Methods for seamless nucleic acid assembly

Description

SEQUENCE LISTING

The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Jun. 6, 2018, is named 44854-743_301_SL.txt and is 1,591 bytes in size.

BACKGROUND

De novo nucleic acid synthesis is a powerful tool for basic biological research and biotechnology applications. While various methods are known for the synthesis of relatively short fragments of nucleic acids in a small scale, these techniques suffer from scalability, automation, speed, accuracy, and cost. Thus, a need remains for efficient methods of seamless nucleic acid assembly.

BRIEF SUMMARY

Provided herein is a method for nucleic acid assembly, comprising: (a) providing at least one double stranded nucleic acid comprising in 5′ to 3′ order: a 5′ flanking adapter sequence, a first homology sequence, an insert sequence, a second homology sequence, and a 3′ flanking adapter sequence, wherein the first homology sequence and the second homology sequence comprises about 20 to about 100 base pairs in length; (b) providing a vector comprising the first homology sequence and the second homology sequence; and (c) mixing the at least one double stranded nucleic acid and the vector with a bacterial lysate. Further provided herein is a method, wherein the bacterial lysate comprises a nuclease or a recombinase. Further provided herein is a method, wherein the bacterial lysate comprises a nuclease and a recombinase. Further provided herein is a method, wherein the first homology sequence and the second homology sequence each comprises about 20 base pairs. Further provided herein is a method, wherein the first homology sequence and the second homology sequence each comprises about 41 base pairs. Further provided herein is a method, wherein the first homology sequence and the second homology sequence each comprises 30 to 50 base pairs. Further provided herein is a method, wherein the first homology sequence and the second homology sequence each comprises 35 to 45 base pairs. Further provided herein is a method, wherein the first homology sequence and the second homology sequence each comprises about 100 base pairs. Further provided herein is a method, wherein the first homology sequence or the second homology sequence is flanked by the 5′ flanking adapter sequence and the 3′ flanking adapter sequence. Further provided herein is a method, wherein the first homology sequence or the second homology sequence is at a terminal end. Further provided herein is a method, wherein a percentage of correct assembly is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%.

Provided herein is a method for nucleic acid assembly comprising: (a) de novo synthesizing a plurality of polynucleotides, wherein each polynucleotide comprises a first homology region that comprises in 5′ to 3′ order: a 5′ flanking adapter sequence, a first homology sequence, an insert sequence, a second homology sequence, and a 3′ flanking adapter sequence, wherein the first homology sequence and the second homology sequence each comprises about 20 to about 100 base pairs in length, and wherein each polynucleotide comprises a homology sequence identical to that of another polynucleotide of the plurality of polynucleotides; and (b) mixing of the plurality of polynucleotides with a bacterial lysate to processively form nucleic acids each having a predetermined sequence. Further provided herein is a method, wherein the bacterial lysate comprises a nuclease. Further provided herein is a method, wherein the first homology sequence and the second homology sequence each comprises about 20 base pairs. Further provided herein is a method, wherein the first homology sequence and the second homology sequence each comprises about 41 base pairs. Further provided herein is a method, wherein the first homology sequence and the second homology sequence each comprises about 100 base pairs. Further provided herein is a method, wherein the first homology sequence or the second homology sequence is flanked by the 5′ flanking adapter sequence and the 3′ flanking adapter sequence. Further provided herein is a method, wherein the first homology sequence or the second homology sequence is at a terminal end. Further provided herein is a method wherein a percentage of correct assembly is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%.

Provided herein is a method for nucleic acid assembly comprising: (a) providing a first double stranded nucleic acid and a second double stranded nucleic acid, wherein the first double stranded nucleic acid comprises in 5′ to 3′ order: a 5′ flanking adapter sequence, an insert sequence, a homology sequence, and a 3′ flanking adapter sequence, and wherein the second double stranded nucleic acid comprises in 5′ to 3′ order: a 5′ flanking adapter sequence, an insert sequence, a homology sequence, and a 3′ flanking adapter sequence; (b) annealing a uracil separately to each of (i) a 5′ end and a 3′ end of the first double stranded nucleic acid and (ii) a 5′ end and a 3′ end of the second double stranded nucleic acid; (c) amplifying the first double stranded nucleic acid and the second double stranded nucleic acid using a uracil compatible polymerase to form amplification products; (d) mixing the amplification products to form a mixture; and (e) amplifying the mixture using a uracil incompatible polymerase to generate the nucleic acid. Further provided herein is a method, wherein the uracil incompatible polymerase is a DNA polymerase. Further provided herein is a method, wherein a plurality of double stranded nucleic acids is provided. Further provided herein is a method, wherein the homology sequence comprises about 20 to about 100 base pairs. Further provided herein is a method, wherein the homology sequence comprises about 20 base pairs. Further provided herein is a method, wherein the homology sequence comprises about 41 base pairs. Further provided herein is a method, wherein the homology sequence comprises about 100 base pairs. Further provided herein is a method, wherein a percentage of correct assembly is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%.

Provided herein is a method for nucleic acid assembly comprising: (a) providing predetermined sequences for a first double stranded nucleic acid and a second double stranded nucleic acid, wherein the first double stranded nucleic acid comprises in 5′ to 3′ order: a 5′ flanking adapter sequence, an insert sequence, a homology sequence, and a 3′ flanking adapter sequence, and wherein the second double stranded nucleic acid comprises in 5′ to 3′ order: a 5′ flanking adapter sequence, an insert sequence, a homology sequence, and a 3′ flanking adapter sequence; (b) synthesizing a plurality of polynucleotides encoding for the predetermined sequences; (c) annealing a universal primer comprising uracil at a terminal end of the first double stranded nucleic acid and the second double stranded nucleic acid; (d) amplifying the first double stranded nucleic acid and the second double stranded nucleic acid using a uracil incompatible polymerase to form amplification products; (e) mixing the amplification products to form a mixture; and (f) amplifying the mixture to generate the nucleic acid. Further provided herein is a method, wherein the uracil incompatible polymerase is a DNA polymerase. Further provided herein is a method, wherein a plurality of double stranded nucleic acids is provided. Further provided herein is a method, wherein the homology sequence comprises about 20 to about 100 base pairs. Further provided herein is a method, wherein the homology sequence comprises about 20 base pairs. Further provided herein is a method, wherein the homology sequence comprises about 41 base pairs. Further provided herein is a method, wherein the homology sequence comprises about 100 base pairs. Further provided herein is a method, wherein a percentage of correct assembly is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%.

Provided herein is a method for nucleic acid assembly comprising: (a) providing a plurality of double stranded nucleic acids; (b) annealing a uracil at a 5′ end and a 3′ end of at least two of the double stranded nucleic acids; (c) amplifying the double stranded nucleic acids using a uracil compatible polymerase to form amplification products; (d) mixing the amplification products from step (c) to form a mixture; and (e) amplifying the mixture from step (d) using a uracil incompatible polymerase to generate a single-stranded nucleic acid. Further provided herein is a method, wherein the uracil incompatible polymerase is a DNA polymerase. Further provided herein is a method, wherein a plurality of double stranded nucleic acids is provided. Further provided herein is a method, wherein the homology sequence comprises about 20 to about 100 base pairs. Further provided herein is a method, wherein the homology sequence comprises about 20 base pairs. Further provided herein is a method, wherein the homology sequence comprises about 41 base pairs. Further provided herein is a method, wherein the homology sequence comprises about 100 base pairs. Further provided herein is a method, wherein a percentage of correct assembly is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%.

INCORPORATION BY REFERENCE

All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 depicts a schematic of single-stranded DNA mediated hierarchal assembly with two fragments.

FIG. 2 depicts a schematic of single-stranded DNA mediated hierarchal assembly with three fragments.

FIG. 3 depicts a schematic for in vitro recombination cloning with a single gene fragment.

FIG. 4 depicts a schematic for in vitro recombination cloning with two gene fragments.

FIG. 5 depicts gene fragment designs with varying lengths of non-homologous sequences.

FIGS. 6A-6B depict gene fragment designs of internal homology sequences.

FIG. 7 depicts a workflow for in vitro recombination cloning.

FIG. 8 depicts a schematic of overlap extension polymerase chain reaction without primer removal.

FIG. 9 depicts systems for polynucleotide synthesis and seamless nucleic acid assembly.

FIG. 10 illustrates a computer system.

FIG. 11 is a block diagram illustrating architecture of a computer system.

FIG. 12 is a block diagram of a multiprocessor computer system using a shared virtual address memory space.

FIG. 13 is a diagram demonstrating a network configured to incorporate a plurality of computer systems, a plurality of cell phones and personal data assistants, and Network Attached Storage (NAS).

FIG. 14 is a plot of correct assembly (black bars) and incorrect assembly (white bars) following overlap extension polymerase chain reaction without primer removal for two genes (Gene 1 and Gene 2). Homology sequence length includes 20, 41, and 100 base pairs.

FIG. 15 is a plot of correct assembly (black bars) and incorrect assembly (white bars) following single-stranded DNA mediated hierarchal assembly using Q5 DNA polymerase and KapaHiFi polymerase enzymes. Homology sequence length includes 20, 41, and 100 base pairs.

FIG. 16 is a plot of colony forming units (CFU, Y-axis) versus insert: vector ratio (X-axis). An amount of insert includes 13 fmol (white bars), 26 fmol (hashed bars), and 40 fmol (black bars).

FIG. 17 is an image capture of a capillary gel electrophoresis following in vitro recombination cloning.

FIG. 18 is a plot of colony forming units (CFU) of homology sequences comprising 20, 41, or 100 base pairs. Homology sequences are flanked by universal primers (internal) or at a 5′ or 3′ end of an insert (terminal).

FIG. 19 is a plot of correct assembly (black bars) and incorrect assembly (white bars) following in vitro recombination cloning. Homology sequences comprise 20, 41, or 100 base pairs and are flanked by universal primers (internal) or at a 5′ or 3′ end of an insert (terminal).

FIG. 20A is a plot of percentage of hierarchal assembly (HA) for non-homologous sequences comprising 0, 24, 124, or 324 base pair lengths.

FIG. 20B is a plot of colony forming units (CFU) for non-homologous sequences comprising 0, 24, 124, or 324 base pair lengths.

FIG. 21A is a plot of percentage of hierarchal assembly (HA) for internal sequences comprising 24, 124, or 324 base pair lengths.

FIG. 21B is a plot of colony forming units (CFU) for internal sequences comprising 24, 124, or 324 base pair lengths.

DETAILED DESCRIPTION
Definitions

Throughout this disclosure, various embodiments are presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of any embodiments. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range to the tenth of the unit of the lower limit unless the context clearly dictates otherwise. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual values within that range, for example, 1.1, 2, 2.3, 5, and 5.9. This applies regardless of the breadth of the range. The upper and lower limits of these intervening ranges may independently be included in the smaller ranges, and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention, unless the context clearly dictates otherwise.

The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of any embodiment. As used herein, the singular forms “a,” “an” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise. It will be further understood that the terms “comprises” and/or “comprising,” when used in this specification, specify the presence of stated features, integers, steps, operations, elements, and/or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and/or groups thereof. As used herein, the term “and/or” includes any and all combinations of one or more of the associated listed items.

Unless specifically stated or obvious from context, as used herein, the term “nucleic acid” as used herein encompass double- or triple-stranded nucleic acids, as well as single-stranded molecules. In double- or triple-stranded nucleic acids, the nucleic acid strands need not be coextensive (i.e., a double-stranded nucleic acid need not be double-stranded along the entire length of both strands). Nucleic acid sequences, when provided, are listed in the 5′ to 3′ direction, unless stated otherwise. Methods described herein provide for the generation of isolated nucleic acids. Methods described herein additionally provide for the generation of isolated and purified nucleic acids. A “nucleic acid” as referred to herein can comprise at least 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, or more bases in length. Moreover, provided herein are methods for the synthesis of any number of polypeptide-segments encoding nucleotide sequences, including sequences encoding non-ribosomal peptides (NRPs), sequences encoding non-ribosomal peptide-synthetase (NRPS) modules and synthetic variants, polypeptide segments of other modular proteins, such as antibodies, polypeptide segments from other protein families, including non-coding DNA or RNA, such as regulatory sequences e.g. promoters, transcription factors, enhancers, siRNA, shRNA, RNAi, miRNA, small nucleolar RNA derived from microRNA, or any functional or structural DNA or RNA unit of interest. The following are non-limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, intergenic DNA, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short-hairpin RNA (shRNA), micro-RNA (miRNA), small nucleolar RNA, ribozymes, complementary DNA (cDNA), which is a DNA representation of mRNA, usually obtained by reverse transcription of messenger RNA (mRNA) or by amplification; DNA molecules produced synthetically or by amplification, genomic DNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. cDNA encoding for a gene or gene fragment referred herein may comprise at least one region encoding for exon sequences without an intervening intron sequence in the genomic equivalent sequence.

Unless specifically stated or obvious from context, as used herein, the term “about” in reference to a number or range of numbers is understood to mean the stated number and numbers+/−10% thereof, or 10% below the lower listed limit and 10% above the higher listed limit for the values listed for a range.

