggcga ggatgattctgatgactcat ttcttctcta8881tccttctagc tcaggagcaa cttgaaaaag ccctggattgtcagatctac ggggcctgtt8941actccattga gccacttgac ctacctcaga tcattgaacgactccatggt cttagcgcat9001tttcactcca cagttactct ccaggtgaga tcaatagggtggcttcatgc ctcaggaaac9061ttggggtacc gcctttgcga gtctggagac atcgggccagaagtgtccgc gctaagctac9121tgtcccaggg ggggagggct gccacttgcg gcaagtacctcttcaactgg gcagtaaaga9181ccaagcttaa actcactcca atcccggctg cgtcccagctagacttgtcc ggctggttcg9241ttgctggtta caacggggga gacatatatc acagcctgtctcgtgcccga ccccgttggt9301tcatgttgtg cctactccta ctttctgtag gggtaggcatctacctgctc cccaaccggt9361gaacggggag ctaaccactc caggccaata ggccattccctttttttttt ttc


General Target Region:


5′ Untranslated Region—nts 1-328—Internal Ribosome Entry Site (IRES):

5′UUGGGGGCGACACUCCACCAUAGAUCACUCCCCUGUGAGGAACUACUGUCUU(SEQ ID NO: 18)CACGCAGAAAGCGUCUAGCCAUGGCGUUAGUAUGAGUGUUGUGCAGCCUCCAGGACCCCCCCUCCCGGGAGAGCCAUAGUGGUCUGCGGAACCGGUGAGUACACCGGAAUUGCCAGGACGACCGGGUCCUUUCUUGGAUCAACCCGCUCAAUGCCUGGAGAUUUGGGCGUGCCCCCGCGAGACUGCUAGCCGAGUAGUGUUGGGUCGCGAAAGGCCUUGUGGUACUGCCUGAUAGGGUGCUUGCGAGUGCCCCGGGAGGUCUCGUAGACCGUGCAU3′


Initial Specific Target Motifs:


(1) Subdomain IIIc within HCV IRES—nts 213-226

5′AUUUGGGCGUGCCC3′(SEQ ID NO: 19)


(2) Subdomain IIId within HCV IRES—nts 241-267

5′GCCGAGUAGUGUUGGGUCGCGAAAGGC3′(SEQ ID NO: 20)


5.8. Ribonuclease P RNA (“RNaseP”)

GenBank Accession #s


X15624 Homo sapiens RNaseP H1 RNA:

(SEQ ID NO: 21)1atgggcggag ggaagctcat cagtggggcc acgagctgagtgcgtcctgt cactccactc61ccatgtccct tgggaaggtc tgagactagg gccagaggcggccctaacag ggctctccct121gagcttcagg gaggtgagtt cccagagaac ggggctccgcgcgaggtcag actgggcagg181agatgccgtg gaccccgccc ttcggggagg ggcccggcggatgcctcctt tgccggagct241tggaacagac tcacggccag cgaagtgagt tcaatggctgaggtgaggta ccccgcaggg301gacctcataa cccaattcag accactctcc tccgcccatt


U64885 Staphylococcus aureus RNaseP (rrnB) RNA:

(SEQ ID NO: 22)1gaggaaagtc cgggctcaca cagtctgaga tgattgtagtgttcgtgctt gatgaaacaa61taaatcaagg cattaatttg acggcaatga aatatcctaagtctttcgat atggatagag121taatttgaaa gtgccacagt gacgtagctt ttatagaaatataaaaggtg gaacgcggta181aacccctcga gtgagcaatc caaatttggt aggagcacttgtttaacgga attcaacgta241taaacgagac acacttcgcg aaatgaagtg gtgtagacagatggttatca cctgagtacc301agtgtgacta gtgcacgtga tgagtacgat ggaacagaacgcggcttat


M17569 Escherichia coli RNA component (M1 RNA) of ribonuclease P (rnpB) gene:

(SEQ ID NO: 23)1gaagctgacc agacagtcgc cgcttcgtcg tcgtcctcttcgggggagac gggcggaggg61gaggaaagtc cgggctccat agggcagggt gccaggtaacgcctgggggg gaaacccacg121accagtgcaa cagagagcaa accgccgatg gcccgcgcaagcgggatcag gtaagggtga181aagggtgcgg taagagcgca ccgcgcggct ggtaacagtccgtggcacgg taaactccac241ccggagcaag gccaaatagg ggttcataag gtacggcccgtactgaaccc gggtaggctg301cttgagccag tgagcgattg ctggcctaga tgaatgactgtccacgacag aacccggctt361atcggtcagt ttcacct


Z70692 Mycobacterium tuberculosis RNaseP (rnpB) RNA:

