Methods for identifying small molecules that bind specific rna structural motifs

Abstract

The present invention relates to a method for screening and identifying test compounds that bind to a preselected target ribonucleic acid (“RNA”). Direct, non-competitive binding assays are advantageously used to screen libraries of compounds for those that selectively bind to a preselected target RNA. Binding of target RNA molecules to a particular test compound is detected using any physical method that measures the altered physical property of the target RNA bound to a test compound. The structure of the test compound attached to the labeled RNA is also determined. The methods used will depend, in part, on the nature of the library screened. The methods of the present invention provide a simple, sensitive assay for high-throughput screening of libraries of compounds to identify pharmaceutical leads.

Description

1. INTRODUCTION

[0002] The present invention relates to a method for screening and identifying test compounds that bind to a preselected target ribonucleic acid (“RNA”). Direct, non-competitive binding assays are advantageously used to screen libraries of compounds for those that selectively bind to a preselected target RNA. Binding of target RNA molecules to a particular test compound is detected using any physical method that measures the altered physical property of the target RNA bound to a test compound. The methods of the present invention provide a simple, sensitive assay for high-throughput screening of libraries of compounds to identify pharmaceutical leads.

2. BACKGROUND OF THE INVENTION

[0003] Protein-nucleic acid interactions are involved in many cellular functions, including transcription, RNA splicing, mRNA decay, and mRNA translation. Readily accessible synthetic molecules that can bind with high affinity to specific sequences of single- or double-stranded nucleic acids have the potential to interfere with these interactions in a controllable way, making them attractive tools for molecular biology and medicine. Successful approaches for blocking function of target nucleic acids include using duplex-forming antisense oligonucleotides (Miller, 1996, Progress in Nucl. Acid Res. & Mol. Biol. 52:261-291; Ojwang & Rando, 1999, Achieving antisense inhibition by oligodeoxynucleotides containing N7 modified 2′-deoxyguanosine using tumor necrosis factor receptor type 1, METHODS: A Companion to Methods in Enzymology 18:244-251) and peptide nucleic acids (“PNA”) (Nielsen, 1999, Current Opinion in Biotechnology 10:71-75), which bind to nucleic acids via Watson-Crick base-pairing. Triplex-forming anti-gene oligonucleotides can also be designed (Ping et al., 1997, RNA 3:850-860; Aggarwal et al., 1996, Cancer Res. 56:5156-5164; U.S. Pat. No. 5,650,316), as well as pyrrole-imidazole polyamide oligomers (Gottesfeld et al., 1997, Nature 387:202-205; White et al., 1998, Nature 391:468-471), which are specific for the major and minor grooves of a double helix, respectively.

[0004] In addition to synthetic nucleic acids (i.e., antisense, ribozymes, and triplex-forming molecules), there are examples of natural products that interfere with deoxyribonucleic acid (“DNA”) or RNA processes such as transcription or translation. For example, certain carbohydrate-based host cell factors, calicheamicin oligosaccharides, interfere with the sequence-specific binding of transcription factors to DNA and inhibit transcription in vivo (Ho et al., 1994, Proc. Natl. Acad. Sci. USA 91:9203-9207; Liu et al., 1996, Proc. Natl. Acad. Sci. USA 93:940-944). Certain classes of known antibiotics have been characterized and were found to interact with RNA. For example, the antibiotic thiostreptone binds tightly to a 60-mer from ribosomal RNA (Cundliffe et al., 1990, in The Ribosome: Structure, Function & Evolution (Schlessinger et al, eds.) American Society for Microbiology, Washington, D.C. pp. 479-490). Bacterial resistance to various antibiotics often involves methylation at specific rRNA sites (Cundliffe, 1989, Ann. Rev. Microbiol. 43:207-233). Aminoglycosidic aminocyclitol (aminoglycoside) antibiotics and peptide antibiotics are known to inhibit group I intron splicing by binding to specific regions of the RNA (von Ahsen et al., 1991, Nature (London) 353:368-370). Some of these same aminoglycosides have also been found to inhibit hammerhead ribozyme finction (Stage et al., 1995, RNA 1:95-101). In addition, certain aminoglycosides and other protein synthesis inhibitors have been found to interact with specific bases in 16S rRNA (Woodcock et al., 1991, EMBO J. 10:3099-3103). An oligonucleotide analog of the 16S rRNA has also been shown to interact with certain aminoglycosides (Purohit et al., 1994, Nature 370:659-662). A molecular basis for hypersensitivity to aminoglycosides has been found to be located in a single base change in mitochondrial rRNA (Hutchin et al., 1993, Nucleic Acids Res. 21:4174-4179). Aninoglycosides have also been shown to inhibit the interaction between specific structural RNA motifs and the corresponding RNA binding protein. Zapp et al. (Cell, 1993, 74:969-978) has demonstrated that the aminoglycosides neomycin B, lividomycin A, and tobramycin can block the binding of Rev, a viral regulatory protein required for viral gene expression, to its viral recognition element in the IIB (or RRE) region of HIV RNA. This blockage appears to be the result of competitive binding of the antibiotics directly to the RRE RNA structural motif.

[0005] Single stranded sections of RNA can fold into complex tertiary structures consisting of local motifs such as loops, bulges, pseudoknots, guanosine quartets and turns (Chastain & Tinoco, 1991, Progress in Nucleic Acid Res. & Mol. Biol. 41:131-177; Chow & Bogdan, 1997, Chemical Reviews 97:1489-1514; Rando & Hogan, 1998, Biologic activity of guanosine quartet forming oligonucleotides in “Applied Antisense Oligonucleotide Technology” Stein. & Krieg (eds) John Wiley and Sons, New York, pages 335-352). Such structures can be critical to the activity of the nucleic acid and affect functions such as regulation of mRNA transcription, stability, or translation (Weeks & Crothers, 1993, Science 261:1574-1577). The dependence of these functions on the native three-dimensional structural motifs of single-stranded stretches of nucleic acids makes it difficult to identify or design synthetic agents that bind to these motifs using general, simple-to-use sequence-specific recognition rules for the formation of double- and triple-helical nucleic acids used in the design of antisense and ribozyme type molecules. Approaches to screening generally involve competitive assays designed to identify compounds that disrupt the interaction between a target RNA and a physiological, host cell factor(s) that had been previously identified to specifically interact with that particular target RNA. In general, such assays require the identification and characterization of the host cell factor(s) deemed to be required for the function of the target RNA. Both the target RNA and its preselected host cell binding partner are used in a competitive format to identify compounds that disrupt or interfere with the two components in the assay.

[0006] Citation or identification of any reference in Section 2 of this application is not an admission that such reference is available as prior art to the present invention.

3. SUMMARY OF THE INVENTION

[0007] The present invention relates to methods for identifying compounds that bind to preselected target elements of nucleic acids including, but not limited to, specific RNA sequences, RNA structural motifs, and/or RNA structural elements. The specific target RNA sequences, RNA structural motifs, and/or RNA structural elements are used as targets for screening small molecules and identifying those that directly bind these specific sequences, motifs, and/or structural elements. For example, methods are described in which a preselected target RNA having a detectable label is used to screen a library of test compounds, preferably under physiologic conditions. Any complexes formed between the target RNA and a member of the library are identified using physical methods that detect the altered physical property of the target RNA bound to a test compound. In particular, the present invention relates to methods for using a target RNA having a detectable label to screen a library of test compounds free in solution, in labeled tubes or microtiter plate, or in a microarray. Compounds in the library that bind to the labeled target RNA will form a detectably labeled complex. The detectably labeled complex can then be identified and removed from the uncomplexed, unlabeled test compounds in the library, and from uncomplexed, labeled target RNA, by a variety of methods, including but not limited to, methods that differentiate changes in the electrophoretic, chromatographic, or thermostable properties of the complexed target RNA. Such methods include, but are not limited to, electrophoresis, fluorescence spectroscopy, surface plasmon resonance, mass spectrometry, scintillation, proximity assay, structure-activity relationships (“SAR”) by NMR spectroscopy, size exclusion chromatography, affinity chromatography, and nanoparticle aggregation. The structure of the test compound attached to the labeled RNA is then determined. The methods used will depend, in part, on the nature of the library screened. For example, assays or microarrays of test compounds, each having an address or identifier, may be deconvoluted, e.g., by cross-referencing the positive sample to original compound list that was applied to the individual test assays. Another method for identifying test compounds includes de novo structure determination of the test compounds using mass spectrometry or nuclear magnetic resonance (“NMR”). The test compounds identified are useful for any purpose to which a binding reaction may be put, for example in assay methods, diagnostic procedures, cell sorting, as inhibitors of target molecule function, as probes, as sequestering agents and the like. In addition, small organic molecules which interact specifically with target RNA molecules may be useful as lead compounds for the development of therapeutic agents.

[0008] The methods described herein for the identification of compounds that directly bind to a particular preselected target RNA are well suited for high-throughput screening. The direct binding method of the invention offers advantages over drug screening systems for competitors that inhibit the formation of naturally-occurring RNA binding protein:target RNA complexes; i.e., competitive assays. The direct binding method of the invention is rapid and can be set up to be readily performed, e.g., by a technician, making it amenable to high throughput screening. The method of the invention also eliminates the bias inherent in the competitive drug screening systems, which require the use of a preselected host cell factor that may not have physiological relevance to the activity of the target RNA. Instead, the methods of the invention are used to identify any compound that can directly bind to specific target RNA sequences, RNA structural motifs, and/or RNA structural elements, preferably under physiologic conditions. As a result, the compounds so identified can inhibit the interaction of the target RNA with any one or more of the native host cell factors (whether known or unknown) required for activity of the RNA in vivo.

[0009] The present invention may be understood more fully by reference to the detailed description and examples, which are intended to illustrate non-limiting embodiments of the invention.

3.1. Definitions

[0010] As used herein, a “target nucleic acid” refers to RNA, DNA, or a chemically modified variant thereof. In a preferred embodiment, the target nucleic acid is RNA. A target nucleic acid also refers to tertiary structures of the nucleic acids, such as, but not limited to loops, bulges, pseudoknots, guanosine quartets and turns. A target nucleic acid also refers to RNA elements such as, but not limited to, the HIV TAR element, internal ribosome entry site, “slippery site”, instability elements, and adenylate uridylate-rich elements, which are described in Section 5.1. Non-limiting examples of target nucleic acids are presented in Section 5.1 and Section 6.

[0011] As used herein, a “library” refers to a plurality of test compounds with which a target nucleic acid molecule is contacted. A library can be a combinatorial library, e.g., a collection of test compounds synthesized using combinatorial chemistry techniques, or a collection of unique chemicals of low molecular weight (less than 1000 daltons) that each occupy a unique three-dimensional space.

[0012] As used herein, a “label” or “detectable label” is a composition that is detectable, either directly or indirectly, by spectroscopic, photochemical, biochem cal, immunochemical, or chemical means. For example, useful labels include radioactive isotopes (e.g., 32P, 35S, and 3H), dyes, fluorescent dyes, electron-dense reagents, enzymes and their substrates (e.g., as commonly used in enzyme-linked immunoassays, e.g., lkaline phosphatase and horse radish peroxidase), biotin-streptavidin, digoxigenin, or haptens and proteins for which antisera or monoclonal antibodies are available. Moreover, a label or detectable moiety can include a “affinity tag” that, when coupled with the target nucleic acid and incubated with a test compound or compound library, allows for the affinity capture of the target nucleic acid along with molecules bound to the target nucleic acid. One skilled in the art will appreciate that a affinity tag bound to the target nucleic acids has, by definition, a complimentary ligand coupled to a solid support that allows for its capture. For example, useful affinity tags and complimentary partners include, but are not limited to, biotin-streptavidin, complimentary nucleic acid fragments (e.g., oligo dT-oligo dA, oligo T-oligo A, oligo dG-oligo dC, oligo G-oligo C), aptaners, or haptens and proteins for which antisera or monoclonal antibodies are available. The label or detectable moiety is typically bound, either covalently, through a linker or chemical bound, or through ionic, van der Waals or hydrogen bonds to the molecule to be detected.

[0013] As used herein, a “dye” refers to a molecule that, when exposed to radiation, emits radiation at a level that is detectable visually or via conventional spectroscopic means. As used herein, a “visible dye” refers to a molecule having a chromophore that absorbs radiation in the visible region of the spectrum (i.e., having a wavelength of between about 400 nm and about 700 nm) such that the transmitted radiation is in the visible region and can be detected either visually or by conventional spectroscopic means. As used herein, an “ultraviolet dye” refers to a molecule having a chromophore that absorbs radiation in the ultraviolet region of the spectrum (i.e., having a wavelength of between about 30 nm and about 400 nm). As used herein, an “infrared dye” refers to a molecule having a chromophore that absorbs radiation in the infrared region of the spectrum (i.e., having a wavelength between about 700 nm and about 3,000 nm). A “chromophore” is the network of atoms of the dye that, when exposed to radiation, emits radiation at a level that is detectable visually or via conventional spectroscopic means. One of skill in the art will readily appreciate that although a dye absorbs radiation in one region of the spectrum, it may emit radiation in another region of the spectrum. For example, an ultraviolet dye may emit radiation in the visible region of the spectrum. One of skill in the art will also readily appreciate that a dye can transmit radiation or can emit radiation via fluorescence or phosphorescence.

[0014] The phrase “pharmaceutically acceptable salt(s),” as used herein includes but is not limited to salts of acidic or basic groups that may be present in test compounds identified using the methods of the present invention. Test compounds that are basic in nature are capable of forming a wide variety of salts with various inorganic and organic acids. The acids that can be used to prepare pharmaceutically acceptable acid addition salts of such basic compounds are those that form non-toxic acid addition salts, i.e., salts containing pharmacologically acceptable anions, including but not limited to sulfuric, citric, maleic, acetic, oxalic, hydrochloride, hydrobromide, hydroiodide, nitrate, sulfate, bisulfate, phosphate, acid phosphate, isonicotinate, acetate, lactate, salicylate, citrate, acid citrate, tartrate, oleate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucaronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate and pamoate (i.e., 1,1′-methylene-bis-(2-hydroxy-3-naphthoate)) salts. Test compounds that include an amino moiety may form pharmaceutically or cosmetically acceptable s :ts with various amino acids, in addition to the acids mentioned above. Test compounds that are acidic in nature are capable of forming base salts with various pharmacologically or cosmetically acceptable cations. Examples of such salts include alkali metal or alkaline earth metal salts and, particularly, calcium, magnesium, sodium lithium, zinc, potassium, and iron salts.

[0015] By “substantially one type of test compound,” as used herein, is meant that the assay can be performed in such a fashion that at some point, only one compound need be used in each reaction so that, if the result is indicative of a binding event occurring between the target RNA molecule and the test compound, the test compound can be easily identified.

4. DESCRIPTION OF DRAWINGS

[0016] FIG. 1. Gel retardation analysis to detect peptide-RNA interactions. In 20 μl reactions containing increasing concentrations of Tat47-58 peptide (0.1 μM, 0.2 μM, 0.4 μM, 0.8 μM, 1.6 μM) 50 pmole TAR RNA oligonucleotide was added in TK buffer. The reaction mixture was then heated at 90° C. for 2 min and allowed to cool slowly to 24° C. 10 ml of 30% glycerol was added to each sample and applied to a 12% non-denaturing polyacrylamide gel. The gel was electrophoresed using 1200 volt-hours at 4° C. in TBE Buffer. Following electrophoresis, the gel was dried and the radioactivity was quantitated with a phosphorimager. The concentration of peptide added is indicated above each lane.

[0017] FIG. 2. Gentamicin interacts with an oligonucleotide corresponding to the 16S rRNA. 20 μl reactions containing increasing concentrations of gentamicin (1 ng/ml, 10 ng/ml, 100 ng/ml, 1 μg/ml, 10 μg/ml, 50 μg/ml, 500 μg/ml) were added to 50 pmole RNA oligonucleotide in TKM buffer, heated at 90° C. for 2 min and allowed to cool slowly to 24° C. Then 10 μl of 30% glycerol was added to each sample and the samples were applied to a 13.5% non-denaturing polyacrylamide gel. The gel was electrophoresed using 1200 volt-hours at 4° C. in TBE Buffer Following electrophoresis, the gel was dried and the radioactivity was quantitated using a phosphorimager. The concentration of gentamicin added is indicated above each lane.

[0018] FIG. 3. The presence of 10 pg/ml gentamicin produces a gel mobility shift in the presence of the 16S rRNA oligonucleotide. 20 μl reactions containing 30 increasing concentrations of gentamicin (100 ng/ml, 10 ng/ml, 1 ng/ml, 100 pg/ml, and 10 pg/ml) were added to 50 pmole RNA oligonucleotide in TKM buffer were treated as described for FIG. 2.

[0019] FIG. 4. Gentamicin binding to the 16S rRNA oligonucleotide is weak in the absence of MgCl2. Reaction mixtures containing gentamicin (1 mg/ml, 100 μg/ml, 10 μg/ml, 1 μg/ml, 0.1 μg/ml, and 10 ng/ml) were treated as described in FIG. 2 except that the TKM buffer does not contain MgCl2.

[0020] FIG. 5. Gel retardation analysis to detect peptide-RNA interactions. In reactions containing increasing concentrations of Tat47-58 peptide (0.1 μM, 0.2 μM, 0.4 μM, 0.8 μM, 1.6 μM) 50 pmole TAR RNA oligonucleotide was added in TK buffer. The reaction mixture was then heated at 90° C. for 2 min and allowed to cool slowly to 24° C. The reactions were loaded onto a SCE9610 automated capillary electrophoresis apparatus (SpectruMedix; State College, Pa.). The peaks correspond to the amount of free TAR RNA (“TAR”) or the Tat-TAR complex (“Tat-TAR”). The concentration of peptide added is indicated below each lane.

5. DETAILED DESCRIPTION OF THE INVENTION

[0021] The present invention relates to methods for identifying compounds that bind to preselected target elements of nucleic acids, in particular, RNAs, including but not limited to preselected target RNA sequencing structural motifs, or structural elements. Methods are described in which a preselected target RNA having a detectable label is used to screen a library of test compounds. Any complexes formed between the target RNA and a member of the library are identified using physical methods that detect the altered physical property of the target RNA bound to a test compound. Changes in the physical property of the RNA-test compound complex relative to the target RNA or test compound can be measured by methods such as, but not limited to, methods that detect a change in mobility due to a change in mass, change in charge, or a change in thermostability. Such methods include, but are not limited to, electrophoresis, fluorescence spectroscopy, surface plasmon resonance, mass spectrometry, scintillation, proximity assay, structure-activity relationships (“SAR”) by NMR spectroscopy, size exclusion chromatography, affinity chromatography, and nanoparticle aggregation. In particular, the present invention relates to methods for using a target RNA having a detectable label to screen a library of test compounds free in solution, in labeled tubes or microtiter plate, or in a microarray. Compounds in the library that bind to the labeled target RNA will form a detectably labeled complex. The detectably labeled complex can then be identified and removed from the unlabeled, uncomplexed test compounds in the library by a variety of methods capable of differentiating changes in the physical properties of the complexed target RNA. The structure of the test compound attached to the labeled RNA is also determined. The methods used will depend, in part, on the nature of the library screened. For example, assays or microarrays of test compounds, each having an address or identifier, may be deconvoluted, e.g., by cross-referencing the positive sample to an original compound list that was applied to the individual test assays. Another method for identifying test compounds includes de novo structure determination of the test compounds using mass spectrometry or nuclear magnetic resonance (“NMR”).

[0022] Thus, the methods of the present invention provide a simple, sensitive assay for high-throughput screening of libraries of test compounds, in which the test compounds of the library that specifically bind a preselected target nucleic acid are easily distinguished from non-binding members of the library. The structures of the binding molecules are deciphered from the input library by methods depending on the type of library that is used. The test compounds so identified are useful for any purpose to which a binding reaction may be put, for example in assay methods, diagnostic procedures, cell sorting, as inhibitors of target molecule function, as probes, as sequestering agents and lead compounds for development of therapeutics, and the like. Small organic compounds that are identified to interact specifically with the target RNA molecules are particularly attractive candidates as lead compounds for the development of therapeutic agents.

[0023] The assay of the invention reduces bias introduced by competitive binding assays which require the identification and use of a host cell factor (presumably essential for modulating RNA function) as a binding partner for the target RNA. The assays of the present invention are designed to detect any compound or agent that binds to the target RNA, preferably under physiologic conditions. Such agents can then be tested for biological activity, without establishing or guessing which host cell factor or factors is required for modulating the function and/or activity of the target RNA.

[0024] Section 5.1 describes examples of protein-RNA interactions that are important in a variety of cellular functions and several target RNA elements that can be used to identify test compounds. Compounds that inhibit these interactions by binding to the RNA and successfully competing with the natural protein or host cell factor that endogenously binds to the RNA may be important, e.g., in treating or preventing a disease or abnormal condition, such as an infection or unchecked growth. Section 5.2 describes detectable labels for target nucleic acids that are useful in the methods of the invention. Section 5.3 describes libraries of test compounds. Section 5.4 provides conditions for binding a labeled target RNA to a test compound of a library and detecting RNA binding to a test compound using the methods of the invention. Section 5.5 provides methods for separating complexes of target RNAs bound to a test compound from an unbound RNA. Section 5.6 describes methods for identifying test compounds that are bound to the target RNA. Section 5.7 describes a secondary, biological screen of test compounds identified by the methods of the invention to test the effect of the test compounds in vivo. Section 5.8 describes the use of test compounds identified by the methods of the invention for treating or preventing a disease or abnormal condition in mammals.

5.1. Biologically Important RNA-Host Cell Factor Interactions

[0025] Nucleic acids, and in particular RNAs, are capable of folding into complex tertiary structures that include bulges, loops, triple helices and pseudoknots, which can provide binding sites for host cell factors, such as proteins and other RNAs. RNA-protein and RNA-RNA interactions are important in a variety cellular functions, including transcription, RNA splicing, RNA stability and translation. Furthermore, the binding of such host cell factors to RNAs may alter the stability and translational efficiency of such RNAs, and according affect subsequent translation. For example, some diseases are associated with protein overproduction or.decreased protein function. In this case, the identification of compounds to modulate RNA stability and translational efficiency will be useful to treat and prevent such diseases.

[0026] The methods of the present invention are useful for identifying test compounds that bind to target RNA elements in a high throughput screening assay of libraries of test compounds in solution. In particular, the methods of the present invention are useful for identifying a test compound that binds to a target RNA elements and inhibits the interaction of that RNA with one or more host cell factors in vivo. The molecules identified using the methods of the invention are useful for inhibiting the formation of a specific bound RNA:host cell factor complexes in vivo.

[0027] In some embodiments, test compounds identified by the methods of the invention are useful for increasing or decreasing the translation of messenger RNAs (“mRNAs”), e.g., protein production, by binding to one or more regulatory elements in the 5′ untranslated region, the 3′ untranslated region, or the coding region of the mRNA. Compounds that bind to mRNA can, inter alia, increase or decrease the rate of mRNA processing, alter its transport through the cell, prevent or enhance binding of the mRNA to ribosomes, suppressor proteins or enhancer proteins, or alter mRNA stability. Accordingly, compounds that increase or decrease mRNA translation can be used to treat or prever disease. For example, diseases associated with protein overproduction, such as amyloidosis, or with the production of mutant proteins, such as Ras, can be treated or prevented by decreasing translation of the mRNA that codes for the overproduced protein, thus inhibiting production of the protein. Conversely, the symptoms of diseases associated with decreased protein function, such as hemophelia, may be treated by increasing translation of mRNA coding for the protein whose function is decreased, e.g., factor IX in some forms of hemophilia.

[0028] The methods of the invention can be used to identify compounds that bind to mRNAs coding for a variety of proteins with which the progression of diseases in mammals is associated. These mRNAs include, but are not limited to, those coding for amyloid protein and amyloid precursor protein; anti-angiogenic proteins such as angiostatin, endostatin, METH-1 and METH-2; apoptosis inhibitor proteins such as survivin, clotting factors such as Factor IX, Factor VIII, and others in the clotting cascade; collagens; cyclins and cyclin inhibitors, such as cyclin dependent kinases, cyclin D1, cyclin E, WAF1, cdk4 inhibitor, and MTS1; cystic fibrosis transmembrane conductance regulator gene (CFTR); cytokines such as IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17 and other interleukins; hematopoetic growth factors such as erythropoietin (Epo); colony stimulating factors such as G-CSF, GM-CSF, M-CSF, SCF and thrombopoietin; growth factors such as BNDF, BMP, GGRP, EGF, FGF, GDNF, GGF, HGF, IGF-1, IGF-2, KGF, myotrophin, NGF, OSM, PDGF, somatotrophin, TGF-β, TGF-α anc VEGF; antiviral cytokines such as interferons, antiviral proteins induced by interferons, TNF-α, and TNF-β; enzymes such as cathepsin K, cytochrome P-450 and other cytochromes, farnesyl transferase, glutathione-S transferases, heparanase, HMG CoA synthctase, N-acetyltransferase, phenylalanine hydroxylase, phosphodiesterase, ras carboxyl-terminal protease, telomerase and TNF converting enzyme; glycoproteins such as cadherins, e.g., N-cadherin and E-cadherin; cell adhesion molecules; selectins; transmembrane glycoproteins such as CD40; heat shock proteins; hormones such as 5-α reductase, atrial natriuretic factor, calcitonin, corticotrophin releasing factor, diuretic hormones, glucagon, gonadotropin, gonadotropin releasing hormone, growth hormone, growth hormone releasing factor, somatotropin, insulin, leptin, luteinizing hormone, luteinizing hormone releasing hormone, parathyroid hormone, thyroid hormone, and thyroid stimulating hormone; proteins involved in immune responses, including antibodies, CTLA4, hemagglutinin, MHC proteins, VLA-4, and kallikrein-kininogen-kinin system; ligands such as CD4; oncogene products such as sis, hst, protein tyrosine kinase receptors, ras, abl, mos, myc, fos, jun, H-ras, ki-ras, c-fms, bcl-2, L-myc, c-myc, gip, gsp, and HER-2; receptors such as bombesin receptor, estrogen receptor, GABA receptors, growth factor receptors including EGFR, PDGFR, FGFR, and NGFR, GTP-binding regulatory proteins, interleukin receptors, ion channel receptors, leukotriene receptor antagonists, lipoprotein receptors, opioid pain receptors, substance P receptors, retinoic acid and retinoid receptors, steroid receptors, T-cell receptors, thyroid hormone receptors, TNF receptors; tissue plasminogen activator; transmembrane receptors; transmembrane transporting systems, such as calcium pump, proton pump, Na/Ca exchanger, MRP1, MRP2, P170, LRP, and cMOAT; transferrin; and tumor suppressor gene products such as APC, brca1, brca2, DCC, MCC, MTS1, NF1, NF2, nm23, p53 and Rb. In addition to the eukaryotic genes listed above, the invention, as described, can be used to define molecules that interrupt viral, bacterial or fungal transcription or translation efficiencies and therefore form the basis for a novel anti-infectious disease therapeutic. Other target genes include, but are not limited to, those disclosed in Section 5.1 and Section 6.

[0029] The methods of the invention can be used to identify mRNA-binding test compounds for increasing or decreasing the production of a protein, thus treating or preventing a disease associated with decreasing or increasing the production of said protein, respectively. The methods of the invention may be useful for identifying test compounds for treating or preventing a disease in mammals, including cats, dogs, swine, horses, goats, sheep, cattle, primates and humans. Such diseases include, but are not limited to, amyloidosis, hemophilia, Alzheimer's disease, atherosclerosis, cancer, giantism, dwarfism, hypothyroidism, hyperthyroidism, inflammation, cystic fibrosis, autoimmune disorders, diabetes, aging, obesity, neurodegenerative disorders, and Parkinson's disease. Other diseases include, but are not limited to, those described in Section 5.1 and diseases caused by aberrant expression of the genes disclosed in Example 6. In addition to the eukaryotic genes listed above, the invention, as described, can be used to define molecules that interrupt viral, bacterial or fungal transcription or translation efficiencies and therefore form the basis for a novel anti-infectious disease therapeutic.

[0030] In other embodiments, test compounds identified by the methods of the invention are useful for preventing the interaction of an RNA, such as a transfer RNA (“tRNA”), an enzymatic RNA or a ribosomal RNA (“rRNA”), with a protein or with another RNA, thus preventing, e.g., assembly of an in vivo protein-RNA or RNA-RNA complex that is essential for the viability of a cell. The term “enzymatic RNA,” as used herein, refers to RNA molecules that are either self-splicing, or that form an enzyme by virtue of their association with one or more proteins, e.g., as in RNase P, telomerase or small nuclear ribonuclear protein particles. For example, inhibition of an interaction between rRNA and one or more ribosomal proteins may inhibit the assembly of ribosomes, rendering a cell incapable of synthesizing proteins. In addition, inhibition of the interaction of precursor rRNA with ribonucleases or ribonucleoprotein complexes (such as RNase P) that process the precursor rRNA prevent maturation of the rRNA and its assembly into ribosomes. Similarly, a tRNA:tRNA synthetase complex may be inhibited by test compounds identified by the methods of the invention such that tRNA molecules do not become charged with amino acids. Such interactions include, but are not limited to, rRNA interactions with ribosomal proteins, tRNA interactions with tRNA synthetase, RNase P protein interactions with RNase P RNA, and telomerase protein interactions with telomerase RNA.

[0031] In other embodiments, test compounds identified by the methods of the invention are useful for treating or preventing a viral, bacterial, protozoan or fungal infection. For example, transcriptional up-regulation of the genes of human immunodeficiency virus type 1 (“HIV-1”) requires binding of the HIV Tat protein to the HIV trans-activation response region RNA (“TAR RNA”). HIV TAR RNA is a 59-base stem-loop structure located at the 5′-end of all nascent HIV-1 transcripts (Jones & Peterlin, 1994, Annu. Rev. Biochem. 63:717-43). Tat protein is known to interact with uracil 23 in the bulge region of the stem of TAR RNA. Thus, TAR RNA is a potential binding target for test compounds, such as small peptides and peptide analogs that bind to the bulge region of TAR RNA and inhibit formation of a Tat-TAR RNA complex involved in HIV-1 upregulation (see Hwang et al.,1999 Proc. Natl. Acad. Sci. USA 96:12997-13002). Accordingly, test compounds that bind to TAR RNA are useful as anti-HIV therapeutics (Hamy et al., 1997, Proc. Natl. Acad. Sci. USA 94:3548-3553; Hamy et al., 1998, Biochemistry 37:5086-5095; Mei et al., 1998, Biochemistry 37:14204-14212), and therefore, are useful for treating or preventing AIDS.

[0032] The methods of the invention can be used to identify test compounds to treat or prevent viral, bacterial, protozoan or fungal infections in a patient. In some embodiments, the methods of the invention are useful for identifying compounds that decrease translation of microbial genes by interacting with mRNA, as described above, or for identifying compounds that inhibit the interactions of microbial RNAs with proteins or other ligands that are essential for viability of the virus or microbe. Examples of microbial target RNAs useful in the present invention for identifying antiviral, antibacterial, anti-protozoan and anti-fungal compounds include, but are not limited to, general antiviral and anti-inflammatory targets such as mRNAs of INFα, INFγ, RNAse L, RNAse L inhibitor protein, PKR, tumor necrosis factor, interleukins 1-15, and IMP dehydrogenase; internal ribosome entry sites; HIV-1 CT rich domain and RNase H MRNA; HCV internal ribosome entry site (required to direct translation of HCV mRNA), and the 3′-untranslated tail of HCV genomes; rotavirus NSP3 binding site, which binds the protein NSP3 that is required for rotavirus mRNA translation; HBV epsilon domain; Dengue virus 5′ and 3′ untranslated regions, including IRES; INFα, INFβ and INFγ; plasmodium falciparum mRNAs; the 16S ribosomal subunit ribosomal RNA and the RNA component of RNase P of bacteria; and the RNA component of telomerase in fungi and cancer cells. Other target viral and bacterial mRNAs include, but are not limited to, those disclosed in Section 6.

[0033] One of skill in the art will appreciate that, although such target RNAs are functionally conserved in various species (e.g., from yeast to humans), they exhibit nucleotide sequence and structural diversity. Therefore, inhibition of, for example, yeast telomerase by an anti-fungal compound identified by the methods of the invention might not interfere with human telomerase and normal human cell proliferation.

[0034] Thus, the methods of the invention can be used to identify test compounds that interfere with one or more target RNA interactions with host cell factors that are important for cell growth or viability, or essential in the life cycle of a virus, a bacterium, a protozoa or a fungus. Such test compounds and/or congeners that demonstrate desirable biologic and pharmacologic activity can be administered to a patient in need thereof in order to treat or prevent a disease caused by viral, bacterial, protozoan, or fungal infections. Such diseases include, but are not limited to, HIV infection, AIDS, human T-cell leukemia, SIV infection, FIV infection, fel.ne leukemia, hepatitis A, hepatitis B, hepatitis C, Dengue fever, malaria, rotavirus infection, severe acute gastroenteritis, diarrhea, encephalitis, hemorrhagic fever, syphilis, legionella, whooping cough, gonorrhea, sepsis, influenza, pneumonia, tinea infection, candida infection, and meningitis.

[0035] Non-limiting examples of RNA elements involved in the regulation of gene expression, i.e., mRNA stability, translational efficiency via translational initiation and ribosome assembly, etc., include the HIV TAR element, internal ribosome entry site, “slippery site”, instability elements, and adenylate uridylate-rich elements, as discussed below.

5.1.1. HIV TAR Element

[0036] Transcriptional up-regulation of the genes of human immunodeficiency virus type 1 (“HIV-1”) requires binding of the HIV Tat protein to the HIV trans-activation response region RNA (“TAR RNA”), a 59-base stem-loop structure located at the 5′ end of all nascent HIV-1 transcripts (Jones & Peterlin, 1994, Annu. Rev. Biochem. 63:717-43). Tat protein is known to interact with uracil 23 in the bulge region of the stem of TAR RNA. Thus, TAR RNA is a useful binding target for test compounds, such as small peptides and peptide analogs that bind to the bulge region of TAR RNA and inhibit formation of a Tat-TAR RNA complex involved in HIV-1 up-regulation (see Hwang et al., 1999 Proc. Natl. Acad. Sci. USA 96:12997-13002). Accordingly, test compounds that bind to TAR RNA can be useful as anti-HIV therapeutics (Harny et al., 1997, Proc. Natl. Acad. Sci. USA 94:3548-3553; Hamy et al., 1998, Biochemistry 37:5086-5095; Mei et al., 1998, Biochemistry 37:14204-14212), and therefore, are useful for treating or preventing AIDS.

5.1.2. Internal Ribosome Entry Site (“IRES”)

[0037] Internal ribosome entry sites (“IRES”) are found in the 5′ untranslated regions (“5′ UTR”) of several mRNAs, and are thought to be involved in the regulation of translational efficiency. When the IRES element is present on an mRNA downstream of a translational stop codon, it directs ribosomal re-entry (Ghattas et al., 1991, Mol. Cell. Biol. 11:5848-5959), which permits initiation of translation at the start of a second open reading frame.