Seamless Assembly of Nucleic Acids

Provided herein are methods for assembly of nucleic acids with increased efficiency and accuracy. Further provided herein are methods of assembly of nucleic acids into long genes. De novo synthesized polynucleotides as described herein are assembled into nucleic acids by in vitro recombination cloning, single-stranded DNA mediated hierarchal assembly, or overlap extension. Generally, methods for nucleic acid assembly as described herein do not require primer removal.

A first exemplary process for seamless assembly of nucleic acids is depicted in FIG. 1. Single-stranded DNA mediated hierarchal assembly is performed with a first gene fragment 102 and second gene fragment 104 comprising a homology sequence 105. In this workflow, the first gene fragment 102 and the second gene fragment 104 are double-stranded and comprise a 5′ flanking adapter sequence 107a and a 3′ flanking adapter sequence 107b comprising uracil 103. The first gene fragment 102 and the second gene fragment 104 are amplified with primers and a uracil compatible polymerase. In some instances, the uracil compatible polymerase is Phusion U or Kapa Uracil. The resultant PCR product comprises a uracil at the end of the 3′ flanking adapter sequence 107b. The first gene fragment 102 and the second gene fragment 104 are diluted, mixed, and amplified 109 with a primer and a uracil incompatible polymerase that stalls at a uracil. In some instances, the uracil incompatible polymerase is Q5 DNA polymerase. The resultant fragments 106, 108 that do not comprise uracil, serve as primers for each other and are combined 113 and amplified 115 to generate a single-stranded DNA molecule. Single-stranded DNA mediated hierarchal assembly can be performed with multiple gene fragments as seen in FIG. 2. Single-stranded DNA mediated hierarchal assembly is performed with a first gene fragment 202, a second gene fragment 204, and a third gene fragment 206 comprising a homology sequence 205. The first gene fragment 202, the second gene fragment 204, and the third gene fragment 206 are double-stranded and comprise a 5′ flanking adapter sequence 207a and a 3′ flanking adapter sequence 207b. The 3′ flanking adapter sequence 207b of the first gene fragment 202 comprises uracil. The 5′ flanking adapter sequence 207a and the 3′ flanking adapter sequence 207b of the second gene fragment 204 comprise a uracil. The 3′ flanking adapter sequence 207b of the third gene fragment 206 comprises uracil. The first gene fragment 202, the second gene fragment 204, and the third gene fragment 206 are amplified with universal primers (primers that are complementary to a region of each of the gene fragments) and a uracil compatible polymerase. In some instances, the uracil compatible polymerase is Phusion U or Kapa Uracil. The resultant PCR product comprises a uracil at the end of the at least one of the 5′ flanking adapter sequence 207a and the 3′ flanking adapter sequence 207b. The first gene fragment 202, the second gene fragment 204, and the third gene fragment 206 are diluted, mixed, and amplified 209 with universal primers and a uracil incompatible polymerase that stalls at a uracil or is inefficient when interacting with a uracil. In some instances, the uracil incompatible polymerase is Q5 DNA polymerase. The resultant fragment without 208 uracil and fragment comprising uracil 210 serve as primers for each other. The resultant fragment without 208 uracil and fragment comprising uracil 210 are then combined 213 and diluted, mixed, and then amplified 215 with universal primers and DNA polymerase that stalls at uracil (such as Q5 DNA polymerase) to generate an intermediate fragment 212. Intermediate fragment 212 and an additional fragment 214 serve as primers for each other and are combined and amplified 219 to generate a single-stranded DNA molecule.

A second exemplary process for seamless assembly of nucleic acids is depicted in FIG. 3. In vitro recombination cloning is performed with a first gene fragment 302 comprising from 5′ to 3′: a 5′ flanking adapter sequence 307a, a first homology sequence 303, an insert sequence 305, a second homology sequence 309, and a 3′ flanking adapter sequence 307b. The first homology sequence 303 is homologous to sequence 311 of vector 304. The second homology sequence is homologous to sequence 313 of vector 304. The first gene fragment 302 and vector 304 are incubated 317 with bacterial cell lysate to generate assembled construct 306.

In vitro recombination cloning can be performed with multiple gene fragments as seen in FIG. 4. In vitro recombination cloning is performed using two gene fragments. A first gene fragment 402 comprises from 5′ to 3′: a 5′ flanking adapter sequence 407a, a first homology sequence 403, an insert sequence 405, a second homology sequence 409, and a 3′ flanking adapter sequence 407b. A second gene fragment 404 comprises from 5′ to 3′: a 5′ flanking adapter sequence 407a, a first homology sequence 411, an insert sequence 413, a second homology sequence 415, and a 3′ flanking adapter sequence 407b. The first homology sequence 403 of the first gene fragment 402 is homologous to sequence 417 on vector 406. The second homology sequence 409 of the first gene fragment 402 is homologous to the first homology sequence 411 of the second gene fragment 404. The second homology sequence 415 of the second gene fragment 404 is homologous to the sequence 419 of vector 406. The first gene fragment 402, the second gene fragment 404, and vector 406 are incubated 419 with bacterial cell lysate to generate assembled construct 408.

A third exemplary process for seamless assembly of nucleic acids is depicted in FIG. 8. Overlap extension PCR is performed using a nucleic acid 802 comprising a universal primer binding site 803 and a region complementary to nucleic acid 804. Nucleic acid 804 comprises a universal primer binding site 803. An enzyme 805 cleaves a terminal end of nucleic acid 802 and nucleic acid 804. Nucleic acid 802 and nucleic acid 804 are then amplified and serve as a template for each other.

Primers referred to in the exemplary workflows mentioned herein as “universal primers” are short polynucleotides that recognize a primer binding site common to multiple DNA fragments. However, these workflows are not limited to only use of universal primers, and fragment-specific primers may be incorporated in addition or alternatively. In addition, while exemplary workflows described herein refer to assembly of gene fragments, they are not limited as such and are applicable to the assembly of longer nucleic acids in general.

In Vitro Recombination Cloning

Provided herein are methods for seamless assembly of nucleic acids, comprising in vitro recombination cloning. In some instances, in vitro recombination cloning comprises a gene or fragment thereof for insertion into a vector using a bacterial lysate. In some instances, the gene fragment comprises at least one universal primer. In some instances, the gene fragment comprises a vector homology sequence.

Provided herein are methods for in vitro recombination cloning, wherein a bacterial lysate is used. The bacterial lysate may be derived from Escherichia coli. In some instances, the bacterial lysate is derived from RecA bacteria. In some instances, the bacterial strain is from JM109 cells. In some instances, the bacterial lysate comprises a nuclease or a recombinase. In some instances, the bacterial lysate comprises a nuclease and a recombinase.

Provided herein are methods for in vitro recombination cloning, wherein a gene fragment is de novo synthesized and comprise a flanking adapter sequence and a homology sequence. The homology sequence may be at a 5′ or 3′ end of the gene fragment. In some instances, the homology sequence is flanked by a pair of flanking adapter sequences. In some instances, the gene fragment comprises a least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 homology sequences.

Homology sequences described herein for in vitro recombination cloning may vary in length. Exemplary lengths for homology sequences include, but are not limited to, at least or about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, or more than 200 base pairs. In some instances, the length of the homology sequence is 20 base pairs. In some instances, the length of the homology sequence is 41 base pairs. In some instances the length of the homology sequence is 100 base pairs. In some instances, the length of the homology sequence has a range of about 10 to 20, 10 to 30, 10 to 40, 10 to 50, 10 to 60, 10 to 70, 10 to 80, 10 to 100, 10 to 125, 10 to 150, 10 to 200, 20 to 30, 20 to 40, 20 to 50, 20 to 60, 20 to 70, 20 to 80, 20 to 100, 20 to 125, 20 to 150, 20 to 200, 30 to 40, 30 to 50, 30 to 60, 30 to 70, 30 to 80, 30 to 100, 30 to 125, 30 to 150, 30 to 200, 40 to 50, 40 to 60, 40 to 70, 40 to 80, 40 to 100, 40 to 125, 40 to 150, 40 to 200, 50 to 60, 50 to 70, 50 to 80, 50 to 100, 50 to 125, 50 to 150, 50 to 200, 60 to 70, 60 to 80, 60 to 100, 60 to 125, 60 to 150, 60 to 200, 70 to 80, 70 to 100, 70 to 125, 70 to 150, 70 to 200, 80 to 100, 80 to 125, 80 to 150, 80 to 200, 100 to 125, 100 to 150, 100 to 200, 125 to 150, 125 to 200, or 150 to 200 base pairs.

Provided herein are methods for in vitro recombination cloning, wherein a number of gene fragments are inserted into a vector. In some instances, the number of gene fragments that are inserted is at least or about 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 gene fragments. In some instances, the number of gene fragments that are inserted has a range of about 1 to 2, 1 to 3, 1 to 4, 1 to 5, 1 to 6, 1 to 7, 1 to 8, 1 to 9, 1 to 10, 2 to 3, 2 to 4, 2 to 5, 2 to 6, 2 to 7, 2 to 8, 2 to 9, 2 to 10, 3 to 4, 3 to 5, 3 to 6, 3 to 7, 3 to 8, 3 to 9, 3 to 10, 4 to 5, 4 to 6, 4 to 7, 4 to 8, 4 to 9, 4 to 10, 5 to 6, 5 to 7, 5 to 8, 5 to 9, 5 to 10, 6 to 7, 6 to 8, 6 to 9, 6 to 10, 7 to 8, 7 to 9, 7 to 10, 8 to 9, 8 to 10, or 9 to 10.

Provided herein are methods for in vitro recombination cloning, wherein a gene fragment comprises a non-homologous sequence. In some instances, the non-homologous sequence comprises at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300 or more than 300 base pairs in length. In some instances, the number of base pairs is 24 base pairs. In some instances, the number of base pairs is 124 base pairs. In some instances the number of base pairs is 324 base pairs. In some instances, the gene fragment does not comprise a non-homologous sequence.

Provided herein are methods for in vitro recombination cloning, wherein the amount of gene fragment or the amount of vector varies. In some instances, the amount of gene fragment is at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, or more than 100 femtomoles. In some instances, the amount of vector is at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, or more than 100 femtomoles. In some instances, a ratio of gene fragment to vector varies. In some instances, the molar ratio of gene fragment to vector is at least or about 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, or more.

Provided herein are methods for in vitro recombination cloning, wherein a reaction for in vitro recombination cloning occurs at an optimal temperature. In some instances, the reaction occurs at a temperature optimal for enzymatic activity, for example, a temperature in a range of about 25-80° C., 25-70° C., 25-60° C., 25-50° C., or 25-40° C. In some instances, the temperature is at least or about 15° C., 20° C., 25° C., 30° C., 35° C., 40° C., 45° C., 50° C., 55° C., 60° C., 65° C., 70° C., 75° C., 80° C., or more than 80° C. In some instances, the temperature is about 65° C. In some instances, the enzymatic activity is a nuclease activity. In some instances, the enzymatic activity is a recombinase activity.

Methods described herein for in vitro recombination cloning result in a high percentage of correct assembly. In some instances, the percentage of correct assembly is at least or about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or more than 99%. In some instances, the percentage of correct assembly is 100%. In some instances, the percentage of incorrect assembly is at most 5%, 10%, 15%, 20%, 25%, or 30%, or more than 30%.

Methods described herein comprising in vitro recombination cloning result in increased efficiency. In some instances, efficiency is measured by number of colony forming units. In some instances, methods described herein result in at least or about 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 12000, 14000, 16000, 18000, 20000, 25000, 30000, 35000, 40000, 50000, 60000, 70000, 80000, 90000, 100000, 200000, 300000, 400000, 500000, 600000, 700000, 800000, 900000, or more than 900000 colony forming units.

Single-stranded DNA Mediated Hierarchal Assembly

Provided herein are methods for seamless assembly of nucleic acids, wherein methods comprise single-stranded DNA mediated hierarchal assembly. In some instances, the single-stranded DNA mediated hierarchal assembly comprises assembly of a nucleic acid de novo synthesized by methods described herein. In some instances, the assembly comprises amplification of the nucleic acid with a primer, wherein the primer is not removed after amplification. In some instances, assembly results in increased percentage of correctly assembly nucleic acids and improved efficiency.

Provided herein are methods for single-stranded DNA mediated hierarchal assembly, wherein methods comprise an amplification reaction. In some instances, the amplification reaction comprises a polymerase. In some instances, the polymerase is a high fidelity polymerase. In some instances, the polymerase is a DNA polymerase. The DNA polymerase may be from any family of DNA polymerases including, but not limited to, Family A polymerase, Family B polymerase, Family C polymerase, Family D polymerase, Family X polymerase, and Family Y polymerase. In some instances, the DNA polymerase may be a Family B polymerase. Exemplary Family B polymerase is from a species of, but not limited to, Pyrococcus furiosus, Thermococcus gorgonarius, Desulfurococcus strain Tok, Thermococcus sp. 9° N-7, Pyrococcus kodakaraensis, Thermococcus litoralis, Methanococcus voltae, Pyrobaculum islandicum, Archaeoglobus fulgidus, Cenarchaeaum symbiosum, Sulfolobus acidocaldarius, Sulfurisphaera ohwakuensis, Sulfolobus solfataricus, Pyrodictium occultum, and Aeropyrum pernix. In some instances, the Family B polymerase is a polymerases or derivative thereof (e.g., mutants, chimeras) from Pyrococcus furiosus.