(SEQ ID NO: 24)1ccaccggtta cgatcttgcc gaccatggcc ccacaatagggccggggaga cccggcgtca61gtggtgggcg gcacggtcag taacgtctgc gcaacacggggttgactgac gggcaatatc121ggctccatag cgtcggccgc ggatacagta aaggagcattctgtgacgga aaagacgccc181gacgacgtct tcaaacttgc caaggacgag aaggtcgaatatgtcgacgt ccggttctgt241gacctgcctg gcatcatgca gcacttcacg attccggcttcggcctttga caagagcgtg301tttgacgacg gcttggcctt tgacggctcg tcgattcgcgggttccagtc gatccacgaa361tccgacatgt tgcttcttcc cgatcccgag acggcgcgcatcgacccgtt ccgcgcggcc421aagacgctga atatcaactt ctttgtgcac gacccgttcaccctggagcc gtactcccgc481gacccgcgca acatcgcccg caaggccgag aactacctgatcagcactgg catcgccgac541accgcatact tcggcgccga ggccgagttc tacattttcgattcggtgag cttcgactcg601cgcgccaacg gctccttcta cgaggtggac gccatctcggggtggtggaa caccggcgcg661gcgaccgagg ccgacggcag tcccaaccgg ggctacaaggtccgccacaa gggcgggtat721ttcccagtgg cccccaacga ccaatacgtc gacctgcgcgacaagatgct gaccaacctg781atcaactccg gcttcatcct ggagaagggc caccacgaggtgggcagcgg cggacaggcc841gagatcaact accagttcaa ttcgctgctg cacgccgccgacgacatgca gttgtacaag901tacatcatca agaacaccgc ctggcagaac ggcaaaacggtcacgttcat gcccaagccg961ctgttcggcg acaacgggtc cggcatgcac tgtcatcagtcgctgtggaa ggacggggcc1021ccgctgatgt acgacgagac gggttatgcc ggtctgtcggacacggcccg tcattacatc1081ggcggcctgt tacaccacgc gccgtcgctg ctggccttcaccaacccgac ggtgaactcc1141tacaagcggc tggttcccgg ttacgaggcc ccgatcaacctggtctatag ccagcgcaac1201cggtcggcat gcgtgcgcat cccgatcacc ggcagcaacccgaaggccaa gcggctggag1261ttccgaagcc ccgactcgtc gggcaacccg tatctggcgttctcggccat gctgatggca1321ggcctggacg gtatcaagaa caagatcgag ccgcaggcgcccgtcgacaa ggatctctac1381gagctgccgc cggaagaggc cgcgagtatc ccgcagactccgacccagct gtcagatgtg1441atcgaccgtc tcgaggccga ccacgaatac ctcaccgaaggaggggtgtt cacaaacgac1501ctgatcgaga cgtggatcag tttcaagcgc gaaaacgagatcgagccggt caacatccgg1561ccgcatccct acgaattcgc gctgtactac gacgtttaaggactcttcgc agtccgggtg1621tagagggagc ggcgtgtcgt tgccagggcg ggcgtcgaggtttttcgatg ggtgacggtg1681gccggcaacg gcgcgccgac caccgctgcg aagagcccgtttaagaacgt tcaaggacgt1741ttcagccggg tgccacaacc cgcttggcaa tcatctcccgaccgccgagc gggttgtctt1801tcacatgcgc cgaaactcaa gccacgtcgt cgcccaggcgtgtcgtcgcg gccggttcag1861gttaagtgtc ggggattcgt cgtgcgggcg ggcgtccacgctgaccaacg gggcagtcaa1921ctcccgaaca ctttgcgcac taccgccttt gcccgccgcgtcacccgtag gtagttgtcc1981aggaattccc caccgtcgtc gtttcgccag ccggccgcgaccgcgaccgc attgagctgg2041cgcccgggtc ccggcagctg gtcggtgggc ttgccgcgcaccaacaccag cgcgttgcgg2101gcccgggtgg cggtcagcca ggcctgacgg agcagctccacgtcggctgc gggaaccaga2161tcggcggccg cgatgacatc cagggattgc agcgtcgaggtgttgtgcag ggcgggaacc2221tggtgcgcat gctgtagctg cagcaactgc acggtccattcgatgtcggc cagtccgccg2281cggcccagtt tggtgtgtgt gttggggtcg gcaccgcgcggcaaccgctc ggactcgata2341cgggccttga tgcggcgaat ctcgcgcacc gagtcagcggacacaccgtc gggcggatac2401cgcgttttgt cgaccatccg taggaatcgc tgacccaactcggcatcgcc ggcaaccgcg2461tgtgcgcgta gcagggcctg gatctcccat ggctgtgcccactgctcgta gtatgcggcg2521taggacccca gggtgcggac cagcggaccg ttgcggccctcgggtcgcaa attggcgtcg2581agctccagcg gcggatcgac gctgggtgtc cccagcagcgcccgaacccg ctcggcgatc2641gatgtcgacc atttcaccgc ccgtgcatcg tcgacgccggtggccggctc acagacgaac2701atcacgtcgg catccgaccc gtagcccaac tcggcaccacccagccgacc catgccgatg2761accgcgatgg ccgccggggc gcgatcgtcg tcgggaaggctggcccggat catgacgtcc2821agcgcggcct gcagcaccgc cacccacacc gacgtcaacgcccggcacac ctcggtgacc2881tcgagcaggc cgagcaggtc cgccgaaccg atgcgggccagctctcgacg acgcagcgtg2941cgcgcgccgg cgatggcccg ctccgggtcg gggtagcggctcgccgaggc gatcagcgcc3001cgagccacgg cggcgggctc ggtctcgagc agcttcgggcccgcaggccc gtcctcgtac3061tgctggatga cccgcggcgc gcgcatcaac agatccggcacatacgccga ggtacccaag3121acatgcatga gccgcttggc caccgcgggc ttgtcccgcagcgtggccag gtaccagctt3181tcggtggcca gcgcctcact gagccgccgg taggccagcagtccgccgtc gggatcgggg3241gcatacgaca tccagtccag cagcctgggc agcagcaccgactgcacccg tccgcgccgg3301ccgctttgat tgaccaacgc cgacatgtgt ttcaacgcggtctgcggtcc ctcgtagccc3361agcgcggcca gccggcgccc cgcggcctcc aacgtcatgccgtgggcgat ctccaacccg3421gtcgggccga tcgattccag cagcggttga tagaagagtttggtgtgtaa cttcgacacc3481cgcacgttct gcttcttgag ttcctcccgc agcaccccggccgcatcgtt tcggccatcg3541ggccggatgt gggccgcgcg cgccagccag cgcactgcctcctcgtcttc gggatcggga3601agcaggtggg tgcgcttgag ccgctgcaac tgcagtcggtgctcgagcag cctgaggaac3661tcatacgacg cggtcatgtt cgccgcgtcc tcacgcccgatgtagccgcc ttcgcccaac3721gccgccaatg cgtccaccgt ggacgccacc cgtaacgactcgtcgctacg ggcatgaacc3781agctgcagta gctgtacggc gaactccacg tcgcgcaatccgccgctgcc gagtttgagc3841tcgcggccgc ggacatcggc gggcaccagc tgctccacccgccgccgcat ggcctgcacc3901tcgaccacaa agtcttcgcg ctcgcaggct cgccacaccatcggcatcaa ggcggtcagg3961taacgctcgc caagttccgc gtcgccaacg actggccgtgctttcagcaa cgcctgaaac4021tcccaggtct tggcccagcg ctggtagtag gcgatgtgcgactcgagcgt acggaccagc4081tccccgttgc gcccctccgg acgcagggcg gcgtccacctcgaaaaaggc cgccgaggcc4141acccgcatca tctcgctggc cacgcgcgcg ttgcgcgggtcggagcgctc ggcaacgaat4201atgacatcga cgtcgctgac gtagttcagt tcgcgcgcaccgcacttgcc catcgcgatg4261accgccaggc gcggtggcgg gtgctcgccg cacacgctcgcctcggccac gcgcagcgcc4321gccgccagag cggcgtccgc ggcgtccgcc aggcgtgcggccaccacggt gaatggcagc4381accggttcgt cctcgaccgt cgcggccagg tcgagagcggccagcattag cacgtagtcg4441cggtactggg ttcgcaatcg gtgcacgagc gagcccggcataccctccga ttcctcgacg4501cactcgacga acgaccgctg cagctggtca tgggacggcagtgtgacctt gccccgcagc4561aatttccagg actgcggatg ggcgaccagg tgatcgcccaacgccagcga cgagcccagc4621accgagaaca gccgcccgcg cagactgcgt tcgcgcagcagagccgcgtt gagctcgtcc4681catccggtgt ctggattctc cgacagccgg atcaaggcgcgcagcgcggc atcggcgtcc4741ggagcgcgtg acagcgacca cagcaggtcg acgtgcgcctgatcctcgtg ccgatcccac4801cccagctgag ccagacgctc accagcaggg gggtcaactaatccgagccg gccaacgctg4861ggcaacttcg gccgctgcgt ggcgagtttg gtcacgaccacgacggtagc gcaaagcgcg4921tcggcgtcgg atcaaccggt agatctgggc tacagcgacaggtaggtgcg cagctcgtat4981ggcgtgacgt ggctgcggta gttcgcccac tccgtgcgcttgttgcgcaa gaaaaagtca5041aaaacgtgct cccccaaggc ctccgcgacg agttcggaggcctccatggc gcgcagcgca5101ctatccaaac tggacggcaa ttctcggtac cccatcgctcggcgttcctc gggtgtgagg5161tcccatacgt tgtcctcggc ctgcgggccc agcacgtaacccttctctac accccgcaat5221cccgcggcca gcagcacggc gaatgtcaga tagggattgcacgccgaatc agggctgcgt5281acttcgaccc gccgcgacga ggtcttgtgc ggcgtgtacatcggcacccg cactagggcg5341gatcggttgg cggcccccca cgacgcggcc gtgggcgcttcgccgccctg caccagccgc5401ttgtaagagt tgacccactg atttgtgacc gcgctgatctcgcaagcgtg ctccaggatc5461ccggcgatga acgatttacc cacttccgac agctgcagcggatcatcagc gctgtggaac5521gcgttgacat caccctcgaa caggctcatg tgggtgtgcatcgccgagcc cgggtgctgg5581ccgaatggct tgggcatgaa cgacgcccgg gcgccctcttccagcgcgac ttctttgatg5641acgtagcgga aggtcatcac gttgtcagcc atcgacagagcgtcggcaaa ccgcaggtcg5701atctcctgct ggccgggtgc gccttcgtga tggctgaactccaccgagat gcccatgaat5761tccagggcat cgatcgcgtg gcggcgaaag ttcaaggcggagtcgtgcac cgcttggtcg5821aaatagccgg cgttgtcgac cgggacgggc accgacccgtcctcgggtcc gggcttgagc5881aggaagaact cgatttcggg atgcacgtag caggagaagccgagttcgcc ggccttcgtc5941agctgccgcc gcaacacgtg ccgcgggtcc gcccacgacggcgagccgtc cggcatggtg6001atgtcgcaaa acatccgcgc tgagtggtgg tggccggaactggtggccca gggcagcacc6061tggaaggtcg acgggtccgg gtgcgccacc gtatcggattccgagacccg cgcaaagccc6121tcgatcgagg atccgtcgaa gccgatgcct tcctcgaaggcgccctcgag ttcggctggg6181gcgatggcga ccgacttgag gaaaccgagc acgtctgtgaaccacagccg gacgaagcgg6241atgtcgcgtt cttccagggt acgaagaacg aattccttctgtcggtccat acctcgaaca6301gtatgcactg tctgttaaaa ccgtgttacc gatgcccggccagaagcgtt gcggggcggc6361ccgcaagggg agtgcgcggt gagttcaggg cgcgcaccgcagactcgtcg gcggcaaggt6421cccgtcgaga