[0038] As reviewed by Jang et al., a large segment of the 5′ nontranslated region, approximately 400 nucleotides in length, promotes internal entry of ribosomes independent of the non-capped 5′ end of picornavirus mRNAs (mammalian plus-strand RNA viruses whose genomes serve as mRNA). This 400 nucleotide segment (IRES), maps approximately 200 nt down-stream from the 5′ end and is highly structured. IRES elements of different picornaviruses, although functionally similar in vitro and in vivo, are not identical in sequence or structure. However, IRES elements of the genera entero- and rhinoviruses, on the one hand, and cardio- and aphthoviruses, on the other hand, reveal similarities corresponding to phylogenetic kinship. All IRES elements contain a conserved Yn-Xm-AUG unit (Y, pyrimidine; X, nucleotide) which appears essential for IRES function. The IRES elements of cardio-, entero- and aphthoviruses bind a cellular protein, p57. In the case of cardioviruses, the interaction between a specific stem-loop of the IREs is essential for translation in vitro. The IRES elements of entero- and cardioviruses also bind the cellular protein, p52, but the significance of this interaction remains to be shown. The function of p57 or p52 in cellular metabolism is unknown. Since picomaviral IRES elements function in vivo in the absence of any viral gene products, is speculated that IRES-like elements may also occur in specific cellular mRNAs releasing them from cap-dependent translation (Jang et al., 1990, Enzyme 44(1-4):292-309).

5.1.3. “Slippery Site”

[0039] Programmed, or directed, ribosomal frameshifting, when ribosomes shift from one translation reading frame to another and synthesize two viral proteins from a single viral mRNA, is directed by a unique site in viral mRNAs called the “slippery site.” The slippery site directs ribosomal frameshifting in the −1 or +1 direction that causes the ribosome to slip by one base in the 5′ direction thereby placing the ribosome in the new reading frame to produce a new protein.

[0040] Programmed, or directed, ribosomal frameshifting is of particular value to viruses that package their plus strands, as it eliminates the need to splice their mRNAs and reduces the risk of packaging defective genomes and regulates the ratio of viral proteins synthesized. Examples of programmed translational frameshifting (both +1 and −1 shifts) have been identified in ScV systems (Lopinski et al., 2000, Mol. Cell. Biol. 20(4):1095-103, retroviruses (Falk et al., 1993, J. Virol. 67:273-6277; Jacks & Varmus, 1985, Science 230:1237-1242; Morikawa & Bishop, 1992, Virology 186:389-397; Nam et al., 1993, J. Virol. 67:196-203); coronaviruses (Brierley et al., 1987, EMBO J. 6:3779-3785; Herold & Siddell, 1993, Nucleic Acids Res. 21:5838-5842); giardiaviruses, which are also members of the Totiviridae (Wang et al., 1993, Proc. Natl. Acad. Sci. USA 90:8595-8599); two bacterial genes (Blinkowa & Walker, 1990, Nucleic Acids Res., 18: i725-1729; Craigen & Caskey, 1986, Nature 322:273); bacteriophage genes (Condron et al., 1991, Nucleic Acids Res. 19:5607-5612); astroviruses (Marczinke et al., 1994, J. Virol. 68:5588-5595); the yeast EST3 gene (Lundblad & Morris, 1997, Curr. Biol. 7:969-976); and the rat, mouse, Xenopus, and Drosophila ornithine decarboxylase antizymes (Matsufuji et al., 1995, Cell 80:51-60); and a significant number of cellular genes (Herold & Siddell, 1993, Nucleic Acids Res. 21:5838-5842).

[0041] Drugs targeted to ribosomal frameshifting minimize the problem of virus drug resistance because this strategy targets a host cellular process rather than one introduced into the cell by the virus, which minimizes the ability of viruses to evolve drug-resistant mutants. Compounds that target the RNA elements involved in regulating programmed frameshifting should have several advantages, including (a) any selective pressure on the host cellular translational machinery to adapt to the drugs would have to occur at the host evolutionary time scale, which is on the order of millions of years, (b) ribosomal frameshifting is not used to express any host proteins, and (c) altering viral frameshifting efficiencies by modulating the activity of a host protein minimizing the likelihood that the virus will acquire resistance to such inhibition by mutations in its own genome.

5.1.4. Instability Elements

[0042] “Instability elements” may be defined as specific sequence elements that promote the recognition of unstable mRNAs by cellular turnover machinery. Instability elements have been found within mRNA protein coding regions as well as untranslated regions.

[0043] Altering the control of stability of normal mRNAs may lead to disease. The alteration of mRNA stability has been implicated in diseases such as, but not limited to, cancer, immune disorders, heart disease, and fibrotic disorders.

[0044] There are several examples of mutations that delete instability elements which then result in stabilization of mRNAs that may be involved in the onset of cancer. In Burkitt's lymphoma, a portion of the c-myc proto-oncogene is translocated to an Ig locus, producing a form of the c-myc mRNA that is five times more stable (see, e.g., Kapstein et al., 1996, J. Biol. Chem. 271(31):18875-84). The highly oncogenic v-fos mRNA lacks the 3′ UTR adenylate uridylate rich element (“ARE”) that is found in the more labile and weakly oncogenic c-fos mRNA (see, e.g., Schiavi et al., 1992, Biochim Biophys Acta. 1114(2-3):95-106). Differences between the benign cervical lesions brought about by nonintegrated circular human papillomavirus type 16 and its integrated form, that lacks the 3′ UTR ARE and correlates with cervical carcinomas, may be a consequence of stabilizing the E6/E7 transcripts encoding oncogenic proteins. Integration of the virus results in deletion of the ARE instability element, resulting in stabilizion of the transcripts and over-expression of the proteins (see, e.g., Jeon & Lambert, 1995, Proc. Natl. Acad. Sci. USA 92(5):1654-8). Deletion of AREs from the 3′ UTR of the IL-2 and IL-3 genes promotes increased stabilization of these mRNAs, high expression of these proteins, and leads to the formation of cancerous cells (see, e.g., Stoecklin et al., 2000, Mol. Cell. Biol. 20(11):3753-63).

[0045] Mutations in trans-acting factors involved in mRNA turnover may also promote cancer. In monocytic tumors, the lymphokine GM-CSF mRNA is specifically stabilized as a consequence of an oncogenic lesion in a trans-acting factor that controls mRNA turnover rates. Furthermore, the normally unstable IL-3 transcript is inappropriately long-lived in mast tumor cells. Similarly, the labile GM-CSF mRNA is greatly stabilized in bladder carcinoma cells. See, e.g., Bickel et al., 1990, J. Immunol. 145(3):840-5.

[0046] The immune system is regulated by a large number of regulatory molecules that either activate or inhibit the immune response. It has now been clearly demonstrated that stability of the transcripts encoding these proteins are highly regulated. Altered regulation of these molecules leads to mis-regulation of this process and can result in drastic medical consequences. For example, recent results using transgenic mice have shown that mis-regulation of the stability of the important modulator TNFα mRNA leads to diseases such as, but not limited to, rheumatoid arthritis and a Crohn's-like liver disease. See, e.g., Clark, 2000, Arthritis Res. 2(3):172-4.

[0047] Smooth muscle in the heart is modulated by the β-adrenergic receptor, which in turn responds to the sympathetic neurotransmitter norepinephrine and the adrenal hormone epinephrine. Chronic heart failure is characterized by impairment of smooth muscle cells, which results, in part, from the more rapid decay of the β-adrenergic receptor mRNA. See, e.g., Ellis & Frielle, 1999, Biochem. Biophys. Res. Commun. 258(3):552-8.

[0048] A large number of diseases result from over-expression of collagen. For example, cirrhosis results from damage to the liver as a consequence of carcer, viral infection, or alcohol abuse. Such damage causes mis-regulation of collagen expression, leading to the formation of large collagen deposits. Recent results indicate that the sizeable increase in collagen expression is largely attributable to stabilization of its mRNA. See, e.g., Lindquist et al., 2000, Am. J. Physiol. Gastrointest. Liver Physiol. 279(3):G471-6.

5.1.5. Adenylate Uridylate-Rich Elements (“ARE”)

[0049] Adenylate uridylate-rich elements (“ARE”) are found in the 3′ untranslated regions (“3′ UTR”) of several mRNAs, and involved in the turnover of mrRNAs, such as but not limited to transcription factors, cytokines, and lymphokines. AREs may function both as stabilizing and destabilizing elements. ARE mRNAs are classified into five groups, depending on sequence (Bakheet et al., 2001, Nucl. Acids Res. 29(1):246-254). An ongoing database at the web site http://rc.kfshrc.edu.sa/ared contains ARE-containing mRNAs and their cluster groups, which is incorporated by reference in its entirety. The ARE motifs are classified as follows:

Group I Cluster	(AUUUAUUUAUUUAUUUAUUUA)	SEQ ID NO: 1
Group II Cluster	(AUUUAUUUAUUUAUUUA) stretch	SEQ ID NO: 2
Group III Cluster	(WAUUUAUUUAUUUAW) stretch	SEQ ID NO: 3
Group IV Cluster	(WWAUUUAUUUAWW) stretch	SEQ ID NO: 4
Group V Cluster	(WWWWAUUUAWWWW) stretch	SEQ ID NO: 5

[0050] The ARE-mRNAs were clustered into five groups containing five, four, three and two pentameric repeats, while the last group contains only one pentamer within the 13-bp ARE pattern. Functional categories were assigned whenever possible according to NCBI-COG functional annotation (Tatusov et al., 2001, Nucleic Acids Research, 29(1): 22-28), in addition to the categories: inflammation, immune response, development/differentiation, using an extensive literature search.

[0051] Group I contains many secreted proteins including GM-CSF, IL-1, IL-11, IL-12 and Gro-β that affect the growth of hematopoietic and immune cells (Witsell & Schook, 1992, Proc. Natl Acad. Sci. USA, 89:4754-4758). Although TNFα is both a pro-inflammatory and anti-tumor protein, there is experimental evidence that it can act as a growth factor in certain leukemias and lymphomas (Liu et al., 2000, J. Biol. Chem. 275:21086-21093).

[0052] Unlike Group I, Groups II-V contain functionally diverse gene families comprising immune response, cell cycle and proliferation, inflammation and coagulation, angiogenesis, metabolism, energy, DNA binding and transcription, nutrient transportation and ionic homeostasis, protein synthesis, cellular biogenesis, signal transduction, and apoptosis (Bakheet et al., 2001, Nucl. Acids Res. 29(1):246-254).

[0053] Several groups have described ARE-binding proteins that influence the ARE-mRNA stability. Among the well-characterized proteins are the mammalian homologs of ELAV (embryonic lethal abnormal vision) proteins including AUF1, HuR and He1-N2 (Zhang et al., 1993, Mol. Cell. Biol. 13:7652-7665; Levine et al., 1993, Mol. Cell. Biol. 13:3494-3504: Ma et al., 1996, J. Biol. Chem. 271 :8144-8151). The zinc-finger protein tristetraprolin has been identified as another ARE-binding protein with destabilizing activity on TNF-α, IL-3 and GM-CSF mRNAs (Stoecklin et al., 2000, Mol. Cell. Biol. 20:3753-3763; Carballo et al., 2000, Blood 95:1891-1899).

[0054] Since ARE-containing genes are clearly important in biological systems, including but not limited to a number of the early response genes that regulate cell proliferation and responses to exogenous agents, the identification of compounds that bind to one or more of the ARE clusters and potentially modulate the stability of the target RNA can potentially be of value as a therapeutic.

5.2. Detectably Labeled Target RNAs

[0055] Target nucleic acids, including but not limited to RNA and DNA, useful in the methods of the present invention have a label that is detectable via conventional spectroscopic means or radiographic means. Preferably, target nucleic acids are labeled with a covalently attached dye molecule. Useful dye-molecule labels include, but are not limited to, fluorescent dyes, phosphorescent dyes, ultraviolet dyes, infrared dyes, and visible dyes. Preferably, the dye is a visible dye.

[0056] Useful labels in the present invention can include, but are not limited to, spectroscopic labels such as fluorescent dyes (e.g., fluorescein and derivatives such as fluorescein isothiocyanate (FITC) and Oregon Green™, rhodamine and derivatives (e.g., Texas red, tetramethylrhodimine isothiocynate (TRITC), bora-3a,4a-diaza-s-indacene (BODIPY®) and derivatives, etc.), digoxigenin, biotin, phycoerythrin, AMCA, CyDye™, and the like), radiolabels (e.g., 3H, 125I, 35S, 14C, 32P,33P, etc.), enzymes (e.g., horse radish peroxidase, alkaline phosphatase etc.), spectroscopic calorimetric labels such as colloidal gold or colored glass or plastic (e.g. polystyrene, polypropylene, latex, etc.) beads, or nanoparticles—nanoclusters of inorganic ions with defined dimension from 0.1 to 1000 nm. Useful affinity tags and complimentary partners include, but are not limited to, biotin-streptavidin, complimentary nucleic acid fragments (e.g., oligo dT-oligo dA, oligo T-oligo A, oligo dG-oligo dC, oligo G-oligo C), aptamer-streptavidin, or haptens and proteins for which antisera or monoclonal antibodies are available. The label may be coupled directly or indirectly to a component of the detection assay (e.g., the detection reagent) according to methods well known in the art. A wide variety of labels may be used, with the choice of label depending on sensitivity required, ease of conjugation with the compound, stability requirements, available instrumentation, and disposal provisions.

[0057] In one embodiment, nucleic acids that are labeled at one or more specific locations are chemically synthesized using phosphoramidite or other solution or solid-phase methods. Detailed descriptions of the chemistry used to form polynucleotides by the phosphoramidite method are well known (see, e.g., Caruthers et al., U.S. Pat. Nos. 4,458,066 and 4,415,732; Caruthers et al., 1982, Genetic Engineering 4:1-17; Users Manual Model 392 and 394 Polynucleotide Synthesizers, 1990, pages 6-1 through 6-22, Applied Biosystems, Part No. 901237; Ojwang, et al., 1997, Biochemistry, 36:6033-6045). The phosphoramidite method of polynucleotide synthesis is the preferred method because of its efficient and rapid coupling and the stability of the starting materials. The synthesis is performed with the growing polynucleotide chain attached to a solid support, such that excess reagents, which are generally in the liquid phase, can be easily removed by washing, decanting, and/or filtration, thereby eliminating the need for purification steps between synthesis cycles.

[0058] The following briefly describes illustrative steps of a typical polynucleotide synthesis cycle using the phosphoramidite method. First, a solid support to which is attached a protected nucleoside monomer at its 3′ terminus is treated with acid, e.g., trichloroacetic acid, to remove the 5′-hydroxyl protecting group, freeing the hydroxyl group for a subsequent coupling reaction. After the coupling reaction is completed an activated intermediate is formed by contacting the support-bound nucleoside with a protected nucleoside phosphoramidite monomer and a weak acid, e.g., tetrazole. The weak acid protonates the nitrogen atom of the phosphoramidite forming a reactive intermediate. Nucleoside addition is generally complete within 30 seconds. Next, a capping step is performed, which terminates any polynucleotide chains that did not undergo nucleoside addition. Capping is preferably performed using acetic anhydride and 1-methylimidazole. The phosphite group of the internucleotide linkage is then converted to the more stable phosphotriester by oxidation using iodine as the preferred oxidizing agent and water as the oxygen donor. After oxidation, the hydroxyl protecting group of the newly added nucleoside is removed with a protic acid, e.g., trichloroacetic acid or dichloroacetic acid, and the cycle is repeated one or more times until chain elongation is complete. After synthesis, the polynucleotide chain is cleaved from the support using a base, e.g., ammonium hydroxide or t-butyl amine. The cleavage reaction also removes any phosphate protecting groups, e.g., cyanoethyl. Finally, the protecting groups on the exocyclic amines of the bases and any protecting groups on the dyes are removed by treating the polynucleotide solution in base at an elevated temperature, e.g., at about 55° C. Preferably the various protecting groups are removed using ammonium hydroxide or t-butyl amine.

[0059] Any of the nucleoside phosphoramidite monomers can be labeled using standard phosphoramidite chemistry methods (Hwang et al., 1999, Proc. Natl. Acad. Sci. USA 96(23):12997-13002; Ojwang et aL, 1997, Biochemistry. 36:6033-6045 and references cited therein). Dye molecules useful for covalently coupling to phosphoramidites preferably comprise a primary hydroxyl group that is not part of the dye's chromophore. Illustrative dye molecules include, but are not limited to, disperse dye CAS 4439-31-0, disperse dye CAS 6054-58-6, disperse dye CAS 4392-69-2 (Sigma-Aldrich, St. Louis, Mo.), disperse red, and 1-pyrenebutanol (Molecular Probes, Eugene, Oreg.). Other dyes useful for coupling to phosphoramidites will be apparent to those of skill in the art, such as fluoroscein, cy3, and cyS fluorescent dyes, and may be purchased from, e.g., Sigma-Aldrich, St. Louis, Mo. or Molecular Probes, Inc., Eugene, Oreg.

[0060] In another embodiment, dye-labeled target RNA molecules are synthesized enzymatically using in vitro transcription (Hwang et al., 1999, Proc. Natl. Acad. Sci. USA 96(23):12997-13002 and references cited therein). In this embodiment, a template DNA is denatured by heating to about 90° C. and an oligonucleotide primer is annealed to the template DNA, for example by slow-cooling the mixture of the denatured template and the primer from about 90° C. to room temperature. A mixture of ribonucleoside-5′-triphosphates capable of supporting template-directed enzymatic extension of the primed template (e.g., a mixture including GTP, ATP, CTP, and UTP), including one or more dye-labeled ribonucleotides (Sigma-Aldrich, St. Louis, Mo.), is added to the primed template. Next, a polymerase enzyme is added to the mixture under conditions where the polymerase enzyme is active, which are well-known to those skilled in the art. A labeled polynucleotide is formed by the incorporation of the labeled ribonucleotides during polymerase-mediated strand synthesis.

[0061] In yet another embodiment of the invention, nucleic acid molecules are end-labeled after their synthesis. Methods for labeling the 5′-end of an oligonucleotide include but are by no means limited to: (i) periodate oxidation of a 5′-to-5′-coupled ribonucleotide, followed by reaction with an arnine-reactive label (Heller & Morisson, 1985, in Rapid Detection and Identification ofInfectious Agents, D. T. Kingsbury and S. Falkow, eds., pp. 245-256, Academic Press); (ii) condensation of ethylenediamine with 5′-phosphorylated polynucleotide, followed by reaction with an amine reactive label (Morrison, European Patent Application 232 967); (iii) introduction of an aliphatic amine substituent using an aminohexyl phosphite reagent in solid-phase DNA synthesis, followed by reaction with an amine reactive label (Cardullo et al., 1988, Proc. Natl. Acad. Sci. USA 85:8790-8794); and (iv) introduction of a thiophosphate group on the 5′-end of the nucleic acid, using phosphatase treatment followed by end-labeling with ATP-?S and kinase, which reacts specifically and efficiently with maleimide-labeled fluorescent dyes (Czworkowski et al., 1991, Biochem. 30:4821-4830).

[0062] A detectable label should not be incorporated into a target nucleic acid at the specific binding site at which test compounds are likely to bind, since the presence of a covalently attached label might interfere sterically or chemically with the binding of the test compounds at this site. Accordingly, if the region of the target nucleic acid that binds to a host cell factor is known, a detectable label is preferably incorporated into the nucleic acid molecule at one or more positions that are spatially or sequentially remote from the binding region.

[0063] After synthesis, the labeled target nucleic acid can be purified using standard techniques known to those skilled in the art (see Hwang et al., 1999, Proc. Natl. Acad. Sci. USA 96(23):12997-13002 and references cited therein). Depending on the length of the target nucleic acid and the method of its synthesis, such purification techniques include, but are not limited to, reverse-phase high-performance liquid chromatography (“reverse-phase HPLC”), fast performance liquid chromatography (“FPLC”), and gel purification. After purification, the target RNA is refolded into its native conformation, preferably by heating to approximately 85-95° C. and slowly cooling to room temperature in a buffer, e.g., a buffer comprising about 50 mM Tris-HCl, pH 8 and 100 mM NaCl.

[0064] In another embodiment, the target nucleic acid can also be radiolabeled. A radiolabel, such as, but not limited to, an isotope of phosphorus, sulfur, or hydrogen, may be incorporated into a nucleotide, which is added either after or during the synthesis of the target nucleic acid. Methods for the synthesis and purification of radiolabeled nucleic acids are well known to one of skill in the art. See, e.g., Sambrook et al., 1989, in Molecular Cloning: A Laboratory Manual, pp 10.2-10.70, Cold Spring Harbor Laboratory Press, and the references cited therein, which are hereby incorporated by reference in their entireties.

[0065] In another embodiment, the target nucleic acid can be attached to an inorganic nanoparticle. A nanoparticle is a cluster of ions with controlled size from 0.1 to 1000 nm comprised of metals, metal oxides, or semiconductors including, but not limited to Ag2S, ZnS, CdS, CdTe, Au, or TiO2. Nanoparticles have unique optical, electronic and catalytic properties relative to bulk materials which can be adjusted according to the size of the particle. Methods for the attachment of nucleic acids are well know to one of skill in the art (see, e.g., Niemeyer, 2001, Angew. Chem. Int. Ed. 40: 4129-4158, International Patent Publication WO/0218643, and the references cited therein, the disclosures of which are hereby incorporated by reference in their entireties).

5.3. Libraries of Small Molecules

[0066] Libraries screened using the methods of the present invention can comprise a variety of types of test compounds. In some embodiments, the test compounds are nucleic acid or peptide molecules. In a non-limiting example, peptide molecules can exist in a phage display library. In other embodiments, types of test compounds include, but are not limited to, peptide analogs including peptides comprising non-naturally occurring amino acids, e.g., D-amino acids, phosphorous analogs of amino acids, such as α-amino phosphoric acids and α-amino phosphoric acids, or amino acids having non-peptide linkages, nucleic acid analogs such as phosphorothioates and PNAs, hormones, antigens, synthetic or naturally occurring drugs, opiates, dopamine, serotonin, catecholamines, thrombin, acetylcholine, prostaglandins, organic molecules, pheromones, adenosine, sucrose, glucose, lactose and galactose. Libraries of polypeptides or proteins can also be used.

[0067] In a preferred embodiment, the combinatorial libraries are small organic molecule libraries, such as, but not limited to, benzodiazepines, isoprenoids, thiazolidinones, metathiazanones, pyrrolidines, morpholino compounds, and diazepindiones. In another embodiment, the combinatorial libraries comprise peptoids; random bio-oligomers; diversomers such as hydantoins, benzodiazepines and dipeptides; vinylogous polypeptides; nonpeptidal peptidomimetics; oligocarbamates; peptidyl phosphonates; peptide nucleic acid libraries; antibody libraries; or carbohydrate libraries. Combinatorial libraries are themselves commercially available (see, e.g., Advanced ChemTech Europe Ltd., Cambridgeshire, UK; ASINEX, Moscow Russia; BioFocus plc, Sittingbourne, UK; Bionet Research (A division of Key Organics Limited), Camelford, UK; ChemBridge Corporation, San Diego, Calif.; ChemDiv Inc, San Diego, Calif.; ChemRx Advanced Technologies, South San Francisco, Calif.; ComGenex Inc., Budapest, Hungary; Evotec OAI Ltd, Abingdon, UK; IF LAB Ltd., Kiev, Ukraine; Maybridge plc, Cornwall, UK; PharmaCore, Inc., North Carolina; SIDDCO Inc, Tucson, Ariz.; TimTec Inc, Newark, Delaware; Tripos Receptor Research Ltd, Bude, UK; Toslab, Ekaterinburg, Russia).

[0068] In one embodiment, the combinatorial compound library for the methods of the present invention may be synthesized. There is a great interest in synthetic methods directed toward the creation of large collections of small organic compounds, or libraries, which could be screened for pharmacological, biological or other activity (Dolle, 2001, J. Comb. Chem. 3:477-517; Hall etal., 2001, J. Comb. Chem. 3:125-150; Dolle, 2000, J. Comb. Chem. 2:383-433; Dolle, 1999, J. Comb. Chem. 1:235-282). The synthetic methods applied to create vast combinatorial libraries are performed in solution or in the solid phase, i.e., on a solid support. Solid-phase synthesis makes it easier to conduct multi-step reactions and to drive reactions to completion with high yields because excess reagents can be easily added and washed away after each reaction step. Solid-phase combinatorial synthesis also tends to improve isolation, purification and screening. However, the more traditional solution phase chemistry supports a wider variety of organic reactions than solid-phase chemistry. Methods and strategies for the synthesis of combinatorial libraries can be found in A Practical Guide to Combinatorial Chemistry, A. W. Czarnik and S. H. Dewitt, eds., American Chemical Society, 1997; The Combinatorial Index, B. A. Bunin, Academic Press, 1998; Organic Synthesis on Solid Phase, F. Z. Dörwald, Wiley-VCH, 2000; and Solid-Phase Organic Syntheses, Vol. 1, A. W. Czarnik, ed., Wiley Interscience, 2001.

[0069] Combinatorial compound libraries of the present invention may be synthesized using apparatuses described in U.S. Pat. No. 6,358,479 to Frisina et al., U.S. Pat. No. 6,190,619 to Kilcoin et al., U.S. Pat. No. 6,132,686 to Gallup et al., U.S. Pat. No. 6,126,904 to Zuellig et al., U.S. Pat. No. 6,074,613 to Harness et al., U.S. Pat. No. 6,054,100 to Stanchfield et al., and U.S. Pat. No. 5,746,982 to Saneii et al. which are hereby incorporated by reference in their entirety. These patents describe synthesis apparatuses capable of holding a plurality of reaction vessels for parallel synthesis of multiple discrete compounds or for combinatorial libraries of compounds.

[0070] In one embodiment, the combinatorial compound library can be synthesized in solution. The method disclosed in U.S. Pat. No. 6,194,612 to Boger et al., which is hereby incorporated by reference in its entirety, features compounds useful as templates for solution phase synthesis of combinatorial libraries. The template is designed to permit reaction products to be easily purified from unreacted reactants using liquid/liquid or solid/liquid extractions. The compounds produced by combinatorial synthesis using the template will preferably be small organic molecules. Some compounds in the library may mimic the effects of non-peptides or peptides. In contrast to solid phase synthesize of combinatorial compound libraries, liquid phase synthesis does not require the use of specialized protocols for monitoring the individual steps of a multistep solid phase synthesis (Egner et al., 1995, J. Org. Chem. 60:2652; Anderson et al., 1995, J. Org. Chem. 60:2650; Fitch et al., 1994, J. Org. Chem. 59:7955; Look et al., 1994, J. Org. Chem. 49:7588; Metzger et al., 1993, Angew. Chem., Int. Ed. Engl. 32:894; Youngquist et al., 1994, Rapid Commun. Mass Spect. 8:77; Chu et al., 1995, J. Am. Chem. Soc. 117:5419; Brummel et al., 1994, Science 264:399; Stevanovic et al., 1993, Bioorg. Med. Chem. Lett. 3:431).

[0071] Combinatorial compound libraries useful for the methods of the present invention can be synthesized on solid supports. In one embodiment, a split synthesis method, a protocol of separating and mixing solid supports during the synthesis, is used to synthesize a library of compounds on solid supports (see Lam et al., 1997, Chem. Rev. 97:41-448; Ohlmeyer et al., 1993, Proc. Natl. Acad. Sci. USA 90:10922-10926 and references cited therein). Each solid support in the final library has substantially one type of test compound attached to its surface. Other methods for synthesizing combinatorial libraries on solid supports, wherein one product is attached to each support, will be known to those of skill in the art (see, e.g., Nefzi et al., 1997, Chem. Rev. 97:449-472 and U.S. Pat. No. 6,087,186 to Cargill et al. which are hereby incorporated by reference in their entirety).

[0072] As used herein, the term “solid support” is not limited to a specific type of solid support. Rather a large number of supports are available and are known to one skilled in the art. Solid supports include silica gels, resins, derivatized plastic films, glass beads, cotton, plastic beads, polystyrene beads, alumina gels, and polysaccharides. A suitable solid support may be selected on the basis of desired end use and suitability for various synthetic protocols. For example, for peptide synthesis, a solid support can be a resin such as p-methylbenzhydrylamine (PMBHA) resin (Peptides International, Louisville, Ky.), polystyrenes (e.g., PAM-resin obtained from Bachem Inc., Peninsula Laboratories, etc.), including chloromethylpolystyrene, hydroxymethylpolystyrene and aminomethylpolystyrene, poly (dimethylacrylamide)-grafted styrene co-divinyl-benzene (e.g, POLYHIPE resin, obtained from Aminotech, Canada), polyamide resin (obtained from Peninsula Laboratories), polystyrene resin grafted with polyethylene glycol (e.g., TENTAGEL or ARGOGEL, Bayer, Tubingen, Germany) polydimethylacrylamide resin (obtained from Milligen/Biosearch, California), or Sepharose (Pharmacia, Sweden).

[0073] In one embodiment, the solid phase support is suitable for in vivo use, i.e., it can serve as a carrier or support for administration of the test compound to a patient (e.g., TENTAGEL, Bayer, Tubingen, Germany). In a particular embodiment, the solid support is palatable and/or orally ingestable.

[0074] In some embodiments of the present invention, compounds can be attached to solid supports via linkers. Linkers can be integral and part of the solid support, or they may be nonintegral that are either synthesized on the solid support or attached thereto after synthesis. Linkers are useful not only for providing points of test compound attachment to the solid support, but also for allowing different groups of molecules to be cleaved from the solid support under different conditions, depending on the nature of the linker. For example, linkers can be, inter alia, electrophilically cleaved, nucleophilically cleaved, photocleavable, enzymatically cleaved, cleaved by metals, cleaved under reductive conditions or cleaved under oxidative conditions.

[0075] In another embodiment, the combinatorial compound libraries can be assembled in situ using dynamic combinatorial chemistry as described in European Patent Application 1,118,359 Al to Lehn; Huc & Nguyen, 2001, Comb. Chem. High Throughput. Screen. 4:53-74; Lehn and Eliseev, 2001, Science 291:2331-2332; Cousins et al. 2000, Curr. Opin. Chem. Biol. 4: 270-279; and Karan & Miller, 2000, Drug. Disc. Today 5:67-75 which are incorporated by reference in their entirety.

[0076] Dynamic combinatorial chemistry uses non-covalent interaction with a target biomolecule, including but not limited to a protein, RNA, or DNA, to favor assembly of the most tightly binding molecule that is a combination of constituent subunits present as a mixture in the presence of the biomolecule. According to the laws of thermodynamics, when a collection of molecules is able to combine and recombine at equilibrium through reversible chemical reactions in solution, molecules, preferably one molecule, that bind most tightly to a templating biomolecule will be present in greater amount than all other possible combinations. The reversible chemical reactions include, but are not limited to, imine, acyl-hydrazone, amide, acetal, or ester formation between carbonyl-containing compounds and amines, hydrazines, or alcohols; thiol exchange between disulfides; alcohol exchange in borate esters; Diels-Alder reactions; thermal- or photoinduced sigmatropic or electrocyclic rearrangements; or Michael reactions.

[0077] In the preferred embodiment of this technique, the constituent components of the dynamic combinatorial compound library are allowed to combine and reach equilibrium in the absence of the target RNA and then incubated in the presence of the target RNA, preferably at physiological conditions, until a second equilibrium is reached. The second, perturbed, equilibrium (the so-called “templated mixture”) can, but need not necessarily, be fixed by a further chemical transformation, including but not limited to reduction, oxidation, hydrolysis, acidification, or basification, to prevent restoration of the original equilibrium when the dynamical combinatorial compound library is separated from the target RNA.

[0078] In the preferred embodiment of this technique, the predominant product or products of the templated dynamic combinatorial library can separated from the minor products and directly identified. In another embodiment, the identity of the predominant product or products can be identified by a deconvolution strategy involving preparation of derivative dynamic combinatorial libraries, as described in European Patent Application 1,118,359 A1, which is incorporated by reference in their entirety, whereby each component of the mixture is, preferably one-by-one but possibly group-wise, left out of the mixture and the ability of the derivative library mixture at chemical equilibrium to bind the target RNA is measured. The components whose removal most greatly reduces the ability of the derivative dynamic combinatorial library to bind the target RNA are likely the components of the predominant product or products in the original dynamic combinatorial library.

5.4. Library Screening

[0079] After a target nucleic acid, such as but not limited to RNA or DNA, is labeled and a test compound library is synthesized or purchased or both, the labeled target nucleic acid is used to screen the library to identify test compounds that bind to the nucleic acid. Screening comprises contacting a labeled target nucleic acid with an individual, or small group, of the components of the compound library. Preferably, the contacting occurs in an aqueous solution, and most preferably, under physiologic conditions. The aqueous solution preferably stabilizes the labeled target nucleic acid and prevents denaturation or degradation of the nucleic acid without interfering with binding of the test compounds. The aqueous solution can be similar to the solution in which a complex between the target RNA and its corresponding host cell factor (if known) is formed in vitro. For example, TK buffer, which is commonly used to form Tat protein-TAR RNA complexes in vitro, can be used in the methods of the invention as an aqueous solution to screen a library of test compounds for TAR RNA binding compounds.

[0080] The methods of the present invention for screening a library of test compounds preferably comprise contacting a test compound with a target nucleic acid in the presence of an aqueous solution, the aqueous solution comprising a buffer and a combination of salts, preferably approximating or mimicking physiologic conditions. The aqueous solution optionally further comprises non-specific nucleic acids, such as, but not limited to, DNA; yeast tRNA; salmon sperm DNA; homoribopolymers such as, but not limited to, poly IC, polyA, polyU, and polyC; and non-specific RNA. The non-specific RNA may be an unlabeled target nucleic acid having a mutation at the binding site, which renders the unlabeled nucleic acid incapable of interacting with a test compound at that site. For example, if dye-labeled TAR RNA is used to screen a library, unlabeled TAR RNA having a mutation in the uracil 23/cytosine 24 bulge region may also be present in the aqueous solution. Without being bound by any theory, the addition of unlabeled RNA that is essentially identical to the dye-labeled target RNA except for a mutation at the binding site might minimize interactions of other regions of the dye-labeled target RNA with test compounds or with the solid support and prevent false positive results.

[0081] The solution further comprises a buffer, a combination of salts, and optionally, a detergent or a surfactant. The pH of the solution typically ranges from about 5 to about 8, preferably from about 6 to about 8, most preferably from about 6.5 to about 8. A variety of buffers may be used to achieve the desired pH. Suitable buffers include, but are not limited to, Tris, Mes, Bis-Tris, Ada, Aces, Pipes, Mopso, Bis-Tris propane, Bes, Mops, Tes, Hepes, Dipso, Mobs, Tapso, Trizma, Heppso, Popso, TEA, Epps, Tricine, Gly-Gly, Bicine, and sodium-potassium phosphate. The buffering agent comprises from about 10 mM to about 100 mM, preferably from about 25 mM to about 75 mM, most preferably from about 40 mM to about 60 mM buffering agent. The pH of the aqeuous solution can be optimized for different screening reactions, depending on the target RNA used and the types of test compounds in the library, and therefore, the type and amount of the buffer used in the solution can vary from screen to screen. In a preferred embodiment, the aqueous solution has a pH of about 7.4, which can be achieved using about 50 mM Tris buffer.