Polymerases described herein for use in an amplification reaction may comprise various enzymatic activities. Polymerases are used in the methods of the invention, for example, to extend primers to produce extension products. In some instances, the DNA polymerase has 5′ to 3′ polymerase activity. In some instances, the DNA polymerase comprises 3′ to 5′ exonuclease activity. In some instances, the DNA polymerase comprises proofreading activity. Exemplary polymerases include, but are not limited to, DNA polymerase (I, II, or III), T4 DNA polymerase, T7 DNA polymerase, Bst DNA polymerase, Bca polymerase, Vent DNA polymerase, Pfu DNA polymerase, and Taq DNA polymerase.

Polymerases described herein for use in an amplification reaction may recognize a modified base. In some instances, the modified base is a variation in nucleic acid composition or a chemical modification. In some instances, a modified base comprises a base other than adenine, guanine, cytosine or thymine in DNA or a base other than adenine, guanine, cytosine or uracil in RNA. Modified bases described herein include, without limitation, oxidized bases, alkylated bases, deaminated bases, pyrimidine derivatives, purine derivatives, ring-fragmented bases, and methylated bases. Exemplary modified bases include, but are not limited to, uracil, 3-meA (3-methyladenine), hypoxanthine, 8-oxoG (7,8-dihydro-8-oxoguanine), FapyG, FapyA, Tg (thymine glycol), hoU (hydroxyuracil), hmU (hydroxymethyluracil), fU (formyluracil), hoC (hydroxycytosine), fC (formylcytosine), 5-meC (5-methylcytosine), 6-meG (O6-methylguanine), 7-meG (N7-methylguanine), εC (ethenocytosine), 5-caC (5-carboxylcytosine), 2-hA, εA (ethenoadenine), 5-fU (5-fluorouracil), 3-meG (3-methylguanine), and isodialuric acid. In some instances, a modified base in DNA is a uracil. Non-limiting examples of uracil compatible DNA polymerases include Pfu polymerase, Pfu Turbo Cx and KAPA HiFi Uracil+. In some instances, the polymerase selected for the amplification reaction is not capable of recognizing a modified base. For example, the polymerase is incompatible with uracil. Exemplary polymerases that are incompatible with uracil include, but are not limited to, KAPA HiFi polymerase, KAPA HiFi, Phusion®, and Q5® High Fidelity DNA polymerase.

In some instances, a single DNA polymerase or a plurality of DNA polymerases are used. In some instances, the same DNA polymerase or set of DNA polymerases are used at different stages of the present methods. For example, in a first amplification reaction a DNA polymerase that is compatible with uracil is used, and in a second amplification reaction a DNA polymerase that is incompatible with uracil is used. In some instances, the DNA polymerases are varied. For example, the DNA polymerases are varied based on enzymatic activities. In some instances, additional polymerases are added during various steps.

Described herein are methods for nucleic acid assembly comprising an amplification reaction, wherein the amplification reaction comprises a universal primer binding sequence. In some instances, the universal primer binding sequence is capable of binding the same 5′ or 3′ primer. In some instances, the universal primer binding sequence is shared among a plurality of target nucleic acids in the amplification reaction.

Provided herein are methods for single-stranded DNA mediated hierarchal assembly, wherein a reaction for single-stranded DNA mediated hierarchal assembly occurs at an optimal temperature. In some instances, the reaction occurs at a temperature optimal for polymerase activity. In some instances, the reaction occurs at a temperature optimal for enzymatic activity. In some instances, the reaction occurs at a temperature in a range of about 25-80° C., 25-70° C., 25-60° C., 25-50° C., or 25-40° C. In some instances, the temperature is at least or about 15° C., 20° C., 25° C., 30° C., 35° C., 40° C., 45° C., 50° C., 55° C., 60° C., 65° C., 70° C., 75° C., 80° C., or more than 80° C.

Provided herein are methods for single-stranded DNA mediated hierarchal assembly, wherein a gene fragment to be assembled comprises a homology sequence. In some instances, the homology sequence is complementary to a homology sequence in another gene fragment to be assembled. The homology sequence may comprise a number of base pairs. In some instances, the number of base pairs is at least or about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, or more than 200 base pairs. In some instances, the number of base pairs is 20 base pairs. In some instances, the number of base pairs is 41 base pairs. In some instances the number of base pairs is 100 base pairs. In some instances, the number of base pairs is 10 to 20, 10 to 30, 10 to 40, 10 to 50, 10 to 60, 10 to 70, 10 to 80, 10 to 100, 10 to 125, 10 to 150, 10 to 200, 20 to 30, 20 to 40, 20 to 50, 20 to 60, 20 to 70, 20 to 80, 20 to 100, 20 to 125, 20 to 150, 20 to 200, 30 to 40, 30 to 50, 30 to 60, 30 to 70, 30 to 80, 30 to 100, 30 to 125, 30 to 150, 30 to 200, 40 to 50, 40 to 60, 40 to 70, 40 to 80, 40 to 100, 40 to 125, 40 to 150, 40 to 200, 50 to 60, 50 to 70, 50 to 80, 50 to 100, 50 to 125, 50 to 150, 50 to 200, 60 to 70, 60 to 80, 60 to 100, 60 to 125, 60 to 150, 60 to 200, 70 to 80, 70 to 100, 70 to 125, 70 to 150, 70 to 200, 80 to 100, 80 to 125, 80 to 150, 80 to 200, 100 to 125, 100 to 150, 100 to 200, 125 to 150, 125 to 200, or 150 to 200 base pairs.

Provided herein are methods for single-stranded DNA mediated hierarchal assembly, wherein a plurality of gene fragments are assembled. In some instances, the number of gene fragments that are assembled is at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 gene fragments. In some instances, the number of gene fragments is 1 to 2, 1 to 3, 1 to 4, 1 to 5, 1 to 6, 1 to 7, 1 to 8, 1 to 9, 1 to 10, 2 to 3, 2 to 4, 2 to 5, 2 to 6, 2 to 7, 2 to 8, 2 to 9, 2 to 10, 3 to 4, 3 to 5, 3 to 6, 3 to 7, 3 to 8, 3 to 9, 3 to 10, 4 to 5, 4 to 6, 4 to 7, 4 to 8, 4 to 9, 4 to 10, 5 to 6, 5 to 7, 5 to 8, 5 to 9, 5 to 10, 6 to 7, 6 to 8, 6 to 9, 6 to 10, 7 to 8, 7 to 9, 7 to 10, 8 to 9, 8 to 10, or 9 to 10.

Methods described herein for single-stranded DNA mediated hierarchal assembly result in a high percentage of correct assembly. In some instances, the percentage of correct assembly is at least or about 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or more than 99%. In some instances, the percentage of correct assembly is 100%. In some instances, the percentage of incorrect assembly is at most 5%, 10%, 15%, 20%, 25%, or 30%, or more than 30%.

Systems for Synthesis of Nucleic Acids and Seamless Assembly

Polynucleotide Synthesis

Provided herein are methods for seamless assembly of nucleic acids following generation of polynucleotides by de novo synthesis by methods described herein. An exemplary workflow is seen in FIG. 9. A computer readable input file comprising a nucleic acid sequence is received. A computer processes the nucleic acid sequence to generate instructions for synthesis of the polynucleotide sequence or a plurality of polynucleotide sequences collectively encoding the nucleic acid sequence. Instructions are transmitted to a material deposition device 903 for synthesis of the plurality of polynucleotides based on the plurality of nucleic acid sequences. The material deposition device 903, such as a polynucleotide acid synthesizer, is designed to release reagents in a step wise fashion such that multiple polynucleotides extend, in parallel, one residue at a time to generate oligomers with a predetermined nucleic acid sequence. The material deposition device 903 generates oligomers on an array 905 that includes multiple clusters 907 of loci for polynucleotide acid synthesis and extension. However, the array need not have loci organized in clusters. For example, the loci can be uniformly spread across the array. De novo polynucleotides are synthesized and removed from the plate and an assembly reaction commenced in a collection chamber 909 followed by formation population of longer polynucleotides 911. The collection chamber may comprise a sandwich of multiple surfaces (e.g., a top and bottom surface) or well or channel in containing transferred material from the synthesis surface. De novo polynucleotides can also be synthesized and removed from the plate to form a population of longer polynucleotides 911. The population of longer polynucleotides 911 can then be partitioned into droplets or subject to PCR. The population of longer polynucleotides 911 is then subject to nucleic acid assembly by either in vitro recombination cloning 915, or single-stranded DNA hierarchal assembly 917.

Provided herein are systems for seamless assembly of nucleic acids following generation of polynucleotides by de novo synthesis by methods described herein. In some instances, the system comprises a computer, a material deposition device, a surface, and a nucleic acid assembly surface. In some instances, the computer comprises a readable input file with a nucleic acid sequence. In some instances, the computer processes the nucleic acid sequence to generate instructions for synthesis of the polynucleotide sequence or a plurality of polynucleotide sequences collectively encoding for the nucleic acid sequence. In some instances, the computer provides instructions to the material deposition device for the synthesis of the plurality of polynucleotide acid sequences. In some instances, the material deposition device deposits nucleosides on the surface for an extension reaction. In some instances, the surface comprises a locus for the extension reaction. In some instances, the locus is a spot, well, microwell, channel, or post. In some instances, the plurality of polynucleotide acid sequences is synthesized following the extension reaction. In some instances, the plurality of polynucleotide acid sequences are removed from the surface and prepared for nucleic acid assembly. In some instances, nucleic acid assembly comprises in vitro recombination cloning. In some instances, nucleic acid assembly comprises single-stranded hierarchal DNA assembly. In some instances, nucleic acid assembly comprises overlap extension PCR without primer removal.

Provided herein are methods for polynucleotide synthesis involving phosphoramidite chemistry. In some instances, polynucleotide synthesis comprises coupling a base with phosphoramidite. In some instances, polynucleotide synthesis comprises coupling a base by deposition of phosphoramidite under coupling conditions, wherein the same base is optionally deposited with phosphoramidite more than once, i.e., double coupling. In some instances, polynucleotide synthesis comprises capping of unreacted sites. In some cases, capping is optional. In some instances, polynucleotide synthesis comprises oxidation. In some instances, polynucleotide synthesis comprises deblocking or detritylation. In some instances, polynucleotide synthesis comprises sulfurization. In some cases, polynucleotide synthesis comprises either oxidation or sulfurization. In some instances, between one or each step during a polynucleotide synthesis reaction, the substrate is washed, for example, using tetrazole or acetonitrile. Time frames for any one step in a phosphoramidite synthesis method include less than about 2 min, 1 min, 50 sec, 40 sec, 30 sec, 20 sec and 10 sec.

Polynucleotide synthesis using a phosphoramidite method comprises the subsequent addition of a phosphoramidite building block (e.g., nucleoside phosphoramidite) to a growing polynucleotide chain for the formation of a phosphite triester linkage. Phosphoramidite polynucleotide synthesis proceeds in the 3′ to 5′ direction. Phosphoramidite polynucleotide synthesis allows for the controlled addition of one nucleotide to a growing nucleic acid chain per synthesis cycle. In some instances, each synthesis cycle comprises a coupling step. Phosphoramidite coupling involves the formation of a phosphite triester linkage between an activated nucleoside phosphoramidite and a nucleoside bound to the substrate, for example, via a linker. In some instances, the nucleoside phosphoramidite is provided to the substrate activated. In some instances, the nucleoside phosphoramidite is provided to the substrate with an activator. In some instances, nucleoside phosphoramidites are provided to the substrate in a 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100-fold excess or more over the substrate-bound nucleosides. In some instances, the addition of nucleoside phosphoramidite is performed in an anhydrous environment, for example, in anhydrous acetonitrile. Following addition of a nucleoside phosphoramidite, the substrate is optionally washed. In some instances, the coupling step is repeated one or more additional times, optionally with a wash step between nucleoside phosphoramidite additions to the substrate. In some instances, a polynucleotide synthesis method used herein comprises 1, 2, 3 or more sequential coupling steps. Prior to coupling, in many cases, the nucleoside bound to the substrate is de-protected by removal of a protecting group, where the protecting group functions to prevent polymerization. A common protecting group is 4,4′-dimethoxytrityl (DMT).

Following coupling, phosphoramidite polynucleotide synthesis methods optionally comprise a capping step. In a capping step, the growing polynucleotide is treated with a capping agent. A capping step is useful to block unreacted substrate-bound 5′-OH groups after coupling from further chain elongation, preventing the formation of polynucleotides with internal base deletions. Further, phosphoramidites activated with 1H-tetrazole may react, to a small extent, with the 06 position of guanosine. Without being bound by theory, upon oxidation with 12/water, this side product, possibly via 06-N7 migration, may undergo depurination. The apurinic sites may end up being cleaved in the course of the final deprotection of the polynucleotide thus reducing the yield of the full-length product. The 06 modifications may be removed by treatment with the capping reagent prior to oxidation with 12/water. In some instances, inclusion of a capping step during polynucleotide synthesis decreases the error rate as compared to synthesis without capping. As an example, the capping step comprises treating the substrate-bound polynucleotide with a mixture of acetic anhydride and 1-methylimidazole. Following a capping step, the substrate is optionally washed.