aaatagtgca tcaccgcaga gtccacacactggttgccat cgaacaccgc6481agtgtgttgg gtgccgtcga aggtgatcag cggtgcgcccagctggcggg ccaggtctac6541cccggactga tacggagtgg ccgggtcgtg ggtggtggacaccacgacga ccttgccagc6601cccggccggc gccgcggggt gcggcgtcga cgttgccggcaccggccaca gcgcgcacag6661atcgcggggg gcggatccgg tgaactgccc gtagctaaggaacggggcga cctgacggat6721ccgttggtcg gcggccaccc aggccgctgg atcggccggtgtgggcgcat cgacgcaccg6781gaccgcgttg aacgcgtcct ggtcgttgct gtagtgcccgtctgcatccc ggccgtcata6841gtcgtcggca agcaccagca agtcgccggc gtcgctgccgcgctgcagcc ccagcagacc6901actggtcagg tacttccagc gctgagggct gtacagcgcgttgatggtgc ccgtcgtcgc6961gtcggcgtag ctcaggccac gtggatccga cgtcttacccggcttctgca ccagcgggtc7021aaccagggcg tggtagcggt tgacccactg ggccgagtcggtgcccagag ggcaggccgg7081cgagcgggcg cagtcggcgg cgtagtcatt gaaagcggtctgaaatcccg ccatttggct7141gatgctttcc tcgattgggc taacggctgg atcgatagcgccgtcgagga ccatcgcccg7201cacatgagta ccgaaccgtt ccaggtaagc ggtgcccaactcggtgccgt agctgtatcc7261gaggtagttg atctgatcgt cacctaacgc ttggcgaaccatgtccatgt cccgtgcgac7321ggacgcggta ccgatattgg ccaagaagct gaagcccatccggtcaacac agtcctgggc7381caactgccgg tagacctgtt cgacgtgggt gacaccggccggactgtagt cggccatcgg7441atcgcgccgg tacgcgtcga actcggcgtc ggtgcgacaccgcaacgcag gggtcgagtg7501gccgacccct ctcgggtcga agcccaccag gtcgaagtggcggagaatgt cggtgtcggc7561gatcgcgggt gccatagcgg cgaccatgtc gaccgccgacgccccgggtc ccccaggatt7621gaccagcagt gctccgaatc gctgtcccgt cgcggggacgcggatcaccg ccaacttcgc7681ttgtgtccca ccgggttggt cgtagtcgac ggggacggacaccgtcgcgc agcgtgcagt7741gcgaatttcg ctggtgtcgg cgatgaactc gcggcagctgttccaactct gttgcggcgc7801cacgaccggc gcacccgggg tttggccggc gccgggttcttcagtcgcgc cggccaacgg7861gggcgctgct aggggcagtc cgccgagcag caacccgaaggacagcagcg ccgagctcaa7921cggtctgcgg cgccacatgg ccgccatcgt ctcaccggcgaatacctgtg acggcgcgaa7981atgatcacac cttcgtttct tcgccccgct agcacttggcgccgctgggc ggcgtggtgc8041cgccgattaa atacgccgtc acgtactcgt caatgcagctgtcgccctgg aataccaccg8101tgtgctgggt tccgtcgaag gtcagcaacg aaccgcgaagctggttcgcc aggtcgaccc8161cggccttgta cggcgtcgcc gggtcatggg tggtggataccaccaccgtc ggcactaggc8221cgggcgccga gacggcatgg ggctgacttg tgggtggcaccggccagaac gcgcaggtgc8281ccagcggcgc atcaccggtg aacttcccgt agctcatgaacggtgcgatc tcccgggcgc8341ggcggtcttc gtcgatgacc ttgtcgcgat cggtaaccgggggctgatcg acgcaattga8401tcgccacccg cgcgtcaccg gaattgttgt agcggccgtgcgagtcccga cgcatgtaca8461tgtcggccag agccagcagg gtgtctccgc gattgtcgaccagctccgac agcccgtcgg8521tcaagtgttg ccacagattc ggtgagtaca gcgccataatggtgcccacg atggcgtcgc8581tataactcag cccgcgcgga tccttcgtgc gcgccggcctgctgatcctc gggttgtccg8641ggtcgaccaa cggatcgacc aggctgtggt agacctcgacggctttggcc gggtcggcgc8701ccagcgggca gcccgcgttc ttggcgcagt cggcggcatagttgttgaac gcgtcctgga8761agcccttggc ctggcgcagc tccgcctcga tgggatcggcattggggtcg acggcaccgt8821cgagaatcat tgcccgcacc cgctgcggaa attcctcggcatacgcggag ccgatccggg8881tgccgtacga gtagcccagg taggtcagct tgtcgtcgcccaacgccgcg cgaatggcat8941ccaggtcctt ggcgacgttg accgtcccga catgggccagaaagttcttg cccatcttgt9001ccacacagcg accgacgaat tgcttggtct cgttctcgatgtgcgccaca ccctcccggc9061tgtagtcaac ctgcggctcg gcccgcagcc ggtcgttgtcggcatcggag ttgcaccaga9121tcgccggccg ggacgacgcc accccgcggg ggtcgaacccaaccaggtcg aacctttcgt9181gcacccgctt cggcaatgtc tggaagacgc ccaaggcggcctcgataccg gattcgccgg9241gtccaccggg atttatgacc agcgaaccga tcttgtctcccgtcgccgga aagcgaatca9301gcgccagcgc cgccacgtca ccatcggggc ggtcgtagtcgaccggtaca gcgagcttgc9361cgcataacgc gccgccgggg atctttactt gcgggtttgacgaccggcac ggtgtccact9421ccaccggctg gcccagcttc ggctccgcca tacgagcgcgtcccccgacc acgcggatgc9481agcccacaag aaccaacgcc acggcggcga gcgcggcccagatcaacagc atgcgcgcga9541tcttgtcgcg gcgagacagc ctcatgccca caatgctgccagagcagacc cgagatcctg9601gccagcggcc accgtcggcc gactaaccgg ccgctgccagcagtcctgcc atcgccgatg9661gcgaactcgt cggccatccc ccatacgtcc ggtaacagatccgggcaaga caccgacccg9721tcgaccggat ccggcacggg cgcgtcggcc tcggcggtgcacaactgcga catcaggttg9781gcgctggcac cccgtccacg ccggcatggt gcaccttggccatcgcccga gggcgatccc9841cgatgccgtc caccccttcg acgaacccat ctcccacggcggtcgccggc agcgacgcga9901tgtggccgca gatctccgag agttcggccc gcccgcccggcgacggcaac ccgatgccgt9961gcaagtgacg atcgatgtga ggttcaaggt tcagcgcactgctggcaagc tttttccgaa10021accgcggcct cgccttgatc tggagtcaga acgcgtcacgcagccggtca aaggcgtaac10081ccatgctcga gcaaacatgc atgggctgag tggacgtttccagacacagc aactggcgtc10141caggccactg agccgctgca tgcgcgatgg tatgccgatgggggccccgg gcgcgtctga10201ggggaagaag tggcagactg tcagggtccg acgaacccggggaccctaac gggccacgag10261gatcgacccg accaccatta gggacagtga tgtctgagcagactatctat ggggccaata10321cccccggagg ctccgggccg cggaccaaga tccgcacccaccacctacag agatggaagg10381ccgacggcca caagtgggcc atgctgacgg cctacgactattcgacggcc cggatcttcg10441acgaggccgg catcccggtg ctgctggtcg gtgattcggcggccaacgtc gtgtacggct10501acgacaccac cgtgccgatc tccatcgacg agctgatcccgctggtccgt ggcgtggtgc10561ggggtgcccc gcacgcactg gtcgtcgccg acctgccgttcggcagctac gaggcggggc10621ccaccgccgc gttggccgcc gccacccggt tcctcaaggacggcggcgca catgcggtca10681agctcgaggg cggtgagcgg gtggccgagc aaatcgcctgtctgaccgcg gcgggcatcc10741cggtgatggc acacatcggc ttcaccccgc aaagcgtcaacaccttgggc ggcttccggg10801tgcagggccg cggcgacgcc gccgaacaaa ccatcgccgacgcgatcgcc gtcgccgaag10861ccggagcgtt tgccgtcgtg atggagatgg tgcccgccgagttggccacc cagatcaccg10921gcaagcttac cattccgacg gtcgggatcg gcgctgggcccaactgcgac ggccaggtcc10981tggtatggca ggacatggcc gggttcagcg gcgccaagaccgcccgcttc gtcaaacggt11041atgccgatgt cggtggtgaa ctacgccgtg ctgcaatgcaatacgcccaa gaggtggccg11101gcggggtatt ccccgctgac gaacacagtt tctgaccaagccgaatcagc ccgatgcgcg11161ggcattgcgg tggcgccctg gatgccgtcg acgccggattgccggcgcgg acgcgccagc11221gggacccatc ggcgtcgcgt tcgccggttg agcccggggtgagcccagac attcgatgtg11281cccaacacca tccgccacag cccaattgat gtggcactctatgcatgcct atccccgacc11341aaccaccacc gcggcgacgc atcatgaccg gaggcgaagatgccagtaga ggcgcccaga11401ccagcgcgcc atctggaggt cgagcgcaag ttcgacgtgatcgagtcgac ggtgtcgccg11461tcgttcgagg gcatcgccgc ggtggttcgc gtcgagcagtcgccgaccca gcagctcgac11521gcggtgtact tcgacacacc gtcgcacgac ctggcgcgcaaccagatcac cttgcggcgc11581cgcaccggcg gcgccgacgc cggctggcat ctgaagctgccggccggacc cgacaagcgc11641accgagatgc gagcaccgct gtccgcatca ggcgacgctgtgccggccga gttgttggat11701gtggtgctgg cgatcgtccg cgaccagccg gttcagccggtcgcgcggat cagcactcac11761cgcgaaagcc agatcctgta cggcgccggg ggcgacgcgctggcggaatt ctgcaacgac11821gacgtcaccg catggtcggc cggggcattc cacgccgctggtgcagcgga caacggccct11881gccgaacagc agtggcgcga atgggaactg gaactggtcaccacggatgg gaccgccgat11941accaagctac tggaccggct agccaaccgg ctgctcgatgccggtgccgc acctgccggc12001cacggctcca aactggcgcg ggtgctcggt gcgacctctcccggtgagct gcccaacggc12061ccgcagccgc cggcggatcc agtacaccgc gcggtgtccgagcaagtcga gcagctgctg12121ctgtgggatc gggccgtgcg ggccgacgcc tatgacgccgtgcaccagat gcgagtgacg12181acccgcaaga tccgcagctt gctgacggat tcccaggagtcgtttggcct gaaggaaagt12241gcgtgggtca tcgatgaact gcgtgagctg gccgatgtcctgggcgtagc ccgggacgcc12301gaggtactcg gtgaccgcta ccagcgcgaa ctggacgcgctggcgccgga gctggtacgc12361ggccgggtgc gcgagcgcct ggtagacggg gcgcggcggcgataccagac cgggctgcgg12421cgatcactga tcgcattgcg gtcgcagcgg tacttccgtctgctcgacgc tctagacgcg12481cttgtgtccg aacgcgccca tgccacttct ggggaggaatcggcaccggt aaccatcgat12541gcggcctacc ggcgagtccg caaagccgca aaagccgcaaagaccgccgg cgaccaggcg12601ggcgaccacc accgcgacga ggcattgcac ctgatccgcaagcgcgcgaa gcgattacgc12661tacaccgcgg cggctactgg ggcggacaat gtgtcacaagaagccaaggt catccagacg12721ttgctaggcg atcatcaaga cagcgtggtc agccgggaacatctgatcca gcaggccata12781gccgcgaaca ccgccggcga