[0082] In addition to an appropriate buffer, the aqueous solution further comprises a combination of salts, from about 0 mM to about 100 mM KCl, from about 0 mM to about 1 M NaCl, and from about 0 mM to about 200 mM MgCl2. In a preferred embodiment, the combination of salts is about 100 mM KCl, 500 mM NaCl, and 10 mM MgCl2. Without being bound by any theory, Applicant has found that a combination of KCl, NaCl, and MgCl2 stabilizes the target RNA such that most of the RNA is not denatured or digested over the course of the screening reaction. The optional concentration of each salt used in the aqueous solution is dependent on the particular target RNA used and can be determined using routine experimentation.

[0083] The solution optionally comprises from about 0.01% to about 0.5% (w/v) of a detergent or a surfactant. Without being bound by any theory, a small amount of detergent or surfactant in the solution might reduce non-specific binding of the target RNA to the solid support and control aggregation and increase stability of target RNA molecules. Typical detergents useful in the methods of the present invention include, but are not limited to, anionic detergents, such as salts of deoxycholic acid, 1-heptanesulfonic acid, N-laurylsarcosine, lauryl sulfate, 1-octane sulfonic acid and taurocholic acid; cationic detergents such as benzalkonium chloride, cetylpyridinium, methylbenzethonium chloride, and decamethonium bromide; zwitterionic detergents such as CHAPS, CHAPSO, alkyl betaines, alkyl amidoalkyl betaines, N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate, and phosphatidylcholine; and non-ionic detergents such as n-decyl a-D-glucopyranoside, n-decyl β-D-maltopyranoside, n-dodecyl β-D-maltoside, n-octyl β-D-glucopyranoside, sorbitan esters, n-tetradecyl β-D-maltoside, octylphenoxy polyethoxyethanol (Nonidet P-40), nonylphenoxypolyethoxyethanol (NP-40), and tritonis. Preferably, the detergent, if present, is a nonionic detergent. Typical surfactants useful in the methods of the present invention include, but are not limited to, ammonium lauryl sulfate, polyethylene glycols, butyl glucoside, decyl glucoside, Polysorbate 80, lauric acid, myristic acid, palmitic acid, potassium palmitate, undecanoic acid, lauryl betaine, and lauryl alcohol. More preferably, the detergent, if present, is Triton X-100 and present in an amount of about 0.1% (w/v).

[0084] Non-specific binding of a labeled target nucleic acid to test compounds can be further minimized by treating the binding reaction with one or more blocking agents. In one embodiment, the binding reactions are treated with a blocking agent, e.g., bovine serum albumin (“BSA”), before contacting with to.the labeled target nucleic acid. In another embodiment, the binding reactions are treated sequentially with at least two different blocking agents. This blocking step is preferably performed at room temperature for from about 0.5 to about 3 hours. In a subsequent step, the reaction mixture is further treated with unlabeled RNA having a mutation at the binding site. This blocking step is preferably performed at about 4° C. for from about 12 hours to about 36 hours before addition of the dye-labeled target RNA. Preferably, the solution used in the one or more blocking steps is substantially similar to the aqueous solution used to screen the library with the dye-labeled target RNA, e.g., in pH and salt concentration.

[0085] Once contacted, the mixture of labeled target nucleic acid and the test compound is preferably maintained at 4° C. for from about 1 day to about 5 days, preferably from about 2 days to about 3 days with constant agitation. To identify the reactions in which binding to the labeled target nucleic acid occurred, after the incubation period, bound from free compounds are determined using an electrophoretic technique (see Section 5.5.1), or any of the methods disclosed in Section 5.5 infra. In another embodiment, the complexed target nucleic acid does not need to be separated from the free target nucleic acid if a technique (i.e., spectrometry) that diferentiates between bound and unbound target nucleic acids is used.

[0086] The methods for identifying small molecules bound to labeled nucleic acid will vary with the type of label on the target nucleic acid. For example, if a target RNA is labeled with a visible of fluorescent dye, the target RNA complexes are preferably identified using a chromatographic technique that separates bound from free target by an electrophoretic or size differential technique using individual reactions. The reactions corresponding to changes in the migration of the complexed RNA can be cross-referenced to the small molecule compound(s) added to said reaction. Alternatively, complexed target RNA can be screened en masse and then separated from free target RNA using an electrophoretic or size differential technique, the resultant complexed target is then analyzed using a mass spectrometric technique. In this fashion the bound small molecule can be identified on the basis of its molecular weight. In this reaction a priori knowledge of the exact molecular weights of all compounds within the library is known. In another embodiment, the test compounds bound to the target nucleic acid may not require separation from the unbound target nucleic acid if a technique such as, but not limited to, spectrometry is used.

5.5. Separation Methods for Screening Test Compounds

[0087] Any method that detects an altered physical property of a target nucleic acid complexed to a test compound from the unbound target nucleic acid may be used for separation of the complexed and non-complexed target nucleic acids. Methods that can be utilized for the physical separation of complexed target RNA from unbound target RNA include, but are not limited to, electrophoresis, fluorescence spectroscopy, surface plasmon resonance, mass spectrometry, scintillation, proximity assay, structure-activity relationships (“SAR”) by NMR spectroscopy, size exclusion chromatography, affinity chromatography, and nanoparticle aggregation.

5.5.1. Electrophoresis

[0088] Methods for separation of the complex of a target RNA bound to a test compound from the unbound RNA comprises any method of electrophoretic separation, including but not limited to, denaturing and non-denaturing polyacrylamide gel electrophoresis, urea gel electrophoresis, gel filtration, pulsed field gel electrophoresis, two dimensional gel electrophoresis, continuous flow electrophoresis, zone electrophoresis, agarose gel electrophoresis, and capillary electrophoresis.

[0089] In a preferred embodiment, an automated electrophoretic system comprising a capillary cartridge having a plurality of capillary tubes is used for high-throughput screening of test compounds bound to target RNA. Such an apparatus for performing automated capillary gel electrophoresis is disclosed in U.S. Pat. Nos. 5,885,430; 5,916,428; 6,027,627; and 6,063,251, the disclosures of which are incorporated by reference in their entireties.

[0090] The device disclosed in U.S. Pat. No. 5,885,430, which is incorporated by reference in its entirety, allows one to simultaneously introduce samples into a plurality of capillary tubes directly from microtiter trays having a standard size. U.S. Pat. No. 5,885,430 discloses a disposable capillary cartridge which can be cleaned between electrophoresis runs, the cartridge having a plurality of capillary tubes. A first end of each capillary tube is retained in a mounting plate, the first ends collectively forming an array in the mounting plate. The spacing between the first ends corresponds to the spacing between the centers of the wells of a microtiter tray having a standard size. Thus, the first ends of the capillary tubes can simultaneously be dipped into the samples present in the tray's wells. The cartridge is provided with a second mounting plate in which the second ends of the capillary tubes are retained. The second ends of the capillary tubes are arranged in an array which corresponds to the wells in the microtiter tray, which allows for each capillary tube to be isolated from its neighbors and therefore free from cross-contamination, as each end is dipped into an individual well.

[0091] Plate holes may be provided in each mounting plate and the capillary tubes inserted through these plate holes. In such a case, the plate holes are sealed airtight so that the side of the mounting plate having the exposed capillary ends can be pressurized. Application of a positive pressure in the vicinity of the capillary openings in this mounting plate allows for the introduction of air and fluids during electrophoretic operations and also can be used to force out gel and other materials from the capillary tubes during reconditioning. The capillary tubes may be protected from damage using a needle comprising a cannula and/or plastic tubes, and the like when they are placed in these plate holes. When metallic cannula or the like are used, they can serve as electrical contacts for current flow during electrophoresis. In the presence of a second mounting plate, the second mounting plate is provided with plate holes through which the second ends of the capillary tubes project. In this instance, the second mounting plate serves as a pressure containment member of a pressure cell and the second ends of the capillary tubes communicate with an internal cavity of the pressure cell. The pressure cell is also formed with an inlet and an outlet. Gels, buffer solutions, cleaning agents, and the like may be introduced into the internal cavity through the inlet, and each of these can simultaneously enter the second ends of the capillaries.

[0092] In another preferred embodiment, the automated electrophoretic system can comprise a chip system consisting of complex designs of interconnected channels that perform and analyze enzyme reactions using part of a channel design as a tiny, continuously operating electrophoresis material, where reactions with one sample are going on in one area of the chip while electrophoretic separation of the products of another sample is taking place in a different part of the chip. Such a system is disclosed in U.S. Pat. Nos. 5,699,157; 5,842,787; 5,869,004; 5,876,675; 5,942,443; 5,948,227; 6,042,709; 6,042,710; 6,046,056; 6,048,498; 6,086,740; 6,132,685; 6,150,119; 6,150,180; 6,153,073; 6,167,910; 6,171,850; and 6,186,660, the disclosures of which are incorporated by reference in their entireties.

[0093] The system disclosed in U.S. Pat. No. 5,699,157, which is hereby incorporated by reference in its entirety, provides for a microfluidic system for high-speed electrophoretic analysis of subject materials for applications in the fields of chemistry, biochemistry, biotechnology, molecular biology and numerous other areas. The system has a channel in a substrate, a light source and a photoreceptor. The channel holds subject materials in solution in an electric field so that the materials move through the channel and separate into bands according to species. The light source excites fluorescent light in the species bands and the photoreceptor is arranged to receive the fluorescent light from the bands. The system further has a means for masking the channel so that the photoreceptor can receive the fluorescent light only at periodically spaced regions along the channel. The system also has an unit connected to analyze the modulation frequencies of light intensity received by the photoreceptor so that velocities of the bands along the channel are determined, which allows the materials to be analyzed.

[0094] The system disclosed in U.S. Pat. No. 5,699,157 also provides for a method of performing high-speed electrophoretic analysis of subject materials, which comprises the steps of holding the subject materials in solution in a channel of a microfluidic system; subjecting the materials to an electric field so that the subject materials move through the channel and separate into species bands; directing light toward the channel; receiving light from periodically spaced regions along the channel simultaneously; and analyzing the frequencies of light intensity of the received light so that velocities of the bands along the channel can be determined for analysis of said materials. The determination of the velocity of a species band determines the electrophoretic mobility of the species and its identification.

[0095] U.S. Pat. No. 5,842,787, which is hereby incorporated by reference in its entirety, is generally directed to devices and systems employ channels having, at least in part, depths that are varied over those which have been previously described (such as the device disclosed in U.S. Pat. No. 5,699,157), wherein said channel depths provide numerous beneficial and unexpected results such as but not limited to, a reduction in sample perturbation, reduced non-specific sample mixture by diffusion, and increased resolution.

[0096] In another embodiment, the electrophoretic method of separation comprises polyacrylamide gel electrophoresis. In a preferred embodiment, the polyacrylamide gel electrophoresis is non-denaturing, so as to differentiate the mobilities of the target RNA bound to a test compound from free target RNA. If the polyacrylamide gel electrophoresis is denaturing, then the target RNA:test compound complex must be cross-linked prior to electrophoresis to prevent the disassociation of the target RNA from the test compound during electrophoresis. Such techniques are well known to one of skill in the art.

[0097] In one embodiment of the method, the binding of test compounds to target nucleic acid can be detected, preferably in an automated fashion, by gel electrophoretic analysis of interference footprinting. RNA can be degraded at specific base sites by enzymatic methods such as ribonucleases A, U2, CL3, T1, Phy M, and B. cereus or chemical methods such as diethylpyrocarbonate, sodium hydroxide, hydrazine, piperidine formate, dimethyl sulfate, [2,12-dimethyl-3,7,11,17-tetraazacyclo[11.3.1]heptadeca-1(17),2,11,13,15-pentaenato] nickel(II) (NiCR), cobalt(II)chloride, or iron(II) ethylenediaminetetraacetate (Fe-EDTA) as described for example in Zheng et al., 1999, Biochem. 37:2207-2214; Latham & Cech, 1989, Science 245:276-282; and Sambrook et al., 2001, in Molecular Cloning: A Laboratory Manual, pp 12.61-12.73, Cold Spring Harbor Laboratory Press, and the references cited therein, which are hereby incorporated by reference in their entireties. The specific pattern of cleavage sites is determined by the accessibility of particular bases to the reagent employed to initiate cleavage and, as such, is therefore is determined by the three-dimensional structure of the RNA.

[0098] The interaction of small molecules with a target nucleic acid can change the accessibility of bases to these cleavage reagents both by causing conformational changes in the target nucleic acid or by covering a base at the binding interface. When a test compound binds to the nucleic acid and changes the accessibility of bases to cleavage reagents, the observed cleavage pattern will change. This method can be used to identify and characterize the binding of small molecules to RNA as described, for example, by Prudent et al., 1995, J. Am. Chem. Soc. 117:10145-10146 and Mei et al., 1998, Biochem. 37:14204-14212.

[0099] In the preferred embodiment of this technique, the detectably labeled target nucleic acid is incubated with an individual test compound and then subjected to treatment with a cleavage reagent, either enzymatic or chemical. The reaction mixture can be preferably be examined directly, or treated further to isolate and concentrate the nucleic acid. The fragments produced are separated by electrophoresis and the pattern of cleavage can be compared to a cleavage reaction performed in the absence of test compound. A change in the cleavage pattern directly indicates that the test compound binds to the target nucleic acid. Multiple test compounds can be examined both in parallel and serially.

[0100] Other embodiments of electrophoretic separation include, but are not limited to urea gel electrophoresis, gel filtration, pulsed field gel electrophoresis, two dimensional gel electrophoresis, continuous flow electrophoresis, zone electrophoresis, and agarose gel electrophoresis.

5.5.2. Fluorescence Spectroscopy

[0101] In a preferred embodiment, fluorescence polarization spectroscopy, an optical detection method that can differentiate the proportion of a fluorescent molecule that is either bound or unbound in solution (e.g., the labeled target nucleic acid of the present invention), can be used to read reaction results without electrophoretic separation of the samples. Fluorescence polarization spectroscopy can be used to read the reaction results in the chip system disclosed in U.S. Pat. Nos. 5,699,157; 5,842,787; 5,869,004; 5,876,675; 5,942,443; 5,948,227; 6,042,709; 6,042,710; 6,046,056; 6,048,498; 6,086,740; 6,132,685; 6,150,119; 6,150,180; 6,153,073; 6,167,910; 6,171,850; and 6,186,660, the disclosures of which are incorporated by reference in their entireties. The application of fluorescence polarization spectroscopy to the chip system disclosed in the U.S. Patents listed supra is fast, efficient, and well-adapted for high-throughput screening.

[0102] In another embodiment, a compound that has an affinity for the target nucleic acid of interest can be labeled with a fluorophore to screen for test compounds that bind to the target nucleic acid. For example, a pyrene-containing aminoglycoside analog was used to accurately monitor antagonist binding to a prokaryotic 16S rRNA A site (which comprises the natural target for arninoglycoside antibiotics) in a screen using a fluorescence quenching technique in a 96-well plate format (Hamasaki & Rando, 1998, Anal. Biochem. 261(2):183-90).

[0103] In another embodiment, fluorescence resonance energy transfer (FRET) can be used to screen for test compounds that bind to the target nucleic acid. FRET, a characteristic change in fluorescence, occurs when two fluorophores with overlapping emission and excitation wavelength bands are held together in close proximity, such as by a binding event. In the preferred embodiment, the fluorophore on the target nucleic acid and the fluorophore on the test compounds will have overlapping excitation and emission spectra such that one fluorophore (the donor) transfers its emission energy to excite the other fluorophore (the acceptor). The acceptor preferably emits light of a different wavelength upon relaxing to the ground state, or relaxes non-radiatively to quench fluorescence. FRET is very sensitive to the distance between the two fluorophores, and allows measurement of molecular distances less than 10 nm. For example, U.S, Pat. No. 6,337,183 to Arenas et al., which is incorporated by reference in its entirety, describes a screen for compounds that bind RNA that uses FRET to measure the effect of test compounds on the stability of a target RNA molecule where the target RNA is labeled with both fluorescent acceptor and donor molecules and the distance between the two fluorophores as determined by FRET provides a measure of the folded structure of the RNA. Matsumoto et al. (2000, Bioorg. Med. Chem. Lett. 10:1857-1861) describe a system where a peptide that binds to HIV-1 TAR RNA is labeled on one end with a fluorescein fluorophore and a tetramethylrhodamine on the other end. The conformational change of the peptide upon binding to the RNA provided a FRET signal to screen for compounds that bound to the TAR RNA.

[0104] In the preferred embodiment, both the target nucleic acid and a compound that has an affinity for the target nucleic acid of interest are labeled with fluorophores with overlapping emission and excitation spectra (donor and acceptor), including but not limited to fluorescein and derivatives, rhodamine and derivatives, cyanine dyes and derivatives, bora-3a,4a-diaza-s-indacene (BODIPY®) and derivatives, pyrene, nanoparticles, or non-fluorescent quenching molecules. Binding of a labeled test compound to the target nucleic acid can be identified by the change in observable fluorescence as a result of FRET.

[0105] If the target nucleic acid is labeled with the donor fluorophore, then the test compounds is labeled with the acceptor fluorophore. Conversely, if the target nucleic acid is labeled with the acceptor fluorophore, then the test compounds is labeled with the donor fluorophore. A wide variety of labels may be used, with the choice of label depending on sensitivity required, ease of conjugation with the compound, stability requirements, available instrumentation, and disposal provisions. The fluorophore on the target nucleic acid must be in close proximity to the binding site of the test compounds, but should not be incorporated into a target nucleic acid at the specific binding site at which test compounds are likely to bind, since the presence of a covalently attached label might interfere sterically or chemically with the binding of the test compounds at this site.

[0106] In yet another embodiment, homogeneous time-resolved fluorescence (“HTPF”) techniques based on time-resolved energy transfer from lanthanide ion complexes to a suitable acceptor species can be adapted for high-throughput screening for inhibitors of RNA-protein complexes (Hemmilä, 1999, J. Biomol. Screening 4:303-107; Mathis, 1999, J. Biomol. Screening 4:309-313). HTRF is similar to fluorescence resonance energy transfer using conventional organic dye pairs, but has several advantages, such as increased sensitivity and efficiency, and background elimination (Xavier et al., 2000, Trends Biotechnol. 18(8):349-356).

[0107] Fluorescence spectroscopy has traditionally been used to characterize DNA-protein and protein-protein interactions, but fluorescence spectroscopy has not been widely used to characterize RNA-protein interactions because of an interfering absorption of RNA nucleotides with the intrinsic tryptophan fluorescence of proteins (Xavier et al., 2000, Trends Biotechnol. 18(8):349-356.). However, fluorescence spectroscopy has been used in studying the: single tryptophan residue within the arginine-rich RNA-binding domain of Rev protein and its interaction with the RRE in a time-resolved fluorescence study (Kwon & Carson, 1998, Anal. Biochem. 264:133-140). Thus, in this invention, fluorescence spectroscopy is less preferred if the test compounds or peptides or proteins possess intrinsic tryptophan fluorescence. However, fluorescence spectroscopy can be used for test compounds that do not possess intrinsic fluorescence.

5.5.3. Surface Plasmon Resonance (“SPR”)

[0108] Surface plasmon resonance (SPR) can be used for determining kinetic rate constants and equilibrium constants for macromolecular interactions by following the association project in “real time” (Schuck, 1997, Annu. Rev. Biophys. Biomol. Struct. 26:541-566).

[0109] The principle of SPR is summarized by Xavier et al. (Trends Biotechnol., 2000, 18(8):349-356) as follows. Total internal reflection occurs at the boundary between two substances of different refractive index. The incident light's electromagnetic field penetrates beyond the interface as an evanescent wave, which extends a few hundred nanometers beyond the surface into the medium. Insertion of a thin gold foil at the interace produced SPR owing to the absorption of the energy from the evanescent wave by free electron clouds of the metal (plasmons). As a result of this absorbance, there is a drop in the intensity of the reflected light at a particular angle of incidence. The evanescent wave profile depends exquisitely on the refractive index of the medium it probes. Thus, the angle at which absorption occurs is very sensitive to the refractive changes in the external medium. All proteins and nucleic acids are known to change the refractive index of water by a similar amount per unit mass, irrespective of their amino acid or nucleotide composition (the refractive index change is different for proteins and nucleic acids). When the protein or nucleic acid content of the layer at the sensor changes, the refractive index also changes. Typically, one member of a complex is immobilized in a dextran layer and then the other member is introduced into the solution, either in a flow cell (Biacore AB, Uppsala, Sweden) or a stirred cuvette (Affinity Sensors, Santa Fe, N. Mex.). It has been determined that there is a linear correlation between the surface concentration of protein or nucleic acid and the shift in resonance angle, which can be used to quantitate kinetic rate constants and/or the equilibrium constants.

[0110] In the present invention, the target RNA may be immobilized to the sensor surface through a streptavidin-biotin linkage, the linkage of which is disclosed by Crouch et al. (Methods Mol. Biol., 1999, 118:143-160). The RNA is biotinylated either during synthesis or post-synthetically via the conversion of the 3′ terminal ribonucleoside of the RNA into a reactive free amino group or using a T7 polymerase incorporated guanosine monophosphorothioate at the 5′ end. SPR has been used to determine the stoichiometry and affinity of the interaction between the HIV Rev protein and the RRE (Van Ryk & Venkatesan, 1999, J. Biol. Chem. 274:17452-17463) and the aminoglycoside antibiotics with RRE and a model RNA derived from the 16S ribosomal A site, respectively (Hendrix et al., 1997, J. Am. Chem. Soc. 119:3641-3648; Wong et al., 1998, Chem. Biol. 5:397-406).

[0111] In one embodiment of the present invention, the target nucleic acid can be immobilized to a sensor surface (e.g., by a streptavidin-biotin linkage) and SPR can be used to (a) determine whether the target RNA binds a test compound and (b) further characterize the binding of the target nucleic acids of the present invention to a test compound.

5.5.4. Mass Spectrometry

[0112] An automated method for analyzing mass spectrometer data which can analyze complex mixtures containing many thousands of components and can correct for background noise, multiply charged peaks and atomic isotope peaks is described in U.S. Pat. No. 6,147,344, which is hereby incorporated by reference in its entirety. The system disclosed in U.S. Pat. No. 6,147,344 is a method for analyzing mass spectrometer data in which a control sample measurement is performed providing a background noise check. The peak height and width values at each m/z ratio as a finction of time are stored in a memory. A mass spectrometer operation on a material to be analyzed is performed and the peak height and width values at each m/z ratio versus time are stored in a second memory location. The mass spectrometer operation on the material to be analyzed is repeated a fixed number of times and the stored control sample values at each m/z ratio level at each time increment are subtracted from each corresponding one from the operational runs thus producing a difference value at each mass ratio for each of the multiple runs at each time increment. If the MS value minus the background noise does not exceed a preset value, the m/z ratio data point is not recorded, thus eliminating background noise, chemical noise and false positive peaks from the mass spectrometer data. The stored data for each of the multiple runs is then compared to a predetermined value at each m/z ratio and the resultant series of peaks, which are now determined to be above the background, is stored in the m/z points in which the peaks are of significance.

[0113] One possibility for the utilization of mass spectrometry in high throughput screening is the integration of SPR with mass spectrometry. Approaches that have been tried are direct analysis of the analyte retained on the sensor chip and mass spectrometry with the eluted analyte (Sonksen et al., 1998, Anal. Chem. 70:2731-2736; Nelson & Krone, 1999, J. Mol. Recog. 12:77-93). Further developments, especially in the interfacing of the sensor chip with the mass spectrometer and in reusing the sensor chip, are required to make SPR combined with mass spectroscopy a high-throughput method for biomolecular interaction analysis and the screening of targets for small molecule inhibitors (Xavier et al., 2000, Trends Biotechnol. 18(8):349-356).

[0114] In one embodiment of the present invention, the target nucleic acid complexed to a test compound can be determined by any of the mass spectrometry processed described supra. Furthermore, mass spectrometry can also be used to elucidate the structure of the test compound.

5.5.5. Scintillation Proximity Assay (“SPA”)

[0115] Scintillation Proximity Assay (“SPA”) is a method that can be used for screening small molecules that bind to the target RNAs. SPA would involve radiolabeling either the target RNA or the test compound and then quantitating its binding to the other member to a bead or a surface impregnated with a scintillant (Cook, 1996, Drug Discov. Today 1:287-294). Currently, fluorescence-based techniques are preferred for high-throughput screening (Pope et al., 1999, Drug Discov. Today 4:350-362).

[0116] Screening for small molecules that inhibit Tat peptide:TAR RNA interaction has been performed with SPA, and inhibitors of the interaction were isolated and characterized (Mei et al., 1997, Bioorg. Med. Chem. 5:1173-1184; Mei et al., 1998, Biochemistry 37:14204-14212). A similar approach can be used to identify small molecules that directly bind to a preselected target RNA element in accordance with the invention can be utilized.

[0117] SPA can be adapted to high throughput screening by the availability of microplates, wherein the scintillant is directly incorporated into the plastic of the microtiter wells (Nakayama et al., 1998, J. Biomol. Screening 3:43-48). Thus, one embodiment of the present invention comprises (a) labeling of the target nucleic acid with a radioactive or fluorescent label; (b) contacted the labeled nucleic acid with test compounds, wherein each test compound is in a microtiter well coated with scintillant and is tethered to the microtiter well; and (c) identifying and quantifying the test compounds bound to the target nucleic acid with SPA, wherein the test compound is identified by virtue of its location in the microplate.

5.5.6. Structure-Activity Relationships (“SAR”) by NMR Spectroscopy

[0118] NMR spectroscopy is a valuable technique for identifying complexed target nucleic acids by qualitatively determining changes in chemical shift, specifically from distances measured using relaxation effects, and NMR-based approaches have been used in the identification of small molecule binders of protein drug targets (Xavier et al., 2000, Trends Biotechnol. 18(8):349-356). The determination of structure-activity relationships (“SAR”) by NMR is the first method for NMR described in which small molecules that bind adjacent subsites are identified by two-dimentional 1H-15N spectra of the target protein (Shuker et al., 1996, Science 274:1531-1534). The signal from the bound molecule is monitored by employing line broadening, transferred NOEs and pulsed field gradient diffusion measurements (Moore, 1999, Curr. Opin. Biotechnol. 10:54-58). A strategy for lead generation by NMR using a library of small molecules has been recently described (Fejzo et al., 1999, Chem. Biol. 6:755-769).

[0119] In one embodiment of the present invention, the target nucleic acid complexed to a test compound can be determined by SAR by NMR. Furthermore, SAR by NMR can also be used to elucidate the structure of the test compound.

5.5.7. Size Exclusion Chromatography

[0120] In another embodiment of the present invention, size-exclusion chromatography is used to purify test compounds that are bound to a target nucleic from a complex mixture of compounds. Size-exclusion chromatography separates molecules based on their size and uses gel-based media comprised of beads with specific size distributions. When applied to a column, this media settles into a tightly packed matrix and forms a complex array of pores. Separation is accomplished by the inclusion or exclusion of molecules by these pores based on molecular size. Small molecules are included into the pores and, consequently, their migration through the matrix is retarded due to the added distance they must travel before elution. Large molecules are excluded from the pores and migrate with the void volume when applied to the matrix. In the present invention, a target nucleic acid is incubated with a mixture of test compounds while free in solution and allowed to reach equilibrium. When applied to a size exclusion column, test compounds free in solution are retained by the column, and test compounds bound to the target nucleic acid are passed through the column. In a preferred embodiment, spin columns commonly used for “desalting” of nucleic acids will be employed to separate bound from unbound test compounds (e.g., Bio-Spin columns manufactured by BIO-RAD). In another embodiment, the size exclusion matrix is packed into multiwell plates to allow high throughput separation of mixtures (e.g., PLASMID 96-well SEC plates manufactured by Millipore).

5.5.8. Affinity Chromatography

[0121] In one embodiment of the present invention, affinity capture is used to purify test compounds that are bound to a target nucleic acid labeled with an affinity tag from a complex mixture of compounds. To accomplish this, a target nucleic acid labeled with an affinity tag is incubated with a mixture of test compounds while free in solution and then captured to a solid support once equilibrium has been established; alternatively, target nucleic acids labeled with an affinity tag can be captured to a solid support first and then allowed to reach equilibrium with a mixture of test compounds.

[0122] The solid support is typically comprised of, but not limited to, cross-linked agarose beads that are coupled with a ligand for the affinity tag. Alternatively, the solid support may be a glass, silicon, metal, or carbon, plastic (polystyrene, polypropylene) surface with or without a self-assembled monolayer (SAM) either with a covalently attached ligand for the affinity tag, or with inherent affinity for the tag on the target nucleic acid.

[0123] Once the complex between the target nucleic acid and test compound has reached equilibrium and has been captured, one skilled in the art will appreciate that the retention of bound compounds and removal of unbound compounds is facilitated by washing the solid support with large excesses of binding reaction buffer. Furthermore, retention of high affinity compounds and removal of low affinity compounds can be accomplished by a number of means that increase the stringency of washing; these means include, but are not limited to, increasing the number and duration of washes, raising the salt concentration of the wash buffer, addition of detergent or surfactant to the wash buffer, and addition of non-specific competitor to the wash buffer.

[0124] In one embodiment, the test compounds themselves are detectably labeled with fluorescent dyes, radioactive isotopes, or nanoparticles. When the test compounds are applied to the captured target nucleic acid in a spatially addressed fashion (e.g., in separate wells of a 96-well microplate), binding between the test compounds and the target nucleic acid can be determined by the presence of the detectable label on the test compound using fluorescence.

[0125] Following the removal of unbound compounds, bound compounds with high affinity for the target nucleic acid can be eluted from the immobilized target nucleic acids and analyzed. The elution of test compounds can be accomplished by any means that break the non-covalent interactions between the target nucleic acid and compound. Means for elution include, but are not limited to, hanging the pH, changing the salt concentration, the application of organic solvents, and the application of molecules that compete with the bound ligand. In a preferred embodiment, the means employed for elution will release the compound from the target RNA, but will not effect the interaction between the affinity tag and the solid support, thereby achieving selective elution of test compound. Moreover, a preferred embodiment will employ an elution buffer that is volatile to allow for subsequent concentration by lyophilization of the eluted compound (e.g., 0 M to 5 M ammonium acetate).

5.5.9. Nanoparticle Aggregation

[0126] In one embodiment of the present invention, both the target nucleic acid and the test compounds are labeled with nanoparticles. A nanoparticle is a cluster of ions with controlled size from 0.1 to 1000 nm comprised of metals, metal oxides, or semiconductors including, but not limited to Ag2S, ZnS, CdS, CdTe, Au, or TiO2. Methods for the attachment of nucleic acids and small molecules to nanoparticles are well know to one of skill in the art (reviewed in Niemeyer, 2001, Angew. Chem. Int. Ed. 40:4129-4158. The references cited therein are hereby incorporated by reference in their entireties). In particular, if multiple copies of the target nucleic acid are attached to a single nanoparticle and multiple copies of a test compound are attached to another nanoparticle, then interaction between the test compound and target nucleic acid will induce aggregation of nanoparticles as described, for example, by Mitchel et al. 1999, J. Am. Chem. Soc. 121:8122-8123. The aggregate can be detected by changes in absorbance or fluorescence spectra and physically separated from the unbound components through filtration or centrifugation.

5.6. Methods for Identifying or Characterizing the Test Compounds Bound to the Target Nucleic Acids

[0127] If the library comprises arrays or microarrays of test compounds, wherein each test compound has an address or identifier, the test compound can be deconvoluted, e.g., by cross-referencing the positive sample to original compound list that was applied to the individual test assays.

[0128] If the library is a peptide or nucleic acid library, the sequence of the test compound can be determined by direct sequencing of the peptide or nucleic acid. Such methods are well known to one of skill in the art.

[0129] A number of physico-chemical techniques can be used for the de novo characterization of test compounds bound to the target.

5.6.1. Mass Spectrometry

[0130] Mass spectrometry (e.g., electrospray ionization (“ESI”) and matrix-assisted laser desorption-ionization (“MALDI”), Fourier-transform ion cyclotron resonance (“FT-ICR”)) can be used both for high-throughput screening of test compounds that bind to a target RNA and elucidating the structure of the test compound. Thus, one example of mass spectroscopy is that separation of a bound and unbound complex and test compound structure elucidation can be carried out in a single step.

[0131] MALDI uses a pulsed laser for desorption of the ions and a time-of-flight analyzer, and has been used for the detection of noncovalent tRNA:amino-acyl-tRNA synthetase complexes (Gruic-Sovulj et al., 1997, J. Biol. Chem. 272:32084-32091). However, covalent cross-linking between the target nucleic acid and the test compound is required for detection, since a non-covalently bound complex may dissociate during the MALDI process.

[0132] ESI mass spectrometry (“ESI-MS”) has been of greater utility for studying non-covalent molecular interactions because, unlike the MALDI process, ESI-MS generates molecular ions with little to no fragmentation (Xavier et al., 2000, Trends Biotechnol. 18(8):349-356). ESI-MS has been used to study the complexes formed by HIV Tat peptide and protein with the TAR RNA (Sannes-Lowery et al., 1997, Anal. Chem. 69:5130-5135).

[0133] Fourier-transform ion cyclotron resonance (“FT-ICR”) mass spectrometry provides high-resolution spectra, isotope-resolved precursor ion selection, and accurate mass assignments (Xavier et al., 2000, Trends Biotechnol. 18(8):349-356). FT-ICR has been used to study the interaction of aminoglycoside antibiotics with cognate and non-cognate RNAs (Hofstadler et al., 1999, Anal. Chem. 71:3436-3440; Griffey et al., 1999, Proc. Natl. Acad. Sci. USA 96:10129-10133). As true for all of the mass spectrometry methods discussed herein, FT-ICR does not require labeling of the target RNA or a test compound.

[0134] An advantage of mass spectroscopy is not only the elucidation of the structure of the test compound, but also the determination of the structure of the test compound bound to the preselected target RNA. Such information can enable the discovery of a consensus structure of a test compound that specifically binds to a preselected target RNA.

5.6.2. NMR Spectroscopy

[0135] As described above, NMR spectroscopy is a technique for identifying binding sites in target nucleic acids by qualitatively determining changes in chemical shift, specifically from distances measured using relaxation effects. Examples of NMR that can be used for the invention include, but are not limited to, one-dimentional NMR, two-dimentional NMR, correlation spectroscopy (“COSY”), and nuclear Overhauser effect (“NOE”) spectroscopy. Such methods of structure determination of test compounds are well known to one of skill in the art.

[0136] Similar to mass spectroscopy, an advantage of NMR is the not only the elucidation of the structure of the test compound, but also the determination of the structure of the test compound bound to the preselected target RNA. Such information can enable the discovery of a consensus structure of a test compound that specifically binds to a preselected target RNA.

5.6.3. Vibrational Spectroscopy

[0137] Vibrational spectroscopy (e.g. infrared (IR) spectroscopy or Raman spectroscopy) can be used for elucidating the structure of the test compound on the isolated bead.