In some instances, following addition of a nucleoside phosphoramidite, and optionally after capping and one or more wash steps, the substrate bound growing nucleic acid is oxidized. The oxidation step comprises the phosphite triester is oxidized into a tetracoordinated phosphate triester, a protected precursor of the naturally occurring phosphate diester internucleoside linkage. In some cases, oxidation of the growing polynucleotide is achieved by treatment with iodine and water, optionally in the presence of a weak base (e.g., pyridine, lutidine, collidine). Oxidation may be carried out under anhydrous conditions using, e.g. tert-Butyl hydroperoxide or (1S)-(+)-(10-camphorsulfonyl)-oxaziridine (CSO). In some methods, a capping step is performed following oxidation. A second capping step allows for substrate drying, as residual water from oxidation that may persist can inhibit subsequent coupling. Following oxidation, the substrate and growing polynucleotide is optionally washed. In some instances, the step of oxidation is substituted with a sulfurization step to obtain polynucleotide phosphorothioates, wherein any capping steps can be performed after the sulfurization. Many reagents are capable of the efficient sulfur transfer, including but not limited to 3-(Dimethylaminomethylidene)amino)-3H-1,2,4-dithiazole-3-thione, DDTT, 3H-1,2-benzodithiol-3-one 1,1-dioxide, also known as Beaucage reagent, and N,N,N′N′-Tetraethylthiuram disulfide (TETD).

In order for a subsequent cycle of nucleoside incorporation to occur through coupling, the protected 5′ end of the substrate bound growing polynucleotide is removed so that the primary hydroxyl group is reactive with a next nucleoside phosphoramidite. In some instances, the protecting group is DMT and deblocking occurs with trichloroacetic acid in dichloromethane. Conducting detritylation for an extended time or with stronger than recommended solutions of acids may lead to increased depurination of solid support-bound polynucleotide and thus reduces the yield of the desired full-length product. Methods and compositions of the invention described herein provide for controlled deblocking conditions limiting undesired depurination reactions. In some cases, the substrate bound polynucleotide is washed after deblocking. In some cases, efficient washing after deblocking contributes to synthesized polynucleotides having a low error rate.

Methods for the synthesis of polynucleotides typically involve an iterating sequence of the following steps: application of a protected monomer to an actively functionalized surface (e.g., locus) to link with either the activated surface, a linker or with a previously deprotected monomer; deprotection of the applied monomer so that it is reactive with a subsequently applied protected monomer; and application of another protected monomer for linking. One or more intermediate steps include oxidation or sulfurization. In some cases, one or more wash steps precede or follow one or all of the steps.

Methods for phosphoramidite based polynucleotide synthesis comprise a series of chemical steps. In some instances, one or more steps of a synthesis method involve reagent cycling, where one or more steps of the method comprise application to the substrate of a reagent useful for the step. For example, reagents are cycled by a series of liquid deposition and vacuum drying steps. For substrates comprising three-dimensional features such as wells, microwells, channels and the like, reagents are optionally passed through one or more regions of the substrate via the wells and/or channels.

Polynucleotides synthesized using the methods and/or substrates described herein comprise at least about 20, 30, 40, 50, 60, 70, 75, 80, 90, 100, 120, 150, 200, 500 or more bases in length. In some instances, at least about 1 pmol, 10 pmol, 20 pmol, 30 pmol, 40 pmol, 50 pmol, 60 pmol, 70 pmol, 80 pmol, 90 pmol, 100 pmol, 150 pmol, 200 pmol, 300 pmol, 400 pmol, 500 pmol, 600 pmol, 700 pmol, 800 pmol, 900 pmol, 1 nmol, 5 nmol, 10 nmol, 100 nmol or more of a polynucleotide is synthesized within a locus. Methods for polynucleotide synthesis on a surface provided herein allow for synthesis at a fast rate. As an example, at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 125, 150, 175, 200 nucleotides per hour, or more are synthesized. Nucleotides include adenine, guanine, thymine, cytosine, uridine building blocks, or analogs/modified versions thereof. In some instances, libraries of polynucleotides are synthesized in parallel on a substrate. For example, a substrate comprising about or at least about 100; 1,000; 10,000; 100,000; 1,000,000; 2,000,000; 3,000,000; 4,000,000; or 5,000,000 resolved loci is able to support the synthesis of at least the same number of distinct polynucleotides, wherein polynucleotide encoding a distinct sequence is synthesized on a resolved locus.

Various suitable methods are known for generating high density polynucleotide arrays. In an exemplary workflow, a substrate surface layer is provided. In the example, chemistry of the surface is altered in order to improve the polynucleotide synthesis process. Areas of low surface energy are generated to repel liquid while areas of high surface energy are generated to attract liquids. The surface itself may be in the form of a planar surface or contain variations in shape, such as protrusions or microwells which increase surface area. In the workflow example, high surface energy molecules selected serve a dual function of supporting DNA chemistry, as disclosed in International Patent Application Publication WO/2015/021080, which is herein incorporated by reference in its entirety.

In situ preparation of polynucleotide arrays is generated on a solid support and utilizes single nucleotide extension process to extend multiple oligomers in parallel. A deposition device, such as a polynucleotide synthesizer, is designed to release reagents in a step wise fashion such that multiple polynucleotides extend, in parallel, one residue at a time to generate oligomers with a predetermined nucleic acid sequence. In some cases, polynucleotides are cleaved from the surface at this stage. Cleavage includes gas cleavage, e.g., with ammonia or methylamine.

Substrates

Devices used as a surface for polynucleotide synthesis may be in the form of substrates which include, without limitation, homogenous array surfaces, patterned array surfaces, channels, beads, gels, and the like. Provided herein are substrates comprising a plurality of clusters, wherein each cluster comprises a plurality of loci that support the attachment and synthesis of polynucleotides. The term “locus” as used herein refers to a discrete region on a structure which provides support for polynucleotides encoding for a single predetermined sequence to extend from the surface. In some instances, a locus is on a two dimensional surface, e.g., a substantially planar surface. In some instances, a locus is on a three-dimensional surface, e.g., a well, microwell, channel, or post. In some instances, a surface of a locus comprises a material that is actively functionalized to attach to at least one nucleotide for polynucleotide synthesis, or preferably, a population of identical nucleotides for synthesis of a population of polynucleotides. In some instances, polynucleotide refers to a population of polynucleotides encoding for the same nucleic acid sequence. In some cases, a surface of a substrate is inclusive of one or a plurality of surfaces of a substrate. The average error rates for polynucleotides synthesized within a library described herein using the systems and methods provided are often less than 1 in 1000, less than about 1 in 2000, less than about 1 in 3000 or less often without error correction.

Provided herein are surfaces that support the parallel synthesis of a plurality of polynucleotides having different predetermined sequences at addressable locations on a common support. In some instances, a substrate provides support for the synthesis of more than 50, 100, 200, 400, 600, 800, 1000, 1200, 1400, 1600, 1800, 2,000; 5,000; 10,000; 20,000; 50,000; 100,000; 200,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,200,000; 1,400,000; 1,600,000; 1,800,000; 2,000,000; 2,500,000; 3,000,000; 3,500,000; 4,000,000; 4,500,000; 5,000,000; 10,000,000 or more non-identical polynucleotides. In some cases, the surfaces provides support for the synthesis of more than 50, 100, 200, 400, 600, 800, 1000, 1200, 1400, 1600, 1800, 2,000; 5,000; 10,000; 20,000; 50,000; 100,000; 200,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,200,000; 1,400,000; 1,600,000; 1,800,000; 2,000,000; 2,500,000; 3,000,000; 3,500,000; 4,000,000; 4,500,000; 5,000,000; 10,000,000 or more polynucleotides encoding for distinct sequences. In some instances, at least a portion of the polynucleotides have an identical sequence or are configured to be synthesized with an identical sequence. In some instances, the substrate provides a surface environment for the growth of polynucleotides having at least 80, 90, 100, 120, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500 bases or more.

Provided herein are methods for polynucleotide synthesis on distinct loci of a substrate, wherein each locus supports the synthesis of a population of polynucleotides. In some cases, each locus supports the synthesis of a population of polynucleotides having a different sequence than a population of polynucleotides grown on another locus. In some instances, each polynucleotide sequence is synthesized with 1, 2, 3, 4, 5, 6, 7, 8, 9 or more redundancy across different loci within the same cluster of loci on a surface for polynucleotide synthesis. In some instances, the loci of a substrate are located within a plurality of clusters. In some instances, a substrate comprises at least 10, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000, 20000, 30000, 40000, 50000 or more clusters. In some instances, a substrate comprises more than 2,000; 5,000; 10,000; 100,000; 200,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,100,000; 1,200,000; 1,300,000; 1,400,000; 1,500,000; 1,600,000; 1,700,000; 1,800,000; 1,900,000; 2,000,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,200,000; 1,400,000; 1,600,000; 1,800,000; 2,000,000; 2,500,000; 3,000,000; 3,500,000; 4,000,000; 4,500,000; 5,000,000; or 10,000,000 or more distinct loci. In some instances, a substrate comprises about 10,000 distinct loci. The amount of loci within a single cluster is varied in different instances. In some cases, each cluster includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 130, 150, 200, 300, 400, 500 or more loci. In some instances, each cluster includes about 50-500 loci. In some instances, each cluster includes about 100-200 loci. In some instances, each cluster includes about 100-150 loci. In some instances, each cluster includes about 109, 121, 130 or 137 loci. In some instances, each cluster includes about 19, 20, 61, 64 or more loci.

In some instances, the number of distinct polynucleotides synthesized on a substrate is dependent on the number of distinct loci available in the substrate. In some instances, the density of loci within a cluster of a substrate is at least or about 1, 10, 25, 50, 65, 75, 100, 130, 150, 175, 200, 300, 400, 500, 1,000 or more loci per mm². In some cases, a substrate comprises 10-500, 25-400, 50-500, 100-500, 150-500, 10-250, 50-250, 10-200, or 50-200 mm². In some instances, the distance between the centers of two adjacent loci within a cluster is from about 10-500, from about 10-200, or from about 10-100 um. In some instances, the distance between two centers of adjacent loci is greater than about 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 um. In some instances, the distance between the centers of two adjacent loci is less than about 200, 150, 100, 80, 70, 60, 50, 40, 30, 20 or 10 um. In some instances, each locus has a width of about 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 um. In some cases, the each locus is has a width of about 0.5-100, 0.5-50, 10-75, or 0.5-50 um.

In some instances, the density of clusters within a substrate is at least or about 1 cluster per 100 mm², 1 cluster per 10 mm², 1 cluster per 5 mm², 1 cluster per 4 mm², 1 cluster per 3 mm², 1 cluster per 2 mm², 1 cluster per 1 mm², 2 clusters per 1 mm², 3 clusters per 1 mm², 4 clusters per 1 mm², 5 clusters per 1 mm², 10 clusters per 1 mm², 50 clusters per 1 mm²or more. In some instances, a substrate comprises from about 1 cluster per 10 mm²to about 10 clusters per 1 mm². In some instances, the distance between the centers of two adjacent clusters is at least or about 50, 100, 200, 500, 1000, 2000, or 5000 um. In some cases, the distance between the centers of two adjacent clusters is between about 50-100, 50-200, 50-300, 50-500, and 100-2000 um. In some cases, the distance between the centers of two adjacent clusters is between about 0.05-50, 0.05-10, 0.05-5, 0.05-4, 0.05-3, 0.05-2, 0.1-10, 0.2-10, 0.3-10, 0.4-10, 0.5-10, 0.5-5, or 0.5-2 mm. In some cases, each cluster has a cross section of about 0.5 to about 2, about 0.5 to about 1, or about 1 to about 2 mm. In some cases, each cluster has a cross section of about 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9 or 2 mm. In some cases, each cluster has an interior cross section of about 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.15, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9 or 2 mm.

In some instances, a substrate is about the size of a standard 96 well plate, for example between about 100 and about 200 mm by between about 50 and about 150 mm. In some instances, a substrate has a diameter less than or equal to about 1000, 500, 450, 400, 300, 250, 200, 150, 100 or 50 mm. In some instances, the diameter of a substrate is between about 25-1000, 25-800, 25-600, 25-500, 25-400, 25-300, or 25-200 mm. In some instances, a substrate has a planar surface area of at least about 100; 200; 500; 1,000; 2,000; 5,000; 10,000; 12,000; 15,000; 20,000; 30,000; 40,000; 50,000 mm²or more. In some instances, the thickness of a substrate is between about 50-2000, 50-1000, 100-1000, 200-1000, or 250-1000 mm.