ggacaccttc acctacggtctgctctacca acaggaagcc12841gacttggccg agcgctgccg ggagcagctt gaagccgcgctgcgcaaact cgacaaggcg12901gtccgcaaag cacgggattg agcccgccag gggcggacgagttggcctgt aagccggatt12961ctgttccgcg ccgccacagc caagctaacg gcggcacggcggcgaccatc catctggaca13021caccgttacc gggtgcctcg agcggcctac ccgcaggctcgggcgagcaa ccctcaagcg13081cctgcgcggc cgcactttcg gtgcggcctt cttggccttgcttcgggtgg ggtttgccta13141gccaccccgg tcacccggaa tgctggtgcg ctcttaccgcaccgtttcac ccttgccacc13201acgaggatgg cggtctgttt tctgtggcac tttcccgcgagtcacctcgg attgccgtta13261gcaatcaccc tgctctgtga agtccggact ttcctcgactcgacgctgaa cctcgtgaat13321ccacacaagc cctacgcgag ccgcggccgc ccagccaactcatccgcgac gaccacgcta13381ccccgctggg cggtgtcgcg gccagtgtga ccgctggacgacacggctag tcggacagcc13441gatccggcgg gcagtcctta tcgtggactg gtgacacggtgggacaaacg cgtcgactcc13501ggcgactggg acgccatcgc tgccgaggtc agcgagtacggtggcgcact gctacctcgg13561ctgatcaccc ccggcgaggc cgcccggctg cgcaagctgtacgccgacga cggcctgttt13621cgctcgacgg tcgatatggc atccaagcgg tacggcgccgggcagtatcg atatttccat13681gccccctatc ccgagtgatc gagcgtctca agcaggcgctgtatcccaaa ctgctgccga13741tagcgcgcaa ctggtgggcc aaactgggcc gggaggcgccctggccagac agccttgatg13801actggttggc gagctgtcat gccgccggcc aaacccgatccacagcgctg atgttgaagt13861acggcaccaa cgactggaac gccctacacc aggatctctacggcgagttg gtgtttccgc13921tgcaggtggt gatcaacctg agcgatccgg aaaccgactacaccggcggc gagttcctgc13981ttgtcgaaca gcggcctcgc gcccaatccc ggggtaccgcaatgcaactt ccgcagggac14041atggttatgt gttcacgacc cgtgatcggc cggtgcggactagccgtggc tggtcggcat14101ctccagtgcg ccatgggctt tcgactattc gttccggcgaacgctatgcc atggggctga14161tctttcacga cgcagcctga ttgcacgcca tctatagatagcctgtctga ttcaccaatc14221gcaccgacga tgccccatcg gcgtagaact cggcgatgctcagcgatgcc agatcaagat14281gcaaccgata taggacgccc gacccggcat ccaacgccagccgcaacaac attttgatcg14341gcgtgacatg tgacaccacc agcaccgtcg cgccttcgtagccaacgatg atccgatcac14401gtccccgccg aacccgccgc agcacgtcgt cgaagctttccccacccggg ggcgtgatgc14461tggtgtcctg cagccagcga cggtgcagct cgggatcgcgttctgcggcc tccgcgaacg14521tcagcccctc ccaggcgccg aagtcggtct cgaccaggtcgtcatcgacg accacgtcca14581gggccagggc tctggcggcg gtcaccgcgg tgtcgtaagcccgctgtagc ggcgaggaga14641ccaccgcagc gatcccgccg cgccgcgcca gatacccggccgccgcacca acctggcgcc14701accccacctc gttcaacccc gggttgccgc gccccgaatagcggcgttgc tccgacagct14761ccgtctgccc gtggcgcaac aaaagtagtc gggtgggtgtaccgcgggcg ccggtccagc14821cgggagatgt cggtgactcg gtcgcaacga ttttggcaggatccgcatcc gccgcagccg14881attgcgcggc ggcgtccatc gcgtcattgg ccaaccggtctgcatacgtg ttccgggcac14941gcggaaccca ctcgtagttg atcctgcgaa actgggacgccaacgcctga gcctggacat15001agagcttcag cagatccggg tgcttgacct tccaccgcccggacatctgc tccaccacca15061gcttggagtc catcagcacc gcggcctcgg tggcacctagtttcacggcg tcgtccaaac15121cggctatcag gccgcggtat tcggcgacgt tgttcgtcgcccggccgatc gcctgcttgg15181actcggccag cacggtggag tgatcggcgg tccacaccaccgcgccgtat ccggccggtc15241cgggattgcc ccgcgatccg ccgtcggctt cgatgacaactttcactcct caaatccttc15301gagccgcaac aagatcgctc cgcattccgg gcagcgcaccacttcatcct cggcggccgc15361cgagatctgg gccagctcgc cgcggccgat ctcgatccggcaggcaccac atcgatgacc15421ttgcaaccgc ccggcccctg gcccgcctcc ggcccgctgtctttcgtaga gccccgcaag15481ctcgggatca agtgtcgccg tcagcatgtc gcgttgcgatgaatgttggt gccgggcttg15541gtcgatttcg gcaagtgcct cgtccaaagc ctgctgggcggcggccaggt cggcccgcaa15601cgcttggagc gcccgcgact cggcggtctg ttgagcctgcagctcctcgc ggcgttccag15661cacctccagc agggcatctt ccaaactggc ttgacggcgttgcaagctgt cgagctcgtg15721ctgcagatca gccaattgct tggcgtccgt tgcacccgaagtgagcaacg accggtcccg15781gtcgccacgc ttacgcaccg catcgatctc cgactcaaaacgcgacacct ggccgtccaa15841gtcctccgcc gcgattcgca gggccgccat cctgtcgttggcggcgttgt gctcggcctg15901cacctgctgg taagccgccc gctgcggcag atgggtagcccgatgcgcga tccgggtcag15961ctcagcatcc agcttcgcca attccagtag cgaccgttgctgtgccactc cggctttcat16021gcctgatctc tcccagtttc gtgatcgagg ttccacgggtcggtgcagat ggtgcacaca16081cgcaccggca gcgacgcgcc gaaatgagac cgcaacacttcggcggcctg gccgcaccac16141gggaattcgc ttgcccaatg cgcgacgtcg atcagggccacttgcgaagc tcggcaatgc16201tcgtcggctg gatgatgtcg cagatcggcc gtaacgtacgcttgcacgtc cgcggcggcc16261acggtggcaa gcaacgagtc cccggcgccg ccgcagaccgcgacccgcga caccagcagg16321tcgggatccc cggcggcgcg cacaccggtc gcagtcggcggcaacgcggc ctccagacgg16381gcaacaaagg tgcgcagcgg ttcgggtttt ggcagtctgccaatccggcc taacccgctg16441ccgaccggcg gtggtaccag cgcgaagatg tcgaatgccggctcctcgta agggtgcgcg16501gcgcgcatcg ccgccaacac ctcggcgcgc gctcgtgcgggtgcgacgac ctcgacccgg16561tcctcggcca cccgttcgac ggtaccgacg ctgcctatggcgggcgacgc cccgtcgtgc16621gccaggaact gcccggtacc cgcgacactc cagctgcagtgcgagtagtc gccgatatgg16681ccggcaccgg cctcaaagac cgctgcccgc accgcctctgagttctcgcg cggcacatag16741atgacccact tgtcgagatc ggccgctccg ggcaccgggtcgagaacggc gtcgacggtc16801agaccaacag cgtgtgccag cgcgtcggac acacccggcgacgccgagtc ggcgttggtg16861tgcgcggtaa acaacgagcg accggtccgg atcaggcggtgcaccagcac accctttggc16921gtgttggccg cgaccgtatc gaccccacgc agtaacaacgggtggtgcac caatagcagt16981ccggcctggg gaacctggtc caccaccgcc ggcgtcgcgtccaccgcaac ggtcaccgaa17041tccaccacgt cgtcggggtc gccgcacacc agacccaccgaatcccacga ctgggcaagc17101cgcggcgggt aggcctggtc cagcacgtcg atgacatcggccagccgcac actcatcggc17161gtcctccacg ctttgcccac tcggcgatcg ccgccaccagcacgggccac tccgggcgca17221ccgccgcccg caggtaccgc gcgtccaggc cgacgaaggtgtcaccgcgg cgcaccgcaa17281ttcctttgct ctgcaaatag tttcgtaatc cgtcagcatcggcgatgttg aacagtacga17341aaggggccgc accatcgacc acctcggcac ccaccgatctcagtccggcc accatctccg17401cgcgcagcgc cgtcaaccgc accgcatcgg ctgcggcagcggcgaccgcc cggggggcgc17461agcaagcagc gatggccgtc agttgcaatg ttcccaacggccagtgcgct cgctgcacgg17521tcaaccgagc cagcacgtct ggcgagccga gcgcgtagcccacccgcaat ccggccagcg17581accacgtttt cgtcaagcta cggagcacca gcacatcgggcagcgagtca tcggccaacg17641attgcggctc gccgggaacc caatcagcga acgcctcgtcgaccaccagg atgcgtcccg17701gccggcgtaa ctcgagcagc tgctcgcgga ggtgcagcaccgaggtgggg ttggtcggat17761tacccacgac gacaaggtcg gcgtcgtcag gcacgtgcgcggtgtccagc acgaacggcg17821gctttaggac aacatggtgc gccgtgattc cggcagcgctcaaggctatg gccggctcgg17881tgaacgcggg cacgacgatt gctgcccgca ccggacttaggttgtgcagc aatgcgaatc17941cctccgccgc cccgacgagc gggagcactt cgtcacgggttctgccatga cgttcagcga18001ccgcgtcttg cgcccggtgc acatcgtcgg tgctcggatagcgggccagc tccggcagca18061gcgcggcgag ctgccggacc aaccattccg ggggccggtcatggcggacg ttgacggcga18121agtccagcac gccgggcgcg acatcctgat caccgtggtagcgcgccgcg gcaagcgggc18181tagtgtctag actcgccaca gcgtcaaaca gtagtgggccggtgtgcggg ccaagaatcc18241agagcaccgc cgacgcgttg tctacgcggc gacaaccgcgacatcacagg cagctaacag18301ggcgtcggcg gtgatgatcg tcaggccaag cagctgtgcctgggcgatga gcacacggtc18361gaatggatgt cgatggtgat ccggaagctc tgcggtgcgcagtgtgtgcg tggtcaactg18421acagcggcga cgtgccgcag cggcgcattc gatcgggcacgtaagaagcc gatggctcgg18481gcggcgggag cttgccgagg cggtagttga tcgcgatctcccaggcactg gcggccgaca18541agagaatgct gttgcggacg tcctgaacaa tcgcccgtgtttcgttgacg gcatccgcag18601ccaaacgtgg gtgtcgatga ggtagcgctt caccggtgaaagcgttcgag cacgtcgtct18661gacaacggag cgtccaaatc gtcgggcacg cggtacacgccatggtcaat gcctaaccgc18721cgagtctcat gaggatgcag cggcacaagc tttgctaccggctcgccgcg gcgggcaatc18781tcaacctctg cccgccgtag acgagccgca gcagctcggacaggcgtgtc ttcgcctcgt18841gaacgccgac ccgcttcgca ggcgcccaga ctttcgcgtcgaccacctgc tcaccaaact18901tcgcgatcat cgcctgatac cacagcgcca acgggtagcggtttgtccaa ccgcttcgtc18961aacgacaatg ggatcgtgac cgacacgacc gcgagcgggaccaattgccc gcctcctcca19021cgcgccgccg cacggcgcgc atcgtcgccg ggtgaatcgccgcagctggt gatcttcgat19081ctggacggca cgctgaccga ctcggcgcgc ggaatcgtatccagcttccg