[0138] Infrared spectroscopy measures the frequencies of infrared light (wavelengths from 100 to 10,000 nm) absorbed by the test compound as a result of excitation of vibrational modes according to quantum mechanical selection rules which require that absorption of light cause a change in the electric dipole moment of the molecule. The infrared spectrum of any molecule is a unique pattern of absorption wavelengths of varying intensity that can be considered as a molecular fingerprint to identify any compound.

[0139] Infrared spectra can be measured in a scanning mode by measuring the absorption of individual frequencies of light, produced by a grating which separates frequencies from a mixed-frequency infrared light source, by the test compound relative to a standard intensity (double-beam instrument) or pre-measured (‘blank’) intensity (single-beam instrument). In a preferred embodiment, infrared spectra are measured in a pulsed mode (FT-IR) where a mixed beam, produced by an interferometer, of all infrared light frequencies is passed through or reflected off the test compound. The resulting interferogram, which may or may not be added with the resulting interferograms from subsequent pulses to increase the signal strength while averaging random noise in the electronic signal, is mathematically transformed into a spectrum using Fourier Transform or Fast Fourier Transform algorithms.

[0140] Raman spectroscopy measures the difference in frequency due to absorption of infrared frequencies of scattered visible or ultraviolet light relative to the incident beam. The incident monochromatic light beam, usually a single laser frequency, is not truly absorbed by the test compound but interacts with the electric field transiently. Most of the light scattered off the sample with be unchanged (Rayleigh scattering) but a portion of the scatter light will have frequencies that are the sum or difference of the incident and molecular vibrational frequencies. The selection rules for Raman (inelastic) scattering require a change in polarizability of the molecule. While some vibrational transitions are observable in both infrared and Raman spectrometry, must are observable only with one or the other technique. The Raman spectrum of any molecule is a unique pattern of absorption wavelengths of varying intensity that can be considered as a molecular fingerprint to identify any compound.

[0141] Raman spectra are measured by submitting monochromatic light to the sample, either passed through or preferably reflected off, filtering the Rayleigh scattered light, and detecting the frequency of the Raman scattered light. An improved Raman spectrometer is described in U.S. Pat. No. 5,786,893 to Fink et al., which is hereby incorporated by reference.

[0142] Vibrational microscopy can be measured in a spatially resolved fashion to address single beads by integration of a visible microscope and spectrometer. A microscopic infrared spectrometer is described in U.S. Pat. No. 5,581,085 to Reffner et al., which is hereby incorporated by reference in its entirety. An instrument that simultaneously performs a microscopic infrared and microscopic Raman analysis on a sample is described in U.S. Pat. No. 5,841,139 to Sostek et al., which is hereby incorporated by reference in its entirety.

[0143] In the preferred embodiment, test compounds can be identified by matching the IR or Raman spectra of a test compound to a dataset of vibrational (IR or Raman) spectra previously acquired for each compound in the combinatorial library. By this method, the spectra of compounds with known structure are recorded so that comparison with these spectra can identify compounds again when isolated from RNA binding experiments.

5.7. Secondary Biological Screens

[0144] The test compounds identified in the binding assay (for convenience referred to herein as a “lead” compound) can be tested for biological activity using host cells containing or engineered to contain the target RNA element coupled to a functional readout system. For example, the lead compound can be tested in a host cell engineered to contain the target RNA element controlling the expression of a reporter gene. In this example, the lead compounds are assayed in the presence or absence of the target RNA. Alternatively, a phenotypic or physiological readout can be used to assess activity of the target RNA in the presence and absence of the lead compound.

[0145] In one embodiment, the lead compound can be tested in a host cell engineered to contain the target RNA element controlling the expression of a reporter gene, such as, but not limited to, β-galactosidase, green fluorescent protein, red fluorescent protein, luciferase, chloramphenicol acetyltransferase, alkaline phosphatase, and β-lactamase. In a preferred embodiment, a cDNA encoding the target element is fused upstream to a reporter gene wherein translation of the reporter gene is repressed upon binding of the lead compound to the target RNA. In other words, the steric hindrance caused by the binding of the lead compound to the target RNA repressed the translation of the reporter gene. This method, termed the translational repression assay procedure (“TRAP”) has been demonstrated in E. coli and S. cerevisiae (Jain & Belasco, 1996, Cell 87(1):115-25; Huang & Schreiber, 1997, Proc. Natl. Acad. Sci. USA 94:13396-13401).

[0146] In another embodiment, a phenotypic or physiological readout can be used to assess activity of the target RNA in the presence and absence of the lead compound. For example, the target RNA may be overexpressed in a cell in which the target RNA is endogenously expressed. Where the target RNA controls expression of a gene product involved in cell growth or viability, the in vivo effect of the lead compound can be assayed by measuring the cell growth or viability of the target cell. Alternatively, a reporter gene can also be fused downstream of the target PNA sequence and the effect of the lead compound on reporter gene expression can be assayed.

[0147] Alternatively, the lead compounds identified in the binding assay can be tested for biological activity using animal models for a disease, condition, or syndrome of interest. These include animals engineered to contain the target RNA element coupled to a functional readout system, such as a transgenic mouse. Animal model systems can also be used to demonstrate safety and efficacy.

[0148] Compounds displaying the desired biological activity can be considered to be lead compounds, and will be used in the design of congeners or analogs possessing useful pharmacological activity and physiological profiles. Following the identification of a lead compound, molecular modeling techniques can be employed, which have proven to be useful in conjunction with synthetic efforts, to design variants of the lead that can be more effective. These applications may include, but are lot limited to, Pharmacophore Modeling (cf. Lamothe, et al. 1997, J. Med. Chem. 40: 3542; Mottola et al. 1996, J. Med. Chem. 39: 285; Beusen et al. 1995, Biopolymers 36: 181; P. Fossa et al. 1998, Comput. Aided Mol. Des. 12: 361), QSAR development (cf Siddiqui et al. 1999, J. Med. Chem. 42: 4122; Barreca et al. 1999 Bioorg. Med. Chem. 7: 2283; Kroemer et al. 1995, J. Med. Chem. 4917; Schaal et al. 2001, J. Med. Chem. 44: 155; Buolamwini & Assefa 2002, J. Mol. Chem. 45: 84), Virtual docking and screening/scoring (cf Anzini et al. 2001, J. Med. Chem. 44: 1134; Faaland et al. 2000, Biochem. Cell. Biol. 78: 415; Silvestri et al 2000, Bioorg. Med. Chem. 8: 2305; J. Lee et al 2001, Bioorg. Med. Chem. 9: 19), and Structure Prediction using RNA structural programs including, but not limited to mFold (as described by Zuker et al. Algorithms and Thermodynamics for RNA Secondary Structure Prediction: A Practical Guide in RNA Biochemistry and Biotechnology pp. 11-43, J. Barciszewski & B. F. C. Clark, eds. (NATO ASI Series, Kluwer Academic Publishers, 1999) and Mathews et al. 1999 J. Mol. Biol. 288: 911-940); RNAmotif (Macke et al. 2001, Nucleic Acids Res. 29: 4724-4735; and the Vienna RNA package (Hofacker et al. 1994, Monatsh. Chem. 125: 167-188).

[0149] Further examples of the application of such techniques can be found in several review articles, such as Rotivinen et al., 1988, Acta Pharmaceutical Fennica 97:159-166; Ripka, 1998, New Scientist 54-57; McKinaly & Rossmann, 1989, Annu. Rev. Pharmacol. Toxiciol. 29:111-122; Perry & Davies, QSAR: Quantitative Structure-Activity Relationships in Drug Design pp. 189-193 (Alan R. Liss, Inc. 1989); Lewis & Dean, 1989, Proc. R. Soc. Lond. 236:125-140 and 141-162; Askew et al., 1989, J. Am. Chem. Soc. 111: 1082-1090. Molecular modeling tools employed may include those from Tripos, Inc., St. Louis, Mo. (e.g., Sybyl/UNITY, CONCORD, DiverseSolutions), Accelerys, San Diego, Calif. (e.g., Catalyst, Wisconsin Package {BLAST, etc.}), Schrodinger, Portland, Oreg. (e.g., QikProp QikFit, Jaguar) or other such vendors as BioDesign, Inc. (Pasadena, Calif.), Allelix, Inc. (Mississauga, Ontario, Canada), and Hypercube, Inc. (Cambridge, Ontario, Canada), and may include privately designed and/or “academic” software (e.g. RNAMotif, MFOLD). These application suites and programs include tools for the atomistic construction and analysis of structural models for drug-like molecules, proteins, and DNA or RNA and their potential interactions. They also provide for the calculation of important physical properties, such as solubility estimates, permeability metrics, and empirical measures of molecular “druggability” (e.g., Lipinski “Rule of 5” as described by Lipinski et al. 1997, Adv. Drug Delivery Rev. 23: 3-25). Most importantly, they provide appropriate metrics and statistical modeling power (such as the patented CoMFA technology in Sybyl as described in U.S. Pat. Nos. 6,240,374 and 6,185,506) to develop Quantitative Structural Activity Relationships (QSARs) which are used to guide the synthesis of more efficacious clinical development candidates while improving desirable physical properties, as determined by results from the aforementioned secondary screening protocols.

5.8. Use of Identified Compounds That Bind RNA to Treat/Prevent Disease

[0150] Biologically active compounds identified using the methods of the invention or a pharmaceutically acceptable salt thereof can be administered to a patient, preferably a mammal, more preferably a human, suffering from a disease whose progression is associated with a target RNA:host cell factor interaction in vivo. In certain embodiments, such compounds or a pharmaceutically acceptable salt thereof is administered to a patient, preferably a mammal, more preferably a human, as a preventative measure against a disease associated with an RNA:host cell factor interaction in vivo.

[0151] In one embodiment, “treatment” or “treating” refers to an amelioration of a disease, or at least one discernible symptom thereof. In another embodiment, “treatment” or “treating” refers to an amelioration of at least one measurable physical parameter, not necessarily discernible by the patient. In yet another embodiment, “treatment” or “treating” refers to inhibiting the progression of a disease, either physically, e.g., stabilization of a discernible symptom, physiologically, e.g., stabilization of a physical parameter, or both. In yet another embodiment, “treatment” or “treating” refers to delaying the onset of a disease.

[0152] In certain embodiments, the compound or a pharmaceutically acceptable salt thereof is administered to a patient, preferably a manmial, more preferably a human, as a preventative measure against a disease associated with an RNA:host cell factor interaction in vivo. As used herein, “prevention” or “preventing” refers to a reduction of the risk of acquiring a disease. In one embodiment, the compound or a pharmaceutically acceptable salt thereof is administered as a preventative measure to a patient. According to this embodiment, the patient can have a genetic predisposition to a disease, such as a family history of the disease, or a non-genetic predisposition to the disease. Accordingly, the compound and pharmaceutically acceptable salts thereof can be used for the treatment of one manifestation of a disease and prevention of another.

[0153] When administered to a patient, the compound or a pharmaceutically acceptable salt thereof is preferably administered as component of a composition that optionally comprises a pharmaceutically acceptable vehicle. The composition can be administered orally, or by any other convenient route, for example, by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal, and intestinal mucosa, etc.) and may be administered together with another biologically active agent. Administration can be systemic or local. Various delivery systems are known, e.g., encapsulation in liposomes, microparticles, microcapsules, capsules, etc., and can be used to administer the compound and pharmaceutically acceptable salts thereof.

[0154] Methods of administration include but are not limited to intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, oral, sublingual, intranasal, intracerebral, intravaginal, transdermal, rectally, by inhalation, or topically, particularly to the ears, nose, eyes, or skin. The mode of administration is left to the discretion of the practitioner. In most instances, administration will result in the release of the compound or a pharmaceutically acceptable salt thereof into the bloodstream.

[0155] In specific embodiments, it may be desirable to administer the compound or a pharmaceutically acceptable salt thereof locally. This may be achieved, for example, and not by way of limitation, by local infusion during surgery, topical application, e.g., in conjunction with a wound dressing after surgery, by injection, by means of a catheter, by means of a suppository, or by means of an implant, said implant being of a porous, non-porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers.

[0156] In certain embodiments, it may be desirable to introduce the compound or a pharmaceutically acceptable salt thereof into the central nervous system by any suitable route, including intraventricular, intrathecal and epidural injection. Intraventricular injection may be facilitated by an intraventricular catheter, for example, attached to a reservoir, such as an Ommaya reservoir.

[0157] Pulmonary administration can also be employed, e.g., by use of an inhaler or nebulizer, and formulation with an aerosolizing agent, or via perfusion in a fluorocarbon or synthetic pulmonary surfactant. In certain embodiments, the compound and pharmaceutically acceptable salts thereof can be formulated as a suppository, with traditional binders and vehicles such as triglycerides.

[0158] In another embodiment, the compound and pharmaceutically acceptable salts thereof can be delivered in a vesicle, in particular a liposome (see Langer, 1990, Science 249:1527-1533; Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 353-365 (1989); Lopez-Berestein, ibid., pp. 317-327; see generally ibid.).

[0159] In yet another embodiment, the compound and pharmaceutically acceptable salts thereof can be delivered in a controlled release system (see, e.g., Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115-138 (1984)). Other controlled-release systems discussed in the review by Langer, 1990, Science 249:1527-1533) may be used. In one embodiment, a pump may be used (see Langer, supra; Sefton, 1987, CRC Crit. Ref. Biomed. Eng. 14:201; Buchwald et al., 1980, Surgery 88:507 Saudek et al, 1989, N. Engl. J. Med. 321:574). In another embodiment, polymeric materials can be used (see Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Fla. (1974); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, 1983, J. Macromol. Sci. Rev. Macromol. Chem. 23:61; see also Levy et al., 1985, Science 228:190; During et al., 1989, Ann. Neurol. 25:351; Howard etal., 1989, J. Neurosurg. 71:105). In yet another embodiment, a controlled-release system can be placed in proximity of a target RNA of the compound or a pharmaceutically acceptable salt thereof, thus requiring only a fraction of the systemic dose.

[0160] Compositions comprising the compound or a pharmaceutically acceptable salt thereof (“compound compositions”) can additionally comprise a suitable amount of a pharmaceutically acceptable vehicle so as to provide the form for proper administration to the patient.

[0161] In a specific embodiment, the term “pharmaceutically acceptable” means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, mammals, and more particularly in humans. The term “vehicle” refers to a diluent, adjuvant, excipient, or carrier with which a compound of the invention is administered. Such pharmaceutical vehicles can be liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. The pharmaceutical vehicles can be saline, gum acacia, gelatin, starch paste, talc, keratin, colloidal silica, urea, and the like. In addition, auxiliary, stabilizing, thickening, lubricating and coloring agents may be used. When administered to a patient, the pharmaceutically acceptable vehicles are preferably sterile. Water is a preferred vehicle when the compound of the invention is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid vehicles, particularly for injectable solutions. Suitable pharmaceutical vehicles also include excipients such as starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. Compound compositions, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents.

[0162] Compound compositions can take the form of solutions, suspensions, emulsion, tablets, pills, pellets, capsules, capsules containing liquids, powders, sustained-release formulations, suppositories, emulsions, aerosols, sprays, suspensions, or any other form suitable for use. In one embodiment, the pharmaceutically acceptable vehicle is a capsule (see e.g., U.S. Pat. No. 5,698,155). Other examples of suitable pharmaceutical vehicles are described in Remington's Pharmaceutical Sciences, Alfonso R. Gennaro, ed., Mack Publishing Co. Easton, Pa., 19th ed., 1995, pp. 1447 to 1676, incorporated herein by reference.

[0163] In a preferred embodiment, the compound or a pharmaceutically acceptable salt thereof is formulated in accordance with routine procedures as a pharmaceutical composition adapted for oral administration to human beings. Compositions for oral delivery may be in the form of tablets, lozenges, aqueous or oily suspensions, granules, powders, emulsions, capsules, syrups, or elixirs, for example. Orally administered compositions may contain one or more agents, for example, sweetening agents such as fructose, aspartame or saccharin; flavoring agents such as peppermint, oil of wintergreen, or cherry; coloring agents; and preserving agents, to provide a pharmaceutically palatable preparation. Moreover, where in tablet or pill form, the compositions can be coated to delay disintegration and absorption in the gastrointestinal tract thereby providing a sustained action over an extended period of time. Selectively permeable membranes surrounding an osmotically active driving compound are also suitable for orally administered compositions. In these later platforms, fluid from the environment surrounding the capsule is imbibed by the driving compound, which swells to displace the agent or agent composition through an aperture. These delivery platforms can provide an essentially zero order delivery profile as opposed to the spiked profiles of immediate release formulations. A time delay material such as glycerol monostearate or glycerol stearate may also be used. Oral compositions can include standard vehicles such as mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, and the like. Such vehicles are preferably of pharmaceutical grade. Typically, compositions for intravenous administration comprise sterile isotonic aqueous buffer. Where necessary, the compositions may also include a solubilizing agent.

[0164] In another embodiment, the compound or a pharmaceutically acceptable salt thereof can be formulated for intravenous administration. Compositions for intravenous administration may optionally include a local anesthetic such as lignocaine to lessen pain at the site of the injection. Generally, the ingredients are supplied either separately or mix ed together in unit dosage form, for example, as a dry lyophilized powder or water-free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent. Where the compound or a pharmaceutically acceptable salt thereof is to be administered by infusion, it can be dispensed, for example, with an infusion bottle containing sterile pharmaceutical grade water or saline. Where the compound or a pharmaceutically acceptable salt thereof is administered by injection, an ampoule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration.

[0165] The amount of a compound or a pharmaceutically acceptable salt thereof that will be effective in the treatment of a particular disease will depend on the nature of the disease, and can be determined by standard clinical techniques. In addition, in vitro or in vivo assays may optionally be employed to help identify optimal dosage ranges. The precise dose to be employed will also depend on the route of administration, and the seriousness of the disease, and should be decided according to the judgment of the practitioner and each patient's circumstances. However, suitable dosage ranges for oral administration are generally about 0.001 milligram to about 200 milligrams of a compound or a pharmaceutically acceptable salt thereof per kilogram body weight per day. In specific preferred embodiments of the invention, the oral dose is about 0.01 milligram to about 100 milligrams per kilogram body weight per day, more preferably about 0.1 milligram to about 75 milligrams per kilogram body weight per day, more preferably about 0.5 milligram to 5 milligrams per kilogram body weight per day. The dosage amounts described herein refer to total amounts administered; that is, if more than one compound is administered, or if a compound is administered with a therapeutic agent, then the preferred dosages correspond to the total amount administered. Oral compositions preferably contain about 10% to about 95% active ingredient by weight.

[0166] Suitable dosage ranges for intravenous (i.v.) administration are about 0.01 milligram to about 100 milligrams per kilogram body weight per day, about 0.1 milligram to about 35 milligrams per kilogram body weight per day, and about 1 milligram to about 10 milligrams per kilogram body weight per day. Suitable dosage ranges for intranasal administration are generally about 0.01 pg/kg body weight per day to about 1 mg/kg body weight per day. Suppositories generally contain about 0.01 milligram to about 50 milligrams of a compound of the invention per kilogram body weight per day and comprise active ingredient in the range of about 0.5% to about 10% by weight.

[0167] Recommended dosages for intradermal, intramuscular, intraperitoneal, subcutaneous, epidural, sublingual, intracerebral, intravaginal, transdermal administration or administration by inhalation are in the range of about 0.001 milligram to about 200 milligrams per kilogram of body weight per day. Suitable doses for topical administration are in the range of about 0.001 milligram to about 1 milligram, depending on the area of administration. Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model test systems. Such animal models and systems are well known in the art.

[0168] The compound and pharmaceutically acceptable salts thereof are preferably assayed in vitro and in vivo, for the desired therapeutic or prophylactic activity, prior to use in humans. For example, in vitro assays can be used to determine whether it is preferable to administer the compound, a pharmaceutically acceptable salt thereof, and/or another therapeutic agent. Animal model systems can be used to demonstrate safety and efficacy.

[0169] A variety of compounds can be used for treating or preventing diseases in mammals. Types of compounds include, but are not limited to, peptides, peptide analogs including peptides comprising non-natural amino acids, e.g., D-amino acids, phosphorous analogs of amino acids, such as a-amino phosphonic acids and a-amino phosphinic acids, or amino acids having non-peptide linkages, nucleic acids, nucleic acid analogs such as phosphorothioates or peptide nucleic acids (“PNAs”), hormones, antigens, synthetic or naturally occurring drugs, opiates, dopamine, serotonin, catecholamines, thrombin, acetylcholine, prostaglandins, organic molecules, pheromones, adenosine, sucrose, glucose, lactose and galactose.

6. EXAMPLE: THERAPEUTIC TARGETS

[0170] The therapeutic targets presented herein are by way of example, and the present invention is not to be limited by the targets described herein. The therapeutic targets presented herein as DNA sequences are understood by one of skill in the art that the sequences can be converted to RNA sequences.

6.1. Tumor Necrosis Factor Alpha (“TNF-α”)

[0171] GenBank Accession # X01394:

1	gcagaggacc agctaagagg gagagaagca actacagacc ccccctgaaa acaaccctca	(SEQ ID NO: 6)
61	gacgccacat cccctgacaa gctgccaggc aggttctctt cctctcacat actgacccac
121	ggctccaccc tctctcccct ggaaaggaca ccatgagcac tgaaagcatg atccgggacg
181	tggagctggc cgaggaggcg ctccccaaga agacaggggg gccccagggc tccaggcggt
241	gcttgttcct cagcctcttc tccttcctga tcgtggcagg cgccaccacg ctcttctgcc
301	tgctgcactt tggagtgatc ggcccccaga gggaagagtt ccccagggac ctctctctaa
361	tcagccctct ggcccaggca gtcagatcat cttctcgaac cccgagtgac aagcctgtag
421	cccatgttgt agcaaaccct caagctgagg ggcagctcca gtggctgaac cgccgggcca
481	atgccctcct ggccaatggc gtggagctga gagataacca gctggtggtg ccatcagagg
541	gcctgtacct catctactcc caggtcctct tcaagggcca aggctgcccc tccacccatg
601	tgctcctcac ccacaccatc agccgcatcg ccgtctccta ccagaccaag gtcaacctcc
661	tctctgccat caagagcccc tgccagaggg agaccccaga gggggctgag gccaagccct
721	ggtatgagcc catctatctg ggaggggtct tccagctgga gaagggtgac cgactcagcg
781	ctgagatcaa tcggcccgac tatctcgact ttgccgagtc tgggcaggtc tactttggga
841	tcattgccct gtgaggagga cgaacatcca accttcccaa acgcctcccc tgccccaatc
901	cctttattac cccctccttc agacaccctc aacctcttct ggctcaaaaa gagaattggg
961	ggcttagggt cggaacccaa gcttagaact ttaagcaaca agaccaccac ttcgaaacct
1021	gggattcagg aatgtgtggc ctgcacagtg aattgctggc aaccactaag aattcaaact
1081	ggggcctcca gaactcactg gggcctacag ctttgatccc tgacatctgg aatctggaga
1141	ccagggagcc tttggttctg gccagaatgc tgcaggactt gagaagacct cacctagaaa
1201	ttgacacaag tggaccttag gccttcctct ctccagatgt ttccagactt ccttgagaca
1261	cggagcccag ccctccccat ggagccagct ccctctattt atgtttgcac ttgtgattat
1321	ttattattta tttattattt atttatttac agatgaatgt atttatttgg gagaccgggg
1381	tatcctgggg gacccaatgt aggagctgcc ttggctcaga catgttttcc gtgaaaacgg
1441	agctgaacaa taggctgttc ccatgtagcc ccctggcctc tgtgccttct tttgattatg
1501	ttttttaaaa tatttatctg attaagttgt ctaaacaatg ctgatttggt gaccaactgt
1561	cactcattgc tgagcctctg ctccccaggg gagttgtgtc tgtaatcgcc ctactattca
1621	gtggcgagaa ataaagtttg ctt

[0172] General Target Regions:

[0173] (1) 5′ Untranslated Region—nts 1-152

[0174] (2) 3′ Untranslated Region—nts 852-1643

[0175] Initial Specific Target Motif:

Group I AU-Rich Element (ARE) Cluster in 3′ untranslated region
5′ AUUUAUUUAUUUAUUUAUUUA 3′ (SEQ ID NO: 1)

6.2. Granulocyte-macrophage Colony Stimulating Factor (“GM-CSF”)

[0176] GenBank Accession #NM—000758:

1	gctggaggat gtggctgcag agcctgctgc tcttgggcac tgtggcctgc agcatctctg	(SEQ ID NO: 7)
61	cacccgcccg ctcgcccagc cccagcacgc agccctggga gcatgtgaat gccatccagg
121	aggcccggcg tctcctgaac ctgagtagag acactgctgc tgagatgaat gaaacagtag
181	aagtcatctc agaaatgttt gacctccagg agccgacctg cctacagacc cgcctggagc
241	tgtacaagca gggcctgcgg ggcagcctca ccaagctcaa gggccccttg accatgatgg
301	ccagccacta caagcagcac tgccctccaa ccccggaaac ttcctgtgca acccagacta
361	tcacctttga aagtttcaaa gagaacctga aggactttct gcttgtcatc ccctttgact
421	gctgggagcc agtccaggag tgagaccggc cagatgaggc tggccaagcc ggggagctgc
481	tctctcatga aacaagagct agaaactcag gatggtcatc ttggagggac caaggggtgg
541	gccacagcca tggtgggagt ggcctggacc tgccctgggc cacactgacc ctgatacagg
601	catggcagaa gaatgggaat attttatact gacagaaatc agtaatattt atatatttat
661	atttttaaaa tatttattta tttatttatt taagttcata ttccatattt attcaagatg
721	ttttaccgta ataattatta ttaaaaatat gcttct

[0177] GenBank Accession #XM—003751:

1	tctggaggat gtggctgcag agcctgctgc tcttgggcac tgtggcctgc agcatctctg	(SEQ ID NO: 8)
61	cacccgcccg ctcgcccagc cccagcacgc agccctggga gcatgtgaat gccatccagg
121	aggcccggcg tctcctgaac ctgagtagag acactgctgc tgagatgaat gaaacagtag
181	aagtcatctc agaaatgttt gacctccagg agccgacctg cctacagacc cgcctggagc
241	tgtacaagca gggcctgcgg ggcagcctca ccaagctcaa gggccccttg accatgatgg
301	ccagccacta caagcagcac tgccctccaa ccccggaaac ttcctgtgca acccagacta
361	tcacctttga aagtttcaaa gagaacctga aggactttct gcttgtcatc ccctttgact
421	gctgggagcc agtccaggag tgagaccggc cagatgaggc tggccaagcc ggggagctgc
481	tctctcatga aacaagagct agaaactcag gatggtcatc ttggagggac caaggggtgg
541	gccacagcca tggtgggagt ggcctggacc tgccctgggc cacactgacc ctgatacagg
601	catggcagaa gaatgggaat attttatact gacagaaatc agtaatattt atatatttat
661	atttttaaaa tatttattta tttatttatt taagttcata ttccatattt attcaagatg
721	ttttaccgta ataattatta ttaaaaatat gcttct

[0178] General Target Regions:

[0179] (1) 5′ Untranslated Region—nts 1-32

[0180] (2) 3′ Untranslated Region—nts 468-789

[0181] Initial Specific Target Motif:

[0182] Group I AU-Rich Element (ARE) Cluster in 3′ untranslated region 5′ AUUUAUUUAUUUAUUUAUUUA 3′ (SEQ ID NO: 1)

6.3. Interleukin 2 (“IL-2”)

[0183] GenBank Accession #U25676:

1	atcactctct ttaatcacta ctcacattaa cctcaactcc tgccacaatg tacaggatgc	(SEQ ID NO: 9)
61	aactcctgtc ttgcattgca ctaattcttg cacttgtcac aaacagtgca cctacttcaa
121	gttcgacaaa gaaaacaaag aaaacacagc tacaactgga gcatttactg ctggatttac
181	agatgatttt gaatggaatt aataattaca agaatcccaa actcaccagg atgctcacat
241	ttaagtttta catgcccaag aaggccacag aactgaaaca gcttcagtgt ctagaagaag
301	aactcaaacc tctggaggaa gtgctgaatt tagctcaaag caaaaacttt cacttaagac
361	ccagggactt aatcagcaat atcaacgtaa tagttctgga actaaaggga tctgaaacaa
421	cattcatgtg tgaatatgca gatgagacag caaccattgt agaatttctg aacagatgga
481	ttaccttttg tcaaagcatc atctcaacac taacttgata attaagtgct tcccacttaa
541	aacatatcag gccttctatt tatttattta aatatttaaa ttttatattt attgttgaat
601	gtatggttgc tacctattgt aactattatt cttaatctta aaactataaa tatggatctt
661	ttatgattct ttttgtaagc cctaggggct ctaaaatggt ttaccttatt tatcccaaaa
721	atatttatta ttatgttgaa tgttaaatat agtatctatg tagattggtt agtaaaacta
781	tttaataaat ttgataaata taaaaaaaaa aaacaaaaaa aaaaa

[0184] General Target Regions:

[0185] (1) 5′ Untranslated Region—nts 1-47

[0186] (2) 3′ Untranslated Region—nts 519-825

[0187] Initial Specific Target Motifs:

Group III AU-Rich Element (ARE) Cluster in 3′ untranslated region
5′NAUUUAUUUAUUUAN 3′ (SEQ ID NO: 10)

6.4. Interleukin 6 (“IL-6”)

[0188] GenBank Accession #NM—000600:

1	ttctgccctc gagcccaccg ggaacgaaag agaagctcta tctcgcctcc aggagcccag	(SEQ ID NO: 11)
61	ctatgaactc cttctccaca agcgccttcg gtccagttgc cttctccctg gggctgctcc
121	tggtgttgcc tgctgccttc cctgccccag tacccccagg agaagattcc aaagatgtag
181	ccgccccaca cagacagcca ctcacctctt cagaacgaat tgacaaacaa attcggtaca
241	tcctcgacgg catctcagcc ctgagaaagg agacatgtaa caagagtaac atgtgtgaaa
301	gcagcaaaga ggcactggca gaaaacaacc tgaaccttcc aaagatggct gaaaaagatg
361	gatgcttcca atctggattc aatgaggaga cttgcctggt gaaaatcatc actggtcttt
421	tggagtttga ggtataccta gagtacctcc agaacagatt tgagagtagt gaggaacaag
481	ccagagctgt gcagatgagt acaaaagtcc tgatccagtt cctgcagaaa aaggcaaaga
541	atctagatgc aataaccacc cctgacccaa ccacaaatgc cagcctgctg acgaagctgc
601	aggcacagaa ccagtggctg caggacatga caactcatct cattctgcgc agctttaagg
661	agttcctgca gtccagcctg agggctcttc ggcaaatgta gcatgggcac ctcagattgt
721	tgttgttaat gggcattcct tcttctggtc agaaacctgt ccactgggca cagaacttat
781	gttgttctct atggagaact aaaagtatga gcgttaggac actattttaa ttatttttaa
841	tttattaata tttaaatatg tgaagctgag ttaatttatg taagtcatat ttatattttt
901	aagaagtacc acttgaaaca ttttatgtat tagttttgaa ataataatgg aaagtggcta
961	tgcagtttga atatcctttg tttcagagcc agatcatttc ttggaaagtg taggcttacc
1021	tcaaataaat ggctaactta tacatatttt taaagaaata tttatattgt atttatataa
1081	tgtataaatg gtttttatac caataaatgg cattttaaaa aattc

[0189] General Target Regions:

[0190] (1) 5′ Untranslated Region—nts 1-62

[0191] (2) 3′ Untranslated Region—nts 699-1125

[0192] Initial Specific Target Motifs:

Group III AU-Rich Element (ARE) Cluster in 3′ untranslated region
5′ NAUUUAUUUAUUUAN 3′ (SEQ ID NO: 10)

6.5. Vascular Endothelial Growth Factor (“VEGF”)

[0193] GenBank Accession #AF022375:

1	aagagctcca gagagaagtc gaggaagaga gagacggggt cagagagagc gcgcgggcgt	(SEQ ID NO: 12)
61	gcgagcagcg aaagcgacag gggcaaagtg agtgacctgc ttttgggggt gaccgccgga
121	gcgcggcgtg agccctcccc cttgggatcc cgcagctgac cagtcgcgct gacggacaga
181	cagacagaca ccgcccccag ccccagttac cacctcctcc ccggccggcg gcggacagtg
241	gacgcggcgg cgagccgcgg gcaggggccg gagcccgccc ccggaggcgg ggtggagggg
301	gtcggagctc gcggcgtcgc actgaaactt ttcgtccaac ttctgggctg ttctcgcttc
361	ggaggagccg tggtccgcgc gggggaagcc gagccgagcg gagccgcgag aagtgctagc
421	tcgggccggg aggagccgca gccggaggag ggggaggagg aagaagagaa ggaagaggag
481	agggggccgc agtggcgact cggcgctcgg aagccgggct catggacggg tgaggcggcg
541	gtgtgcgcag acagtgctcc agcgcgcgcg ctccccagcc ctggcccggc ctcgggccgg
601	gaggaagagt agctcgccga ggcgccgagg agagcgggcc gccccacagc ccgagccgga
661	gagggacgcg agccgcgcgc cccggtcggg cctccgaaac catgaacttt ctgctgtctt
721	gggtgcattg gagccttgcc ttgctgctct acctccacca tgccaagtgg tcccaggctg
781	cacccatggc agaaggagga gggcagaatc atcacgaagt ggtgaagttc atggatgtct
841	atcagcgcag ctactgccat ccaatcgaga ccctggtgga catcttccag gagtaccctg
901	atgagatcga gtacatcttc aagccatcct gtgtgcccct gatgcgatgc gggggctgct
961	ccaatgacga gggcctggag tgtgtgccca ctgaggagtc caacatcacc atgcagatta
1021	tgcggatcaa acctcaccaa ggccagcaca taggagagat gagcttccta cagcacaaca
1081	aatgtgaatg cagaccaaag aaagatagag caagacaaga aaatccctgt gggccttgct
1141	cagagcggag aaagcatttg tttgtacaag atccgcagac gtgtaaatgt tcctgcaaaa
1201	acacacactc gcgttgcaag gcgaggcagc ttgagttaaa cgaacgtact tgcagatgtg
1261	acaagccgag gcggtgagcc gggcaggagg aaggagcctc cctcagggtt tcgggaacca
1321	gatctctctc caggaaagac tgatacagaa cgatcgatac agaaaccacg ctgccgccac
1381	cacaccatca ccatcgacag aacagtcctt aatccagaaa cctgaaatga aggaagagga
1441	gactctgcgc agagcacttt gggtccggag ggcgagactc cggcggaagc attcccgggc
1501	gggtgaccca gcacggtccc tcttggaatt ggattcgcca ttttattttt cttgctgcta
1561	aatcaccgag cccggaagat tagagagttt tatttctggg attcctgtag acacacccac
1621	ccacatacat acatttatat atatatatat tatatatata taaaaataaa tatctctatt
1681	ttatatatat aaaatatata tattcttttt ttaaattaac agtgctaatg ttattggtgt
1741	cttcactgga tgtatttgac tgctgtggac ttgagttggg aggggaatgt tcccactcag
1801	atcctgacag ggaagaggag gagatgagag actctggcat gatctttttt ttgtcccact
1861	tggtggggcc agggtcctct cccctgccca agaatgtgca aggccagggc atgggggcaa
1921	atatgaccca gttttgggaa caccgacaaa cccagccctg gcgctgagcc tctctacccc
1981	aggtcagacg gacagaaaga caaatcacag gttccgggat gaggacaccg gctctgacca
2041	ggagtttggg gagcttcagg acattgctgt gctttgggga ttccctccac atgctgcacg
2101	cgcatctcgc ccccaggggc actgcctgga agattcagga gcctgggcgg ccttcgctta
2161	ctctcacctg cttctgagtt gcccaggagg ccactggcag atgtcccggc gaagagaaga
2221	gacacattgt tggaagaagc agcccatgac agcgcccctt cctgggactc gccctcatcc
2281	tcttcctgct ccccttcctg gggtgcagcc taaaaggacc tatgtcctca caccattgaa
2341	accactagtt ctgtcccccc aggaaacctg gttgtgtgtg tgtgagtggt tgaccttcct
2401	ccatcccctg gtccttccct tcccttcccg aggcacagag agacagggca ggatccacgt
2461	gcccattgtg gaggcagaga aaagagaaag tgttttatat acggtactta tttaatatcc
2521	ctttttaatt agaaattaga acagttaatt taattaaaga gtagggtttt ttttcagtat
2581	tcttggttaa tatttaattt caactattta tgagatgtat cttttgctct ctcttgctct
2641	cttatttgta ccggtttttg tatataaaat tcatgtttcc aatctctctc tccctgatcg
2701	gtgacagtca ctagcttatc ttgaacagat atttaatttt gctaacactc agctctgccc
2761	tccccgatcc cctggctccc cagcacacat tcctttgaaa gagggtttca atatacatct
2821	acatactata tatatattgg gcaacttgta tttgtgtgta tatatatata tatatgttta
2881	tgtatatatg tgatcctgaa aaaataaaca tcgctattct gttttttata tgttcaaacc
2941	aaacaagaaa aaatagagaa ttctacatac taaatctctc tcctttttta attttaatat
3001	ttgttatcat ttatttattg gtgctactgt ttatccgtaa taattgtggg gaaaagatat
3061	taacatcacg tctttgtctc tagtgcagtt tttcgagata ttccgtagta catatttatt
3121	tttaaacaac gacaaagaaa tacagatata tcttaaaaaa aaaaaa