Surface Materials

Substrates, devices, and reactors provided herein are fabricated from any variety of materials suitable for the methods, compositions, and systems described herein. In certain instances, substrate materials are fabricated to exhibit a low level of nucleotide binding. In some instances, substrate materials are modified to generate distinct surfaces that exhibit a high level of nucleotide binding. In some instances, substrate materials are transparent to visible and/or UV light. In some instances, substrate materials are sufficiently conductive, e.g., are able to form uniform electric fields across all or a portion of a substrate. In some instances, conductive materials are connected to an electric ground. In some instances, the substrate is heat conductive or insulated. In some instances, the materials are chemical resistant and heat resistant to support chemical or biochemical reactions, for example polynucleotide synthesis reaction processes. In some instances, a substrate comprises flexible materials. For flexible materials, materials can include, without limitation: nylon, both modified and unmodified, nitrocellulose, polypropylene, and the like. In some instances, a substrate comprises rigid materials. For rigid materials, materials can include, without limitation: glass, fuse silica, silicon, plastics (for example polytetraflouroethylene, polypropylene, polystyrene, polycarbonate, and blends thereof, and the like), and metals (for example, gold, platinum, and the like). The substrate, solid support or reactors can be fabricated from a material selected from the group consisting of silicon, polystyrene, agarose, dextran, cellulosic polymers, polyacrylamides, polydimethylsiloxane (PDMS), and glass. The substrates/solid supports or the microstructures, reactors therein may be manufactured with a combination of materials listed herein or any other suitable material known in the art.

Surface Architecture

Provided herein are substrates for the methods, compositions, and systems described herein, wherein the substrates have a surface architecture suitable for the methods, compositions, and systems described herein. In some instances, a substrate comprises raised and/or lowered features. One benefit of having such features is an increase in surface area to support polynucleotide synthesis. In some instances, a substrate having raised and/or lowered features is referred to as a three-dimensional substrate. In some cases, a three-dimensional substrate comprises one or more channels. In some cases, one or more loci comprise a channel. In some cases, the channels are accessible to reagent deposition via a deposition device such as a polynucleotide synthesizer. In some cases, reagents and/or fluids collect in a larger well in fluid communication one or more channels. For example, a substrate comprises a plurality of channels corresponding to a plurality of loci with a cluster, and the plurality of channels are in fluid communication with one well of the cluster. In some methods, a library of polynucleotides is synthesized in a plurality of loci of a cluster.

Provided herein are substrates for the methods, compositions, and systems described herein, wherein the substrates are configured for polynucleotide synthesis. In some instances, the structure is configured to allow for controlled flow and mass transfer paths for polynucleotide synthesis on a surface. In some instances, the configuration of a substrate allows for the controlled and even distribution of mass transfer paths, chemical exposure times, and/or wash efficacy during polynucleotide synthesis. In some instances, the configuration of a substrate allows for increased sweep efficiency, for example by providing sufficient volume for a growing a polynucleotide such that the excluded volume by the growing polynucleotide does not take up more than 50, 45, 40, 35, 30, 25, 20, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1%, or less of the initially available volume that is available or suitable for growing the polynucleotide. In some instances, a three-dimensional structure allows for managed flow of fluid to allow for the rapid exchange of chemical exposure.

Provided herein are substrates for the methods, compositions, and systems described herein, wherein the substrates comprise structures suitable for the methods, compositions, and systems described herein. In some instances, segregation is achieved by physical structure. In some instances, segregation is achieved by differential functionalization of the surface generating active and passive regions for polynucleotide synthesis. In some instances, differential functionalization is achieved by alternating the hydrophobicity across the substrate surface, thereby creating water contact angle effects that cause beading or wetting of the deposited reagents. Employing larger structures can decrease splashing and cross-contamination of distinct polynucleotide synthesis locations with reagents of the neighboring spots. In some cases, a device, such as a material deposition device, is used to deposit reagents to distinct polynucleotide synthesis locations. Substrates having three-dimensional features are configured in a manner that allows for the synthesis of a large number of polynucleotides (e.g., more than about 10,000) with a low error rate (e.g., less than about 1:500, 1:1000, 1:1500, 1:2,000; 1:3,000; 1:5,000; or 1:10,000). In some cases, a substrate comprises features with a density of about or greater than about 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 400 or 500 features per mm².

A well of a substrate may have the same or different width, height, and/or volume as another well of the substrate. A channel of a substrate may have the same or different width, height, and/or volume as another channel of the substrate. In some instances, the diameter of a cluster or the diameter of a well comprising a cluster, or both, is between about 0.05-50, 0.05-10, 0.05-5, 0.05-4, 0.05-3, 0.05-2, 0.05-1, 0.05-0.5, 0.05-0.1, 0.1-10, 0.2-10, 0.3-10, 0.4-10, 0.5-10, 0.5-5, or 0.5-2 mm. In some instances, the diameter of a cluster or well or both is less than or about 5, 4, 3, 2, 1, 0.5, 0.1, 0.09, 0.08, 0.07, 0.06, or 0.05 mm. In some instances, the diameter of a cluster or well or both is between about 1.0 and about 1.3 mm. In some instances, the diameter of a cluster or well, or both is about 1.150 mm. In some instances, the diameter of a cluster or well, or both is about 0.08 mm. The diameter of a cluster refers to clusters within a two-dimensional or three-dimensional substrate.

In some instances, the height of a well is from about 20-1000, 50-1000, 100-1000, 200-1000, 300-1000, 400-1000, or 500-1000 um. In some cases, the height of a well is less than about 1000, 900, 800, 700, or 600 um.

In some instances, a substrate comprises a plurality of channels corresponding to a plurality of loci within a cluster, wherein the height or depth of a channel is 5-500, 5-400, 5-300, 5-200, 5-100, 5-50, or 10-50 um. In some cases, the height of a channel is less than 100, 80, 60, 40, or 20 um.

In some instances, the diameter of a channel, locus (e.g., in a substantially planar substrate) or both channel and locus (e.g., in a three-dimensional substrate wherein a locus corresponds to a channel) is from about 1-1000, 1-500, 1-200, 1-100, 5-100, or 10-100 um, for example, about 90, 80, 70, 60, 50, 40, 30, 20 or 10 um. In some instances, the diameter of a channel, locus, or both channel and locus is less than about 100, 90, 80, 70, 60, 50, 40, 30, 20 or 10 um. In some instances, the distance between the center of two adjacent channels, loci, or channels and loci is from about 1-500, 1-200, 1-100, 5-200, 5-100, 5-50, or 5-30, for example, about 20 um.

Surface Modifications

Provided herein are methods for polynucleotide synthesis on a surface, wherein the surface comprises various surface modifications. In some instances, the surface modifications are employed for the chemical and/or physical alteration of a surface by an additive or subtractive process to change one or more chemical and/or physical properties of a substrate surface or a selected site or region of a substrate surface. For example, surface modifications include, without limitation, (1) changing the wetting properties of a surface, (2) functionalizing a surface, i.e., providing, modifying or substituting surface functional groups, (3) defunctionalizing a surface, i.e., removing surface functional groups, (4) otherwise altering the chemical composition of a surface, e.g., through etching, (5) increasing or decreasing surface roughness, (6) providing a coating on a surface, e.g., a coating that exhibits wetting properties that are different from the wetting properties of the surface, and/or (7) depositing particulates on a surface.

In some cases, the addition of a chemical layer on top of a surface (referred to as adhesion promoter) facilitates structured patterning of loci on a surface of a substrate. Exemplary surfaces for application of adhesion promotion include, without limitation, glass, silicon, silicon dioxide, and silicon nitride. In some cases, the adhesion promoter is a chemical with a high surface energy. In some instances, a second chemical layer is deposited on a surface of a substrate. In some cases, the second chemical layer has a low surface energy. In some cases, surface energy of a chemical layer coated on a surface supports localization of droplets on the surface. Depending on the patterning arrangement selected, the proximity of loci and/or area of fluid contact at the loci are alterable.

In some instances, a substrate surface, or resolved loci, onto which nucleic acids or other moieties are deposited, e.g., for polynucleotide synthesis, are smooth or substantially planar (e.g., two-dimensional) or have irregularities, such as raised or lowered features (e.g., three-dimensional features). In some instances, a substrate surface is modified with one or more different layers of compounds. Such modification layers of interest include, without limitation, inorganic and organic layers such as metals, metal oxides, polymers, small organic molecules and the like.

In some instances, resolved loci of a substrate are functionalized with one or more moieties that increase and/or decrease surface energy. In some cases, a moiety is chemically inert. In some cases, a moiety is configured to support a desired chemical reaction, for example, one or more processes in a polynucleotide acid synthesis reaction. The surface energy, or hydrophobicity, of a surface is a factor for determining the affinity of a nucleotide to attach onto the surface. In some instances, a method for substrate functionalization comprises: (a) providing a substrate having a surface that comprises silicon dioxide; and (b) silanizing the surface using, a suitable silanizing agent described herein or otherwise known in the art, for example, an organofunctional alkoxysilane molecule. Methods and functionalizing agents are described in U.S. Pat. No. 5,474,796, which is herein incorporated by reference in its entirety.

In some instances, a substrate surface is functionalized by contact with a derivatizing composition that contains a mixture of silanes, under reaction conditions effective to couple the silanes to the substrate surface, typically via reactive hydrophilic moieties present on the substrate surface. Silanization generally covers a surface through self-assembly with organofunctional alkoxysilane molecules. A variety of siloxane functionalizing reagents can further be used as currently known in the art, e.g., for lowering or increasing surface energy. The organofunctional alkoxysilanes are classified according to their organic functions.

Computer Systems

Any of the systems described herein, may be operably linked to a computer and may be automated through a computer either locally or remotely. In some instances, the methods and systems of the invention further comprise software programs on computer systems and use thereof. Accordingly, computerized control for the synchronization of the dispense/vacuum/refill functions such as orchestrating and synchronizing the material deposition device movement, dispense action and vacuum actuation are within the bounds of the invention. The computer systems may be programmed to interface between the user specified base sequence and the position of a material deposition device to deliver the correct reagents to specified regions of the substrate.

The computer system 1000 illustrated in FIG. 10 may be understood as a logical apparatus that can read instructions from media 1011 and/or a network port 1005, which can optionally be connected to server 1009 having fixed media 1012. The system, such as shown in FIG. 10 can include a CPU 1001, disk drives 1003, optional input devices such as keyboard 1015 and/or mouse 1016 and optional monitor 1007. Data communication can be achieved through the indicated communication medium to a server at a local or a remote location. The communication medium can include any means of transmitting and/or receiving data. For example, the communication medium can be a network connection, a wireless connection or an internet connection. Such a connection can provide for communication over the World Wide Web. It is envisioned that data relating to the present disclosure can be transmitted over such networks or connections for reception and/or review by a party 1022 as illustrated in FIG. 10.

FIG. 11 is a block diagram illustrating architecture of a computer system 1100 that can be used in connection with example embodiments of the present invention. As depicted in FIG. 11, the example computer system can include a processor 1102 for processing instructions. Non-limiting examples of processors include: Intel® Xeon® processor, AMD Opteron™ processor, Samsung 32-bit RISC ARM 1176JZ(F)-S v1.0 processor, ARM Cortex-A8 Samsung S5PC100 processor, ARM Cortex-A8 Apple A4 processor, Marvell PXA 930 processor, or a functionally-equivalent processor. Multiple threads of execution can be used for parallel processing. In some instances, multiple processors or processors with multiple cores can also be used, whether in a single computer system, in a cluster, or distributed across systems over a network comprising a plurality of computers, cell phones, and/or personal data assistant devices.

As illustrated in FIG. 11, a high speed cache 1104 can be connected to, or incorporated in, the processor 1102 to provide a high speed memory for instructions or data that have been recently, or are frequently, used by processor 1102. The processor 1102 is connected to a north bridge 1106 by a processor bus 1108. The north bridge 1106 is connected to random access memory (RAM) 1110 by a memory bus 1112 and manages access to the RAM 1110 by the processor 1102. The north bridge 1106 is also connected to a south bridge 1114 by a chipset bus 1116. The south bridge 1114 is, in turn, connected to a peripheral bus 1118. The peripheral bus can be, for example, PCI, PCI-X, PCI Express, or other peripheral bus. The north bridge and south bridge are often referred to as a processor chipset and manage data transfer between the processor, RAM, and peripheral components on the peripheral bus 1118. In some alternative architectures, the functionality of the north bridge can be incorporated into the processor instead of using a separate north bridge chip. In some instances, system 1100 can include an accelerator card 1122 attached to the peripheral bus 1118. The accelerator can include field programmable gate arrays (FPGAs) or other hardware for accelerating certain processing. For example, an accelerator can be used for adaptive data restructuring or to evaluate algebraic expressions used in extended set processing.

Software and data are stored in external storage 1124 and can be loaded into RAM 1110 and/or cache 1104 for use by the processor. The system 1100 includes an operating system for managing system resources; non-limiting examples of operating systems include: Linux, Windows™, MACOS™, BlackBerry OS™, iOS™, and other functionally-equivalent operating systems, as well as application software running on top of the operating system for managing data storage and optimization in accordance with example embodiments of the present invention. In this example, system 1100 also includes network interface cards (NICs) 1120 and 1121 connected to the peripheral bus for providing network interfaces to external storage, such as Network Attached Storage (NAS) and other computer systems that can be used for distributed parallel processing.