acacgcgctc19141aaccacatcg gtgccccagt acccgaaggc gacctggccactcacatcgt cggcccgccc19201atgcatgaga cgctgcgcgc catggggctc ggcgaatccgccgaggaggc gatcgtagcc19261taccgggccg actacagcgc ccgcggttgg gcgatgaacagcttgttcga cgggatcggg19321ccgctgctgg ccgacctgcg caccgccggt gtccggctggccgtcgccac ctccaaggca19381gagccgaccg cacggcgaat cctgcgccac ttcggaattgagcagcactt cgaggtcatc19441gcgggcgcga gcaccgatgg ctcgcgaggc agcaaggtcgacgtgctggc ccacgcgctc19501gcgcagctgc ggccgctacc cgagcggttg gtgatggtcggcgaccgcag ccacgacgtc19561gacggggcgg ccgcgcacgg catcgacacg gtggtggtcggctggggcta cgggcgcgcc19621gactttatcg acaagacctc caccaccgtc gtgacgcatgccgccacgat tgacgagctg19681agggaggcgc taggtgtctg atccgctgca cgtcacattcgtttgtacgg gcaacatctg19741ccggtcgcca atggccgaga agatgttcgc ccaacagcttcgccaccgtg gcctgggtga19801cgcggtgcga gtgaccagtg cgggcaccgg gaactggcatgtaggcagtt gcgccgacga19861gcgggcggcc ggggtgttgc gagcccacgg ctaccctaccgaccaccggg ccgcacaagt19921cggcaccgaa cacctggcgg cagacctgtt ggtggccttggaccgcaacc acgctcggct19981gttgcggcag ctcggcgtcg aagccgcccg ggtacggatgctgcggtcat tcgacccacg20041ctcgggaacc catgcgctcg atgtcgagga tccctactatggcgatcact ccgacttcga20101ggaggtcttc gccgtcatcg aatccgccct gcccggcctgcacgactggg tcgacgaacg20161tctcgcgcgg aacggaccga gttgatgccc cgcctagcgttcctgctgcg gcccggctgg20221ctggcgttgg ccctggtcgt ggtcgcgttc acctacctgtgctttacggt gctcgcgccg20281tggcagctgg gcaagaatgc caaaacgtca cgagagaaccagcagatcag gtattccctc20341gacaccccgc cggttccgct gaaaaccctt ctaccacagcaggattcgtc ggcgccggac20401gcgcagtggc gccgggtgac ggcaaccgga cagtaccttccggacgtgca ggtgctggcc20461cgactgcgcg tggtggaggg ggaccaggcg tttgaggtgttggccccatt cgtggtcgac20521ggcggaccaa ccgtcctggt cgaccgtgga tacgtgcggccccaggtggg ctcgcacgta20581ccaccgatcc cccgcctgcc ggtgcagacg gtgaccatcaccgcgcggct gcgtgactcc20641gaaccgagcg tggcgggcaa agacccattc gtcagagacggcttccagca ggtgtattcg20701atcaataccg gacaggtcgc cgcgctgacc ggagtccagctggctgggtc ctatctgcag20761ttgatcgaag accaacccgg cgggctcggc gtgctcggcgttccgcatct agatcccggg20821ccgttcctgt cctatggcat ccaatggatc tcgttcggcattctggcacc gatcggcttg20881ggctatttcg cctacgccga gatccgggcg cgccgccgggaaaaagcggg gtcgccacca20941ccggacaagc caatgacggt cgagcagaaa ctcgctgaccgctacggccg ccggcggtaa21001accaacatca cggccaatac cgcagccccc gcctggaccacccgcgacag caccacggcg21061cggcgcagat cggccacctt gggcgaccgg ccgtcgcccaaggtgggccg gatctgcaac21121tcatggtggt accgggtggg cccacccagc cgcacgtcaagcgccccagc aaacgccgcc21181tcgacgacac cggcgttggg gctgggatgg cgggcggcgtcgcgccgcca ggcccgtacc21241gcaccgcggg gcgacccacc gaccaccggc gcgcagatcaccaccagcac cgccgtcgcc21301cgtgcgccaa catagttggc ccagtcatcc aatcgtgctgcagcccaacc gaatcggaga21361taacgcggcg agcggtagcc gatcatcgag tccagggtgttgatggcacg atatcccagc21421accgcaggca cgccgctcga agccgcccac agcagcggcaccacctgggc gtcggcggtg21481ttttcggcca ccgactccag cgcggcacgc gtcaggcccgggccgcccag ctgggccggg21541tcacgcccgc acagcgacgg cagcagccgt cgcgccgcctcgacatcgtc gcgctccaac21601aggtccgata tctggcggcc ggtgcgcgcc agcgaagttccgcccagcgc tgcccaggtg21661gccgtcgcgg tggccgccac gggccaggac ctgccgggtagccgctgcag tgccgcgccg21721agcaagccca ccgcgccgac cagcaggccg acgtgtaccgcaccggcgac ccggccgtca21781cggtaggtga tctgctccag cttggcggcc gcccgaccgaacagggccac cggatgacct21841cgtttggggt cgccgaacac gacgtcgagc aggcagccgatcagcacgcc gacggccctg21901gtctgccagg tcgatgcaaa cactccggca gcgtcgcacacgtggtctac gctcagctat21961ttatgacctc atacggcagc tatccacgat gaagcggccagctacccggg ttgccgacct22021gttgaacccg gcggcaatgt tgttgccggc agcgaatgtcatcatgcagc tggcagtgcc22081gggtgtcggg tatggcgtgc tggaaagccc ggtggacagcggcaacgtct acaagcatcc22141gttcaagcgg gcccggacca ccggcaccta cctggcggtggcgaccatcg ggacggaatc22201cgaccgagcg ctgatccggg gtgccgtgga cgtcgcgcaccggcaggttc ggtcgacggc22261ctcgagccca gtgtcctata acgccttcga cccgaagttgcagctgtggg tggcggcgtg22321tctgtaccgc tacttcgtgg accagcacga gtttctgtacggcccactcg aagatgccac22381cgccgacgcc gtctaccaag acgccaaacg gttagggaccacgctgcagg tgccggaggg22441gatgtggccg ccggaccggg tcgcgttcga cgagtactggaagcgctcgc ttgatgggct22501gcagatcgac gcgccggtgc gcgagcatct tcgcggggtggcctcggtag cgtttctccc22561gtggccgttg cgcgcggtgg ccgggccgtt caacctgtttgcgacgacgg gattcttggc22621accggagttc cgcgcgatga tgcagctgga gtggtcacaggcccagcagc gtcgcttcga22681gtggttactt tccgtgctac ggttagccga ccggctgattccgcatcggg cctggatctt22741cgtttaccag ctttacttgt gggacatgcg gtttcgcgcccgacacggcc gccgaatcgt22801ctgatagagc ccggccgagt gtgagcctga cagcccgacaccggcggcgt gtgtcgcgtc22861gccaggttca cgctcggcga tctagagccg ccgaaaacctacttctgggt tgcctcccga22921atcaacgtgc tgatctgctc gagcagctca cgcatatcggcgcgcatcgc atccaccgcg22981gcatacaggt cggccttggt cgccggcagc tggtccgacgtcattggccg caccggcggt23041gctgtctgtc gcgccgcgct gtcgctttga aacccaggtcgctcacccac gaccacgaca23101ctgccatatc cggcgccccg ccgacaacga agcacagctagccggtgggc gcggacggga23161tcgaaccgcc gaccgctggt gtgtaaaacc agagctctaccgctgagcta cgcgcccatg23221accgccgcag gctacacgcc ttgcggccaa gcacccaaaaccttaggccg taagcgccgc23281cagagcgtcg gtccacagcc gctgatcgcg aacttcacccggctgcttca tctcggcgaa23341ccgaatgatc cctgaccgat cgaccacaaa ggtgccccggttagcgatgc cggcctgctc23401gttgaagacg ccgtaggcct gactgaccgc gccgtgtggccagaagtccg acaacagcgg23461aaacgtgaat ccgctctgcg tcgcccagat cttgtgagtgggtggcgggc ccaccgaaat23521cgccagcgcg gcgctgtcgt cgttctcaaa ctcgggcaggtgatcacgca actggtccag23581ctcgccctgg cagatgcccg tgaacgccaa cggaaagaacaccaacagca cgttctttgc23641accccggtag ccgcgcaggg tgacaagctg ctgattctggtcgcgcaacg tgaagtcagg23701ggcggtggct ccgacgttca gcatcagcgc ttgccagcccgcgatttcgg ctgtaccaat23761ctgctggcgc tccagttgcc cagattgacc gacgaggtcggcatcagccc agctgtgggc23821gccgcctcgg caatctcggc gggcaataca tggccgggctggccggtctt gggcgtcacc23881acccaaatca caccgtcctc ggcgagcggg ccgatcgcatccatcagggt gtccaccaaa23941tcgccgtcgc catcacgcca ccacaacagg acgacatcgatgacctcgtc ggtgtcttca24001tcgagcaact ctcccccgca cgcttcttcg atggccgcgcggatgtcgtc gtcggtgtct24061tcgtcccagc cccattcctg gataagttgg tctcgttggatgcccaattt gcgggcgtag24121ttcgaggcgt gatccgccgc gaccaccgtg gaacctccttcagtctccgc gggccatgtg24181cacaccgtcg cgatgggcat tatcgtcgca cagccagaaccggtccaccc gcccgcctca24241gaaggcggcc acgcacattg tcaatgcctt tgtcttggtgtcgttgagcc gatcaacccg24301ccggttgaat tccgctgtcg acgcgtgcgc accgatggcatttgccaccg cgcgggccgc24361gtcgacatat gcgttgagcg catcccccag ttgcgcggacagcgcggcgc tcagactgcc24421tgagaccgtc gaggcactgt tgttgagcgc gtcgatggccggaccttcgg tcggcccggt24481gttgcggccc tgattgaacg cggccacgta ggcgttcaccttgtcgatgg cgtccttgct24541ggtggccgcc agcgcgtcac acgaggtgcg aatcgccttggtcgtcagcg attgttggcg24601ctgcgactcc cggatgctcg acgtcgccgc cgaagccgacaccgacgcgg acaccgacga24661gcggtaggcc ggtgcgacgt tggtgtcggg catggccgtaccgtcggtga cagtggtaca24721tccgacgatc cccatcagca gcagcgcgat gcagccgagcgccagggcgc ctcgcctggg24781gagctccccc ccgtgcctgc gaggcacggc gcgccatccgatgagcacgg catgtgaggt24841tacctggtcg cagcgcgacc gcgctggccg tggtgtgtcgcgcatccgca gaaccgagcg24901gagtgcggct atccgccgcc gacgccggtg cggcacgatagggggacgac catctaaaca24961gcacgcaagc ggaagcccgc cacctacagg agtagtgcgttgaccaccga tttcgcccgc25021cacgatctgg cccaaaactc aaacagcgca agcgaacccgaccgagttcg ggtgatccgc25081gagggtgtgg cgtcgtattt gcccgacatt gatcccgaggagacctcgga gtggctggag25141tcctttgaca cgctgctgca acgctgcggc ccgtcgcgggcccgctacct gatgttgcgg25201ctgctagagc gggccggcga gcagcgggtg gccatcccggcattgacgtc taccgactat25261gtcaacacca tcccgaccga gctggagccg tggttccccggcgacgaaga cgtcgaacgt25321cgttatcgag cgtggatcag atggaatgcg gccatcatggtgcaccgtgc gcaacgaccg25381ggtgtgggcg tgggtggcca tatctcgacc tacgcgtcgtccgcggcgct ctatgaggtc25441ggtttcaacc acttcttccg