[0194] General Target Regions:

[0195] (1) 5′ Untranslated Region—nts 1-701

[0196] (2) 3′ Untranslated Region—nts 1275-3166

[0197] Initial Specific Target Motifs:

(1) Internal Ribosome Entry Site (IRES) in 5′ untranslated region nts 513-704
    5′CCGGGCUCAUGGACGGGUGAGGCGGCGGUGUGCGCAGACAGU (SEQ ID NO: 13)
    GCUCCAGCGCGCGCGCUCCCCAGCCCUGGCCCGGCCUCGGGCCG
    GGAGGAAGAGUAGCUCGCCGAGGCGCCGAGGAGAGCGGGCCGC
    CCCACAGCCCGAGCCGGAGAGGGACGCGAGCCGCGCGCCCCGGU
    CGGGCCUCCGAAACCAUGAACUUUCUGCUGUCUUGGGUGCAUU
    GGAGCCUUGCCUUGCUGCUCUACCUCCACCAUG 3′
(2) Group III AU-Rich Element (ARE) Cluster in 3′ untranslated region
    5′ NAUUUAUUUAUUUAN 3′            (SEQ ID NO: 10)

6.6. Human Immunodeficiency Virus I (“HIV-1”)

[0198] GenBank Accession #NC—001802:

1	ggtctctctg gttagaccag atctgagcct gggagctctc tggctaacta gggaacccac	(SEQ ID NO: 14)
61	tgcttaagcc tcaataaagc ttgccttgag tgcttcaagt agtgtgtgcc cgtctgttgt
121	gtgactctgg taactagaga tccctcagac ccttttagtc agtgtggaaa atctctagca
181	gtggcgcccg aacagggacc tgaaagcgaa agggaaacca gaggagctct ctcgacgcag
241	gactcggctt gctgaagcgc gcacggcaag aggcgagggg cggcgactgg tgagtacgcc
301	aaaaattttg actagcggag gctagaagga gagagatggg tgcgagagcg tcagtattaa
361	gcgggggaga attagatcga tgggaaaaaa ttcggttaag gccaggggga aagaaaaaat
421	ataaattaaa acatatagta tgggcaagca gggagctaga acgattcgca gttaatcctg
481	gcctgttaga aacatcagaa ggctgtagac aaatactggg acagctacaa ccatcccttc
541	agacaggatc agaagaactt agatcattat ataatacagt agcaaccctc tattgtgtgc
601	atcaaaggat agagataaaa gacaccaagg aagctttaga caagatagag gaagagcaaa
661	acaaaagtaa gaaaaaagca cagcaagcag cagctgacac aggacacagc aatcaggtca
721	gccaaaatta ccctatagtg cagaacatcc aggggcaaat ggtacatcag gccatatcac
781	ctagaacttt aaatgcatgg gtaaaagtag tagaagagaa ggctttaagc ccagaagtga
841	tacccatgtt ttcagcatta tcagaaggag ccaccccaca agatttaaac accatgctaa
901	acacagtggg gggacatcaa gcagccatgc aaatgttaaa agagaccatc aatgaggaag
961	ctgcagaatg ggatagagtg catccagtgc atgcagggcc tattgcacca ggccagatga
1021	gagaaccaag gggaagtgac atagcaggaa ctactagtac ccttcaggaa caaataggat
1081	ggatgacaaa taatccacct atcccagtag gagaaattta taaaagatgg ataatcctgg
1141	gattaaataa aatagtaaga atgtatagcc ctaccagcat tctggacata agacaaggac
1201	caaaggaacc ctttagagac tatgtagacc ggttctataa aactctaaga gccgagcaag
1261	cttcacagga ggtaaaaaat tggatgacag aaaccttgtt ggtccaaaat gcgaacccag
1321	attgtaagac tattttaaaa gcattgggac cagcggctac actagaagaa atgatgacag
1381	catgtcaggg agtaggagga cccggccata aggcaagagt tttggctgaa gcaatgagcc
1441	aagtaacaaa ttcagctacc ataatgatgc agagaggcaa ttttaggaac caaagaaaga
1501	ttgttaagtg tttcaattgt ggcaaagaag ggcacacagc cagaaattgc agggccccta
1561	ggaaaaaggg ctgttggaaa tgtggaaagg aaggacacca aatgaaagat tgtactgaga
1621	gacaggctaa ttttttaggg aagatctggc cttcctacaa gggaaggcca gggaattttc
1681	ttcagagcag accagagcca acagccccac cagaagagag cttcaggtct ggggtagaga
1741	caacaactcc ccctcagaag caggagccga tagacaagga actgtatcct ttaacttccc
1801	tcaggtcact ctttggcaac gacccctcgt cacaataaag ataggggggc aactaaagga
1861	agctctatta gatacaggag cagatgatac agtattagaa gaaatgagtt tgccaggaag
1921	atggaaacca aaaatgatag ggggaattgg aggttttatc aaagtaagac agtatgatca
1981	gatactcata gaaatctgtg gacataaagc tataggtaca gtattagtag gacctacacc
2041	tgtcaacata attggaagaa atctgttgac tcagattggt tgcactttaa attttcccat
2101	tagccctatt gagactgtac cagtaaaatt aaagccagga atggatggcc caaaagttaa
2161	acaatggcca ttgacagaag aaaaaataaa agcattagta gaaatttgta cagagatgga
2221	aaaggaaggg aaaatttcaa aaattgggcc tgaaaatcca tacaatactc cagtatttgc
2281	cataaagaaa aaagacagta ctaaatggag aaaattagta gatttcagag aacttaataa
2341	gagaactcaa gacttctggg aagttcaatt aggaatacca catcccgcag ggttaaaaaa
2401	gaaaaaatca gtaacagtac tggatgtggg tgatgcatat ttttcagttc ccttagatga
2461	agacttcagg aagtatactg catttaccat acctagtata aacaatgaga caccagggat
2521	tagatatcag tacaatgtgc ttccacaggg atggaaagga tcaccagcaa tattccaaag
2581	tagcatgaca aaaatcttag agccttttag aaaacaaaat ccagacatag ttatctatca
2641	atacatggat gatttgtatg taggatctga cttagaaata gggcagcata gaacaaaaat
2701	agaggagctg agacaacatc tgttgaggtg gggacttacc acaccagaca aaaaacatca
2761	gaaagaacct ccattccttt ggatgggtta tgaactccat cctgataaat ggacagtaca
2821	gcctatagtg ctgccagaaa aagacagctg gactgtcaat gacatacaga agttagtggg
2881	gaaattgaat tgggcaagtc agatttaccc agggattaaa gtaaggcaat tatgtaaact
2941	ccttagagga accaaagcac taacagaagt aataccacta acagaagaag cagagctaga
3001	actggcagaa aacagagaga ttctaaaaga accagtacat ggagtgtatt atgacccatc
3061	aaaagactta atagcagaaa tacagaagca ggggcaaggc caatggacat atcaaattta
3121	tcaagagcca tttaaaaatc tgaaaacagg aaaatatgca agaatgaggg gtgcccacac
3181	taatgatgta aaacaattaa cagaggcagt gcaaaaaata accacagaaa gcatagtaat
3241	atggggaaag actcctaaat ttaaactgcc catacaaaag gaaacatggg aaacatggtg
3301	gacagagtat tggcaagcca cctggattcc tgagtgggag tttgttaata cccctccctt
3361	agtgaaatta tggtaccagt tagagaaaga acccatagta ggagcagaaa ccttctatgt
3421	agatggggca gctaacaggg agactaaatt aggaaaagca ggatatgtta ctaatagagg
3481	aagacaaaaa gttgtcaccc taactgacac aacaaatcag aagactgagt tacaagcaat
3541	ttatctagct ttgcaggatt cgggattaga agtaaacata gtaacagact cacaatatgc
3601	attaggaatc attcaagcac aaccagatca aagtgaatca gagttagtca atcaaataat
3661	agagcagtta ataaaaaagg aaaaggtcta tctggcatgg gtaccagcac acaaaggaat
3721	tggaggaaat gaacaagtag ataaattagt cagtgctgga atcaggaaag tactattttt
3781	agatggaata gataaggccc aagatgaaca tgagaaatat cacagtaatt ggagagcaat
3841	ggctagtgat tttaacctgc cacctgtagt agcaaaagaa atagtagcca gctgtgataa
3901	atgtcagcta aaaggagaag ccatgcatgg acaagtagac tgtagtccag gaatatggca
3961	actagattgt acacatttag aaggaaaagt tatcctggta gcagttcatg tagccagtgg
4021	atatatagaa gcagaagtta ttccagcaga aacagggcag gaaacagcat attttctttt
4081	aaaattagca ggaagatggc cagtaaaaac aatacatact gacaatggca gcaatttcac
4141	cggtgctacg gttagggccg cctgttggtg ggcgggaatc aagcaggaat ttggaattcc
4201	ctacaatccc caaagtcaag gagtagtaga atctatgaat aaagaattaa agaaaattat
4261	aggacaggta agagatcagg ctgaacatct taagacagca gtacaaatgg cagtattcat
4321	ccacaatttt aaaagaaaag gggggattgg ggggtacagt gcaggggaaa gaatagtaga
4381	cataatagca acagacatac aaactaaaga attacaaaaa caaattacaa aaattcaaaa
4441	ttttcgggtt tattacaggg acagcagaaa tccactttgg aaaggaccag caaagctcct
4501	ctggaaaggt gaaggggcag tagtaataca agataatagt gacataaaag tagtgccaag
4561	aagaaaagca aagatcatta gggattatgg aaaacagatg gcaggtgatg attgtgtggc
4621	aagtagacag gatgaggatt agaacatgga aaagtttagt aaaacaccat atgtatgttt
4681	cagggaaagc taggggatgg ttttatagac atcactatga aagccctcat ccaagaataa
4741	gttcagaagt acacatccca ctaggggatg ctagattggt aataacaaca tattggggtc
4801	tgcatacagg agaaagagac tggcatttgg gtcagggagt ctccatagaa tggaggaaaa
4861	agagatatag cacacaagta gaccctgaac tagcagacca actaattcat ctgtattact
4921	ttgactgttt ttcagactct gctataagaa aggccttatt aggacacata gttagcccta
4981	ggtgtgaata tcaagcagga cataacaagg taggatctct acaatacttg gcactagcag
5041	cattaataac accaaaaaag ataaagccac ctttgcctag tgttacgaaa ctgacagagg
5101	atagatggaa caagccccag aagaccaagg gccacagagg gagccacaca atgaatggac
5161	actagagctt ttagaggagc ttaagaatga agctgttaga cattttccta ggatttggct
5221	ccatggctta gggcaacata tctatgaaac ttatggggat acttgggcag gagtggaagc
5281	cataataaga attctgcaac aactgctgtt tatccatttt cagaattggg tgtcgacata
5341	gcagaatagg cgttactcga cagaggagag caagaaatgg agccagtaga tcctagacta
5401	gagccctgga agcatccagg aagtcagcct aaaactgctt gtaccaattg ctattgtaaa
5461	aagtgttgct ttcattgcca agtttgtttc ataacaaaag ccttaggcat ctcctatggc
5521	aggaagaagc ggagacagcg acgaagagct catcagaaca gtcagactca tcaagcttct
5581	ctatcaaagc agtaagtagt acatgtaatg caacctatac caatagtagc aatagtagca
5641	ttagtagtag caataataat agcaatagtt gtgtggtcca tagtaatcat agaatatagg
5701	aaaatattaa gacaaagaaa aatagacagg ttaattgata gactaataga aagagcagaa
5761	gacagtggca atgagagtga aggagaaata tcagcacttg tggagatggg ggtggagatg
5821	gggcaccatg ctccttggga tgttgatgat ctgtagtgct acagaaaaat tgtgggtcac
5881	agtctattat ggggtacctg tgtggaagga agcaaccacc actctatttt gtgcatcaga
5941	tgctaaagca tatgatacag aggtacataa tgtttgggcc acacatgcct gtgtacccac
6001	agaccccaac ccacaagaag tagtattggt aaatgtgaca gaaaatttta acatgtggaa
6061	aaatgacatg gtagaacaga tgcatgagga tataatcagt ttatgggatc aaagcctaaa
6121	gccatgtgta aaattaaccc cactctgtgt tagtttaaag tgcactgatt tgaagaatga
6181	tactaatacc aatagtagta gcgggagaat gataatggag aaaggagaga taaaaaactg
6241	ctctttcaat atcagcacaa gcataagagg taaggtgcag aaagaatatg cattttttta
6301	taaacttgat ataataccaa tagataatga tactaccagc tataagttga caagttgtaa
6361	cacctcagtc attacacagg cctgtccaaa ggtatccttt gagccaattc ccatacatta
6421	ttgtgccccg gctggttttg cgattctaaa atgtaataat aagacgttca atggaacagg
6481	accatgtaca aatgtcagca cagtacaatg tacacatgga attaggccag tagtatcaac
6541	tcaactgctg ttaaatggca gtctagcaga agaagaggta gtaattagat ctgtcaattt
6601	cacggacaat gctaaaacca taatagtaca gctgaacaca tctgtagaaa ttaattgtac
6661	aagacccaac aacaatacaa gaaaaagaat ccgtatccag agaggaccag ggagagcatt
6721	tgttacaata ggaaaaatag gaaatatgag acaagcacat tgtaacatta gtagagcaaa
6781	atggaataac actttaaaac agatagctag caaattaaga gaacaatttg gaaataataa
6841	aacaataatc tttaagcaat cctcaggagg ggacccagaa attgtaacgc acagttttaa
6901	ttgtggaggg gaatttttct actgtaattc aacacaactg tttaatagta cttggtttaa
6961	tagtacttgg agtactgaag ggtcaaataa cactgaagga agtgacacaa tcaccctccc
7021	atgcagaata aaacaaatta taaacatgtg gcagaaagta ggaaaagcaa tgtatgcccc
7081	tcccatcagt ggacaaatta gatgttcatc aaatattaca gggctgctat taacaagaga
7141	tggtggtaat agcaacaatg agtccgagat cttcagacct ggaggaggag atatgaggga
7201	caattggaga agtgaattat ataaatataa agtagtaaaa attgaaccat taggagtagc
7261	acccaccaag gcaaagagaa gagtggtgca gagagaaaaa agagcagtgg gaataggagc
7321	tttgttcctt gggttcttgg gagcagcagg aagcactatg ggcgcagcct caatgacgct
7381	gacggtacag gccagacaat tattgtctgg tatagtgcag cagcagaaca atttgctgag
7441	ggctattgag gcgcaacagc atctgttgca actcacagtc tggggcatca agcagctcca
7501	ggcaagaatc ctggctgtgg aaagatacct aaaggatcaa cagctcctgg ggatttgggg
7561	ttgctctgga aaactcattt gcaccactgc tgtgccttgg aatgctagtt ggagtaataa
7621	atctctggaa cagatttgga atcacacgac ctggatggag tgggacagag aaattaacaa
7681	ttacacaagc ttaatacact ccttaattga agaatcgcaa aaccagcaag aaaagaatga
7741	acaagaatta ttggaattag ataaatgggc aagtttgtgg aattggttta acataacaaa
7801	ttggctgtgg tatataaaat tattcataat gatagtagga ggcttggtag gtttaagaat
7861	agtttttgct gtactttcta tagtgaatag agttaggcag ggatattcac cattatcgtt
7921	tcagacccac ctcccaaccc cgaggggacc cgacaggccc gaaggaatag aagaagaagg
7981	tggagagaga gacagagaca gatccattcg attagtgaac ggatccttgg cacttatctg
8041	ggacgatctg cggagcctgt gcctcttcag ctaccaccgc ttgagagact tactcttgat
8101	tgtaacgagg attgtggaac ttctgggacg cagggggtgg gaagccctca aatattggtg
8161	gaatctccta cagtattgga gtcaggaact aaagaatagt gctgttagct tgctcaatgc
8221	cacagccata gcagtagctg aggggacaga tagggttata gaagtagtac aaggagcttg
8281	tagagctatt cgccacatac ctagaagaat aagacagggc ttggaaagga ttttgctata
8341	agatgggtgg caagtggtca aaaagtagtg tgattggatg gcctactgta agggaaagaa
8401	tgagacgagc tgagccagca gcagataggg tgggagcagc atctcgagac ctggaaaaac
8461	atggagcaat cacaagtagc aatacagcag ctaccaatgc tgcttgtgcc tggctagaag
8521	cacaagagga ggaggaggtg ggttttccag tcacacctca ggtaccttta agaccaatga
8581	cttacaaggc agctgtagat cttagccact ttttaaaaga aaagggggga ctggaagggc
8641	taattcactc ccaaagaaga caagatatcc ttgatctgtg gatctaccac acacaaggct
8701	acttccctga ttagcagaac tacacaccag ggccaggggt cagatatcca ctgacctttg
8761	gatggtgcta caagctagta ccagttgagc cagataagat agaagaggcc aataaaggag
8821	agaacaccag cttgttacac cctgtgagcc tgcatgggat ggatgacccg gagagagaag
8881	tgttagagtg gaggtttgac agccgcctag catttcatca cgtggcccga gagctgcatc
8941	cggagtactt caagaactgc tgacatcgag cttgctacaa gggactttcc gctggggact
9001	ttccagggag gcgtggcctg ggcgggactg gggagtggcg agccctcaga tcctgcatat
9061	aagcagctgc tttttgcctg tactgggtct ctctggttag accagatctg agcctgggag
9121	ctctctggct aactagggaa cccactgctt aagcctcaat aaagcttgcc ttgagtgctt
9181	c

[0199] Initial Specific Target Motifs:

[0200] (1) Trans-activation response region/Tat protein binding site—TAR RNA—nts 1-60

[0201] “Minimal” TAR RNA element

5′ GGCAGAUCUGAGCCUGGGAGCUCUCU (SEQ ID NO: 15)
GCC 3′

[0202] (2) Gag/Pol Frameshifting Site—“Minimal” frameshifting element

5′ UUUUUUAGGGAAGAUCUGGCCUUCCUACAA (SEQ ID NO: 16)
GGGAAGGCCAGGGAAUUUUCUU 3′

6.7. Hepatitis C Virus (“HCV”—Genotypes 1a & 1b)

[0203] GenBank Accession #NC—001433:

1	ttgggggcga cactccacca tagatcactc ccctgtgagg aactactgtc ttcacgcaga	(SEQ ID NO: 17)
61	aagcgtctag ccatggcgtt agtatgagtg ttgtgcagcc tccaggaccc cccctcccgg
121	gagagccata gtggtctgcg gaaccggtga gtacaccgga attgccagga cgaccgggtc
181	ctttcttgga tcaacccgct caatgcctgg agatttgggc gtgcccccgc gagactgcta
241	gccgagtagt gttgggtcgc gaaaggcctt gtggtactgc ctgatagggt gcttgcgagt
301	gccccgggag gtctcgtaga ccgtgcatca tgagcacaaa tcctaaacct caaagaaaaa
361	ccaaacgtaa caccaaccgc cgcccacagg acgttaagtt cccgggcggt ggtcagatcg
421	ttggtggagt ttacctgttg ccgcgcaggg gccccaggtt gggtgtgcgc gcgactagga
481	agacttccga gcggtcgcaa cctcgtggaa ggcgacaacc tatccccaag gctcgccggc
541	ccgagggtag gacctgggct cagcccgggt acccttggcc cctctatggc aacgagggta
601	tggggtgggc aggatggctc ctgtcacccc gtggctctcg gcctagttgg ggccccacag
661	acccccggcg taggtcgcgt aatttgggta aggtcatcga tacccttaca tgcggcttcg
721	ccgacctcat ggggtacatt ccgcttgtcg gcgcccccct agggggcgct gccagggccc
781	tggcacatgg tgtccgggtt ctggaggacg gcgtgaacta tgcaacaggg aatctgcccg
841	gttgctcttt ctctatcttc ctcttagctt tgctgtcttg tttgaccatc ccagcttccg
901	cttacgaggt gcgcaacgtg tccgggatat accatgtcac gaacgactgc tccaactcaa
961	gtattgtgta tgaggcagcg gacatgatca tgcacacccc cgggtgcgtg ccctgcgtcc
1021	gggagagtaa tttctcccgt tgctgggtag cgctcactcc cacgctcgcg gccaggaaca
1081	gcagcatccc caccacgaca atacgacgcc acgtcgattt gctcgttggg gcggctgctc
1141	tctgttccgc tatgtacgtt ggggatctct gcggatccgt ttttctcgtc tcccagctgt
1201	tcaccttctc acctcgccgg tatgagacgg tacaagattg caattgctca atctatcccg
1261	gccacgtatc aggtcaccgc atggcttggg atatgatgat gaactggtca cctacaacgg
1321	ccctagtggt atcgcagcta ctccggatcc cacaagccgt cgtggacatg gtggcggggg
1381	cccactgggg tgtcctagcg ggccttgcct actattccat ggtggggaac tgggctaagg
1441	tcttgattgt gatgctactc tttgctggcg ttgacgggca cacccacgtg acagggggaa
1501	gggtagcctc cagcacccag agcctcgtgt cctggctctc acaaggccca tctcagaaaa
1561	tccaactcgt gaacaccaac ggcagctggc acatcaacag gaccgctctg aattgcaatg
1621	actccctcca aactgggttc attgctgcgc tgttctacgc acacaggttc aacgcgtccg
1681	ggtgcccaga gcgcatggct agctgccgcc ccatcgatga gttcgctcag gggtggggtc
1741	ccatcactca tgatatgcct gagagctcgg accagaggcc atattgctgg cactacgcgc
1801	ctcgaccgtg cgggatcgtg cctgcgtcgc aggtgtgtgg tccagtgtat tgcttcactc
1861	cgagccctgt tgtagtgggg acgaccgatc gtttcggcgc tcctacgtat agctgggggg
1921	agaatgagac agacgtgctg ctacttagca acacgcggcc gcctcaaggc aactggtttg
1981	ggtgcacgtg gatgaacagc actgggttca ccaagacgtg cgggggccct ccgtgcaaca
2041	tcgggggggt cggcaacaac accttggtct gccccacgga ttgcttccgg aagcaccccg
2101	aggccactta cacaaagtgt ggctcggggc cctggttgac acccaggtgc atggttgact
2161	acccatacag gctctggcac tacccctgca ctgttaactt taccgtcttt aaggtcagga
2221	tgtatgtggg gggcgtggag cacaggctca atgctgcatg caattggact cgaggagagc
2281	gctgtgactt ggaggacagg gataggtcag aactcagccc gctgctgctg tctacaacag
2341	agtggcagat actgccctgt tccttcacca ccctaccggc cctgtccact ggcttgatcc
2401	atcttcaccg gaacatcgtg gacgtgcaat acctgtacgg tatagggtcg gcagttgtct
2461	cctttgcaat caaatgggag tatatcctgt tgcttttcct tcttctggcg gacgcgcgcg
2521	tctgtgcctg cttgtggatg atgctgctga tagcccaggc tgaggccacc ttagagaacc
2581	tggtggtcct caatgcggcg tctgtggccg gagcgcatgg ccttctctcc ttcctcgtgt
2641	tcttctgcgc cgcctggtac atcaaaggca ggctggtccc tggggcggca tatgctctct
2701	atggcgtatg gccgttgctc ctgctcttgc tggccttacc accacgagct tatgccatgg
2761	accgagagat ggctgcatcg tgcggaggcg cggtttttgt aggtctggta ctcttgacct
2821	tgtcaccata ctataaggtg ttcctcgcta ggctcatatg gtggttacaa tattttatca
2881	ccagagccga ggcgcacttg caagtgtggg tcccccctct caatgttcgg ggaggccgcg
2941	atgccatcat cctccttaca tgcgcggtcc atccagagct aatctttgac atcaccaaac
3001	tcctgctcgc catactcggt ccgctcatgg tgctccaggc tggcataact agagtgccgt
3061	actttgtacg cgctcagggg ctcatccgtg catgcatgtt agtgcggaag gtcgctggag
3121	gccactatgt ccaaatggcc ttcatgaagc tggccgcgct gacaggtacg tacgtatatg
3181	accatcttac tccactgcgg gattgggccc acgcgggcct acgagacctt gcggtggcag
3241	tagagcccgt cgtcttctct gacatggaga ctaaactcat cacctggggg gcagacaccg
3301	cggcgtgtgg ggacatcatc tcgggtctac cagtctccgc ccgaaggggg aaggagatac
3361	ttctaggacc ggccgatagt tttggagagc aggggtggcg gctccttgcg cctatcacgg
3421	cctattccca acaaacgcgg ggcctgcttg gctgtatcat cactagcctc acaggtcggg
3481	acaagaacca ggtcgatggg gaggttcagg tgctctccac cgcaacgcaa tctttcctgg
3541	cgacctgcgt caatggcgtg tgttggaccg tctaccatgg tgccggctcg aagaccctgg
3601	ccggcccgaa gggtccaatc acccaaatgt acaccaatgt agaccaggac ctcgtcggct
3661	ggccggcgcc ccccggggcg cgctccatga caccgtgcac ctgcggcagc tcggaccttt
3721	acttggtcac gaggcatgct gatgtcgttc cggtgcgccg gcggggcgac agcaggggga
3781	gcctgctttc ccccaggccc atctcctacc tgaagggctc ctcgggtgga ccactgcttt
3841	gcccttcggg gcacgttgta ggcatcttcc gggctgctgt gtgcacccgg ggggttgcga
3901	aggcggtgga cttcataccc gttgagtcta tggaaactac catgcggtct ccggtcttca
3961	cagacaactc atcccctccg gccgtaccgc aaacattcca agtggcacat ttacacgctc
4021	ccactggcag cggcaagagc accaaagtgc cggctgcata tgcagcccaa gggtacaagg
4081	tgctcgtcct aaacccgtcc gttgccgcca cattgggctt tggagcgtat atgtccaagg
4141	cacatggcat cgagcctaac atcagaactg gggtaaggac catcaccacg ggcggcccca
4201	tcacgtactc cacctattgc aagttccttg ccgacggtgg atgctccggg ggcgcctatg
4261	acatcataat atgtgatgaa tgccactcaa ctgactcgac taccatcttg ggcatcggca
4321	cagtcctgga tcaggcagag acggctggag cgcggctcgt cgtgctcgcc accgccacgc
4381	ctccgggatc gatcaccgtg ccacacccca acatcgagga agtggccctg tccaacactg
4441	gagagattcc cttctatggc aaagccatcc ccattgaggc catcaagggg ggaaggcatc
4501	tcatcttctg ccattccaag aagaagtgtg acgagctcgc cgcaaagctg acaggcctcg
4561	gactcaatgc tgtagcgtat taccggggtc tcgatgtgtc cgtcataccg actagcggag
4621	acgtcgttgt cgtggcaaca gacgctctaa tgacgggttt taccggcgac tttgactcag
4681	tgatcgactg caacacatgt gtcacccaga cagtcgattt cagcttggat cccaccttca
4741	ccattgagac gacaacgctg ccccaagacg cggtgtcgcg tgcgcagcgg cgaggtagga
4801	ctggcagggg caggagtggc atctacaggt ttgtgactcc aggagaacgg ccctcaggca
4861	tgttcgactc ctcggtcctg tgtgagtgct atgacgcagg ctgcgcttgg tatgagctca
4921	cgcccgctga gacctcggtt aggttgcggg cttacctaaa tacaccaggg ttgcccgtct
4981	gccaggacca cctagagttc tgggagagcg tcttcacagg cctcacccac atagatgccc
5041	acttcttgtc ccagaccaaa caggcaggag acaacctccc ctacctggta gcataccaag
5101	ccacagtgtg cgccagggct caggctccac ctccatcgtg ggaccaaatg tggaagtgtc
5161	tcatacggct aaagcccaca ctgcatgggc caacgcccct gctgtacagg ctaggagccg
5221	ttcaaaatga ggtcactctc acacacccca taaccaaata catcatggca tgcatgtcgg
5281	ctgacctgga ggtcgtcact agcacctggg tgctagtagg cggagtcctt gcggctctgg
5341	ccgcgtactg cctgacgaca ggcagcgtgg tcattgtggg caggatcatc ttgtccggga
5401	ggccagctgt tattcccgac agggaagtcc tctaccagga gttcgatgag atggaagagt
5461	gtgcttcaca cctcccttac atcgagcaag gaatgcagct cgccgagcaa ttcaaacaga
5521	aggcgctcgg attgctgcaa acagccacca agcaagcgga ggctgctgct cccgtggtgg
5581	agtccaagtg gcgagccctt gaggtcttct gggcgaaaca catgtggaac ttcatcagcg
5641	ggatacagta cttggcaggc ctatccactc tgcctggaaa ccccgcgata gcatcattga
5701	tggcttttac agcctctatc accagcccgc tcaccaccca aaataccctc ctgtttaaca
5761	tcttgggggg atgggtggct gcccaactcg ctccccccag cgctgcttcg gctttcgtgg
5821	gcgccggcat tgccggtgcg gccgttggca gcataggtct cgggaaggta cttgtggaca
5881	ttctggcggg ctatggggcg ggggtggctg gcgcactcgt ggcctttaag gtcatgagcg
5941	gcgagatgcc ctccactgag gatctggtta atttactccc tgccatcctt tctcctggcg
6001	ccctggttgt cggggtcgtg tgcgcagcaa tactgcgtcg gcacgtgggc ccgggagagg
6061	gggctgtgca gtggatgaac cggctgatag cgttcgcttc gcggggtaac cacgtctccc
6121	ccacgcacta tgtgcccgag agcgacgccg cggcgcgtgt tactcagatc ctctccagcc
6181	ttaccatcac tcagttgctg aagaggcttc atcagtggat taatgaggac tgctccacgc
6241	cttgttccgg ctcgtggcta aaggatgttt gggactggat atgcacggtg ttgagtgact
6301	tcaagacttg gctccagtcc aagctcctgc cgcggttacc gggactccct ttcctgtcat
6361	gccaacgcgg gtacaaggga gtctggcggg gggatggcat catgcaaacc acctgcccat
6421	gtggagcaca gatcaccgga catgtcaaaa atggctccat gaggattgtt gggccaaaaa
6481	cctgcagcaa cacgtggcat ggaacattcc ccatcaacgc atacaccacg ggcccctgca
6541	cgccctcccc agcgccgaac tattccaggg cgctgtggcg ggtggctgct gaggagtacg
6601	tggaggttac gcgggtgggg gatttccact acgtgacggg catgaccact gacaacgtga
6661	aatgcccatg ccaggttcca gcccctgaat ttttcacgga ggtggatgga gtacggttgc
6721	acaggtatgc tccagtgtgc aaacctctcc tacgagagga ggtcgtattc caggtcgggc
6781	tcaaccagta cctggtcggg tcacagctcc catgtgagcc cgaaccggat gtggcagtgc
6841	tcacttccat gctcaccgac ccctctcata ttacagcaga gacggccaag cgtaggctgg
6901	ccagggggtc tcccccctcc ttggccagct cttcagctag ccagttgtct gcgccttctt
6961	tgaaggcgac atgtactacc catcatgact ccccggacgc tgacctcatc gaggccaacc
7021	tcctgtggcg gcaggagatg ggcgggaaca tcacccgtgt ggagtcagaa aataaggtgg
7081	taatcctgga ctctttcgat ccgattcggg cggtggagga tgagagggaa atatccgtcc
7141	cggcggagat cctgcgaaaa cccaggaagt tccccccagc gttgcccata tgggcacgcc
7201	cggattacaa ccctccactg ctagagtcct ggaaggaccc ggactacgtc cccccggtgg
7261	tacacgggtg ccctttgcca tctaccaagg cccccccaat accacctcca cggaggaaga
7321	ggacggttgt cctgacagag tccaccgtgt cttctgcctt ggcggagctc gctactaaga
7381	cctttggcag ctccgggtcg tcggccgttg acagcggcac ggcgactggc cctcccgatc
7441	aggcctccga cgacggcgac aaaggatccg acgttgagtc gtactcctcc atgccccccc
7501	tcgagggaga gccaggggac cccgacctca gcgacgggtc ttggtctacc gtgagcgggg
7561	aagctggtga ggacgtcgtc tgctgctcaa tgtcctatac atggacaggt gccttgatca
7621	cgccatgcgc tgcggaggag agcaagttgc ccatcaatcc gttgagcaac tctttgctgc
7681	gtcaccacag tatggtctac tccacaacat ctcgcagcgc aagtctgcgg cagaagaagg
7741	tcacctttga cagactgcaa gtcctggacg accactaccg ggacgtgctc aaggagatga
7801	aggcgaaggc gtccacagtt aaggctaggc ttctatctat agaggaggcc tgcaaactga
7861	cgcccccaca ttcggccaaa tccaaatttg gctacggggc gaaggacgtc cggagcctat
7921	ccagcagggc cgtcaaccac atccgctccg tgtgggagga cttgctggaa gacactgaaa
7981	caccaattga taccaccatc atggcaaaaa atgaggtttt ctgcgtccaa ccagagaaag
8041	gaggccgcaa gccagctcgc cttatcgtat tcccagacct gggggtacgt gtatgcgaga
8101	agatggccct ttacgacgtg gtctccaccc ttcctcaggc cgtgatgggc ccctcatacg
8161	gattccagta ctctcctggg cagcgggtcg agttcctggt gaatacctgg aaatcaaaga
8221	aatgccctat gggcttctca tatgacaccc gctgctttga ctcaacggtc actgagaatg
8281	acatccgtac tgaggaatca atttaccaat gttgtgactt ggcccccgaa gccaggcagg
8341	ccataaggtc gctcacagag cggctttatg tcgggggtcc cctgactaat tcgaaggggc
8401	agaactgcgg ttatcgccgg tgccgcgcaa gtggcgtgct gacgactagc tgcggcaaca
8461	ccctcacatg ttacttgaag gccactgcgg cctgtcgagc tgcaaagctc caggactgca
8521	cgatgctcgt gaacggagac gaccttgtcg ttatctgtga gagtgcggga acccaggagg
8581	atgcggcggc cctacgagcc ttcacggagg ctatgactag gtattccgcc ccccccgggg
8641	acccgcccca accagaatac gacttggagc tgataacgtc atgctcctcc aatgtgtcgg
8701	tcgcgcacga tgcatccggc aaaagggtgt actacctcac ccgtgacccc accacccccc
8761	tcgcacgggc tgcgtgggag acagttagac acactccagt caactcctgg ctaggcaata
8821	tcatcatgta tgcgcccacc ctatgggcga ggatgattct gatgactcat ttcttctcta
8881	tccttctagc tcaggagcaa cttgaaaaag ccctggattg tcagatctac ggggcctgtt
8941	actccattga gccacttgac ctacctcaga tcattgaacg actccatggt cttagcgcat
9001	tttcactcca cagttactct ccaggtgaga tcaatagggt ggcttcatgc ctcaggaaac
9061	ttggggtacc gcctttgcga gtctggagac atcgggccag aagtgtccgc gctaagctac
9121	tgtcccaggg ggggagggct gccacttgcg gcaagtacct cttcaactgg gcagtaaaga
9181	ccaagcttaa actcactcca atcccggctg cgtcccagct agacttgtcc ggctggttcg
9241	ttgctggtta caacggggga gacatatatc acagcctgtc tcgtgcccga ccccgttggt
9301	tcatgttgtg cctactccta ctttctgtag gggtaggcat ctacctgctc cccaaccggt
9361	gaacggggag ctaaccactc caggccaata ggccattccc tttttttttt ttc