FIG. 12 is a block diagram of a multiprocessor computer system using a shared virtual address memory space in accordance with an example embodiment. The system includes a plurality of processors 1202a-f that can access a shared memory subsystem 1204. The system incorporates a plurality of programmable hardware memory algorithm processors (MAPs) 1206a-f in the memory subsystem 1204. Each MAP 1206a-f can comprise a memory 1208a-f and one or more field programmable gate arrays (FPGAs) 1210a-f. The MAP provides a configurable functional unit and particular algorithms or portions of algorithms can be provided to the FPGAs 1210a-f for processing in close coordination with a respective processor. For example, the MAPs can be used to evaluate algebraic expressions regarding the data model and to perform adaptive data restructuring in example embodiments. In this example, each MAP is globally accessible by all of the processors for these purposes. In one configuration, each MAP can use Direct Memory Access (DMA) to access an associated memory 1208a-f, allowing it to execute tasks independently of, and asynchronously from, the respective microprocessor 1202a-f. In this configuration, a MAP can feed results directly to another MAP for pipelining and parallel execution of algorithms.

FIG. 13 is a diagram showing a network with a plurality of computer systems 1302a and 1302b, a plurality of cell phones and personal data assistants 1302c, and Network Attached Storage (NAS) 1304a and 1304b. In example embodiments, systems 1302a, 1302b, and 1302c can manage data storage and optimize data access for data stored in Network Attached Storage (NAS) 1304a and 1304b. A mathematical model can be used for the data and be evaluated using distributed parallel processing across computer systems 1302a, and 1302b, and cell phone and personal data assistant systems 1302c. Computer systems 1302a, and 1302b, and cell phone and personal data assistant systems 1302c can also provide parallel processing for adaptive data restructuring of the data stored in Network Attached Storage (NAS) 1304a and 1304b. FIG. 13 illustrates an example only, and a wide variety of other computer architectures and systems can be used in conjunction with the various embodiments of the present invention. For example, a blade server can be used to provide parallel processing. Processor blades can be connected through a back plane to provide parallel processing. Storage can also be connected to the back plane or as Network Attached Storage (NAS) through a separate network interface. In some instances, processors can maintain separate memory spaces and transmit data through network interfaces, back plane or other connectors for parallel processing by other processors. In some instances, some or all of the processors can use a shared virtual address memory space.

Any of the systems described herein may comprise sequence information stored on non-transitory computer readable storage media. In some instances, any of the systems described herein comprise a computer input file. In some instances, the computer input file comprises sequence information. In some instances, the computer input file comprises instructions for synthesis of a plurality of polynucleotide sequence. In some instances, the instructions are received by a computer. In some instances, the instructions are processed by the computer. In some instances, the instructions are transmitted to a material deposition device. In some instances, the non-transitory computer readable storage media is encoded with a program including instructions executable by the operating system of an optionally networked digital processing device. In some instances, a computer readable storage medium is a tangible component of a digital processing device. In some instances, a computer readable storage medium is optionally removable from a digital processing device. In some instances, a computer readable storage medium includes, by way of non-limiting examples, CD-ROMs, DVDs, flash memory devices, solid state memory, magnetic disk drives, magnetic tape drives, optical disk drives, cloud computing systems and services, and the like. In some instances, the program and instructions are permanently, substantially permanently, semi-permanently, or non-transitorily encoded on the media.

EXAMPLES

The following examples are given for the purpose of illustrating various embodiments of the invention and are not meant to limit the present invention in any fashion. The present examples, along with the methods described herein are presently representative of preferred embodiments, are exemplary, and are not intended as limitations on the scope of the invention. Changes therein and other uses which are encompassed within the spirit of the invention as defined by the scope of the claims will occur to those skilled in the art.

Example 1: Functionalization of a Substrate Surface

A substrate was functionalized to support the attachment and synthesis of a library of polynucleotides. The substrate surface was first wet cleaned using a piranha solution comprising 90% H₂SO₄and 10% H₂O₂for 20 minutes. The substrate was rinsed in several beakers with deionized water, held under a deionized water gooseneck faucet for 5 min, and dried with N2. The substrate was subsequently soaked in NH₄OH (1:100; 3 mL:300 mL) for 5 min, rinsed with DI water using a handgun, soaked in three successive beakers with deionized water for 1 min each, and then rinsed again with deionized water using the handgun. The substrate was then plasma cleaned by exposing the substrate surface to O₂. A SAMCO PC-300 instrument was used to plasma etch O₂at 250 watts for 1 min in downstream mode.

The cleaned substrate surface was actively functionalized with a solution comprising N-(3-triethoxysilylpropyl)-4-hydroxybutyramide using a YES-1224P vapor deposition oven system with the following parameters: 0.5 to 1 torr, 60 min, 70° C., 135° C. vaporizer. The substrate surface was resist coated using a Brewer Science 200X spin coater. SPR™ 3612 photoresist was spin coated on the substrate at 2500 rpm for 40 sec. The substrate was pre-baked for 30 min at 90° C. on a Brewer hot plate. The substrate was subjected to photolithography using a Karl Suss MA6 mask aligner instrument. The substrate was exposed for 2.2 sec and developed for 1 min in MSF 26A. Remaining developer was rinsed with the handgun and the substrate soaked in water for 5 min. The substrate was baked for 30 min at 100° C. in the oven, followed by visual inspection for lithography defects using a Nikon L200. A cleaning process was used to remove residual resist using the SAMCO PC-300 instrument to O₂plasma etch at 250 watts for 1 min.

The substrate surface was passively functionalized with a 100 μL solution of perfluorooctyltrichlorosilane mixed with 10 μL light mineral oil. The substrate was placed in a chamber, pumped for 10 min, and then the valve was closed to the pump and left to stand for 10 min. The chamber was vented to air. The substrate was resist stripped by performing two soaks for 5 min in 500 mL NMP at 70° C. with ultrasonication at maximum power (9 on Crest system). The substrate was then soaked for 5 min in 500 mL isopropanol at room temperature with ultrasonication at maximum power. The substrate was dipped in 300 mL of 200 proof ethanol and blown dry with N2. The functionalized surface was activated to serve as a support for polynucleotide synthesis.

Example 2: Synthesis of a 50-Mer Sequence on an Oligonucleotide Synthesis Device

A two dimensional oligonucleotide synthesis device was assembled into a flowcell, which was connected to a flowcell (Applied Biosystems (“ABI394 DNA Synthesizer”)). The two-dimensional oligonucleotide synthesis device was uniformly functionalized with N-(3-TRIETHOXYSILYLPROPYL)-4-HYDROXYBUTYRAMIDE (Gelest) was used to synthesize an exemplary polynucleotide of 50 bp (“50-mer polynucleotide”) using polynucleotide synthesis methods described herein.

The sequence of the 50-mer was as described in SEQ ID NO.: 1. 5′AGACAATCAACCATTTGGGGTGGACAGCCTTGACCTCTAGACTTCGGCAT##TTTTTTT TTT3′ (SEQ ID NO.: 1), where # denotes Thymidine-succinyl hexamide CED phosphoramidite (CLP-2244 from ChemGenes), which is a cleavable linker enabling the release of polynucleotides from the surface during deprotection.

The synthesis was done using standard DNA synthesis chemistry (coupling, capping, oxidation, and deblocking) according to the protocol in Table 1 and ABI394 DNA Synthesizer.

TABLE 1

Synthesis Protocol

General DNA Synthesis
Table 1

Process Name
Process Step
Time (sec)

WASH (Acetonitrile Wash
Acetonitrile System Flush
4

Flow)
Acetonitrile to Flowcell
23

N2 System Flush
4

Acetonitrile System Flush
4

DNA BASE ADDITION
Activator Manifold Flush
2

(Phosphoramidite +
Activator to Flowcell
6

Activator Flow)
Activator +
6

Phosphoramidite to

Flowcell

Activator to Flowcell
0.5

Activator +
5

Phosphoramidite to

Flowcell

Activator to Flowcell
0.5

Activator +
5

Phosphoramidite to

Flowcell

Activator to Flowcell
0.5

Activator +
5

Phosphoramidite to

Flowcell

Incubate for 25 sec
25

WASH (Acetonitrile Wash
Acetonitrile System Flush
4

Flow)
Acetonitrile to Flowcell
15

N2 System Flush
4

Acetonitrile System Flush
4

DNA BASE ADDITION
Activator Manifold Flush
2

(Phosphoramidite +
Activator to Flowcell
5

Activator Flow)
Activator +
18

Phosphoramidite to

Flowcell

Incubate for 25 sec
25

WASH (Acetonitrile Wash
Acetonitrile System Flush
4

Flow)
Acetonitrile to Flowcell
15

N2 System Flush
4

Acetonitrile System Flush
4

CAPPING (CapA + B, 1:1,
CapA + B to Flowcell
15

Flow)

WASH (Acetonitrile Wash
Acetonitrile System Flush
4

Flow)
Acetonitrile to Flowcell
15

Acetonitrile System Flush
4

OXIDATION (Oxidizer
Oxidizer to Flowcell
18

Flow)

WASH (Acetonitrile Wash
Acetonitrile System Flush
4

Flow)
N2 System Flush
4

Acetonitrile System Flush
4

Acetonitrile to Flowcell
15

Acetonitrile System Flush
4

Acetonitrile to Flowcell
15

N2 System Flush
4

Acetonitrile System Flush
4

Acetonitrile to Flowcell
23

N2 System Flush
4

Acetonitrile System Flush
4

DEBLOCKING (Deblock
Deblock to Flowcell
36

Flow)

WASH (Acetonitrile Wash
Acetonitrile System Flush
4

Flow)
N2 System Flush
4

Acetonitrile System Flush
4

Acetonitrile to Flowcell
18

N2 System Flush
4.13

Acetonitrile System Flush
4.13

Acetonitrile to Flowcell
15

The phosphoramidite/activator combination was delivered similar to the delivery of bulk reagents through the flowcell. No drying steps were performed as the environment stays “wet” with reagent the entire time.

The flow restrictor was removed from the ABI394 DNA Synthesizer to enable faster flow. Without flow restrictor, flow rates for amidites (0.1M in ACN), Activator, (0.25M Benzoylthiotetrazole (“BTT”; 30-3070-xx from GlenResearch) in ACN), and Ox (0.02M 12 in 20% pyridine, 10% water, and 70% THF) were roughly ˜100 uL/sec, for acetonitrile (“ACN”) and capping reagents (1:1 mix of CapA and CapB, wherein CapA is acetic anhydride in THF/Pyridine and CapB is 16% 1-methylimidizole in THF), roughly ˜200 uL/sec, and for Deblock (3% dichloroacetic acid in toluene), roughly 300 uL/sec (compared to 50 uL/sec for all reagents with flow restrictor). The time to completely push out Oxidizer was observed, the timing for chemical flow times was adjusted accordingly and an extra ACN wash was introduced between different chemicals. After polynucleotide synthesis, the chip was deprotected in gaseous ammonia overnight at 75 psi. Five drops of water were applied to the surface to recover polynucleotides. The recovered polynucleotides were then analyzed on a BioAnalyzer small RNA chip (data not shown).

Example 3: Synthesis of a 100-Mer Sequence on an Oligonucleotide Synthesis Device

The same process as described in Example 2 for the synthesis of the 50-mer sequence was used for the synthesis of a 100-mer polynucleotide (“100-mer polynucleotide”; 5′ CGGGATCCTTATCGTCATCGTCGTACAGATCCCGACCCATTTGCTGTCCACCAGTCATG CTAGCCATACCATGATGATGATGATGATGAGAACCCCGCAT##TTTTTTTTTT3′, where # denotes Thymidine-succinyl hexamide CED phosphoramidite (CLP-2244 from ChemGenes); SEQ ID NO.: 2) on two different silicon chips, the first one uniformly functionalized with N-(3-TRIETHOXYSILYLPROPYL)-4-HYDROXYBUTYRAMIDE and the second one functionalized with 5/95 mix of 11-acetoxyundecyltriethoxysilane and n-decyltriethoxysilane, and the polynucleotides extracted from the surface were analyzed on a BioAnalyzer instrument (data not shown).

All ten samples from the two chips were further PCR amplified using a forward (5′ATGCGGGGTTCTCATCATC3′; SEQ ID NO.: 3) and a reverse (5′CGGGATCCTTATCGTCATCG3′; SEQ ID NO.: 4) primer in a 50 uL PCR mix (25 uL NEB Q5 mastermix, 2.5 uL 10 uM Forward primer, 2.5 uL 10 uM Reverse primer, 1 uL polynucleotide extracted from the surface, and water up to 50 uL) using the following thermalcycling program:

98° C., 30 sec

98° C., 10 sec; 63° C., 10 sec; 72° C., 10 sec; repeat 12 cycles

72° C., 2 min

The PCR products were also run on a BioAnalyzer (data not shown), demonstrating sharp peaks at the 100-mer position. Next, the PCR amplified samples were cloned, and Sanger sequenced. Table 2 summarizes the results from the Sanger sequencing for samples taken from spots 1-5 from chip 1 and for samples taken from spots 6-10 from chip 2.