cggcaagtcg cacccgggcggcggcgatca ggtgttcatc25501cagggccacg cttccccggg aatctacgcg cgcgccttcctcgaagggcg gttgaccgcc25561gagcaactcg acggattccg ccaggaacac agccatgtcggcggcgggtt gccgtcctat25621ccgcacccgc ggctcatgcc cgacttctgg gaattccccaccgtgtcgat gggtttgggc25681ccgctcaacg ccatctacca ggcacggttc aaccactatctgcatgaccg cggtatcaaa25741gacacctccg atcaacacgt gtggtgtttt ttgggcgacggcgagatgga cgaacccgag25801agccgtgggc tggcccacgt cggcgcgctg gaaggcttggacaacttgac cttcgtgatc25861aactgcaatc tgcagcgact cgacggcccg gtgcgcggcaacggcaagat catccaggag25921ctggagtcgt tcttccgcgg tgccggctgg aacgtcatcaaggtggtgtg gggccgcgaa25981tgggatgccc tgctgcacgc cgaccgcgac ggtgcgctggtgaatttaat gaatacaaca26041cccgatggcg attaccagac ctataaggcc aacgacggcggctacgtgcg tgaccacttc26101ttcggccgcg acccacgcac caaggcgctg gtggagaacatgagcgacca ggatatctgg26161aacctcaaac ggggcggcca cgattaccgc aaggtttacgccgcctaccg cgccgccgtc26221gaccacaagg gacagccgac ggtgatcctg gccaagaccatcaaaggcta cgcgctgggc26281aagcatttcg aaggacgcaa tgccacccac cagatgaaaaaactgaccct ggaagacctt26341aaggagtttc gtgacacgca gcggattccg gtcagcgacgcccagcttga agagaatccg26401tacctgccgc cctactacca ccccggcctc aacgccccggagattcgtta catgctcgac26461cggcgccggg ccctcggggg ctttgttccc gagcgcaggaccaagtccaa agcgctgacc26521ctgccgggtc gcgacatcta cgcgccgctg aaaaagggctctgggcacca ggaggtggcc26581accaccatgg cgacggtgcg cacgttcaaa gaagtgttgcgcgacaagca gatcgggccg26641cggatagtcc cgatcattcc cgacgaggcc cgcaccttcgggatggactc ctggttcccg26701tcgctaaaga tctataaccg caatggccag ctgtataccgcggttgacgc cgacctgatg26761ctggcctaca aggagagcga agtcgggcag atcctgcacgagggcatcaa cgaagccggg26821tcggtgggct cgttcatcgc ggccggcacc tcgtatgcgacgcacaacga accgatgatc26881cccatttaca tcttctactc gatgttcggc ttccagcgcaccggcgatag cttctgggcc26941gcggccgacc agatggctcg agggttcgtg ctcggggccaccgccgggcg caccaccctg27001accggtgagg gcctgcaaca cgccgacggt cactcgttgctgctggccgc caccaacccg27061gcggtggttg cctacgaccc ggccttcgcc tacgaaatcgcctacatcgt ggaaagcgga27121ctggccagga tgtgcgggga gaacccggag aacatcttcttctacatcac cgtctacaac27181gagccgtacg tgcagccgcc ggagccggag aacttcgatcccgagggcgt gctgcggggt27241atctaccgct atcacgcggc caccgagcaa cgcaccaacaaggcgcagat cctggcctcc27301ggggtagcga tgcccgcggc gctgcgggca gcacagatgctggccgccga gtgggatgtc27361gccgccgacg tgtggtcggt gaccagttgg ggcgagctaaaccgcgacgg ggtggccatc27421gagaccgaga agctccgcca ccccgatcgg ccggcgggcgtgccctacgt gacgagagcg27481ctggagaatg ctcggggccc ggtgatcgcg gtgtcggactggatgcgcgc ggtccccgag27541cagatccgac cgtgggtgcc gggcacatac ctcacgttgggcaccgacgg gttcggcttt27601tccgacactc ggcccgccgc tcgccgctac ttcaacaccgacgccgaatc ccaggtggtc27661gcggttttgg aggcgttggc gggcgacggc gagatcgacccatcggtgcc ggtcgcggcc27721gcccgccagt accggatcga cgacgtggcg gctgcgcccgagcagaccac ggatcccggt27781cccggggcct aacgccggcg agccgaccgc ctttggccgaatcttccaga aatctggcgt27841agcttttagg agtgaacgac aatcagttgg ctccagttgcccgcccgagg tcgccgctcg27901aactgctgga cactgtgccc gattcgctgc tgcggcggttgaagcagtac tcgggccggc27961tggccaccga ggcagtttcg gccatgcaag aacggttgccgttcttcgcc gacctagaag28021cgtcccagcg cgccagcgtg gcgctggtgg tgcagacggccgtggtcaac ttcgtcgaat28081ggatgcacga cccgcacagt gacgtcggct ataccgcgcaggcattcgag ctggtgcccc28141aggatctgac gcgacggatc gcgctgcgcc agaccgtggacatggtgcgg gtcaccatgg28201agttcttcga agaagtcgtg cccctgctcg cccgttccgaagagcagttg accgccctca28261cggtgggcat tttgaaatac agccgcgacc tggcattcaccgccgccacg gcctacgccg28321atgcggccga ggcacgaggc acctgggaca gccggatggaggccagcgtg gtggacgcgg28381tggtacgcgg cgacaccggt cccgagctgc tgtcccgggcggccgcgctg aattgggaca28441ccaccgcgcc ggcgaccgta ctggtgggaa ctccggcgcccggtccaaat ggctccaaca28501gcgacggcga cagcgagcgg gccagccagg atgtccgcgacaccgcggct cgccacggcc28561gcgctgcgct gaccgacgtg cacggcacct ggctggtggcgatcgtctcc ggccagctgt28621cgccaaccga gaagttcctc aaagacctgc tggcagcattcgccgacgcc ccggtggtca28681tcggccccac ggcgcccatg ctgaccgcgg cgcaccgcagcgctagcgag gcgatctccg28741ggatgaacgc cgtcgccggc tggcgcggag cgccgcggcccgtgctggct agggaacttt28801tgcccgaacg cgccctgatg ggcgacgcct cggcgatcgtggccctgcat accgacgtga28861tgcggcccct agccgatgcc ggaccgacgc tcatcgagacgctagacgca tatctggatt28921gtggcggcgc gattgaagct tgtgccagaa agttgttcgttcatccaaac acagtgcggt28981accggctcaa gcggatcacc gacttcaccg ggcgcgatcccacccagcca cgcgatgcct29041atgtccttcg ggtggcggcc accgtgggtc aactcaactatccgacgccg cactgaagca29101tcgacagcaa tgccgtgtca tagattccct cgccggtcagagggggtcca gcaggggccc29161cggaaagata ccaggggcgc cgtcggacgg aaagtgatccagacaacagg tcgcgggacg29221atctcaaaaa catagcttac aggcccgttt tgttggttatatacaaaaac ctaagacgag29281gttcataatc tgttacaccg cgcaaaaccg tcttcacagtgttctcttag acacgtgatt29341gcgttgctcg cacccggaca gggttcgcaa accgagggaatgttgtcgcc gtggcttcag29401ctgcccggcg cagcggacca gatcgcggcg tggtcgaaagccgctgatct agatcttgcc29461cggctgggca ccaccgcctc gaccgaggag atcaccgacaccgcggtcgc ccagccattg29521atcgtcgccg cgactctgct ggcccaccag gaactggcgcgccgatgcgt gctcgccggc29581aaggacgtca tcgtggccgg ccactccgtc ggcgaaatcgcggcctacgc aatcgccggt29641gtgatagccg ccgacgacgc cgtcgcgctg gccgccacccgcggcgccga gatggccaag29701gcctgcgcca ccgagccgac cggcatgtct gcggtgctcggcggcgacga gaccgaggtg29761ctgagtcgcc tcgagcagct cgacttggtc ccggcaaaccgcaacgccgc cggccagatc29821gtcgctgccg gccggctgac cgcgttggag aagctcgccgaagacccgcc ggccaaggcg29881cgggtgcgtg cactgggtgt cgccggagcg ttccacaccgagttcatggc gcccgcactt29941gacggctttg cggcggccgc ggccaacatc gcaaccgccgaccccaccgc cacgctgctg30001tccaaccgcg acgggaagcc ggtgacatcc gcggccgcggcgatggacac cctggtctcc30061cagctcaccc aaccggtgcg atgggacctg tgcaccgcgacgctgcgcga acacacagtc30121acggcgatcg tggagttccc ccccgcgggc acgcttagcggtatcgccaa acgcgaactt30181cggggggttc cggcacgcgc cgtcaagtca cccgcagacctggacgagct ggcaaaccta30241taaccgcgga ctcggccaga acaaccacat acccgtcagttcgatttgta cacaacatat30301tacgaaggga agcatgctgt gcctgtcact caggaagaaatcattgccgg tatcgccgag30361atcatcgaag aggtaaccgg tatcgagccg tccgagatcaccccggagaa gtcgttcgtc30421gacgacctgg acatcgactc gctgtcgatg gtcgagatcgccgtgcagac cgaggacaag30481tacggcgtca agatccccga cgaggacctc gccggtctgcgtaccgtcgg tgacgttgtc30541gcctacatcc agaagctcga ggaagaaaac ccggaggcggctcaggcgtt gcgcgcgaag30601attgagtcgg agaaccccga tgccgttgcc aacgttcaggcgaggcttga ggccgagtcc30661aagtgagtca gccttccacc gctaatggcg gtttccccagcgttgtggtg accgccgtca30721cagcgacgac gtcgatctcg ccggacatcg agagcacgtggaagggtctg ttggccggcg30781agagcggcat ccacgcactc gaagacgagt tcgtcaccaagtgggatcta gcggtcaaga30841tcggcggtca cctcaaggat ccggtcgaca gccacatgggccgactcgac atgcgacgca30901tgtcgtacgt ccagcggatg ggcaagttgc tgggcggacagctatgggag tccgccggca30961gcccggaggt cgatccagac cggttcgccg ttgttgtcggcaccggtcta ggtggagccg31021agaggattgt cgagagctac gacctgatga atgcgggcggcccccggaag gtgtccccgc31081tggccgttca gatgatcatg cccaacggtg ccgcggcggtgatcggtctg cagcttgggg31141cccgcgccgg ggtgatgacc ccggtgtcgg cctgttcgtcgggctcggaa gcgatcgccc31201acgcgtggcg tcagatcgtg atgggcgacg ccgacgtcgccgtctgcggc ggtgtcgaag31261gacccatcga ggcgctgccc atcgcggcgt tctccatgatgcgggccatg tcgacccgca31321acgacgagcc tgagcgggcc tcccggccgt tcgacaaggaccgcgacggc tttgtgttcg31381gcgaggccgg tgcgctgatg ctcatcgaga cggaggagcacgccaaagcc cgtggcgcca31441agccgttggc ccgattgctg ggtgccggta tcacctcggacgcctttcat atggtggcgc31501ccgcggccga tggtgttcgt gccggtaggg cgatgactcgctcgctggag ctggccgggt31561tgtcgccggc ggacatcgac cacgtcaacg cgcacggcacggcgacgcct atcggcgacg31621ccgcggaggc caacgccatc cgcgtcgccg gttgtgatcaggccgcggtg tacgcgccga31681agtctgcgct gggccactcg atcggcgcgg tcggtgcgctcgagtcggtg ctcacggtgc31741tgacgctgcg cgacggcgtc atcccgccga ccctgaactacgagacaccc