[0204] General Target Region:

[0205] 5′ Untranslated Region—nts 1-328 - Internal Ribosome Entry Site (IRES):

5′UUGGGGGCGACACUCCACCAUAGAUCACUCCCCUGUGAGGAACUACUGUCU (SEQ ID NO: 18)
UCACGCAGAAAGCGUCUAGCCAUGGCGUUAGUAUGAGUGUUGUGCAGCCUC
CAGGACCCCCCCUCCCGGGAGAGCCAUAGUGGUCUGCGGAACCGGUGAGUAC
ACCGGAAUUGCCAGGACGACCGGGUCCUUUCUUGGAUCAACCCGCUCAAUGC
CUGGAGAUUUGGGCGUGCCCCCGCGAGACUGCUAGCCGAGUAGUGUUGGGU
CGCGAAAGGCCUUGUGGUACUGCCUGAUAGGGUGCUUGCGAGUGCCCCGGG
AGGUCUCGUAGACCGUGCAU3′

[0206] Initial Specific Target Motifs:

[0207] (1) Subdomain IIIc within HCV IRES—nts 213-226

5′AUUUGGGCGUGCCC3′ (SEQ ID NO: 19)

[0208] (2) Subdomain IIId within HCV IRES—nts 241-267

5′GCCGAGUAGUGUUGGGUCGCGAAAGGC3′ (SEQ ID NO: 20)

6.8. Ribonuclease P RNA (“RNaseP”)

[0209] GenBank Accession #s

[0210] X15624 Homo sapiens RNaseP H1 RNA:

1	atgggcggag ggaagctcat cagtggggcc acgagctgag tgcgtcctgt cactccactc	(SEQ ID NO: 21)
61	ccatgtccct tgggaaggtc tgagactagg gccagaggcg gccctaacag ggctctccct
121	gagcttcagg gaggtgagtt cccagagaac ggggctccgc gcgaggtcag actgggcagg
181	agatgccgtg gaccccgccc ttcggggagg ggcccggcgg atgcctcctt tgccggagct
241	tggaacagac tcacggccag cgaagtgagt tcaatggctg aggtgaggta ccccgcaggg
301	gacctcataa cccaattcag accactctcc tccgcccatt

[0211] U64885 Staphylococcus aureus RNaseP (rrnB) RNA:

1	gaggaaagtc cgggctcaca cagtctgaga tgattgtagt gttcgtgctt gatgaaacaa	(SEQ ID NO: 22)
61	taaatcaagg cattaatttg acggcaatga aatatcctaa gtctttcgat atggatagag
121	taatttgaaa gtgccacagt gacgtagctt ttatagaaat ataaaaggtg gaacgcggta
181	aacccctcga gtgagcaatc caaatttggt aggagcactt gtttaacgga attcaacgta
241	taaacgagac acacttcgcg aaatgaagtg gtgtagacag atggttatca cctgagtacc
301	agtgtgacta gtgcacgtga tgagtacgat ggaacagaac gcggcttat

[0212] M17569 Escherichia coli RNA component (M1 RNA) of ribonuclease P (mpB) gene:

1	gaagctgacc agacagtcgc cgcttcgtcg tcgtcctctt cgggggagac gggcggaggg	(SEQ ID NO: 23)
61	gaggaaagtc cgggctccat agggcagggt gccaggtaac gcctgggggg gaaacccacg
121	accagtgcaa cagagagcaa accgccgatg gcccgcgcaa gcgggatcag gtaagggtga
181	aagggtgcgg taagagcgca ccgcgcggct ggtaacagtc cgtggcacgg taaactccac
241	ccggagcaag gccaaatagg ggttcataag gtacggcccg tactgaaccc gggtaggctg
301	cttgagccag tgagcgattg ctggcctaga tgaatgactg tccacgacag aacccggctt
361	atcggtcagt ttcacct

[0213] Z70692 Mycobacterium tuberculosis RNaseP (mpB) RNA:

1	ccaccggtta cgatcttgcc gaccatggcc ccacaatagg gccggggaga cccggcgtca	(SEQ ID NO: 24)
61	gtggtgggcg gcacggtcag taacgtctgc gcaacacggg gttgactgac gggcaatatc
121	ggctccatag cgtcggccgc ggatacagta aaggagcatt ctgtgacgga aaagacgccc
181	gacgacgtct tcaaacttgc caaggacgag aaggtcgaat atgtcgacgt ccggttctgt
241	gacctgcctg gcatcatgca gcacttcacg attccggctt cggcctttga caagagcgtg
301	tttgacgacg gcttggcctt tgacggctcg tcgattcgcg ggttccagtc gatccacgaa
361	tccgacatgt tgcttcttcc cgatcccgag acggcgcgca tcgacccgtt ccgcgcggcc
421	aagacgctga atatcaactt ctttgtgcac gacccgttca ccctggagcc gtactcccgc
481	gacccgcgca acatcgcccg caaggccgag aactacctga tcagcactgg catcgccgac
541	accgcatact tcggcgccga ggccgagttc tacattttcg attcggtgag cttcgactcg
601	cgcgccaacg gctccttcta cgaggtggac gccatctcgg ggtggtggaa caccggcgcg
661	gcgaccgagg ccgacggcag tcccaaccgg ggctacaagg tccgccacaa gggcgggtat
721	ttcccagtgg cccccaacga ccaatacgtc gacctgcgcg acaagatgct gaccaacctg
781	atcaactccg gcttcatcct ggagaagggc caccacgagg tgggcagcgg cggacaggcc
841	gagatcaact accagttcaa ttcgctgctg cacgccgccg acgacatgca gttgtacaag
901	tacatcatca agaacaccgc ctggcagaac ggcaaaacgg tcacgttcat gcccaagccg
961	ctgttcggcg acaacgggtc cggcatgcac tgtcatcagt cgctgtggaa ggacggggcc
1021	ccgctgatgt acgacgagac gggttatgcc ggtctgtcgg acacggcccg tcattacatc
1081	ggcggcctgt tacaccacgc gccgtcgctg ctggccttca ccaacccgac ggtgaactcc
1141	tacaagcggc tggttcccgg ttacgaggcc ccgatcaacc tggtctatag ccagcgcaac
1201	cggtcggcat gcgtgcgcat cccgatcacc ggcagcaacc cgaaggccaa gcggctggag
1261	ttccgaagcc ccgactcgtc gggcaacccg tatctggcgt tctcggccat gctgatggca
1321	ggcctggacg gtatcaagaa caagatcgag ccgcaggcgc ccgtcgacaa ggatctctac
1381	gagctgccgc cggaagaggc cgcgagtatc ccgcagactc cgacccagct gtcagatgtg
1441	atcgaccgtc tcgaggccga ccacgaatac ctcaccgaag gaggggtgtt cacaaacgac
1501	ctgatcgaga cgtggatcag tttcaagcgc gaaaacgaga tcgagccggt caacatccgg
1561	ccgcatccct acgaattcgc gctgtactac gacgtttaag gactcttcgc agtccgggtg
1621	tagagggagc ggcgtgtcgt tgccagggcg ggcgtcgagg tttttcgatg ggtgacggtg
1681	gccggcaacg gcgcgccgac caccgctgcg aagagcccgt ttaagaacgt tcaaggacgt
1741	ttcagccggg tgccacaacc cgcttggcaa tcatctcccg accgccgagc gggttgtctt
1801	tcacatgcgc cgaaactcaa gccacgtcgt cgcccaggcg tgtcgtcgcg gccggttcag
1861	gttaagtgtc ggggattcgt cgtgcgggcg ggcgtccacg ctgaccaacg gggcagtcaa
1921	ctcccgaaca ctttgcgcac taccgccttt gcccgccgcg tcacccgtag gtagttgtcc
1981	aggaattccc caccgtcgtc gtttcgccag ccggccgcga ccgcgaccgc attgagctgg
2041	cgcccgggtc ccggcagctg gtcggtgggc ttgccgcgca ccaacaccag cgcgttgcgg
2101	gcccgggtgg cggtcagcca ggcctgacgg agcagctcca cgtcggctgc gggaaccaga
2161	tcggcggccg cgatgacatc cagggattgc agcgtcgagg tgttgtgcag ggcgggaacc
2221	tggtgcgcat gctgtagctg cagcaactgc acggtccatt cgatgtcggc cagtccgccg
2281	cggcccagtt tggtgtgtgt gttggggtcg gcaccgcgcg gcaaccgctc ggactcgata
2341	cgggccttga tgcggcgaat ctcgcgcacc gagtcagcgg acacaccgtc gggcggatac
2401	cgcgttttgt cgaccatccg taggaatcgc tgacccaact cggcatcgcc ggcaaccgcg
2461	tgtgcgcgta gcagggcctg gatctcccat ggctgtgccc actgctcgta gtatgcggcg
2521	taggacccca gggtgcggac cagcggaccg ttgcggccct cgggtcgcaa attggcgtcg
2581	agctccagcg gcggatcgac gctgggtgtc cccagcagcg cccgaacccg ctcggcgatc
2641	gatgtcgacc atttcaccgc ccgtgcatcg tcgacgccgg tggccggctc acagacgaac
2701	atcacgtcgg catccgaccc gtagcccaac tcggcaccac ccagccgacc catgccgatg
2761	accgcgatgg ccgccggggc gcgatcgtcg tcgggaaggc tggcccggat catgacgtcc
2821	agcgcggcct gcagcaccgc cacccacacc gacgtcaacg cccggcacac ctcggtgacc
2881	tcgagcaggc cgagcaggtc cgccgaaccg atgcgggcca gctctcgacg acgcagcgtg
2941	cgcgcgccgg cgatggcccg ctccgggtcg gggtagcggc tcgccgaggc gatcagcgcc
3001	cgagccacgg cggcgggctc ggtctcgagc agcttcgggc ccgcaggccc gtcctcgtac
3061	tgctggatga cccgcggcgc gcgcatcaac agatccggca catacgccga ggtacccaag
3121	acatgcatga gccgcttggc caccgcgggc ttgtcccgca gcgtggccag gtaccagctt
3181	tcggtggcca gcgcctcact gagccgccgg taggccagca gtccgccgtc gggatcgggg
3241	gcatacgaca tccagtccag cagcctgggc agcagcaccg actgcacccg tccgcgccgg
3301	ccgctttgat tgaccaacgc cgacatgtgt ttcaacgcgg tctgcggtcc ctcgtagccc
3361	agcgcggcca gccggcgccc cgcggcctcc aacgtcatgc cgtgggcgat ctccaacccg
3421	gtcgggccga tcgattccag cagcggttga tagaagagtt tggtgtgtaa cttcgacacc
3481	cgcacgttct gcttcttgag ttcctcccgc agcaccccgg ccgcatcgtt tcggccatcg
3541	ggccggatgt gggccgcgcg cgccagccag cgcactgcct cctcgtcttc gggatcggga
3601	agcaggtggg tgcgcttgag ccgctgcaac tgcagtcggt gctcgagcag cctgaggaac
3661	tcatacgacg cggtcatgtt cgccgcgtcc tcacgcccga tgtagccgcc ttcgcccaac
3721	gccgccaatg cgtccaccgt ggacgccacc cgtaacgact cgtcgctacg ggcatgaacc
3781	agctgcagta gctgtacggc gaactccacg tcgcgcaatc cgccgctgcc gagtttgagc
3841	tcgcggccgc ggacatcggc gggcaccagc tgctccaccc gccgccgcat ggcctgcacc
3901	tcgaccacaa agtcttcgcg ctcgcaggct cgccacacca tcggcatcaa ggcggtcagg
3961	taacgctcgc caagttccgc gtcgccaacg actggccgtg ctttcagcaa cgcctgaaac
4021	tcccaggtct tggcccagcg ctggtagtag gcgatgtgcg actcgagcgt acggaccagc
4081	tccccgttgc gcccctccgg acgcagggcg gcgtccacct cgaaaaaggc cgccgaggcc
4141	acccgcatca tctcgctggc cacgcgcgcg ttgcgcgggt cggagcgctc ggcaacgaat
4201	atgacatcga cgtcgctgac gtagttcagt tcgcgcgcac cgcacttgcc catcgcgatg
4261	accgccaggc gcggtggcgg gtgctcgccg cacacgctcg cctcggccac gcgcagcgcc
4321	gccgccagag cggcgtccgc ggcgtccgcc aggcgtgcgg ccaccacggt gaatggcagc
4381	accggttcgt cctcgaccgt cgcggccagg tcgagagcgg ccagcattag cacgtagtcg
4441	cggtactggg ttcgcaatcg gtgcacgagc gagcccggca taccctccga ttcctcgacg
4501	cactcgacga acgaccgctg cagctggtca tgggacggca gtgtgacctt gccccgcagc
4561	aatttccagg actgcggatg ggcgaccagg tgatcgccca acgccagcga cgagcccagc
4621	accgagaaca gccgcccgcg cagactgcgt tcgcgcagca gagccgcgtt gagctcgtcc
4681	catccggtgt ctggattctc cgacagccgg atcaaggcgc gcagcgcggc atcggcgtcc
4741	ggagcgcgtg acagcgacca cagcaggtcg acgtgcgcct gatcctcgtg ccgatcccac
4801	cccagctgag ccagacgctc accagcaggg gggtcaacta atccgagccg gccaacgctg
4861	ggcaacttcg gccgctgcgt ggcgagtttg gtcacgacca cgacggtagc gcaaagcgcg
4921	tcggcgtcgg atcaaccggt agatctgggc tacagcgaca ggtaggtgcg cagctcgtat
4981	ggcgtgacgt ggctgcggta gttcgcccac tccgtgcgct tgttgcgcaa gaaaaagtca
5041	aaaacgtgct cccccaaggc ctccgcgacg agttcggagg cctccatggc gcgcagcgca
5101	ctatccaaac tggacggcaa ttctcggtac cccatcgctc ggcgttcctc gggtgtgagg
5161	tcccatacgt tgtcctcggc ctgcgggccc agcacgtaac ccttctctac accccgcaat
5221	cccgcggcca gcagcacggc gaatgtcaga tagggattgc acgccgaatc agggctgcgt
5281	acttcgaccc gccgcgacga ggtcttgtgc ggcgtgtaca tcggcacccg cactagggcg
5341	gatcggttgg cggcccccca cgacgcggcc gtgggcgctt cgccgccctg caccagccgc
5401	ttgtaagagt tgacccactg atttgtgacc gcgctgatct cgcaagcgtg ctccaggatc
5461	ccggcgatga acgatttacc cacttccgac agctgcagcg gatcatcagc gctgtggaac
5521	gcgttgacat caccctcgaa caggctcatg tgggtgtgca tcgccgagcc cgggtgctgg
5581	ccgaatggct tgggcatgaa cgacgcccgg gcgccctctt ccagcgcgac ttctttgatg
5641	acgtagcgga aggtcatcac gttgtcagcc atcgacagag cgtcggcaaa ccgcaggtcg
5701	atctcctgct ggccgggtgc gccttcgtga tggctgaact ccaccgagat gcccatgaat
5761	tccagggcat cgatcgcgtg gcggcgaaag ttcaaggcgg agtcgtgcac cgcttggtcg
5821	aaatagccgg cgttgtcgac cgggacgggc accgacccgt cctcgggtcc gggcttgagc
5881	aggaagaact cgatttcggg atgcacgtag caggagaagc cgagttcgcc ggccttcgtc
5941	agctgccgcc gcaacacgtg ccgcgggtcc gcccacgacg gcgagccgtc cggcatggtg
6001	atgtcgcaaa acatccgcgc tgagtggtgg tggccggaac tggtggccca gggcagcacc
6061	tggaaggtcg acgggtccgg gtgcgccacc gtatcggatt ccgagacccg cgcaaagccc
6121	tcgatcgagg atccgtcgaa gccgatgcct tcctcgaagg cgccctcgag ttcggctggg
6181	gcgatggcga ccgacttgag gaaaccgagc acgtctgtga accacagccg gacgaagcgg
6241	atgtcgcgtt cttccagggt acgaagaacg aattccttct gtcggtccat acctcgaaca
6301	gtatgcactg tctgttaaaa ccgtgttacc gatgcccggc cagaagcgtt gcggggcggc
6361	ccgcaagggg agtgcgcggt gagttcaggg cgcgcaccgc agactcgtcg gcggcaaggt
6421	cccgtcgaga aaatagtgca tcaccgcaga gtccacacac tggttgccat cgaacaccgc
6481	agtgtgttgg gtgccgtcga aggtgatcag cggtgcgccc agctggcggg ccaggtctac
6541	cccggactga tacggagtgg ccgggtcgtg ggtggtggac accacgacga ccttgccagc
6601	cccggccggc gccgcggggt gcggcgtcga cgttgccggc accggccaca gcgcgcacag
6661	atcgcggggg gcggatccgg tgaactgccc gtagctaagg aacggggcga cctgacggat
6721	ccgttggtcg gcggccaccc aggccgctgg atcggccggt gtgggcgcat cgacgcaccg
6781	gaccgcgttg aacgcgtcct ggtcgttgct gtagtgcccg tctgcatccc ggccgtcata
6841	gtcgtcggca agcaccagca agtcgccggc gtcgctgccg cgctgcagcc ccagcagacc
6901	actggtcagg tacttccagc gctgagggct gtacagcgcg ttgatggtgc ccgtcgtcgc
6961	gtcggcgtag ctcaggccac gtggatccga cgtcttaccc ggcttctgca ccagcgggtc
7021	aaccagggcg tggtagcggt tgacccactg ggccgagtcg gtgcccagag ggcaggccgg
7081	cgagcgggcg cagtcggcgg cgtagtcatt gaaagcggtc tgaaatcccg ccatttggct
7141	gatgctttcc tcgattgggc taacggctgg atcgatagcg ccgtcgagga ccatcgcccg
7201	cacatgagta ccgaaccgtt ccaggtaagc ggtgcccaac tcggtgccgt agctgtatcc
7261	gaggtagttg atctgatcgt cacctaacgc ttggcgaacc atgtccatgt cccgtgcgac
7321	ggacgcggta ccgatattgg ccaagaagct gaagcccatc cggtcaacac agtcctgggc
7381	caactgccgg tagacctgtt cgacgtgggt gacaccggcc ggactgtagt cggccatcgg
7441	atcgcgccgg tacgcgtcga actcggcgtc ggtgcgacac cgcaacgcag gggtcgagtg
7501	gccgacccct ctcgggtcga agcccaccag gtcgaagtgg cggagaatgt cggtgtcggc
7561	gatcgcgggt gccatagcgg cgaccatgtc gaccgccgac gccccgggtc ccccaggatt
7621	gaccagcagt gctccgaatc gctgtcccgt cgcggggacg cggatcaccg ccaacttcgc
7681	ttgtgtccca ccgggttggt cgtagtcgac ggggacggac accgtcgcgc agcgtgcagt
7741	gcgaatttcg ctggtgtcgg cgatgaactc gcggcagctg ttccaactct gttgcggcgc
7801	cacgaccggc gcacccgggg tttggccggc gccgggttct tcagtcgcgc cggccaacgg
7861	gggcgctgct aggggcagtc cgccgagcag caacccgaag gacagcagcg ccgagctcaa
7921	cggtctgcgg cgccacatgg ccgccatcgt ctcaccggcg aatacctgtg acggcgcgaa
7981	atgatcacac cttcgtttct tcgccccgct agcacttggc gccgctgggc ggcgtggtgc
8041	cgccgattaa atacgccgtc acgtactcgt caatgcagct gtcgccctgg aataccaccg
8101	tgtgctgggt tccgtcgaag gtcagcaacg aaccgcgaag ctggttcgcc aggtcgaccc
8161	cggccttgta cggcgtcgcc gggtcatggg tggtggatac caccaccgtc ggcactaggc
8221	cgggcgccga gacggcatgg ggctgacttg tgggtggcac cggccagaac gcgcaggtgc
8281	ccagcggcgc atcaccggtg aacttcccgt agctcatgaa cggtgcgatc tcccgggcgc
8341	ggcggtcttc gtcgatgacc ttgtcgcgat cggtaaccgg gggctgatcg acgcaattga
8401	tcgccacccg cgcgtcaccg gaattgttgt agcggccgtg cgagtcccga cgcatgtaca
8461	tgtcggccag agccagcagg gtgtctccgc gattgtcgac cagctccgac agcccgtcgg
8521	tcaagtgttg ccacagattc ggtgagtaca gcgccataat ggtgcccacg atggcgtcgc
8581	tataactcag cccgcgcgga tccttcgtgc gcgccggcct gctgatcctc gggttgtccg
8641	ggtcgaccaa cggatcgacc aggctgtggt agacctcgac ggctttggcc gggtcggcgc
8701	ccagcgggca gcccgcgttc ttggcgcagt cggcggcata gttgttgaac gcgtcctgga
8761	agcccttggc ctggcgcagc tccgcctcga tgggatcggc attggggtcg acggcaccgt
8821	cgagaatcat tgcccgcacc cgctgcggaa attcctcggc atacgcggag ccgatccggg
8881	tgccgtacga gtagcccagg taggtcagct tgtcgtcgcc caacgccgcg cgaatggcat
8941	ccaggtcctt ggcgacgttg accgtcccga catgggccag aaagttcttg cccatcttgt
9001	ccacacagcg accgacgaat tgcttggtct cgttctcgat gtgcgccaca ccctcccggc
9061	tgtagtcaac ctgcggctcg gcccgcagcc ggtcgttgtc ggcatcggag ttgcaccaga
9121	tcgccggccg ggacgacgcc accccgcggg ggtcgaaccc aaccaggtcg aacctttcgt
9181	gcacccgctt cggcaatgtc tggaagacgc ccaaggcggc ctcgataccg gattcgccgg
9241	gtccaccggg atttatgacc agcgaaccga tcttgtctcc cgtcgccgga aagcgaatca
9301	gcgccagcgc cgccacgtca ccatcggggc ggtcgtagtc gaccggtaca gcgagcttgc
9361	cgcataacgc gccgccgggg atctttactt gcgggtttga cgaccggcac ggtgtccact
9421	ccaccggctg gcccagcttc ggctccgcca tacgagcgcg tcccccgacc acgcggatgc
9481	agcccacaag aaccaacgcc acggcggcga gcgcggccca gatcaacagc atgcgcgcga
9541	tcttgtcgcg gcgagacagc ctcatgccca caatgctgcc agagcagacc cgagatcctg
9601	gccagcggcc accgtcggcc gactaaccgg ccgctgccag cagtcctgcc atcgccgatg
9661	gcgaactcgt cggccatccc ccatacgtcc ggtaacagat ccgggcaaga caccgacccg
9721	tcgaccggat ccggcacggg cgcgtcggcc tcggcggtgc acaactgcga catcaggttg
9781	gcgctggcac cccgtccacg ccggcatggt gcaccttggc catcgcccga gggcgatccc
9841	cgatgccgtc caccccttcg acgaacccat ctcccacggc ggtcgccggc agcgacgcga
9901	tgtggccgca gatctccgag agttcggccc gcccgcccgg cgacggcaac ccgatgccgt
9961	gcaagtgacg atcgatgtga ggttcaaggt tcagcgcact gctggcaagc tttttccgaa
10021	accgcggcct cgccttgatc tggagtcaga acgcgtcacg cagccggtca aaggcgtaac
10031	ccatgctcga gcaaacatgc atgggctgag tggacgtttc cagacacagc aactggcgtc
10141	caggccactg agccgctgca tgcgcgatgg tatgccgatg ggggccccgg gcgcgtctga
10201	ggggaagaag tggcagactg tcagggtccg acgaacccgg ggaccctaac gggccacgag
10261	gatcgacccg accaccatta gggacagtga tgtctgagca gactatctat ggggccaata
10321	cccccggagg ctccgggccg cggaccaaga tccgcaccca ccacctacag agatggaagg
10381	ccgacggcca caagtgggcc atgctgacgg cctacgacta ttcgacggcc cggatcttcg
10441	acgaggccgg catcccggtg ctgctggtcg gtgattcggc ggccaacgtc gtgtacggct
10501	acgacaccac cgtgccgatc tccatcgacg agctgatccc gctggtccgt ggcgtggtgc
10561	ggggtgcccc gcacgcactg gtcgtcgccg acctgccgtt cggcagctac gaggcggggc
10621	ccaccgccgc gttggccgcc gccacccggt tcctcaagga cggcggcgca catgcggtca
10681	agctcgaggg cggtgagcgg gtggccgagc aaatcgcctg tctgaccgcg gcgggcatcc
10741	cggtgatggc acacatcggc ttcaccccgc aaagcgtcaa caccttgggc ggcttccggg
10801	tgcagggccg cggcgacgcc gccgaacaaa ccatcgccga cgcgatcgcc gtcgccgaag
10861	ccggagcgtt tgccgtcgtg atggagatgg tgcccgccga gttggccacc cagatcaccg
10921	gcaagcttac cattccgacg gtcgggatcg gcgctgggcc caactgcgac ggccaggtcc
10981	tggtatggca ggacatggcc gggttcagcg gcgccaagac cgcccgcttc gtcaaacggt
11041	atgccgatgt cggtggtgaa ctacgccgtg ctgcaatgca atacgcccaa gaggtggccg
11101	gcggggtatt ccccgctgac gaacacagtt tctgaccaag ccgaatcagc ccgatgcgcg
11161	ggcattgcgg tggcgccctg gatgccgtcg acgccggatt gccggcgcgg acgcgccagc
11221	gggacccatc ggcgtcgcgt tcgccggttg agcccggggt gagcccagac attcgatgtg
11281	cccaacacca tccgccacag cccaattgat gtggcactct atgcatgcct atccccgacc
11341	aaccaccacc gcggcgacgc atcatgaccg gaggcgaaga tgccagtaga ggcgcccaga
11401	ccagcgcgcc atctggaggt cgagcgcaag ttcgacgtga tcgagtcgac ggtgtcgccg
11461	tcgttcgagg gcatcgccgc ggtggttcgc gtcgagcagt cgccgaccca gcagctcgac
11521	gcggtgtact tcgacacacc gtcgcacgac ctggcgcgca accagatcac cttgcggcgc
11581	cgcaccggcg gcgccgacgc cggctggcat ctgaagctgc cggccggacc cgacaagcgc
11641	accgagatgc gagcaccgct gtccgcatca ggcgacgctg tgccggccga gttgttggat
11701	gtggtgctgg cgatcgtccg cgaccagccg gttcagccgg tcgcgcggat cagcactcac
11761	cgcgaaagcc agatcctgta cggcgccggg ggcgacgcgc tggcggaatt ctgcaacgac
11821	gacgtcaccg catggtcggc cggggcattc cacgccgctg gtgcagcgga caacggccct
11881	gccgaacagc agtggcgcga atgggaactg gaactggtca ccacggatgg gaccgccgat
11941	accaagctac tggaccggct agccaaccgg ctgctcgatg ccggtgccgc acctgccggc
12001	cacggctcca aactggcgcg ggtgctcggt gcgacctctc ccggtgagct gcccaacggc
12061	ccgcagccgc cggcggatcc agtacaccgc gcggtgtccg agcaagtcga gcagctgctg
12121	ctgtgggatc gggccgtgcg ggccgacgcc tatgacgccg tgcaccagat gcgagtgacg
12181	acccgcaaga tccgcagctt gctgacggat tcccaggagt cgtttggcct gaaggaaagt
12241	gcgtgggtca tcgatgaact gcgtgagctg gccgatgtcc tgggcgtagc ccgggacgcc
12301	gaggtactcg gtgaccgcta ccagcgcgaa ctggacgcgc tggcgccgga gctggtacgc
12361	ggccgggtgc gcgagcgcct ggtagacggg gcgcggcggc gataccagac cgggctgcgg
12421	cgatcactga tcgcattgcg gtcgcagcgg tacttccgtc tgctcgacgc tctagacgcg
12481	cttgtgtccg aacgcgccca tgccacttct ggggaggaat cggcaccggt aaccatcgat
12541	gcggcctacc ggcgagtccg caaagccgca aaagccgcaa agaccgccgg cgaccaggcg
12601	ggcgaccacc accgcgacga ggcattgcac ctgatccgca agcgcgcgaa gcgattacgc
12661	tacaccgcgg cggctactgg ggcggacaat gtgtcacaag aagccaaggt catccagacg
12721	ttgctaggcg atcatcaaga cagcgtggtc agccgggaac atctgatcca gcaggccata
12781	gccgcgaaca ccgccggcga ggacaccttc acctacggtc tgctctacca acaggaagcc
12841	gacttggccg agcgctgccg ggagcagctt gaagccgcgc tgcgcaaact cgacaaggcg
12901	gtccgcaaag cacgggattg agcccgccag gggcggacga gttggcctgt aagccggatt
12961	ctgttccgcg ccgccacagc caagctaacg gcggcacggc ggcgaccatc catctggaca
13021	caccgttacc gggtgcctcg agcggcctac ccgcaggctc gggcgagcaa ccctcaagcg
13081	cctgcgcggc cgcactttcg gtgcggcctt cttggccttg cttcgggtgg ggtttgccta
13141	gccaccccgg tcacccggaa tgctggtgcg ctcttaccgc accgtttcac ccttgccacc
13201	acgaggatgg cggtctgttt tctgtggcac tttcccgcga gtcacctcgg attgccgtta
13261	gcaatcaccc tgctctgtga agtccggact ttcctcgact cgacgctgaa cctcgtgaat
13321	ccacacaagc cctacgcgag ccgcggccgc ccagccaact catccgcgac gaccacgcta
13381	ccccgctggg cggtgtcgcg gccagtgtga ccgctggacg acacggctag tcggacagcc
13441	gatccggcgg gcagtcctta tcgtggactg gtgacacggt gggacaaacg cgtcgactcc
13501	ggcgactggg acgccatcgc tgccgaggtc agcgagtacg gtggcgcact gctacctcgg
13561	ctgatcaccc ccggcgaggc cgcccggctg cgcaagctgt acgccgacga cggcctgttt
13621	cgctcgacgg tcgatatggc atccaagcgg tacggcgccg ggcagtatcg atatttccat
13681	gccccctatc ccgagtgatc gagcgtctca agcaggcgct gtatcccaaa ctgctgccga
13741	tagcgcgcaa ctggtgggcc aaactgggcc gggaggcgcc ctggccagac agccttgatg
13801	actggttggc gagctgtcat gccgccggcc aaacccgatc cacagcgctg atgttgaagt
13861	acggcaccaa cgactggaac gccctacacc aggatctcta cggcgagttg gtgtttccgc
13921	tgcaggtggt gatcaacctg agcgatccgg aaaccgacta caccggcggc gagttcctgc
13981	ttgtcgaaca gcggcctcgc gcccaatccc ggggtaccgc aatgcaactt ccgcagggac
14041	atggttatgt gttcacgacc cgtgatcggc cggtgcggac tagccgtggc tggtcggcat
14101	ctccagtgcg ccatgggctt tcgactattc gttccggcga acgctatgcc atggggctga
14161	tctttcacga cgcagcctga ttgcacgcca tctatagata gcctgtctga ttcaccaatc
14221	gcaccgacga tgccccatcg gcgtagaact cggcgatgct cagcgatgcc agatcaagat
14281	gcaaccgata taggacgccc gacccggcat ccaacgccag ccgcaacaac attttgatcg
14341	gcgtgacatg tgacaccacc agcaccgtcg cgccttcgta gccaacgatg atccgatcac
14401	gtccccgccg aacccgccgc agcacgtcgt cgaagctttc cccacccggg ggcgtgatgc
14461	tggtgtcctg cagccagcga cggtgcagct cgggatcgcg ttctgcggcc tccgcgaacg
14521	tcagcccctc ccaggcgccg aagtcggtct cgaccaggtc gtcatcgacg accacgtcca
14581	gggccagggc tctggcggcg gtcaccgcgg tgtcgtaagc ccgctgtagc ggcgaggaga
14641	ccaccgcagc gatcccgccg cgccgcgcca gatacccggc cgccgcacca acctggcgcc
14701	accccacctc gttcaacccc gggttgccgc gccccgaata gcggcgttgc tccgacagct
14761	ccgtctgccc gtggcgcaac aaaagtagtc gggtgggtgt accgcgggcg ccggtccagc
14821	cgggagatgt cggtgactcg gtcgcaacga ttttggcagg atccgcatcc gccgcagccg
14881	attgcgcggc ggcgtccatc gcgtcattgg ccaaccggtc tgcatacgtg ttccgggcac
14941	gcggaaccca ctcgtagttg atcctgcgaa actgggacgc caacgcctga gcctggacat
15001	agagcttcag cagatccggg tgcttgacct tccaccgccc ggacatctgc tccaccacca
15061	gcttggagtc catcagcacc gcggcctcgg tggcacctag tttcacggcg tcgtccaaac
15121	cggctatcag gccgcggtat tcggcgacgt tgttcgtcgc ccggccgatc gcctgcttgg
15181	actcggccag cacggtggag tgatcggcgg tccacaccac cgcgccgtat ccggccggtc
15241	cgggattgcc ccgcgatccg ccgtcggctt cgatgacaac tttcactcct caaatccttc
15301	gagccgcaac aagatcgctc cgcattccgg gcagcgcacc acttcatcct cggcggccgc
15361	cgagatctgg gccagctcgc cgcggccgat ctcgatccgg caggcaccac atcgatgacc
15421	ttgcaaccgc ccggcccctg gcccgcctcc ggcccgctgt ctttcgtaga gccccgcaag
15481	ctcgggatca agtgtcgccg tcagcatgtc gcgttgcgat gaatgttggt gccgggcttg
15541	gtcgatttcg gcaagtgcct cgtccaaagc ctgctgggcg gcggccaggt cggcccgcaa
15601	cgcttggagc gcccgcgact cggcggtctg ttgagcctgc agctcctcgc ggcgttccag
15661	cacctccagc agggcatctt ccaaactggc ttgacggcgt tgcaagctgt cgagctcgtg
15721	ctgcagatca gccaattgct tggcgtccgt tgcacccgaa gtgagcaacg accggtcccg
15781	gtcgccacgc ttacgcaccg catcgatctc cgactcaaaa cgcgacacct ggccgtccaa
15841	gtcctccgcc gcgattcgca gggccgccat cctgtcgttg gcggcgttgt gctcggcctg
15901	cacctgctgg taagccgccc gctgcggcag atgggtagcc cgatgcgcga tccgggtcag
15961	ctcagcatcc agcttcgcca attccagtag cgaccgttgc tgtgccactc cggctttcat
16021	gcctgatctc tcccagtttc gtgatcgagg ttccacgggt cggtgcagat ggtgcacaca
16081	cgcaccggca gcgacgcgcc gaaatgagac cgcaacactt cggcggcctg gccgcaccac
16141	gggaattcgc ttgcccaatg cgcgacgtcg atcagggcca cttgcgaagc tcggcaatgc
16201	tcgtcggctg gatgatgtcg cagatcggcc gtaacgtacg cttgcacgtc cgcggcggcc
16261	acggtggcaa gcaacgagtc cccggcgccg ccgcagaccg cgacccgcga caccagcagg
16321	tcgggatccc cggcggcgcg cacaccggtc gcagtcggcg gcaacgcggc ctccagacgg
16381	gcaacaaagg tgcgcagcgg ttcgggtttt ggcagtctgc caatccggcc taacccgctg
16441	ccgaccggcg gtggtaccag cgcgaagatg tcgaatgccg gctcctcgta agggtgcgcg
16501	gcgcgcatcg ccgccaacac ctcggcgcgc gctcgtgcgg gtgcgacgac ctcgacccgg
16561	tcctcggcca cccgttcgac ggtaccgacg ctgcctatgg cgggcgacgc cccgtcgtgc
16621	gccaggaact gcccggtacc cgcgacactc cagctgcagt gcgagtagtc gccgatatgg
16681	ccggcaccgg cctcaaagac cgctgcccgc accgcctctg agttctcgcg cggcacatag
16741	atgacccact tgtcgagatc ggccgctccg ggcaccgggt cgagaacggc gtcgacggtc
16801	agaccaacag cgtgtgccag cgcgtcggac acacccggcg acgccgagtc ggcgttggtg
16861	tgcgcggtaa acaacgagcg accggtccgg atcaggcggt gcaccagcac accctttggc
16921	gtgttggccg cgaccgtatc gaccccacgc agtaacaacg ggtggtgcac caatagcagt
16981	ccggcctggg gaacctggtc caccaccgcc ggcgtcgcgt ccaccgcaac ggtcaccgaa
17041	tccaccacgt cgtcggggtc gccgcacacc agacccaccg aatcccacga ctgggcaagc
17101	cgcggcgggt aggcctggtc cagcacgtcg atgacatcgg ccagccgcac actcatcggc
17161	gtcctccacg ctttgcccac tcggcgatcg ccgccaccag cacgggccac tccgggcgca
17221	ccgccgcccg caggtaccgc gcgtccaggc cgacgaaggt gtcaccgcgg cgcaccgcaa
17281	ttcctttgct ctgcaaatag tttcgtaatc cgtcagcatc ggcgatgttg aacagtacga
17341	aaggggccgc accatcgacc acctcggcac ccaccgatct cagtccggcc accatctccg
17401	cgcgcagcgc cgtcaaccgc accgcatcgg ctgcggcagc ggcgaccgcc cggggggcgc
17461	agcaagcagc gatggccgtc agttgcaatg ttcccaacgg ccagtgcgct cgctgcacgg
17521	tcaaccgagc cagcacgtct ggcgagccga gcgcgtagcc cacccgcaat ccggccagcg
17581	accacgtttt cgtcaagcta cggagcacca gcacatcggg cagcgagtca tcggccaacg
17641	attgcggctc gccgggaacc caatcagcga acgcctcgtc gaccaccagg atgcgtcccg
17701	gccggcgtaa ctcgagcagc tgctcgcgga ggtgcagcac cgaggtgggg ttggtcggat
17761	tacccacgac gacaaggtcg gcgtcgtcag gcacgtgcgc ggtgtccagc acgaacggcg
17821	gctttaggac aacatggtgc gccgtgattc cggcagcgct caaggctatg gccggctcgg
17881	tgaacgcggg cacgacgatt gctgcccgca ccggacttag gttgtgcagc aatgcgaatc
17941	cctccgccgc cccgacgagc gggagcactt cgtcacgggt tctgccatga cgttcagcga
18001	ccgcgtcttg cgcccggtgc acatcgtcgg tgctcggata gcgggccagc tccggcagca
18061	gcgcggcgag ctgccggacc aaccattccg ggggccggtc atggcggacg ttgacggcga
18121	agtccagcac gccgggcgcg acatcctgat caccgtggta gcgcgccgcg gcaagcgggc
18181	tagtgtctag actcgccaca gcgtcaaaca gtagtgggcc ggtgtgcggg ccaagaatcc
18241	agagcaccgc cgacgcgttg tctacgcggc gacaaccgcg acatcacagg cagctaacag
18301	ggcgtcggcg gtgatgatcg tcaggccaag cagctgtgcc tgggcgatga gcacacggtc
18361	gaatggatgt cgatggtgat ccggaagctc tgcggtgcgc agtgtgtgcg tggtcaactg
18421	acagcggcga cgtgccgcag cggcgcattc gatcgggcac gtaagaagcc gatggctcgg
18481	gcggcgggag cttgccgagg cggtagttga tcgcgatctc ccaggcactg gcggccgaca
18541	agagaatgct gttgcggacg tcctgaacaa tcgcccgtgt ttcgttgacg gcatccgcag
18601	ccaaacgtgg gtgtcgatga ggtagcgctt caccggtgaa agcgttcgag cacgtcgtct
18661	gacaacggag cgtccaaatc gtcgggcacg cggtacacgc catggtcaat gcctaaccgc
18721	cgagtctcat gaggatgcag cggcacaagc tttgctaccg gctcgccgcg gcgggcaatc
18781	tcaacctctg cccgccgtag acgagccgca gcagctcgga caggcgtgtc ttcgcctcgt
18841	gaacgccgac ccgcttcgca ggcgcccaga ctttcgcgtc gaccacctgc tcaccaaact
18901	tcgcgatcat cgcctgatac cacagcgcca acgggtagcg gtttgtccaa ccgcttcgtc
18961	aacgacaatg ggatcgtgac cgacacgacc gcgagcggga ccaattgccc gcctcctcca
19021	cgcgccgccg cacggcgcgc atcgtcgccg ggtgaatcgc cgcagctggt gatcttcgat
19081	ctggacggca cgctgaccga ctcggcgcgc ggaatcgtat ccagcttccg acacgcgctc
19141	aaccacatcg gtgccccagt acccgaaggc gacctggcca ctcacatcgt cggcccgccc
19201	atgcatgaga cgctgcgcgc catggggctc ggcgaatccg ccgaggaggc gatcgtagcc
19261	taccgggccg actacagcgc ccgcggttgg gcgatgaaca gcttgttcga cgggatcggg
19321	ccgctgctgg ccgacctgcg caccgccggt gtccggctgg ccgtcgccac ctccaaggca
19381	gagccgaccg cacggcgaat cctgcgccac ttcggaattg agcagcactt cgaggtcatc
19441	gcgggcgcga gcaccgatgg ctcgcgaggc agcaaggtcg acgtgctggc ccacgcgctc
19501	gcgcagctgc ggccgctacc cgagcggttg gtgatggtcg gcgaccgcag ccacgacgtc
19561	gacggggcgg ccgcgcacgg catcgacacg gtggtggtcg gctggggcta cgggcgcgcc
19621	gactttatcg acaagacctc caccaccgtc gtgacgcatg ccgccacgat tgacgagctg
19681	agggaggcgc taggtgtctg atccgctgca cgtcacattc gtttgtacgg gcaacatctg
19741	ccggtcgcca atggccgaga agatgttcgc ccaacagctt cgccaccgtg gcctgggtga
19801	cgcggtgcga gtgaccagtg cgggcaccgg gaactggcat gtaggcagtt gcgccgacga
19861	gcgggcggcc ggggtgttgc gagcccacgg ctaccctacc gaccaccggg ccgcacaagt
19921	cggcaccgaa cacctggcgg cagacctgtt ggtggccttg gaccgcaacc acgctcggct
19981	gttgcggcag ctcggcgtcg aagccgcccg ggtacggatg ctgcggtcat tcgacccacg
20041	ctcgggaacc catgcgctcg atgtcgagga tccctactat ggcgatcact ccgacttcga
20101	ggaggtcttc gccgtcatcg aatccgccct gcccggcctg cacgactggg tcgacgaacg
20161	tctcgcgcgg aacggaccga gttgatgccc cgcctagcgt tcctgctgcg gcccggctgg
20221	ctggcgttgg ccctggtcgt ggtcgcgttc acctacctgt gctttacggt gctcgcgccg
20281	tggcagctgg gcaagaatgc caaaacgtca cgagagaacc agcagatcag gtattccctc
20341	gacaccccgc cggttccgct gaaaaccctt ctaccacagc aggattcgtc ggcgccggac
20401	gcgcagtggc gccgggtgac ggcaaccgga cagtaccttc cggacgtgca ggtgctggcc
20461	cgactgcgcg tggtggaggg ggaccaggcg tttgaggtgt tggccccatt cgtggtcgac
20521	ggcggaccaa ccgtcctggt cgaccgtgga tacgtgcggc cccaggtggg ctcgcacgta
20581	ccaccgatcc cccgcctgcc ggtgcagacg gtgaccatca ccgcgcggct gcgtgactcc
20641	gaaccgagcg tggcgggcaa agacccattc gtcagagacg gcttccagca ggtgtattcg
20701	atcaataccg gacaggtcgc cgcgctgacc ggagtccagc tggctgggtc ctatctgcag
20761	ttgatcgaag accaacccgg cgggctcggc gtgctcggcg ttccgcatct agatcccggg
20821	ccgttcctgt cctatggcat ccaatggatc tcgttcggca ttctggcacc gatcggcttg
20881	ggctatttcg cctacgccga gatccgggcg cgccgccggg aaaaagcggg gtcgccacca
20941	ccggacaagc caatgacggt cgagcagaaa ctcgctgacc gctacggccg ccggcggtaa
21001	accaacatca cggccaatac cgcagccccc gcctggacca cccgcgacag caccacggcg
21061	cggcgcagat cggccacctt gggcgaccgg ccgtcgccca aggtgggccg gatctgcaac
21121	tcatggtggt accgggtggg cccacccagc cgcacgtcaa gcgccccagc aaacgccgcc
21181	tcgacgacac cggcgttggg gctgggatgg cgggcggcgt cgcgccgcca ggcccgtacc
21241	gcaccgcggg gcgacccacc gaccaccggc gcgcagatca ccaccagcac cgccgtcgcc
21301	cgtgcgccaa catagttggc ccagtcatcc aatcgtgctg cagcccaacc gaatcggaga
21361	taacgcggcg agcggtagcc gatcatcgag tccagggtgt tgatggcacg atatcccagc
21421	accgcaggca cgccgctcga agccgcccac agcagcggca ccacctgggc gtcggcggtg
21481	ttttcggcca ccgactccag cgcggcacgc gtcaggcccg ggccgcccag ctgggccggg
21541	tcacgcccgc acagcgacgg cagcagccgt cgcgccgcct cgacatcgtc gcgctccaac
21601	aggtccgata tctggcggcc ggtgcgcgcc agcgaagttc cgcccagcgc tgcccaggtg
21661	gccgtcgcgg tggccgccac gggccaggac ctgccgggta gccgctgcag tgccgcgccg
21721	agcaagccca ccgcgccgac cagcaggccg acgtgtaccg caccggcgac ccggccgtca
21781	cggtaggtga tctgctccag cttggcggcc gcccgaccga acagggccac cggatgacct
21841	cgtttggggt cgccgaacac gacgtcgagc aggcagccga tcagcacgcc gacggccctg
21901	gtctgccagg tcgatgcaaa cactccggca gcgtcgcaca cgtggtctac gctcagctat
21961	ttatgacctc atacggcagc tatccacgat gaagcggcca gctacccggg ttgccgacct
22021	gttgaacccg gcggcaatgt tgttgccggc agcgaatgtc atcatgcagc tggcagtgcc
22081	gggtgtcggg tatggcgtgc tggaaagccc ggtggacagc ggcaacgtct acaagcatcc
22141	gttcaagcgg gcccggacca ccggcaccta cctggcggtg gcgaccatcg ggacggaatc
22201	cgaccgagcg ctgatccggg gtgccgtgga cgtcgcgcac cggcaggttc ggtcgacggc
22261	ctcgagccca gtgtcctata acgccttcga cccgaagttg cagctgtggg tggcggcgtg
22321	tctgtaccgc tacttcgtgg accagcacga gtttctgtac ggcccactcg aagatgccac
22381	cgccgacgcc gtctaccaag acgccaaacg gttagggacc acgctgcagg tgccggaggg
22441	gatgtggccg ccggaccggg tcgcgttcga cgagtactgg aagcgctcgc ttgatgggct
22501	gcagatcgac gcgccggtgc gcgagcatct tcgcggggtg gcctcggtag cgtttctccc
22561	gtggccgttg cgcgcggtgg ccgggccgtt caacctgttt gcgacgacgg gattcttggc
22621	accggagttc cgcgcgatga tgcagctgga gtggtcacag gcccagcagc gtcgcttcga
22681	gtggttactt tccgtgctac ggttagccga ccggctgatt ccgcatcggg cctggatctt
22741	cgtttaccag ctttacttgt gggacatgcg gtttcgcgcc cgacacggcc gccgaatcgt
22801	ctgatagagc ccggccgagt gtgagcctga cagcccgaca ccggcggcgt gtgtcgcgtc
22861	gccaggttca cgctcggcga tctagagccg ccgaaaacct acttctgggt tgcctcccga
22921	atcaacgtgc tgatctgctc gagcagctca cgcatatcgg cgcgcatcgc atccaccgcg
22981	gcatacaggt cggccttggt cgccggcagc tggtccgacg tcattggccg caccggcggt
23041	gctgtctgtc gcgccgcgct gtcgctttga aacccaggtc gctcacccac gaccacgaca
23101	ctgccatatc cggcgccccg ccgacaacga agcacagcta gccggtgggc gcggacggga
23161	tcgaaccgcc gaccgctggt gtgtaaaacc agagctctac cgctgagcta cgcgcccatg
23221	accgccgcag gctacacgcc ttgcggccaa gcacccaaaa ccttaggccg taagcgccgc
23281	cagagcgtcg gtccacagcc gctgatcgcg aacttcaccc ggctgcttca tctcggcgaa
23341	ccgaatgatc cctgaccgat cgaccacaaa ggtgccccgg ttagcgatgc cggcctgctc
23401	gttgaagacg ccgtaggcct gactgaccgc gccgtgtggc cagaagtccg acaacagcgg
23461	aaacgtgaat ccgctctgcg tcgcccagat cttgtgagtg ggtggcgggc ccaccgaaat
23521	cgctagcgcg gcgctgtcgt cgttctcaaa ctcgggcagg tgatcacgca actggtccag
23581	ctcgccctgg cagatgcccg tgaacgccaa cggaaagaac accaacagca cgttctttgc
23641	accccggtag ccgcgcaggg tgacaagctg ctgattctgg tcgcgcaacg tgaagtcagg
23701	ggcggtggct ccgacgttca gcatcagcgc ttgccagccc gcgatttcgg ctgtaccaat
23761	ctgctggcgc tccagttgcc cagattgacc gacgaggtcg gcatcagccc agctgtgggc
23821	gccgcctcgg caatctcggc gggcaataca tggccgggct ggccggtctt gggcgtcacc
23881	acccaaatca caccgtcctc ggcgagcggg ccgatcgcat ccatcagggt gtccaccaaa
23941	tcgccgtcgc catcacgcca ccacaacagg acgacatcga tgacctcgtc ggtgtcttca
24001	tcgagcaact ctcccccgca cgcttcttcg atggccgcgc ggatgtcgtc gtcggtgtct
24061	tcgtcccagc cccattcctg gataagttgg tctcgttgga tgcccaattt gcgggcgtag
24121	ttcgaggcgt gatccgccgc gaccaccgtg gaacctcctt cagtctccgc gggccatgtg
24181	cacaccgtcg cgatgggcat tatcgtcgca cagccagaac cggtccaccc gcccgcctca
24241	gaaggcggcc acgcacattg tcaatgcctt tgtcttggtg tcgttgagcc gatcaacccg
24301	ccggttgaat tccgctgtcg acgcgtgcgc accgatggca tttgccaccg cgcgggccgc
24361	gtcgacatat gcgttgagcg catcccccag ttgcgcggac agcgcggcgc tcagactgcc
24421	tgagaccgtc gaggcactgt tgttgagcgc gtcgatggcc ggaccttcgg tcggcccggt
24481	gttgcggccc tgattgaacg cggccacgta ggcgttcacc ttgtcgatgg cgtccttgct
24541	ggtggccgcc agcgcgtcac acgaggtgcg aatcgccttg gtcgtcagcg attgttggcg
24601	ctgcgactcc cggatgctcg acgtcgccgc cgaagccgac accgacgcgg acaccgacga
24661	gcggtaggcc ggtgcgacgt tggtgtcggg catggccgta ccgtcggtga cagtggtaca
24721	tccgacgatc cccatcagca gcagcgcgat gcagccgagc gccagggcgc ctcgcctggg
24781	gagctccccc ccgtgcctgc gaggcacggc gcgccatccg atgagcacgg catgtgaggt
24841	tacctggtcg cagcgcgacc gcgctggccg tggtgtgtcg cgcatccgca gaaccgagcg
24901	gagtgcggct atccgccgcc gacgccggtg cggcacgata gggggacgac catctaaaca
24961	gcacgcaagc ggaagcccgc cacctacagg agtagtgcgt tgaccaccga tttcgcccgc
25021	cacgatctgg cccaaaactc aaacagcgca agcgaacccg accgagttcg ggtgatccgc
25081	gagggtgtgg cgtcgtattt gcccgacatt gatcccgagg agacctcgga gtggctggag
25141	tcctttgaca cgctgctgca acgctgcggc ccgtcgcggg cccgctacct gatgttgcgg
25201	ctgctagagc gggccggcga gcagcgggtg gccatcccgg cattgacgtc taccgactat
25261	gtcaacacca tcccgaccga gctggagccg tggttccccg gcgacgaaga cgtcgaacgt
25321	cgttatcgag cgtggatcag atggaatgcg gccatcatgg tgcaccgtgc gcaacgaccg
25381	ggtgtgggcg tgggtggcca tatctcgacc tacgcgtcgt ccgcggcgct ctatgaggtc
25441	ggtttcaacc acttcttccg cggcaagtcg cacccgggcg gcggcgatca ggtgttcatc
25501	cagggccacg cttccccggg aatctacgcg cgcgccttcc tcgaagggcg gttgaccgcc
25561	gagcaactcg acggattccg ccaggaacac agccatgtcg gcggcgggtt gccgtcctat
25621	ccgcacccgc ggctcatgcc cgacttctgg gaattcccca ccgtgtcgat gggtttgggc
25681	ccgctcaacg ccatctacca ggcacggttc aaccactatc tgcatgaccg cggtatcaaa
25741	gacacctccg atcaacacgt gtggtgtttt ttgggcgacg gcgagatgga cgaacccgag
25801	agccgtgggc tggcccacgt cggcgcgctg gaaggcttgg acaacttgac cttcgtgatc
25861	aactgcaatc tgcagcgact cgacggcccg gtgcgcggca acggcaagat catccaggag
25921	ctggagtcgt tcttccgcgg tgccggctgg aacgtcatca aggtggtgtg gggccgcgaa
25981	tgggatgccc tgctgcacgc cgaccgcgac ggtgcgctgg tgaatttaat gaatacaaca
26041	cccgatggcg attaccagac ctataaggcc aacgacggcg gctacgtgcg tgaccacttc
26101	ttcggccgcg acccacgcac caaggcgctg gtggagaaca tgagcgacca ggatatctgg
26161	aacctcaaac ggggcggcca cgattaccgc aaggtttacg ccgcctaccg cgccgccgtc
26221	gaccacaagg gacagccgac ggtgatcctg gccaagacca tcaaaggcta cgcgctgggc
26281	aagcatttcg aaggacgcaa tgccacccac cagatgaaaa aactgaccct ggaagacctt
26341	aaggagtttc gtgacacgca gcggattccg gtcagcgacg cccagcttga agagaatccg
26401	tacctgccgc cctactacca ccccggcctc aacgccccgg agattcgtta catgctcgac
26461	cggcgccggg ccctcggggg ctttgttccc gagcgcagga ccaagtccaa agcgctgacc
26521	ctgccgggtc gcgacatcta cgcgccgctg aaaaagggct ctgggcacca ggaggtggcc
26581	accaccatgg cgacggtgcg cacgttcaaa gaagtgttgc gcgacaagca gatcgggccg
26641	aggatagtcc cgatcattcc cgacgaggcc cgcaccttcg ggatggactc ctggttcccg
26701	tcgctaaaga tctataaccg caatggccag ctgtataccg cggttgacgc cgacctgatg
26761	ctggcctaca aggagagcga agtcgggcag atcctgcacg agggcatcaa cgaagccggg
26821	tcggtgggct cgttcatcgc ggccggcacc tcgtatgcga cgcacaacga accgatgatc
26881	cccatttaca tcttctactc gatgttcggc ttccagcgca ccggcgatag cttctgggcc
26941	gcggccgacc agatggctcg agggttcgtg ctcggggcca ccgccgggcg caccaccctg
27001	accggtgagg gcctgcaaca cgccgacggt cactcgttgc tgctggccgc caccaacccg
27061	gcggtggttg cctacgaccc ggccttcgcc tacgaaatcg cctacatcgt ggaaagcgga
27121	ctggccagga tgtgcgggga gaacccggag aacatcttct tctacatcac cgtctacaac
27181	gagccgtacg tgcagccgcc ggagccggag aacttcgatc ccgagggcgt gctgcggggt
27241	atctaccgct atcacgcggc caccgagcaa cgcaccaaca aggcgcagat cctggcctcc
27301	ggggtagcga tgcccgcggc gctgcgggca gcacagatgc tggccgccga gtgggatgtc
27361	gccgccgacg tgtggtcggt gaccagttgg ggcgagctaa accgcgacgg ggtggccatc
27421	gagaccgaga agctccgcca ccccgatcgg ccggcgggcg tgccctacgt gacgagagcg
27481	ctggagaatg ctcggggccc ggtgatcgcg gtgtcggact ggatgcgcgc ggtccccgag
27541	cagatccgac cgtgggtgcc gggcacatac ctcacgttgg gcaccgacgg gttcggcttt
27601	tccgacactc ggcccgccgc tcgccgctac ttcaacaccg acgccgaatc ccaggtggtc
27661	gcggttttgg aggcgttggc gggcgacggc gagatcgacc catcggtgcc ggtcgcggcc
27721	gcccgccagt accggatcga cgacgtggcg gctgcgcccg agcagaccac ggatcccggt
27781	cccggggcct aacgccggcg agccgaccgc ctttggccga atcttccaga aatctggcgt
27841	agcttttagg agtgaacgac aatcagttgg ctccagttgc ccgcccgagg tcgccgctcg
27901	aactgctgga cactgtgccc gattcgctgc tgcggcggtt gaagcagtac tcgggccggc
27961	tggccaccga ggcagtttcg gccatgcaag aacggttgcc gttcttcgcc gacctagaag
28021	cgtcccagcg cgccagcgtg gcgctggtgg tgcagacggc cgtggtcaac ttcgtcgaat
28081	ggatgcacga cccgcacagt gacgtcggct ataccgcgca ggcattcgag ctggtgcccc
28141	aggatctgac gcgacggatc gcgctgcgcc agaccgtgga catggtgcgg gtcaccatgg
28201	agttcttcga agaagtcgtg cccctgctcg cccgttccga agagcagttg accgccctca
28261	cggtgggcat tttgaaatac agccgcgacc tggcattcac cgccgccacg gcctacgccg
28321	atgcggccga ggcacgaggc acctgggaca gccggatgga ggccagcgtg gtggacgcgg
28381	tggtacgcgg cgacaccggt cccgagctgc tgtcccgggc ggccgcgctg aattgggaca
28441	ccaccgcgcc ggcgaccgta ctggtgggaa ctccggcgcc cggtccaaat ggctccaaca
28501	gcgacggcga cagcgagcgg gccagccagg atgtccgcga caccgcggct cgccacggcc
28561	gcgctgcgct gaccgacgtg cacggcacct ggctggtggc gatcgtctcc ggccagctgt
28621	cgccaaccga gaagttcctc aaagacctgc tggcagcatt cgccgacgcc ccggtggtca
28681	tcggccccac ggcgcccatg ctgaccgcgg cgcaccgcag cgctagcgag gcgatctccg
28741	ggatgaacgc cgtcgccggc tggcgcggag cgccgcggcc cgtgctggct agggaacttt
28801	tgcccgaacg cgccctgatg ggcgacgcct cggcgatcgt ggccctgcat accgacgtga
28861	tgcggcccct agccgatgcc ggaccgacgc tcatcgagac gctagacgca tatctggatt
28921	gtggcggcgc gattgaagct tgtgccagaa agttgttcgt tcatccaaac acagtgcggt
28981	accggctcaa gcggatcacc gacttcaccg ggcgcgatcc cacccagcca cgcgatgcct
29041	atgtccttcg ggtggcggcc accgtgggtc aactcaacta tccgacgccg cactgaagca
29101	tcgacagcaa tgccgtgtca tagattccct cgccggtcag agggggtcca gcaggggccc
29161	cggaaagata ccaggggcgc cgtcggacgg aaagtgatcc agacaacagg tcgcgggacg
29221	atctcaaaaa catagcttac aggcccgttt tgttggttat atacaaaaac ctaagacgag
29281	gttcataatc tgttacaccg cgcaaaaccg tcttcacagt gttctcttag acacgtgatt
29341	gcgttgctcg cacccggaca gggttcgcaa accgagggaa tgttgtcgcc gtggcttcag
29401	ctgcccggcg cagcggacca gatcgcggcg tggtcgaaag ccgctgatct agatcttgcc
29461	cggctgggca ccaccgcctc gaccgaggag atcaccgaca ccgcggtcgc ccagccattg
29521	atcgtcgccg cgactctgct ggcccaccag gaactggcgc gccgatgcgt gctcgccggc
29581	aaggacgtca tcgtggccgg ccactccgtc ggcgaaatcg cggcctacgc aatcgccggt
29641	gtgatagccg ccgacgacgc cgtcgcgctg gccgccaccc gcggcgccga gatggccaag
29701	gcctgcgcca ccgagccgac cggcatgtct gcggtgctcg gcggcgacga gaccgaggtg
29761	ctgagtcgcc tcgagcagct cgacttggtc ccggcaaacc gcaacgccgc cggccagatc
29821	gtcgctgccg gccggctgac cgcgttggag aagctcgccg aagacccgcc ggccaaggcg
29881	cgggtgcgtg cactgggtgt cgccggagcg ttccacaccg agttcatggc gcccgcactt
29941	gacggctttg cggcggccgc ggccaacatc gcaaccgccg accccaccgc cacgctgctg
30001	tccaaccgcg acgggaagcc ggtgacatcc gcggccgcgg cgatggacac cctggtctcc
30061	cagctcaccc aaccggtgcg atgggacctg tgcaccgcga cgctgcgcga acacacagtc
30121	acggcgatcg tggagttccc ccccgcgggc acgcttagcg gtatcgccaa acgcgaactt
30181	cggggggttc cggcacgcgc cgtcaagtca cccgcagacc tggacgagct ggcaaaccta
30241	taaccgcgga ctcggccaga acaaccacat acccgtcagt tcgatttgta cacaacatat
30301	tacgaaggga agcatgctgt gcctgtcact caggaagaaa tcattgccgg tatcgccgag
30361	atcatcgaag aggtaaccgg tatcgagccg tccgagatca ccccggagaa gtcgttcgtc
30421	gacgacctgg acatcgactc gctgtcgatg gtcgagatcg ccgtgcagac cgaggacaag
30481	tacggcgtca agatccccga cgaggacctc gccggtctgc gtaccgtcgg tgacgttgtc
30541	gcctacatcc agaagctcga ggaagaaaac ccggaggcgg ctcaggcgtt gcgcgcgaag
30601	attgagtcgg agaaccccga tgccgttgcc aacgttcagg cgaggcttga ggccgagtcc
30661	aagtgagtca gccttccacc gctaatggcg gtttccccag cgttgtggtg accgccgtca
30721	cagcgacgac gtcgatctcg ccggacatcg agagcacgtg gaagggtctg ttggccggcg
30781	agagcggcat ccacgcactc gaagacgagt tcgtcaccaa gtgggatcta gcggtcaaga
30841	tcggcggtca cctcaaggat ccggtcgaca gccacatggg ccgactcgac atgcgacgca
30901	tgtcgtacgt ccagcggatg ggcaagttgc tgggcggaca gctatgggag tccgccggca
30961	gcccggaggt cgatccagac cggttcgccg ttgttgtcgg caccggtcta ggtggagccg
31021	agaggattgt cgagagctac gacctgatga atgcgggcgg cccccggaag gtgtccccgc
31081	tggccgttca gatgatcatg cccaacggtg ccgcggcggt gatcggtctg cagcttgggg
31141	cccgcgccgg ggtgatgacc ccggtgtcgg cctgttcgtc gggctcggaa gcgatcgccc
31201	acgcgtggcg tcagatcgtg atgggcgacg ccgacgtcgc cgtctgcggc ggtgtcgaag
31261	gacccatcga ggcgctgccc atcgcggcgt tctccatgat gcgggccatg tcgacccgca
31321	acgacgagcc tgagcgggcc tcccggccgt tcgacaagga ccgcgacggc tttgtgttcg
31381	gcgaggccgg tgcgctgatg ctcatcgaga cggaggagca cgccaaagcc cgtggcgcca
31441	agccgttggc ccgattgctg ggtgccggta tcacctcgga cgcctttcat atggtggcgc
31501	ccgcggccga tggtgttcgt gccggtaggg cgatgactcg ctcgctggag ctggccgggt
31561	tgtcgccggc ggacatcgac cacgtcaacg cgcacggcac ggcgacgcct atcggcgacg
31621	ccgcggaggc caacgccatc cgcgtcgccg gttgtgatca ggccgcggtg tacgcgccga
31681	agtctgcgct gggccactcg atcggcgcgg tcggtgcgct cgagtcggtg ctcacggtgc
31741	tgacgctgcg cgacggcgtc atcccgccga ccctgaacta cgagacaccc gatcccgaga
31801	tcgaccttga cgtcgtcgcc ggcgaaccgc gctatggcga ttaccgctac gcagtcaaca
31861	actcgttcgg gttcggcggc cacaatgtgg cgcttgcctt cgggcgttac tgaagcacga
31921	catcgcgggt cgcgaggccc gaggtggggg tccccccgct tgcgggggcg agtcggaccg
31981	atatggaagg aacgttcgca agaccaatga cggagctggt taccgggaaa gcctttccct
32041	acgtagtcgt caccggcatc gccatgacga ccgcgctcgc gaccgacgcg gagactacgt
32101	ggaagttgtt gctggaccgc caaagcggga tccgtacgct cgatgaccca ttcgtcgagg
32161	agttcgacct gccagttcgc atcggcggac atctgcttga ggaattcgac caccagctga
32221	cgcggatcga actgcgccgg atgggatacc tgcagcggat gtccaccgtg ctgagccggc
32281	gcctgtggga aaatgccggc tcacccgagg tggacaccaa tcgattgatg gtgtccatcg
32341	gcaccggcct gggttcggcc gaggaactgg tcttcagtta cgacgatatg cgcgctcgcg
32401	gaatgaaggc ggtctcgccg ctgaccgtgc agaagtacat gcccaacggg gccgccgcgg
32461	cggtcgggtt ggaacggcac gccaaggccg gggtgatgac gccggtatcg gcgtgcgcat
32521	ccggcgccga ggccatcgcc cgtgcgtggc agcagattgt gctgggagag gccgatgccg
32581	ccatctgcgg cggcgtggag accaggatcg aagcggtgcc catcgccggg ttcgctcaga
32641	tgcgcatcgt gatgtccacc aacaacgacg accccgccgg tgcatgccgc ccattcgaca
32701	gggaccgcga cggctttgtg ttcggcgagg gcggcgccct tctgttgatc gagaccgagg
32761	agcacgccaa ggcacgtggc gccaacatcc tggcccggat catgggcgcc agcatcacct
32821	ccgatggctt ccacatggtg gccccggacc ccaacgggga acgcgccggg catgcgatta
32881	cgcgggcgat tcagctggcg ggcctcgccc ccggcgacat cgaccacgtc aatgcgcacg
32941	ccaccggcac ccaggtcggc gacctggccg aaggcagggc catcaacaac gccttgggcg
33001	gcaaccgacc ggcggtgtac gcccccaagt ctgccctcgg ccactcggtg ggcgcggtcg
33061	gcgcggtcga atcgatcttg acggtgctcg cgttgcgcga tcaggtgatc ccgccgacac
33121	tgaatctggt aaacctcgat cccgagatcg atttggacgt ggtggcgggt gaaccgcgac
33181	cgggcaatta ccggtatgcg atcaataact cgttcggatt cggcggccac aacgtggcaa
33241	tcgccttcgg acggtactaa accccagcgt tacgcgacag gagacctgcg atgacaatca
33301	tggcccccga ggcggttggc gagtcgctcg acccccgcga tccgctgttg cggctgagca
33361	acttcttcga cgacggcagc gtggaattgc tgcacgagcg tgaccgctcc ggagtgctgg
33421	ccgcggcggg caccgtcaac ggtgtgcgca ccatcgcgtt ctgcaccgac ggcaccgtga
33481	tgggcggcgc catgggcgtc gaggggtgca cgcacatcgt caacgcctac gacactgcca
33541	tcgaagacca gagtcccatc gtgggcatct ggcattcggg tggtgcccgg ctggctgaag
33601	gtgtgcgggc gctgcacgcg gtaggccagg tgttcgaagc catgatccgc gcgtccggct
33661	acatcccgca gatctcggtg gtcgtcggtt tcgccgccgg cggcgccgcc tacggaccgg
33721	cgttgaccga cgtcgtcgtc atggcgccgg aaagccgggt gttcgtcacc gggcccgacg
33781	tggtgcgcag cgtcaccggc gaggacgtcg acatggcctc gctcggtggg ccggagaccc
33841	accacaagaa gtccggggtg tgccacatcg tcgccgacga cgaactcgat gcctacgacc
33901	gtgggcgccg gttggtcgga ttgttctgcc agcaggggca tttcgatcgc agcaaggccg
33961	aggccggtga caccgacatc cacgcgctgc tgccggaatc ctcgcgacgt gcctacgacg
34021	tgcgtccgat cgtgacggcg atcctcgatg cggacacacc gttcgacgag ttccaggcca
34081	attgggcgcc gtcgatggtg gtcgggctgg gtcggctgtc gggtcgcacg gtgggtgtac
34141	tggccaacaa cccgctacgc ctgggcggct gcctgaactc cgaaagcgca gagaaggcag
34201	cgcgtttcgt gcggctgtgc gacgcgttcg ggattccgct ggtggtggtg gtcgatgtgc
34261	cgggctatct gcccggtgtc gaccaggagt ggggtggcgt ggtgcgccgt ggcgccaagt
34321	tgctgcacgc gttcggcgag tgcaccgttc cgcgggtcac gctggtcacc cgaaagacct
34381	acggcggggc atacattgcg atgaactccc ggtcgttgaa cgcgaccaag gtgttcgcct
34441	ggccggacgc cgaggtcgcg gtgatgggcg ctaaggcggc cgtcggcatc ctgcacaaga
34501	agaagttggc cgccgctccg gagcacgaac gcgaagcgct gcacgaccag ttggccgccg
34561	agcatgagcg catcgccggc ggggtcgaca gtgcgctgga catcggtgtg gtcgacgaga
34621	agatcgaccc ggcgcatact cgcagcaagc tcaccgaggc gctggcgcag gctccggcac
34681	ggcgcggccg ccacaagaac atcccgctgt agttctgacc gcgagcagac gcagaatcgc
34741	acgcgcgagg tccgcgccgt gcgattctgc gtctgctcgc cagttatccc cagcggtggc
34801	tggtcaacgc gaggcgctcc tcgcatgctc ggacggtgcc taccgacgcg ctaacaattc
34861	tcgagaaggc cggcgggttc gccaccaccg cgcaattgct cacggtcatg acccgccaac
34921	agctcgacgt ccaagtgaaa aacggcggcc tcgttcgcgt ttggtacggg gtctacgcgg
34981	cacaagagcc ggacctgttg ggccgcttgg cggctctcga tgtgttcatg ggggggcacg
35041	ccgtcgcgtg tctgggcacc gccgccgcgt tgtatggatt cgacacggaa aacaccgtcg
35101	ctatccatat gctcgatccc ggagtaagga tgcggcccac ggtcggtctg atggtccacc
35161	aacgcgtcgg tgcccggctc caacgggtgt caggtcgtct cgcgaccgcg cccgcatgga
35221	ctgccgtgga ggtcgcacga cagttgcgcc gcccgcgggc gctggccacc ctcgacgccg
35281	cactacggtc aatgcgctgc gctcgcagtg aaattgaaaa cgccgttgct gagcagcgag
35341	gccgccgagg catcgtcgcg gcgcgcgaac tcttaccctt cgccgacgga cgcgcggaat
35401	cggccatgga gagcgaggct cggctcgtca tgatcgacca cgggctgccg ttgcccgaac
35461	ttcaataccc gatacacggc cacggtggtg aaatgtggcg agtcgacttc gcctggcccg
35521	acatgcgtct cgcggccgaa tacgaaagca tcgagtggca cgcgggaccg gcggagatgc
35581	tgcgcgacaa gacacgctgg gccaagctcc aagagctcgg gtggacgatt gtcccgattg
35641	tcgtcgacga tgtcagacgc gaacccggcc gcctggcggc ccgcatcgcc cgccacctcg
35701	accgcgcgcg tatggccggc tgaccgctgg tgagcagacg cagagtcgca ctgcggccgg
35761	cgcagtgcga ctctgcgtct gctcgcgctc aacggctgag gaactcctta gccacggcga
35821	ctacgcgctc gcgatcccgt ggcaccagac cgatccgggt ccggcggtcg aggatatcgt
35881	ccacatccag cgccccctca tgggtcaccg cgtattcgaa ctccgcccgg gtcacgtcga
35941	tgccgtcggc gaccggctcg gtgggccgct cacatgtggc ggcggcagcg acgttggccg
36001	cctcggcccc gtaccgcgcc accagcgact cgggcaatcc ggcgcccgat ccgggggccg
36061	gcccagggtt cgccggtgcg ccgatcagcg gcaggttgcg agtgcggcac ttcgcggctc
36121	gcaggtgtcg cagcgtgatg gcgcgattca gcacatcctc tgccatgtag cggtattccg
36181	tcagcttgcc gccgaccaca ctgatcacgc ccgacggcga ttcaaaaaca gcgtggtcac
36241	gcgaaacgtc ggcggtgcgg ccctggacac cagcaccgcc ggtgtcgatt agcggccgca
36301	atcccgcata ggcaccgatg acatccttgg tgccgaccgc cgtccccaat gcggtgttca
36361	ccgtatccag caggaacgtg atctcttccg aagacggttg tggcacatcg ggaatcgggc
36421	cgggtgcgtc ttcgtcggtc agcccgagat agatccggcc cagctgctcg ggcatggcga
36481	acacgaagcg gttcagctca ccggggatcg gaatggtcag cgcggcagtc ggattggcaa
36541	acgacttcgc gtcgaagacc agatgtgtgc cgcggctggg gcgtagcctc agggacgggt
36601	cgatctcacc cgcccacacg cccgccgcgt tgatgacggc acgcgccgac agcgcgaacg
36661	actgccgggt gcgccggtcg gtcaactcca ccgaagtgcc ggtgacattc gacgcgccca
36721	cgtaagtgag gatgcgggcg ccgtgctggg ccgcggtgcg cgcgacggcc atgaccagcc
36781	gggcgtcgtc gatcaattgc ccgtcgtacg cgagcagacc accgtcgagg ccgtcccgcc
36841	gaacggtggg agcaatctcc accacccgtg acgccgggat tcggcgcgat cggggcaacg
36901	tcgccgccgg cgtacccgct agcacccgca aagcgtcgcc ggccaggaaa ccggcacgca
36961	ccaacgcccg cttggtgtga cccatcgacg gcaacaacgg gaccagttgc ggcatggcat
37021	gcacgagatg aggagcgttg cgtgtcatca ggattccgcg ttcgacggcg ctgcgccggg
37081	cgatgcccac gttgccgctg gccagatagc gcagaccgcc gtgcaccaac ttcgagctcc
37141	agcggctggt gccgaacgcc agatcatgct tttccaccaa ggccaccgtc agaccgcggg
37201	tggcagcatc taaggcaatg ccaacaccgg taatgccgcc gcctatcacg atgacgtcga
37261	gtgcgccacc gtcggccagt gcggtcaggt cggcggagcg acgcgccgcg ttgagtgcag
37321	ccgagtgggg catcagcaca aatatccgtt cagtgcgtgg gtaagttcgg tggccagcgc
37381	ggcggaatcg aggatcgaat cgacgatgtc cgcggactgg atggtcgact gggcgatcag
37441	caacaccatg gtcgccagtc gacgagcgtc gccggagcgc acactgcccg accgctgcgc
37501	cactgtcagc cgggcggcca acccctcgat caggacctgc tggctggtgc cgaggcgctc
37561	ggtgatgtac accctggcca gctccgagtg catgaccgac atgatcagat cgtcaccccg
37621	caaccggtcg gccaccgcga caatctgctt taccaacgct tcccggtcgt ccccgtcgag
37681	gggcacctcc cgcagcacgt cggcgatatg gctggtcagc atggacgcca tgatcgaccg
37741	ggtgtccggc cagcgacggt atacggtcgg gcggctcacg cccgcgcgcc gggcgatctc
37801	ggcaagtgtc acccggtcca cgccgtaatc gacgacgcag ctcgccgctg cccgcaggat
37861	acgaccaccg gtatccgcgc ggtcattact cattgacagc atgtgtaata ctgtaacgcg
37921	tgactcaccg cgaggaactc cttccaccga tgaaatggga cgcgtgggga gatcccgccg
37981	cggccaagcc actttctgat ggcgtccggt cgttgctgaa gcaggttgtg ggcctagcgg
38041	actcggagca gcccgaactc gaccccgcgc aggtgcagct gcgcccgtcc gccctgtcgg
38101	gggcagacca