TABLE 2

Sequencing Results

Spot

Error rate
Cycle efficiency

1
1/763
bp
99.87%

2
1/824
bp
99.88%

3
1/780
bp
99.87%

4
1/429
bp
99.77%

5
1/1525
bp
99.93%

6
1/1615
bp
99.94%

7
1/531
bp
99.81%

8
1/1769
bp
99.94%

9
1/854
bp
99.88%

10
1/1451
bp
99.93%

Thus, the high quality and uniformity of the synthesized polynucleotides were repeated on two chips with different surface chemistries. Overall, 89%, corresponding to 233 out of 262 of the 100-mers that were sequenced were perfect sequences with no errors.

Finally, Table 3 summarizes key error characteristics for the sequences obtained from the polynucleotides samples from spots 1-10.

TABLE 3

Error Characteristics

Sample ID/Spot no.

OSA_0046/1
OSA_0047/2
OSA_ 0048/3
OSA_0049/4
OSA_0050/5

Total Sequences
32
32
32
32
32

Sequencing
25 of 28
27 of 27
26 of 30
21 of 23
25 of 26

Quality

Oligo Quality
23 of 25
25 of 27
22 of 26
18 of 21
24 of 25

ROI Match
2500
2698
2561
2122
2499

Count

ROI Mutation
2
2
1
3
1

ROI Multi Base
0
0
0
0
0

Deletion

ROI Small
1
0
0
0
0

Insertion

ROI Single Base
0
0
0
0
0

Deletion

Large Deletion
0
0
1
0
0

Count

Mutation: G > A
2
2
1
2
1

Mutation: T > C
0
0
0
1
0

ROI Error Count
3
2
2
3
1

ROI Error Rate
Err: ~1
Err: ~1
Err: ~1
Err: ~1
Err: ~1

in 834
in 1350
in 1282
in 708
in 2500

ROI Minus
MP Err: ~1
MP Err: ~1
MP Err: ~1
MP Err: ~1
MP Err: ~1

Primer Error
in 763
in 824
in 780
in 429
in 1525

Rate

Sample ID/Spot no.

OSA_0051/6
OSA_0052/7
OSA_0053/8
OSA_0054/9
OSA_0055/10

Total Sequences
32
32
32
32
32

Sequencing
29 of 30
27 of 31
29 of 31
28 of 29
25 of 28

Quality

Oligo Quality
25 of 29
22 of 27
28 of 29
26 of 28
20 of 25

ROI Match
2666
2625
2899
2798
2348

Count

ROI Mutation
0
2
1
2
1

ROI Multi Base
0
0
0
0
0

Deletion

ROI Small
0
0
0
0
0

Insertion

ROI Single Base
0
0
0
0
0

Deletion

Large Deletion
1
1
0
0
0

Count

Mutation: G > A
0
2
1
2
1

Mutation: T > C
0
0
0
0
0

ROI Error Count
1
3
1
2
1

ROI Error Rate
Err: ~1
Err: ~1
Err: ~1
Err: ~1
Err: ~1

in 2667
in 876
in 2900
in 1400
in 2349

ROI Minus
MP Err: ~1
MP Err: ~1
MP Err: ~1
MP Err: ~1
MP Err: ~1

Primer Error
in 1615
in 531
in 1769
in 854
in 1451

Rate

Example 4. Overlap Extension PCR without Primer Removal

Two genes (Gene 1 and Gene 2) were selected to perform overlap extension PCR without primer removal. Varying lengths of base pair overlap were tested for Gene 1 and Gene 2, including 20, 41, and 100 base pairs. PCR amplification was performed using universal primers. Referring to FIG. 14, incorrect assembly (white) and correct assembly (black) were determined for Gene 1 and Gene 2 amplified with universal primers and having a base pair overlap of 20, 41, and 100 base pairs. Assembly of Gene 1 and Gene 2 without amplification by universal primers with a 20 base pair overlap was also determined. As seen in FIG. 14, universal primers having a base pair overlap of 41 base pairs resulted in improved assembly for Gene 1 and Gene 2. For Gene 1, assembly was about 91%.

Example 5. Single-Stranded DNA Mediated Hierarchal Assembly of Two Gene Fragments

A gene was assembled into a 3 kb gene from two gene fragments. The 5′ and 3′ of each fragment end was appended with uracils and amplified using a uracil compatible polymerase such as KapaU polymerase or PhusionU polymerase. Each of the two fragments further comprised a homology sequence. See FIG. 1. The two fragments were then mixed and amplified with universal primers and Q5 DNA polymerase. Q5 DNA polymerase is incompatible with uracil and resulted in stalling at a uracil base. Single stranded fragments that do not comprise uracil were thus generated. The two fragments were then combined and amplified to generate the 3 kb gene.

Example 6. Single-Stranded DNA Mediated Hierarchal Assembly of Three Gene Fragments

A gene was assembled into a 3 kb gene from three gene fragments. The 5′ and 3′ of each fragment end was appended with flanking adapter sequences comprising uracils and amplified using a uracil compatible polymerase such as KapaU polymerase or PhusionU polymerase. Each of the three fragments comprised a homology sequence. See FIG. 2. The three fragments were mixed and amplified with Q5 DNA polymerase. Q5 DNA polymerase is incompatible with uracil and resulted in stalling at a uracil base. Single stranded fragments that do not comprise uracil were thus generated. Two of the three fragments were then combined and amplified to generate a single fragment. The third fragment was combined with the synthesized fragment and amplified to generate the 3 kb gene.

Example 7. Single-Stranded DNA Mediated Hierarchal Assembly with Varying Base Pair Overlap Sequence Length

Two genes (Gene 1 and Gene 2) were assembled similar to Examples 5-6. The 5′ and 3′ of each fragment end was appended with flanking adapter sequences comprising uracils and amplified using a uracil compatible polymerase such as KapaU polymerase or PhusionU polymerase. Each of the two fragments comprised a homology sequence. The length of the homology sequence was 20, 41, or 100 base pairs. The two fragments were mixed and amplified with universal primers and Q5 DNA polymerase or KapaHiFi polymerase. Q5 DNA polymerase and KapaHiFi polymerase are incompatible with uracil and resulted in stalling at a uracil base. Single stranded fragments that do not comprise uracil were thus generated. The two fragments are combined and amplified to generate Gene 1 and Gene 2.

Incorrect assembly (white) and correct assembly (black) were determined for Gene 1 and Gene 2 amplified with Q5 DNA polymerase and KapaHiFi polymerase and having a base pair overlap of 20, 41, and 100 base pair (FIG. 15). The 20, 41, and 100 base pair overlap resulted in over 70% correct assembly with both Q5 DNA polymerase and KapaHiFi polymerase (FIG. 15). The 41 base pair overlap resulted in further improved assembly at 100% of correct assembly with both Q5 DNA polymerase and KapaHiFi polymerase (FIG. 15).

Example 8. In Vitro Recombination Cloning

In Vitro Recombination (IVTR) Lysate Preparation

JM109 cell lysate was prepared. JM109 was streaked on a M9 agar plate and incubated at 37° C. for about 24 hours. Colonies were picked and incubated in 15 mL tubes comprising 3 mL of M9 broth for a seed culture. The tubes were shaken at 250 rpm at 37° C. for about 19 hours. When OD600 was between about 2-3, 0.016 mL of the seed culture was removed and added to flasks comprising 100 mL of TB broth. The flasks were shaken at 300 rpm at 37° C. for about 4.5 hours. The cells were spun down at 4,816×g for 10 minutes and washed with 100 mL of ice-cold water. The cells were lysed with 2.4 mL CelLytic B Cell Lysis Reagent (Sigma-Aldrich) for 10 minutes at room-temperature and centrifuged at 18,615×g for 5 minutes to collect the supernatant (about 2 mL). The supernatant was mixed with 2 mL of ice cold 80% glycerol and snap frozen in a dry ice-ethanol bath followed by storage at −80° C.

IVTR Cloning

A gene fragment comprised from 5′ to 3′: a 5′ flanking adapter sequence, a first homology sequence, an insert sequence, a second homology sequence, and a 3′ flanking adapter sequence. The gene fragment and a vector comprising homologous sequences to the first homology sequence and the second homology sequence were incubated with JM109 cell lysate. See FIG. 4. A reaction was set up similar to Table 4. Varying amounts of insert were tested: 13 fmol (white bars), 26 fmol (hashed bars), and 40 fmol (black bars) (FIG. 16). The ratio of insert:vector (X-axis) was also varied including ratios of 1:1, 2:1, and 4:1.

Tens of thousands colonies were retrieved. Colony forming unit (CFU, Y-axis) was then determined as a measure of efficiency. More than 99% correct assembly of any selected condition (1 misassembly out of 437 valid clones) was observed (FIG. 16). Referring to FIG. 17, colony PCR results of 48 colonies showed only 4 samples failed, which were background plasmids.

TABLE 4

Reaction Conditions

Final

Concentration

10X IVTR buffer
1X

JM109

VS208 ASP
4 nM

Fragment 1
4 nM

Fragment 2
4 nM

Example 9. In Vitro Recombination Cloning with Two Fragments

A first gene fragment comprised from 5′ to 3′: a 5′ flanking adapter sequence, a first homology sequence, an insert sequence, a second homology sequence, and a 3′ flanking adapter sequence. A second gene fragment comprised from 5′ to 3′: a 5′ flanking adapter sequence, a first homology sequence, an insert sequence, a second homology sequence, and a 3′ flanking adapter sequence. The first homology sequence of the first gene fragment was homologous to a sequence on the vector. See FIG. 4. The first gene fragment, second gene fragment, and vector were incubated with JM109 cell lysate.

The effects of the length of the homology sequence (20, 41, or 100 base pairs) and location of the homology sequence on colony forming unit (CFU, Y-axis) were determined (FIG. 18). Data is summarized in Table 5. The homology sequence was either flanked by the universal primers (internal) or at the 5′ or 3′ end of the gene fragment (terminal). There was increased CFUs with a homology sequence of 41 base pairs. A terminal location of the homology sequence of 41 base pairs resulted in a greater number of CFUs as compared to an internal location. A terminal location of the homology sequence of 100 base pairs also resulted in a greater number of CFUs as compared to an internal location.

Referring to FIG. 19, the percentage of misassembly (white bars) and assembly (black bars) was determined. A terminal location and homology sequence length of 20, 41, and 100 base pairs resulted in 100% assembly. An internal location and homology sequence length of 20 and 41 base pairs also resulted in 100% assembly.

TABLE 5

Colony Forming Unit Results

Homology Sequence Length

(number of base pairs)
Terminal or Internal
CFU

20
Terminal
190

20
Internal
200

41
Terminal
1280

41
Internal
720

100
Terminal
1030

100
Internal
190

Example 10. In Vitro Recombination Cloning with Varying Lengths of Non-Homologous Sequences

The effect of varying lengths of the non-homologous sequence was determined. Four fragments were designed: V1, V2, V3, and V4 (FIG. 5). V1 comprised an overlapping sequence at the terminal end. V2 comprised an internal overlapping sequence followed by at a 24 base pair sequence at the 3′ end. V3 comprised an overlapping sequence followed by a 124 base pair sequence at the end 3′ end. V4 comprised an overlapping sequence followed by a 324 base pair at the 3′ end.

Percentage of assembly (FIG. 20A) and total CFU (FIG. 20B) were determined for sequences comprising 0 (V1), 24 (V2), 124 (V3), and 324 (V4) base pairs at the 3′ end. Referring to FIG. 20A, 100% correct assembly was observed for sequences comprising 0, 24, 124, and 324 base pairs at the 3′ end. Referring to FIG. 20B, sequences comprising 0 and 24 base pairs at the 3′ end resulted in increased CFUs.

Example 11. In Vitro Recombination Cloning with Varying Internal Homology

The effect of internal homology was determined. Three fragments were designed: V5, V6, and V7 (FIG. 6A). V5 comprised a 24 base pair sequence between two overlapping sequences. V6 comprised a 124 base pair sequence between two overlapping sequences. V7 comprised a 324 base pair sequence between two overlapping sequences.

Percentage of assembly (FIG. 21A) and Total CFU (FIG. 21B) were determined for internal sequences comprising 24 (V5), 124 (V6), and 324 (V7) base pairs. Referring to FIG. 21A, more than 80% correct assembly was observed for internal sequences comprising 124 and 324 base pairs. Referring to FIG. 21B, internal sequences comprising 124 and 324 base pairs also resulted in increased CFUs.