gatcccgaga31801tcgaccttga cgtcgtcgcc ggcgaaccgc gctatggcgattaccgctac gcagtcaaca31861actcgttcgg gttcggcggc cacaatgtgg cgcttgccttcgggcgttac tgaagcacga31921catcgcgggt cgcgaggccc gaggtggggg tccccccgcttgcgggggcg agtcggaccg31981atatggaagg aacgttcgca agaccaatga cggagctggttaccgggaaa gcctttccct32041acgtagtcgt caccggcatc gccatgacga ccgcgctcgcgaccgacgcg gagactacgt32101ggaagttgtt gctggaccgc caaagcggga tccgtacgctcgatgaccca ttcgtcgagg32161agttcgacct gccagttcgc atcggcggac atctgcttgaggaattcgac caccagctga32221cgcggatcga actgcgccgg atgggatacc tgcagcggatgtccaccgtg ctgagccggc32281gcctgtggga aaatgccggc tcacccgagg tggacaccaatcgattgatg gtgtccatcg32341gcaccggcct gggttcggcc gaggaactgg tcttcagttacgacgatatg cgcgctcgcg32401gaatgaaggc ggtctcgccg ctgaccgtgc agaagtacatgcccaacggg gccgccgcgg32461cggtcgggtt ggaacggcac gccaaggccg gggtgatgacgccggtatcg gcgtgcgcat32521ccggcgccga ggccatcgcc cgtgcgtggc agcagattgtgctgggagag gccgatgccg32581ccatctgcgg cggcgtggag accaggatcg aagcggtgcccatcgccggg ttcgctcaga32641tgcgcatcgt gatgtccacc aacaacgacg accccgccggtgcatgccgc ccattcgaca32701gggaccgcga cggctttgtg ttcggcgagg gcggcgcccttctgttgatc gagaccgagg32761agcacgccaa ggcacgtggc gccaacatcc tggcccggatcatgggcgcc agcatcacct32821ccgatggctt ccacatggtg gccccggacc ccaacggggaacgcgccggg catgcgatta32881cgcgggcgat tcagctggcg ggcctcgccc ccggcgacatcgaccacgtc aatgcgcacg32941ccaccggcac ccaggtcggc gacctggccg aaggcagggccatcaacaac gccttgggcg33001gcaaccgacc ggcggtgtac gcccccaagt ctgccctcggccactcggtg ggcgcggtcg33061gcgcggtcga atcgatcttg acggtgctcg cgttgcgcgatcaggtgatc ccgccgacac33121tgaatctggt aaacctcgat cccgagatcg atttggacgtggtggcgggt gaaccgcgac33181cgggcaatta ccggtatgcg atcaataact cgttcggattcggcggccac aacgtggcaa33241tcgccttcgg acggtactaa accccagcgt tacgcgacaggagacctgcg atgacaatca33301tggcccccga ggcggttggc gagtcgctcg acccccgcgatccgctgttg cggctgagca33361acttcttcga cgacggcagc gtggaattgc tgcacgagcgtgaccgctcc ggagtgctgg33421ccgcggcggg caccgtcaac ggtgtgcgca ccatcgcgttctgcaccgac ggcaccgtga33481tgggcggcgc catgggcgtc gaggggtgca cgcacatcgtcaacgcctac gacactgcca33541tcgaagacca gagtcccatc gtgggcatct ggcattcgggtggtgcccgg ctggctgaag33601gtgtgcgggc gctgcacgcg gtaggccagg tgttcgaagccatgatccgc gcgtccggct33661acatcccgca gatctcggtg gtcgtcggtt tcgccgccggcggcgccgcc tacggaccgg33721cgttgaccga cgtcgtcgtc atggcgccgg aaagccgggtgttcgtcacc gggcccgacg33781tggtgcgcag cgtcaccggc gaggacgtcg acatggcctcgctcggtggg ccggagaccc33841accacaagaa gtccggggtg tgccacatcg tcgccgacgacgaactcgat gcctacgacc33901gtgggcgccg gttggtcgga ttgttctgcc agcaggggcatttcgatcgc agcaaggccg33961aggccggtga caccgacatc cacgcgctgc tgccggaatcctcgcgacgt gcctacgacg34021tgcgtccgat cgtgacggcg atcctcgatg cggacacaccgttcgacgag ttccaggcca34081attgggcgcc gtcgatggtg gtcgggctgg gtcggctgtcgggtcgcacg gtgggtgtac34141tggccaacaa cccgctacgc ctgggcggct gcctgaactccgaaagcgca gagaaggcag34201cgcgtttcgt gcggctgtgc gacgcgttcg ggattccgctggtggtggtg gtcgatgtgc34261cgggctatct gcccggtgtc gaccaggagt ggggtggcgtggtgcgccgt ggcgccaagt34321tgctgcacgc gttcggcgag tgcaccgttc cgcgggtcacgctggtcacc cgaaagacct34381acggcggggc atacattgcg atgaactccc ggtcgttgaacgcgaccaag gtgttcgcct34441ggccggacgc cgaggtcgcg gtgatgggcg ctaaggcggccgtcggcatc ctgcacaaga34501agaagttggc cgccgctccg gagcacgaac gcgaagcgctgcacgaccag ttggccgccg34561agcatgagcg catcgccggc ggggtcgaca gtgcgctggacatcggtgtg gtcgacgaga34621agatcgaccc ggcgcatact cgcagcaagc tcaccgaggcgctggcgcag gctccggcac34681ggcgcggccg ccacaagaac atcccgctgt agttctgaccgcgagcagac gcagaatcgc34741acgcgcgagg tccgcgccgt gcgattctgc gtctgctcgccagttatccc cagcggtggc34801tggtcaacgc gaggcgctcc tcgcatgctc ggacggtgcctaccgacgcg ctaacaattc34861tcgagaaggc cggcgggttc gccaccaccg cgcaattgctcacggtcatg acccgccaac34921agctcgacgt ccaagtgaaa aacggcggcc tcgttcgcgtttggtacggg gtctacgcgg34981cacaagagcc ggacctgttg ggccgcttgg cggctctcgatgtgttcatg ggggggcacg35041ccgtcgcgtg tctgggcacc gccgccgcgt tgtatggattcgacacggaa aacaccgtcg35101ctatccatat gctcgatccc ggagtaagga tgcggcccacggtcggtctg atggtccacc35161aacgcgtcgg tgcccggctc caacgggtgt caggtcgtctcgcgaccgcg cccgcatgga35221ctgccgtgga ggtcgcacga cagttgcgcc gcccgcgggcgctggccacc ctcgacgccg35281cactacggtc aatgcgctgc gctcgcagtg aaattgaaaacgccgttgct gagcagcgag35341gccgccgagg catcgtcgcg gcgcgcgaac tcttacccttcgccgacgga cgcgcggaat35401cggccatgga gagcgaggct cggctcgtca tgatcgaccacgggctgccg ttgcccgaac35461ttcaataccc gatacacggc cacggtggtg aaatgtggcgagtcgacttc gcctggcccg35521acatgcgtct cgcggccgaa tacgaaagca tcgagtggcacgcgggaccg gcggagatgc35581tgcgcgacaa gacacgctgg gccaagctcc aagagctcgggtggacgatt gtcccgattg35641tcgtcgacga tgtcagacgc gaacccggcc gcctggcggcccgcatcgcc cgccacctcg35701accgcgcgcg tatggccggc tgaccgctgg tgagcagacgcagagtcgca ctgcggccgg35761cgcagtgcga ctctgcgtct gctcgcgctc aacggctgaggaactcctta gccacggcga35821ctacgcgctc gcgatcccgt ggcaccagac cgatccgggtccggcggtcg aggatatcgt35881ccacatccag cgccccctca tgggtcaccg cgtattcgaactccgcccgg gtcacgtcga35941tgccgtcggc gaccggctcg gtgggccgct cacatgtggcggcggcagcg acgttggccg36001cctcggcccc gtaccgcgcc accagcgact cgggcaatccggcgcccgat ccgggggccg36061gcccagggtt cgccggtgcg ccgatcagcg gcaggttgcgagtgcggcac ttcgcggctc36121gcaggtgtcg cagcgtgatg gcgcgattca gcacatcctctgccatgtag cggtattccg36181tcagcttgcc gccgaccaca ctgatcacgc ccgacggcgattcaaaaaca gcgtggtcac36241gcgaaacgtc ggcggtgcgg ccctggacac cagcaccgccggtgtcgatt agcggccgca36301atcccgcata ggcaccgatg acatccttgg tgccgaccgccgtccccaat gcggtgttca36361ccgtatccag caggaacgtg atctcttccg aagacggttgtggcacatcg ggaatcgggc36421cgggtgcgtc ttcgtcggtc agcccgagat agatccggcccagctgctcg ggcatggcga36481acacgaagcg gttcagctca ccggggatcg gaatggtcagcgcggcagtc ggattggcaa36541acgacttcgc gtcgaagacc agatgtgtgc cgcggctggggcgtagcctc agggacgggt36601cgatctcacc cgcccacacg cccgccgcgt tgatgacggcacgcgccgac agcgcgaacg36661actgccgggt gcgccggtcg gtcaactcca ccgaagtgccggtgacattc gacgcgccca36721cgtaagtgag gatgcgggcg ccgtgctggg ccgcggtgcgcgcgacggcc atgaccagcc36781gggcgtcgtc gatcaattgc ccgtcgtacg cgagcagaccaccgtcgagg ccgtcccgcc36841gaacggtggg agcaatctcc accacccgtg acgccgggattcggcgcgat cggggcaacg36901tcgccgccgg cgtacccgct agcacccgca aagcgtcgccggccaggaaa ccggcacgca36961ccaacgcccg cttggtgtga cccatcgacg gcaacaacgggaccagttgc ggcatggcat37021gcacgagatg aggagcgttg cgtgtcatca ggattccgcgttcgacggcg ctgcgccggg37081cgatgcccac gttgccgctg gccagatagc gcagaccgccgtgcaccaac ttcgagctcc37141agcggctggt gccgaacgcc agatcatgct tttccaccaaggccaccgtc agaccgcggg37201tggcagcatc taaggcaatg ccaacaccgg taatgccgccgcctatcacg atgacgtcga37261gtgcgccacc gtcggccagt gcggtcaggt cggcggagcgacgcgccgcg ttgagtgcag37321ccgagtgggg catcagcaca aatatccgtt cagtgcgtgggtaagttcgg tggccagcgc37381ggcggaatcg aggatcgaat cgacgatgtc cgcggactggatggtcgact gggcgatcag37441caacaccatg gtcgccagtc gacgagcgtc gccggagcgcacactgcccg accgctgcgc37501cactgtcagc cgggcggcca acccctcgat caggacctgctggctggtgc cgaggcgctc37561ggtgatgtac accctggcca gctccgagtg catgaccgacatgatcagat cgtcaccccg37621caaccggtcg gccaccgcga caatctgctt taccaacgcttcccggtcgt ccccgtcgag37681gggcacctcc cgcagcacgt cggcgatatg gctggtcagcatggacgcca tgatcgaccg37741ggtgtccggc cagcgacggt atacggtcgg gcggctcacgcccgcgcgcc gggcgatctc37801ggcaagtgtc acccggtcca cgccgtaatc gacgacgcagctcgccgctg cccgcaggat37861acgaccaccg gtatccgcgc ggtcattact cattgacagcatgtgtaata ctgtaacgcg37921tgactcaccg cgaggaactc cttccaccga tgaaatgggacgcgtgggga gatcccgccg37981cggccaagcc actttctgat ggcgtccggt cgttgctgaagcaggttgtg ggcctagcgg38041actcggagca gcccgaactc gaccccgcgc aggtgcagctgcgcccgtcc gccctgtcgg38101gggcagacca