6.9. X-Linked Inhibitor of Apoptosis Protein (“XIAP”)

[0214] GenBank Accession #U45880:

1	gaaaaggtgg acaagtccta ttttcaagag aagatgactt ttaacagttt tgaaggatct	(SEQ ID NO: 25)
61	aaaacttgtg tacctgcaga catcaataag gaagaagaat ttgtagaaga gtttaataga
121	ttaaaaactt ttgctaattt tccaagtggt agtcctgttt cagcatcaac actggcacga
181	gcagggtttc tttatactgg tgaaggagat accgtgcggt gctttagttg tcatgcagct
241	gtagatagat ggcaatatgg agactcagca gttggaagac acaggaaagt atccccaaat
301	tgcagattta tcaacggctt ttatcttgaa aatagtgcca cgcagtctac aaattctggt
361	atccagaatg gtcagtacaa agttgaaaac tatctgggaa gcagagatca ttttgcctta
421	gacaggccat ctgagacaca tgcagactat cttttgagaa ctgggcaggt tgtagatata
481	tcagacacca tatacccgag gaaccctgcc atgtattgtg aagaagctag attaaagtcc
541	tttcagaact ggccagacta tgctcaccta accccaagag agttagcaag tgctggactc
601	tactacacag gtattggtga ccaagtgcag tgcttttgtt gtggtggaaa actgaaaaat
661	tgggaacctt gtgatcgtgc ctggtcagaa cacaggcgac actttcctaa ttgcttcttt
721	gttttgggcc ggaatcttaa tattcgaagt gaatctgatg ctgtgagttc tgataggaat
781	ttcccaaatt caacaaatct tccaagaaat ccatccatgg cagattatga agcacggatc
841	tttacttttg ggacatggat atactcagtt aacaaggagc agcttgcaag agctggattt
901	tatgctttag gtgaaggtga taaagtaaag tgctttcact gtggaggagg gctaactgat
961	tggaagccca gtgaagaccc ttgggaacaa catgctaaat ggtatccagg gtgcaaatat
1021	ctgttagaac agaagggaca agaatatata aacaatattc atttaactca ttcacttgag
1081	gagtgtctgg taagaactac tgagaaaaca ccatcactaa ctagaagaat tgatgatacc
1141	atcttccaaa atcctatggt acaagaagct atacgaatgg ggttcagttt caaggacatt
1201	aagaaaataa tggaggaaaa aattcagata tctgggagca actataaatc acttgaggtt
1261	ctggttgcag atctagtgaa tgctcagaaa gacagtatgc aagatgagtc aagtcagact
1321	tcattacaga aagagattag tactgaagag cagctaaggc gcctgcaaga ggagaagctt
1381	tgcaaaatct gtatggatag aaatattgct atcgtttttg ttccttgtgg acatctagtc
1441	acttgtaaac aatgtgctga agcagttgac aagtgtccca tgtgctacac agtcattact
1501	ttcaagcaaa aaatttttat gtcttaatct aactctatag taggcatgtt atgttgttct
1561	tattaccctg attgaatgtg tgatgtgaac tgactttaag taatcaggat tgaattccat
1621	tagcatttgc taccaagtag gaaaaaaaat gtacatggca gtgttttagt tggcaatata
1681	atctttgaat ttcttgattt ttcagggtat tagctgtatt atccattttt tttactgtta
1741	tttaattgaa accatagact aagaataaga agcatcatac tataactgaa cacaatgtgt
1801	attcatagta tactgattta atttctaagt gtaagtgaat taatcatctg gattttttat
1861	tcttttcaga taggcttaac aaatggagct ttctgtatat aaatgtggag attagagtta
1921	atctccccaa tcacataatt tgttttgtgt gaaaaaggaa taaattgttc catgctggtg
1981	gaaagataga gattgttttt agaggttggt tgttgtgttt taggattctg tccattttct
2041	tgtaaaggga taaacacgga cgtgtgcgaa atatgtttgt aaagtgattt gccattgttg
2101	aaagcgtatt taatgataga atactatcga gccaacatgt actgacatgg aaagatgtca
2161	gagatatgtt aagtgtaaaa tgcaagtggc gggacactat gtatagtctg agccagatca
2221	aagtatgtat gttgttaata tgcatagaac gagagatttg gaaagatata caccaaactg
2281	ttaaatgtgg tttctcttcg gggagggggg gattggggga ggggccccag aggggtttta
2341	gaggggcctt ttcactttcg acttttttca ttttgttctg ttcggatttt ttataagtat
2401	gtagaccccg aagggtttta tgggaactaa catcagtaac ctaacccccg tgactatcct
2461	gtgctcttcc tagggagctg tgttgtttcc cacccaccac ccttccctct gaacaaatgc
2521	ctgagtgctg gggcactttg

[0215] General Target Region:

[0216] Internal Ribosome Entry Site (IRES) in 5′ untranslated region:

5′AGCUCCUAUAACAAAAGUCUGUUGCUUGUGUUUCACAUUUUGGAUU (SEQ ID NO: 26)
UCCUAAUAUAAUGUUCUCUUUUUAGAAAAGGUGGACAAGUCCUAUUU
UCAAGAGAAG3′

[0217] Initial Specific Target Matif:

[0218] RNP core binding site within XIAP IRES

5′GGAUUUCCUAAUAUAAUGUUCUCUUUUU3′ (SEQ ID NO: 27)

6.10. Survivin

[0219] GenBank Accession #NM—001168:

1	ccgccagatt tgaatcgcgg gacccgttgg cagaggtggc ggcggcggca tgggtgcccc	(SEQ ID NO: 28)
61	gacgttgccc cctgcctggc agccctttct caaggaccac cgcatctcta cattcaagaa
121	ctggcccttc ttggagggct gcgcctgcac cccggagcgg atggccgagg ctggcttcat
181	ccactgcccc actgagaacg agccagactt ggcccagtgt ttcttctgct tcaaggagct
241	ggaaggctgg gagccagatg acgaccccat agaggaacat aaaaagcatt cgtccggttg
301	cgctttcctt tctgtcaaga agcagtttga agaattaacc cttggtgaat ttttgaaact
361	ggacagagaa agagccaaga acaaaattgc aaaggaaacc aacaataaga agaaagaatt
421	tgaggaaact gcgaagaaag tgcgccgtgc catcgagcag ctggctgcca tggattgagg
481	cctctggccg gagctgcctg gtcccagagt ggctgcacca cttccagggt ttattccctg
541	gtgccaccag ccttcctgtg ggccccttag caatgtctta ggaaaggaga tcaacatttt
601	caaattagat gtttcaactg tgctcctgtt ttgtcttgaa agtggcacca gaggtgcttc
661	tgcctgtgca gcgggtgctg ctggtaacag tggctgcttc tctctctctc tctctttttt
721	gggggctcat ttttgctgtt ttgattcccg ggcttaccag gtgagaagtg agggaggaag
781	aaggcagtgt cccttttgct agagctgaca gctttgttcg cgtgggcaga gccttccaca
841	gtgaatgtgt ctggacctca tgttgttgag gctgtcacag tcctgagtgt ggacttggca
901	ggtgcctgtt gaatctgagc tgcaggttcc ttatctgtca cacctgtgcc tcctcagagg
961	acagtttttt tgttgttgtg tttttttgtt tttttttttt ggtagatgca tgacttgtgt
1021	gtgatgagag aatggagaca gagtccctgg ctcctctact gtttaacaac atggctttct
1081	tattttgttt gaattgttaa ttcacagaat agcacaaact acaattaaaa ctaagcacaa
1141	agccattcta agtcattggg gaaacggggt gaacttcagg tggatgagga gacagaatag
1201	agtgatagga agcgtctggc agatactcct tttgccactg ctgtgtgatt agacaggccc
1261	agtgagccgc ggggcacatg ctggccgctc ctccctcaga aaaaggcagt ggcctaaatc
1321	ctttttaaat gacttggctc gatgctgtgg gggactggct gggctgctgc aggccgtgtg
1381	tctgtcagcc caaccttcac atctgtcacg ttctccacac gggggagaga cgcagtccgc
1441	ccaggtcccc gctttctttg gaggcagcag ctcccgcagg gctgaagtct ggcgtaagat
1501	gatggatttg attcgccctc ctccctgtca tagagctgca gggtggattg ttacagcttc
1561	gctggaaacc tctggaggtc atctcggctg ttcctgagaa ataaaaagcc tgtcatttc

7. EXAMPLE: IDENTIFICATION OF A DYE-LABELED TARGET RNA BOUND TO SMALL MOLECULAR WEIGHT COMPOUNDS

[0220] The results presented in this Example indicate that gel mobility shift assays can be used to detect the binding of small molecules, such as the Tat peptide and gentamicin, to their respective target RNAs.

7.1. Materials and Methods

7.1.1. Buffers

[0221] Tris-potassium chloride (TK) buffer is composed of 50 mM Tris-HCl pH 7.4, 20 mM KCl, 0.1% Triton X-100, and 0.5 mM MgCl2. Tris-borate-EDTA (TBE) buffer is composed of 45 mM Tris-borate pH 8.0, and 1 mM EDTA. Tris-Potassium chloride-magnesium (TKM) buffer is composed of 50 mM Tris-HCl pH 7.4, 20mM KCl, 0.1 % Triton X-100 and 5 mM MgCl2.

7.1.1. Gel Retardation Analysis

[0222] RNA oligonucleotides were purchased from Dharmacon, Inc, Lafayette, Colo.). 500 pmole of either a 5′ fluorescein labeled oligonucleotide corresponding to the 16S rRNA A site (5′-GGCGUCACACCUUCGGGUGAAGUCGCC-3′ (SEQ ID NO: 29); Moazed & Noller, 1987, Nature 327:389-394; Woodcock et al., 1991, EMBO J. 10:3099-3103; Yoshizawa et al., 1998, EMBO J. 17:6437-6448) or a 5′ fluorescein labeled oligonucleotide correspording to the HIV-1 TAR element TAR RNA (5′-GGCGUCACACCUUCGGGUGAAGUCGCC-3′ (SEQ ID NO: 30); Huq et al., 1999, Nucleic Acids Research. 27:1084-1093; Hwang et al., 1999, Proc. Natl. Acad. Sci. USA 96:12997-13002) was 3′ labeled with 5′-32p cytidine 3′, 5′-bis(phosphate) (NEN) and T4 RNA ligase (NEBiolabs) in 10% DMSO as per manufacturer's instructions. The labeled oligonucleotides were purified using G-25 Sephadex columns (Boehringer Mannheim). For Tat-TAR gel retardation reactions the method of Huq et al. (Nucleic Acids Research, 1999, 27:1084-1093) was utilized with TK buffer containing 0.5 mM MgCl2 and a 12-mer Tat peptide (YGRKKRRQRRRP (SEQ ID NO: 31); single letter amino acid code). For 16S rRNA-gentamicin reactions, the method of Huq et al. was used with TKM buffer. In 20 μl reaction volumes 50 pmoles of 32P cytidine-labeled oligonucleotide and either gentamicin sulfate (Sigma) or the short Tat peptide (Tat47-58) in TK or TKM buffer were heated at 90° C. for 2 minutes and allow to cool to room temperature (approximately 24° C.) over 2 hours. Then 10 μl of 30% glycerol was added to each reaction tube and the entire sample was loaded onto a TBE non-denaturing polyacrylamide gel and electrophoresed at 1200-1600 volt-hours at 4° C. The gel was exposed to an intensifying screen and radioactivity was quantitated using a Typhoon phosporimager (Molecular Dynamics).

7.2. Background

[0223] One method used to demonstrate small molecule interactions with natural occurring RNA structures such as ribosomes is by a method called chemical footprinting or toe printing (Moazed & Noller, 1987, Nature 327:389-394; Woodcock et al., 1991, EMBO J. 10:3099-3103; Yoshizawaetal., 1998, EMBO J. 17:6437-6448). Here the use of gel mobility shift assays to monitor RNA-small molecule interactions are described. This approach allows for rapid visualization of small molecule-RNA interactions based on the difference between mobility of RNA alone versus RNA in a complex with a small molecule. To validate this approach, an RNA oligonucleotide corresponding to the well-characterized gentamicin binding site on the 16S rRNA (Moazed & Noller, 1987, Nature 327:389-394) and the equally well-characterized HIV-1 TAT protein binding site on the HIV-1 TAR element (Huq et al., 1999, Nucleic Acids Res. 27: 1084-1093) were chosen. The purpose of these experiments is to lay the groundwork for the use of chromatographic techniques in a high throughput fashion, such as microcapillary electrophoresis, for drug discovery.

7.3. Results

[0224] A gel retardation assay was performed using the Tat47-58 peptide and the TAR RNA oligonucleotide. As shown in FIG. 1, in the presence of the Tat peptide, a clear shift is visible when the products are separated on a 12% non-denaturing polyacrylamide gel. In the reaction that lacks peptide, only the free RNA is visible. These observations confirm previous reports made using other Tat peptides (Hamy et al., 1997, Proc. Natl. Acad. Sci. USA 94:3548-3553; Huq et al., 1999, Nucleic Acids Res. 27: 1084-1093).

[0225] Based on the results of FIG. 1, it was hypothesized that RNA interactions with small organic molecules could also be visualized using this method. As shown in FIG. 2, the addition of varying concentrations of gentamicin to an RNA oligonucleotide corresponding to the 16S rRNA A site produces a mobility shift. These results demonstrate that the binding of the small molecule gentamicin to an RNA oligonucleotide having a defined structure in solution can be monitored using this approach. In addition, as shown in FIG. 2, a concentration as low as 10 ng/ml gentamicin produces the mobility shift.

[0226] To determine whether lower concentrations of gentamicin would be sufficient to produce a gel shift, similar experiment was performed, as shown in FIG. 2, except that the concentrations of gentamicin ranged from 100 ng/ml to 10 pg/ml. As shown in FIG. 3, gel mobility shifts are produced when the gentamicin concentration is as low as 10 pg/ml. Further, the results shown in FIG. 3 demonstrate that the shift is specific to the 16S rRNA oligonucleotide as the use of an unrelated oligonucleotide, corresponding to the HIV TAR RNA element, does not result in a gel mobility shift when incubated with 10 μg/ml gentamicin. In addition, if a concentration as low as 10 pg/ml gentamicin produces a gel mobility shift then it should be possible to detect changes to RNA structural motifs when small amounts of compound from a library of diverse compounds is screened in this fashion.

[0227] Further analysis of the gentamicin-RNA interaction indicates that the interaction is Mg− and temperature dependent. As shown in FIG. 4, when MgCl2 is not present (TK buffer), 1 mg/ml of gentamicin must be added to the reaction to produce a gel shift.

[0228] Similarly, the temperature of the reaction when gentamicin is added is also important. When gentamicin is present in the reaction during the entire denaturation/renaturation cycle, that is, when gentamicin is added at 90C° C. or 85 ° C., a gel shift is visualized (data not shown). In contrast, when gentamicin is added after the renaturation step has proceeded to 75° C., a mobility shift is not produced. These results are consistent with the notion that gentamicin may recognize and interact with an RNA structure formed early in the renaturation process.

8. EXAMPLE: IDENTIFICATION OF A DYE-LABELED TARGET RNA BOUND TO SMALL MOLECULAR WEIGHT COMPOUNDS BY CAPILLARY ELECTROPHORESIS

[0229] The results presented in this Example indicate that interactions between a peptide and its target RNA, such as the Tat peptide and TAR RNA, can be monitored by gel retardation assays in an automated capillary electrophoresis system.

8.1. Materials and Methods

8.1.1. Buffers

[0230] Tris-potassium chloride (TK) buffer is composed of 50 mM Tris-HCl pH 7.4, 20 mM KCl, 0.1% Triton X-100, and 0.5 mM MgCl2. Tris-borate-EDTA (TBE) buffer is composed of 45 mM Tris-borate pH 8.0, and 1 mM EDTA. Tris-Potassium chloride-magnesium (TKM) buffer is composed of 50 mM Tris-HCl pH 7.4, 20 mM KCl, 0.1% Triton X-100 and 5 mM MgCl2.

8.1.1. Gel Retardation Analysis Using Capillary Electrophoresis

[0231] RNA oligonucleotides were purchased from Dharmacon, Inc. Lafayette, Colo.). 500 pmole of a 5′ fluorescein labeled oligonucleotide corresponding to the HIV-1 TAR element TAR RNA (5′-GGCGUCACACCUUCGGGUGAAGUCGCC-3′ (SEQ ID NO: 30); Huq et al., 1999, Nucleic Acids Research. 27:1084-1093; Hwang et al., 1999, Proc. Natl. Acad. Sci. USA 96:12997-13002) was used. For Tat-TAR gel retardation reactions the method of Huq et al. (Nucleic Acids Research, 1999, 27:1084-1093) was utilized with TK buffer containing 0.5 mM MgCl2 and a 12-mer Tat peptide (YGRKKRRQRRRP (SEQ ID NO: 31); single letter amino acid code). In 20 μl reaction volumes 50 pmoles of labeled oligonucleotide and the short Tat peptide (Tat47-58) in TK or TKM buffer were heated at 90° C. for 2 minutes and allow to cool to room temperature (approximately 24° C.) over 2 hours. The reactions were loaded onto a SCE9610 automated capillary electrophoresis apparatus (SpectruMedix; State College, Pa.).

8.2. Results

[0232] As presented in the previous Example in Section 7, interactions between a peptide and RNA can be monitored by gel retardation assays. It was hypothesized that interactions between a peptide and RNA could be monitored by gel retardation assays by an automated capillary electrophoresis system. To test this hypothesis, a gel retardation assay by an automated capillary electrophoresis system was performed using the Tat47-58 peptide and the TAR RNA oligonucleotide. As shown in FIG. 5 using the capillary electrophoresis system, in the presence of the Tat peptide, a clear shift is visible upon the addition of increasing concentrations of Tat peptide. In the reaction that lacks peptide, only a peak corresponding to the free RNA is observed. These observations confirm previous reports made using other Tat peptides (Hamy et al., 1997, Proc. Natl. Acad. Sci. USA 94:3548-3553; Huq et al., 1999, Nucleic Acids Res. 27: 1084-1093).

[0233] The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described will become apparent to those skilled in the art from the foregoing description and accompanying figures. Such modifications are intended to fall within the scope of the appended claims.

[0234] Various publications are cited herein, the disclosures of which are incorporated by reference in their entireties.

[0235] The invention can be ilustrated by the following embodiments enumerated in the numbered paragraphs that follow:

[0236] 1. A method for identifying a test compound that binds to a target RNA molecule, comprising the steps of (a) contacting a detectably labeled target RNA molecule with a library of test compounds under conditions that permit direct binding of the labeled target RNA to a member of the library of test compounds so that a detectably labeled target RNA:test compound complex is formed; (b) separating the detectably labeled target RNA:test compound complex formed in step(a) from uncomplexed target RNA molecules and test compounds; and (c) determining a structure of the test compound bound to the RNA in the RNA:test compound complex.

[0237] 2. The method of paragraph 1 in which the target RNA molecule contains an HIV TAR element, internal ribosome entry site, “slippery site”, instability element, or adenylate uridylate-rich element.

[0238] 3. The method of paragraph 1 in which the RNA molecule is an element derived from the mRNA for tumor necrosis factor alpha (“TNF-α”), granulocyte-macrophage colony stimulating factor (“GM-CSF”), interleukin 2 (“IL-2”), interleukin 6 (“IL-6”), vascular endothelial growth factor (“VEGF”), human immunodeficiency virus I (“HIV-1”), hepatitis C virus (“HCV”—genotypes 1a & 1b), ribonuclease P RNA (“RNaseP”), X-linked inhibitor of apoptosis protein (“XIAP”), or survivin.

[0239] 4. The method of paragraph 1 in which the detectably labeled RNA is labeled with a fluorescent dye, phosphorescent dye, ultraviolet dye, infrared dye, visible dye, radiolabel, enzyme, spectroscopic colorimetric label, affinity tag, or nanoparticle.

[0240] 5. The method of paragraph 1 in which the test compound is selected from a combinatorial library comprising peptoids; random bio-oligomers; diversomers such as hydantoins, benzodiazepines and dipeptides; vinylogous polypeptides; nonpeptidal peptidomimetics; oligocarbamates; peptidyl phosphonates; peptide nucleic acid libraries; antibody libraries; carbohydrate libraries; and small organic molecule libraries, including but not limited to, libraries of benzodiazepines, isoprenoids, thiazolidinones, metathiazanones, pyrrolidines, morpholino compounds, or diazepindiones.

[0241] 6. The method of paragraph 1 in which screening a library of test compounds comprises contacting the test compound with the target nucleic acid in the presence of an aqueous solution, the aqueous solution comprising a buffer and a combination of salts, preferably approximating or mimicking physiologic conditions.

[0242] 7. The method of paragraph 6 in which the aqueous solution optionally further comprises non-specific nucleic acids comprising DNA, yeast tRNA, salmon sperm DNA, homoribopolymers, and nonspecific RNAs.

[0243] 8. The method of paragraph 6 in which the aqueous solution further comprises a buffer, a combination of salts, and optionally, a detergent or a surfactant. In another embodiment, the aqueous solution further comprises a combination of salts, from about 0 mM to about 100 mM KCl, from about 0 mM to about 1 M NaCl, and from about 0 mM to about 200 mM MgCl2. In a preferred embodiment, the combination of salts is about 100 mM KCl, 500 mM NaCl, and 10 mM MgCl2. In another embodiment, the solution optionally comprises from about 0.01% to about 0.5% (w/v) of a detergent or a surfactant.

[0244] 9. Any method that detects an altered physical property of a target nucleic acid complexed to a test compound from the unbound target nucleic acid may be used for separation of the complexed and non-complexed target nucleic acids in the method of paragraph 1. In a preferred embodiment, elecfrophoresis is used for separation of the complexed and non-complexed target nucleic acids. In a preferred embodiment, the electrophoresis is capillary electrophoresis. In other embodiments, fluorescence spectroscopy, surface plasmon resonance, mass spectrometry, scintillation, proximity assay, structure-activity relationships (“SAR”) by NMR spectroscopy, size exclusion chromatography, affinity chromatography, and nanoparticle aggregation are used for the separation of the complexed and non-complexed target nucleic acids.

[0245] 10. The structure of the test compound of the RNA:test compound complex of paragraph 1 is determined, in part, by the type of library of test compounds. In a preferred embodiment wherein the combinatorial libraries are small organic molecule libraries, mass spectroscopy, NMR, or vibration spectroscopy are used to determine the structure of the test compounds.

Claims

1. A method for identifying a test compound that binds to a target RNA molecule, comprising the steps of: (a) contacting a detectably labeled target RNA molecule with a library of test compounds under conditions that permit direct binding of the labeled target RNA to a member of the library of test compounds so that a detectably labeled target RNA:test compound complex is formed; (b) separating the detectably labeled target RNA:test compound complex formed in step (a) from uncomplexed target RNA molecules and test compounds; and (c) determining a structure of the test compound bound to the RNA in the RNA:test compound complex.

2. The method of claim 1 in which the target RNA molecule contains an HIV TAR element, internal ribosome entry site, “slippery site”, instability element, or adenylate uridylate-rich element.

3. The method of claim 1 in which the RNA molecule is an element derived from the mRNA for tumor necrosis factor alpha (“TNF-α”), granulocyte-macrophage colony stimulating factor (“GM-CSF”), interleukin 2 (“IL-2”), interleukin 6 (“IL-6”), vascular endothelial growth factor (“VEGF”), human immunodeficiency virus I (“HIV-1”), hepatitis C virus (“HCV”—genotypes 1a & 1b), ribonuclease P RNA (“RNaseP”), X-linked inhibitor of apoptosis protein (“XIAP”), or survivin.

4. The method of claim 1 in which the detectably labeled RNA is labeled with a fluorescent dye, phosphorescent dye, ultraviolet dye, infrared dye, visible dye, radiolabel, enzyme, spectroscopic colorimetric label, affinity tag, or nanoparticle.

5. The method of claim 1 in which the test compound is selected from a combinatorial library comprising peptoids; random bio-oligomers; diversomers such as hydantoins, benzodiazepines and dipeptides; vinylogous polypeptides; nonpeptidal peptidomimetics; oligocarbamates; peptidyl phosphonates; peptide nucleic acid libraries; antibody libraries; carbohydrate libraries; or small organic molecule libraries.

6. The method of claim 5 in which the small organic molecule libraries are libraries of benzodiazepines, isoprenoids, thiazolidinones, metathiazanones, pyrrolidines, morpholino compounds, or diazepindiones.

7. The method of claim 1 in which screening a library of test compounds comprises contacting the test compound with the target nucleic acid in the presence of an aqueous solution wherein the aqueous solution comprises a buffer and a combination of salts.

8. The method of claim 7 wherein the aqueous solution approximates or mimics physiologic conditions.

9. The method of claim 7 in which the aqueous solution optionally further comprises non-specific nucleic acids comprising DNA, yeast tRNA, salmon sperm DNA, homoribopolymers, and nonspecific RNAs.

10. The method of claim 7 in which the aqueous solution further comprises a buffer, a combination of salts, and optionally, a detergent or a surfactant.

11. The method of claim 10 in which the aqueous solution further comprises a combination of salts, from about 0 mM to about 100 mM KCl, from about 0 mM to about 1 M NaCl, and from about 0 mM to about 200 MM MgCl2.

13. The method of claim 11 wherein the combination of salts is about 100 mM KCl, 500 mM NaCl, and 10 mM MgCl2.

14. The method of claim 10 wherein the solution optionally comprises from about 0.01% to about 0.5% (w/v) of a detergent or a surfactant.

15. The method of claim 1 in which separating the detectably labeled target RNA:test compound complex formed in step (a) from uncomplexed target RNA and test compounds is by electrophoresis.

16. The method of claim 15 in which the electrophoresis is capillary electrophoresis.

17. The method of claim 1 in which separating the detectably labeled target RNA:test compound. complex formed in step (a) from uncomplexed target RNA and test compounds is by fluorescence spectroscopy, surface plasmon resonance, mass spectrometry, scintillation, proximity assay, structure-activity relationships (“SAR”) by NMR spectroscopy, size exclusion chromatography, affinity chromatography, or nanoparticle aggregation.

18. The method of claim 1 in which the library of test compounds are small organic molecule libraries.

19. The method of claim 18 in which the structure of the test compound is determined by mass spectroscopy, NMR, or vibration spectroscopy.