5.9. X-linked Inhibitor of Apoptosis Protein (“XIAP”)

GenBank Accession # U45880:

(SEQ ID NO: 25)1gaaaaggtgg acaagtccta ttttcaagag aagatgacttttaacagttt tgaaggatct61aaaacttgtg tacctgcaga catcaataag gaagaagaatttgtagaaga gtttaataga121ttaaaaactt ttgctaattt tccaagtggt agtcctgtttcagcatcaac actggcacga181gcagggtttc tttatactgg tgaaggagat accgtgcggtgctttagttg tcatgcagct241gtagatagat ggcaatatgg agactcagca gttggaagacacaggaaagt atccccaaat301tgcagattta tcaacggctt ttatcttgaa aatagtgccacgcagtctac aaattctggt361atccagaatg gtcagtacaa agttgaaaac tatctgggaagcagagatca ttttgcctta421gacaggccat ctgagacaca tgcagactat cttttgagaactgggcaggt tgtagatata481tcagacacca tatacccgag gaaccctgcc atgtattgtgaagaagctag attaaagtcc541tttcagaact ggccagacta tgctcaccta accccaagagagttagcaag tgctggactc601tactacacag gtattggtga ccaagtgcag tgcttttgttgtggtggaaa actgaaaaat661tgggaacctt gtgatcgtgc ctggtcagaa cacaggcgacactttcctaa ttgcttcttt721gttttgggcc ggaatcttaa tattcgaagt gaatctgatgctgtgagttc tgataggaat781ttcccaaatt caacaaatct tccaagaaat ccatccatggcagattatga agcacggatc841tttacttttg ggacatggat atactcagtt aacaaggagcagcttgcaag agctggattt901tatgctttag gtgaaggtga taaagtaaag tgctttcactgtggaggagg gctaactgat961tggaagccca gtgaagaccc ttgggaacaa catgctaaatggtatccagg gtgcaaatat1021ctgttagaac agaagggaca agaatatata aacaatattcatttaactca ttcacttgag1081gagtgtctgg taagaactac tgagaaaaca ccatcactaactagaagaat tgatgatacc1141atcttccaaa atcctatggt acaagaagct atacgaatggggttcagttt caaggacatt1201aagaaaataa tggaggaaaa aattcagata tctgggagcaactataaatc acttgaggtt1261ctggttgcag atctagtgaa tgctcagaaa gacagtatgcaagatgagtc aagtcagact1321tcattacaga aagagattag tactgaagag cagctaaggcgcctgcaaga ggagaagctt1381tgcaaaatct gtatggatag aaatattgct atcgtttttgttccttgtgg acatctagtc1441acttgtaaac aatgtgctga agcagttgac aagtgtcccatgtgctacac agtcattact1501ttcaagcaaa aaatttttat gtcttaatct aactctatagtaggcatgtt atgttgttct1561tattaccctg attgaatgtg tgatgtgaac tgactttaagtaatcaggat tgaattccat1621tagcatttgc taccaagtag gaaaaaaaat gtacatggcagtgttttagt tggcaatata1681atctttgaat ttcttgattt ttcagggtat tagctgtattatccattttt tttactgtta1741tttaattgaa accatagact aagaataaga agcatcatactataactgaa cacaatgtgt1801attcatagta tactgattta atttctaagt gtaagtgaattaatcatctg gattttttat1861tcttttcaga taggcttaac aaatggagct ttctgtatataaatgtggag attagagtta1921atctccccaa tcacataatt tgttttgtgt gaaaaaggaataaattgttc catgctggtg1981gaaagataga gattgttttt agaggttggt tgttgtgttttaggattctg tccattttct2041tgtaaaggga taaacacgga cgtgtgcgaa atatgtttgtaaagtgattt gccattgttg2101aaagcgtatt taatgataga atactatcga gccaacatgtactgacatgg aaagatgtca2161gagatatgtt aagtgtaaaa tgcaagtggc gggacactatgtatagtctg agccagatca2221aagtatgtat gttgttaata tgcatagaac gagagatttggaaagatata caccaaactg2281ttaaatgtgg tttctcttcg gggagggggg gattgggggaggggccccag aggggtttta2341gaggggcctt ttcactttcg acttttttca ttttgttctgttcggatttt ttataagtat2401gtagaccccg aagggtttta tgggaactaa catcagtaacctaacccccg tgactatcct2461gtgctcttcc tagggagctg tgttgtttcc cacccaccacccttccctct gaacaaatgc2521ctgagtgctg gggcactttg


General Target Region:


Internal Ribosome Entry Site (IRES) in 5′ untranslated region:

(SEQ ID NO: 26)5′AGCUCCUAUAACAAAAGUCUGUUGCUUGUGUUUCACAUUUUGGAUUUCCUAAUAUAAUGUUCUCUUUUUAGAAAAGGUGGACAAGUCCUAUUUUCAAGAGAAG3′


Initial Specific Target Motif:


RNP core binding site within XIAP IRES

5′GGAUUUCCUAAUAUAAUGUUCUCUUUUU3′(SEQ ID NO: 27)


5.10. Survivin

GenBank Accession # NM001168:

(SEQ ID NO: 28)1ccgccagatt tgaatcgcgg gacccgttgg cagaggtggcggcggcggca tgggtgcccc61gacgttgccc cctgcctggc agccctttct caaggaccaccgcatctcta cattcaagaa121ctggcccttc ttggagggct gcgcctgcac cccggagcggatggccgagg ctggcttcat181ccactgcccc actgagaacg agccagactt ggcccagtgtttcttctgct tcaaggagct241ggaaggctgg gagccagatg acgaccccat agaggaacataaaaagcatt cgtccggttg301cgctttcctt tctgtcaaga agcagtttga agaattaacccttggtgaat ttttgaaact361ggacagagaa agagccaaga acaaaattgc aaaggaaaccaacaataaga agaaagaatt421tgaggaaact gcgaagaaag tgcgccgtgc catcgagcagctggctgcca tggattgagg481cctctggccg gagctgcctg gtcccagagt ggctgcaccacttccagggt ttattccctg541gtgccaccag ccttcctgtg ggccccttag caatgtcttaggaaaggaga tcaacatttt601caaattagat gtttcaactg tgctcctgtt ttgtcttgaaagtggcacca gaggtgcttc661tgcctgtgca gcgggtgctg ctggtaacag tggctgcttctctctctctc tctctttttt721gggggctcat ttttgctgtt ttgattcccg ggcttaccaggtgagaagtg agggaggaag781aaggcagtgt cccttttgct agagctgaca gctttgttcgcgtgggcaga gccttccaca841gtgaatgtgt ctggacctca tgttgttgag gctgtcacagtcctgagtgt ggacttggca901ggtgcctgtt gaatctgagc tgcaggttcc ttatctgtcacacctgtgcc tcctcagagg961acagtttttt tgttgttgtg tttttttgtt ttttttttttggtagatgca tgacttgtgt1021gtgatgagag aatggagaca gagtccctgg ctcctctactgtttaacaac atggctttct1081tattttgttt gaattgttaa ttcacagaat agcacaaactacaattaaaa ctaagcacaa1141agccattcta agtcattggg gaaacggggt gaacttcaggtggatgagga gacagaatag1201agtgatagga agcgtctggc agatactcct tttgccactgctgtgtgatt agacaggccc1261agtgagccgc ggggcacatg ctggccgctc ctccctcagaaaaaggcagt ggcctaaatc1321ctttttaaat gacttggctc gatgctgtgg gggactggctgggctgctgc aggccgtgtg1381tctgtcagcc caaccttcac atctgtcacg ttctccacacgggggagaga cgcagtccgc1441ccaggtcccc gctttctttg gaggcagcag ctcccgcagggctgaagtct ggcgtaagat1501gatggatttg attcgccctc ctccctgtca tagagctgcagggtggattg ttacagcttc1561gctggaaacc tctggaggtc atctcggctg ttcctgagaaataaaaagcc tgtcatttc


The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described will become apparent to those skilled in the art from the foregoing description and accompanying figures. Such modifications are intended to fall within the scope of the appended claims.


Various publications are cited herein, the disclosures of which are incorporated by reference in their entireties.

Claims
  • 1. A method for identifying a test compound that binds to a target RNA molecule, comprising the steps of: (a) contacting a detectably labeled target RNA molecule with a library of solid support-attached test compounds under conditions that permit direct binding of the labeled target RNA to a member of the library of solid support-attached test compounds so that a detectably labeled target RNA:support-attached test compound complex is formed; (b) separating the detectably labeled target RNA:support-attached test compound complex formed in step (a) from uncomplexed target RNA molecules and test compounds; and (c) determining a structure of the test compound of the RNA support-attached test compound complex.
  • 2. The method of claim 1 in which the target RNA molecule contains an TAR element, internal ribosome entry site, “slippery site”, instability element, or ylate uridylate-rich element.
  • 3. The method of claim 1 in which the RNA molecule is an element ed from the mRNA for tumor necrosis factor alpha (“TNF-α), granulocyte- ophage colony stimulating factor (“GM-CSF”), interleukin 2 (“IL-2”), interleukin 6 -6”), vascular endothelial growth factor (“VEGF”), human immunodeficiency virus I V-1”), hepatitis C virus (“HCV”—genotypes 1a & 1b), ribonuclease P RNA aseP”), X-linked inhibitor of apoptosis protein (“XIAP”), or survivin.
  • 4. The method of claim 1 in which the detectably labeled RNA is ed with a fluorescent dye, phosphorescent dye, ultraviolet dye, infrared dye, visible radiolabel, enzyme, spectroscopic colorimetric label, affinity tag, or nanoparticle.
  • 5. The method of claim 1 in which the test compound is selected from a binatorial library of solid support-attached test compounds comprising peptoids; om bio-oligomers; diversomers such as hydantoins, benzodiazepines and dipeptides; gous polypeptides; nonpeptidal peptidominetics; oligocarbamates; peptidyl honates; peptide nucleic acid libraries; antibody libraries; carbohydrate libraries; and organic molecule libraries.
  • 6. The method of claim 5 in which the small organic molecule libraries braries of benzodiazepines, isoprenoids, thiazolidinones, metathiazanones, lidines, morpholino compounds, or diazepindiones.
  • 7. The method of claim 1 in which screening a library of scid support- ed test compounds comprises contacting the test compound with the target nucleic n the presence of an aqueous solution wherein the aqueous solution comprises a buffer combination of salts.
  • 8. The method of claim 7 wherein the aqueous solution approximates or cs physiologic conditions.
  • 9. The method of claim 7 in which the aqueous solution optionally er comprises non-specific nucleic acids comprising DNA, yeast tRNA, salmon sperm , homoribopolymers, and nonspecific RNAs.
  • 10. The method of claim 7 in which the aqueous solution further rises a buffer, a combination of salts, and optionally, a detergent or a surfactant.
  • 11. The method of claim 10 in which the aqueous solution further rises a combination of salts, from about 0 mM to about 100 mM KCl, from about 0o about 1 M NaCl, and from about 0 mM to about 200 mM MgCl2.
  • 12. The method of claim 11 wherein the combination of salts is about nM KCl, 500 mM NaCl, and 10 mM MgCl2.
  • 13. The method of claim 10 wherein the solution optionally comprises about 0.01% to about 0.5% (w/v) of a detergent or a surfactant.
  • 14. The method of claim 1 in which separating the detectably labeled RNA:support-attached test compound complex formed in step (a) from uncomplexed RNA and test compounds is by flow cytometry, affinity chromatography, manual mode separation, suspension of beads in electric fields, or microwave.
  • 15. The method of claim 1 in which the library of solid support-attached mpounds are small organic molecule libraries.
  • 16. The method of claim 15 in which the structure of the test compound rmined by mass spectroscopy, NMR, or vibration spectroscopy.
  • 17. The method of claim 1 in which the library of solid support-attached mpounds are peptide or peptide-based libraries.
  • 18. The method of claim 17 in which the structure of the test compound rmined by Edman degradation.
Parent Case Info

This application claims the benefit of U.S. Provisional Application No. 60/282,966, filed Apr. 11, 2001, which is incorporated herein by reference in its entirety.

PCT Information
Filing Document Filing Date Country Kind
PCT/US02/11758 4/11/2002 WO
Provisional Applications (1)
Number Date Country
60282966 Apr 2001 US