Example 12. Single-stranded DNA Mediated Hierarchal Assembly of Multiple Gene Fragments

A gene is assembled into a 3 kb gene from five gene fragments. The 5′ and 3′ of each fragment end is appended with flanking adapter sequences comprising uracils. Each of the five fragments comprises a homology sequence. The five fragments are mixed and amplified with universal primers and Q5 DNA polymerase. Following amplification using DNA polymerase, single stranded fragments that do not comprise uracil are generated. Two of the five fragments are combined and amplified with DNA polymerase to generate a single fragment. A third fragment is combined with the synthesized fragment and amplified to generate a single fragment. A fourth fragment is combined with the synthesized fragment and amplified to generate a single fragment. A fifth fragment is combined with the synthesized fragment and amplified to generate the assembled 3 kb gene.

While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.

Claims

1. A method for nucleic acid synthesis and assembly, comprising: a. providing predetermined sequences for a first double stranded nucleic acid and a second double stranded nucleic acid, wherein the first double stranded nucleic acid comprises in 5′ to 3′ order: a 5′ flanking adapter sequence, an insert sequence, a homology sequence, and a 3′ flanking adapter sequence, and wherein the second double stranded nucleic acid comprises in 5′ to 3′ order: a 5′ flanking adapter sequence, an insert sequence, a homology sequence, and a 3′ flanking adapter sequence;b. synthesizing a plurality of double stranded nucleic acids encoding for the predetermined sequences;c. annealing a universal primer comprising uracil at a terminal end of the first double stranded nucleic acid and the second double stranded nucleic acid;d. amplifying the first double stranded nucleic acid and the second double stranded nucleic acid using a uracil incompatible polymerase to form amplification products;e. mixing the amplification products to form a mixture; andf. amplifying the mixture;thereby forming an assembled nucleic acid.
2. The method of claim 1, wherein the uracil incompatible polymerase is a DNA polymerase.
3. The method of claim 1, wherein the homology sequence comprises about 20 to about 100 base pairs.
4. The method of claim 1, wherein the homology sequence comprises about 20, about 41, or about 100 base pairs.
5. The method of claim 1, wherein a percentage of correct assembly is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%.

CROSS-REFERENCE

This application is a continuation of PCT/US2018/37152 filed Jun. 12, 2018, which claims the benefit of U.S. Provisional Patent Application No. 62/518,489 filed on Jun. 12, 2017, which are incorporated herein by reference in their entirety.

US Referenced Citations (1007)

Number	Name	Date	Kind
3549368	Robert et al.	Dec 1970	A
3920714	Streck	Nov 1975	A
4123661	Wolf et al.	Oct 1978	A
4415732	Caruthers et al.	Nov 1983	A
4613398	Chiong et al.	Sep 1986	A
4726877	Fryd et al.	Feb 1988	A
4808511	Holmes	Feb 1989	A
4837401	Hirose et al.	Jun 1989	A
4863557	Kokaku et al.	Sep 1989	A
4981797	Jessee et al.	Jan 1991	A
4988617	Landegren et al.	Jan 1991	A
5102797	Tucker et al.	Apr 1992	A
5118605	Urdea	Jun 1992	A
5137814	Rashtchian et al.	Aug 1992	A
5143854	Pirrung et al.	Sep 1992	A
5242794	Whiteley et al.	Sep 1993	A
5242974	Holmes	Sep 1993	A
5288514	Ellman	Feb 1994	A
5299491	Kawada	Apr 1994	A
5368823	McGraw et al.	Nov 1994	A
5384261	Winkler et al.	Jan 1995	A
5387541	Hodge et al.	Feb 1995	A
5395753	Prakash	Mar 1995	A
5431720	Nagai et al.	Jul 1995	A
5445934	Fodor et al.	Aug 1995	A
5449754	Nishioka	Sep 1995	A
5459039	Modrich et al.	Oct 1995	A
5474796	Brennan	Dec 1995	A
5476930	Letsinger et al.	Dec 1995	A
5487993	Herrnstadt et al.	Jan 1996	A
5494810	Barany et al.	Feb 1996	A
5501893	Laermer et al.	Mar 1996	A
5508169	Deugau et al.	Apr 1996	A
5510270	Fodor et al.	Apr 1996	A
5514789	Kempe	May 1996	A
5527681	Holmes	Jun 1996	A
5530516	Sheets	Jun 1996	A
5556750	Modrich et al.	Sep 1996	A
5586211	Dumitrou et al.	Dec 1996	A
5641658	Adams et al.	Jun 1997	A
5677195	Winkler et al.	Oct 1997	A
5679522	Modrich et al.	Oct 1997	A
5683879	Laney et al.	Nov 1997	A
5688642	Chrisey et al.	Nov 1997	A
5700637	Southern	Dec 1997	A
5700642	Monforte et al.	Dec 1997	A
5702894	Modrich et al.	Dec 1997	A
5707806	Shuber	Jan 1998	A
5712124	Walker	Jan 1998	A
5712126	Weissman et al.	Jan 1998	A
5739386	Holmes	Apr 1998	A
5750672	Kempe	May 1998	A
5780613	Letsinger et al.	Jul 1998	A
5830643	Yamamoto et al.	Nov 1998	A
5830655	Monforte et al.	Nov 1998	A
5830662	Soares et al.	Nov 1998	A
5834252	Stemmer et al.	Nov 1998	A
5843669	Kaiser et al.	Dec 1998	A
5843767	Beattie	Dec 1998	A
5846717	Brow et al.	Dec 1998	A
5854033	Lizardi	Dec 1998	A
5858754	Modrich et al.	Jan 1999	A
5861482	Modrich et al.	Jan 1999	A
5863801	Southgate et al.	Jan 1999	A
5869245	Yeung	Feb 1999	A
5877280	Wetmur	Mar 1999	A
5882496	Northrup et al.	Mar 1999	A
5922539	Modrich et al.	Jul 1999	A
5922593	Livingston	Jul 1999	A
5928907	Woudenberg et al.	Jul 1999	A
5962272	Chenchik et al.	Oct 1999	A
5976842	Wurst	Nov 1999	A
5976846	Passmore et al.	Nov 1999	A
5989872	Luo et al.	Nov 1999	A
5994069	Hall et al.	Nov 1999	A
6001567	Brow et al.	Dec 1999	A
6008031	Modrich et al.	Dec 1999	A
6013440	Lipshutz et al.	Jan 2000	A
6015674	Woudenberg et al.	Jan 2000	A
6017434	Simpson et al.	Jan 2000	A
6020481	Benson et al.	Feb 2000	A
6027898	Gjerde et al.	Feb 2000	A
6028189	Blanchard	Feb 2000	A
6028198	Liu et al.	Feb 2000	A
6040138	Lockhart et al.	Mar 2000	A
6077674	Schleifer et al.	Jun 2000	A
6087482	Teng et al.	Jul 2000	A
6090543	Prudent et al.	Jul 2000	A
6090606	Kaiser et al.	Jul 2000	A
6103474	Dellinger et al.	Aug 2000	A
6107038	Choudhary et al.	Aug 2000	A
6110682	Dellinger et al.	Aug 2000	A
6114115	Wagner, Jr.	Sep 2000	A
6130045	Wurst et al.	Oct 2000	A
6132997	Shannon	Oct 2000	A
6136568	Hiatt et al.	Oct 2000	A
6171797	Perbost	Jan 2001	B1
6180351	Cattell	Jan 2001	B1
6201112	Ach	Mar 2001	B1
6218118	Sampson et al.	Apr 2001	B1
6221653	Caren et al.	Apr 2001	B1
6222030	Dellinger et al.	Apr 2001	B1
6232072	Fisher	May 2001	B1
6235483	Wolber et al.	May 2001	B1
6242266	Schleifer et al.	Jun 2001	B1
6251588	Shannon et al.	Jun 2001	B1
6251595	Gordon et al.	Jun 2001	B1
6251685	Dorsel et al.	Jun 2001	B1
6258454	Lefkowitz et al.	Jul 2001	B1
6262490	Hsu et al.	Jul 2001	B1
6274725	Sanghvi et al.	Aug 2001	B1
6284465	Wolber	Sep 2001	B1
6287776	Hefti	Sep 2001	B1
6287824	Lizardi	Sep 2001	B1
6297017	Schmidt et al.	Oct 2001	B1
6300137	Earhart et al.	Oct 2001	B1
6306599	Perbost	Oct 2001	B1
6309822	Fodor et al.	Oct 2001	B1
6309828	Schleifer et al.	Oct 2001	B1
6312911	Bancroft et al.	Nov 2001	B1
6319674	Fulcrand et al.	Nov 2001	B1
6323043	Caren et al.	Nov 2001	B1
6329210	Schleifer	Dec 2001	B1
6346423	Schembri	Feb 2002	B1
6365355	McCutchen-Maloney	Apr 2002	B1
6372483	Schleifer et al.	Apr 2002	B2
6375903	Cerrina et al.	Apr 2002	B1
6376285	Joyner et al.	Apr 2002	B1
6384210	Blanchard	May 2002	B1
6387636	Perbost et al.	May 2002	B1
6399394	Dahm et al.	Jun 2002	B1
6399516	Ayon	Jun 2002	B1
6403314	Lange et al.	Jun 2002	B1
6406849	Dorsel et al.	Jun 2002	B1
6406851	Bass	Jun 2002	B1
6408308	Maslyn et al.	Jun 2002	B1
6419883	Blanchard	Jul 2002	B1
6428957	Delenstarr	Aug 2002	B1
6440669	Bass et al.	Aug 2002	B1
6444268	Lefkowitz et al.	Sep 2002	B2
6446642	Caren et al.	Sep 2002	B1
6446682	Viken	Sep 2002	B1
6451998	Perbost	Sep 2002	B1
6458526	Schembri et al.	Oct 2002	B1
6458535	Hall et al.	Oct 2002	B1
6458583	Bruhn et al.	Oct 2002	B1
6461812	Barth et al.	Oct 2002	B2
6461816	Wolber et al.	Oct 2002	B1
6469156	Schafer et al.	Oct 2002	B1
6472147	Janda et al.	Oct 2002	B1
6492107	Kauffman et al.	Dec 2002	B1
6518056	Schembri et al.	Feb 2003	B2
6521427	Evans	Feb 2003	B1
6521453	Crameri et al.	Feb 2003	B1
6555357	Kaiser et al.	Apr 2003	B1
6558908	Wolber et al.	May 2003	B2
6562611	Kaiser et al.	May 2003	B1
6566495	Fodor et al.	May 2003	B1
6582908	Fodor et al.	Jun 2003	B2
6582938	Su et al.	Jun 2003	B1
6586211	Staehler et al.	Jul 2003	B1
6587579	Bass	Jul 2003	B1
6589739	Fisher	Jul 2003	B2
6599693	Webb	Jul 2003	B1
6602472	Zimmermann et al.	Aug 2003	B1
6610978	Yin et al.	Aug 2003	B2
6613513	Parce et al.	Sep 2003	B1
6613523	Fischer	Sep 2003	B2
6613560	Tso et al.	Sep 2003	B1
6613893	Webb	Sep 2003	B1
6621076	Van de Goor et al.	Sep 2003	B1
6630581	Dellinger et al.	Oct 2003	B2
6632641	Brennan et al.	Oct 2003	B1
6635226	Tso et al.	Oct 2003	B1
6642373	Manoharan et al.	Nov 2003	B2
6649348	Bass et al.	Nov 2003	B2
6660338	Hargreaves	Dec 2003	B1
6664112	Mulligan et al.	Dec 2003	B2
6670127	Evans	Dec 2003	B2
6670461	Wengel et al.	Dec 2003	B1
6673552	Frey	Jan 2004	B2
6682702	Barth et al.	Jan 2004	B2
6689319	Fisher et al.	Feb 2004	B1
6692917	Neri et al.	Feb 2004	B2
6702256	Killeen et al.	Mar 2004	B2
6706471	Brow et al.	Mar 2004	B1
6706875	Goldberg et al.	Mar 2004	B1
6709841	Short	Mar 2004	B2
6709852	Bloom et al.	Mar 2004	B1
6709854	Donahue et al.	Mar 2004	B2
6713262	Gillibolian et al.	Mar 2004	B2
6716629	Hess et al.	Apr 2004	B2
6716634	Myerson	Apr 2004	B1
6723509	Ach	Apr 2004	B2
6728129	Lindsey et al.	Apr 2004	B2
6743585	Dellinger et al.	Jun 2004	B2
6753145	Holcomb et al.	Jun 2004	B2
6768005	Mellor et al.	Jul 2004	B2
6770748	Imanishi et al.	Aug 2004	B2
6770892	Corson et al.	Aug 2004	B2
6773676	Schembri	Aug 2004	B2
6773888	Li et al.	Aug 2004	B2
6780982	Lyamichev et al.	Aug 2004	B2
6787308	Balasubramanian et al.	Sep 2004	B2
6789965	Barth et al.	Sep 2004	B2
6790620	Bass et al.	Sep 2004	B2
6794499	Wengel et al.	Sep 2004	B2
6796634	Caren et al.	Sep 2004	B2
6800439	McGall et al.	Oct 2004	B1
6814846	Berndt	Nov 2004	B1
6815218	Jacobson et al.	Nov 2004	B1
6824866	Glazer et al.	Nov 2004	B1
6830890	Lockhart et al.	Dec 2004	B2
6833246	Balasubramanian	Dec 2004	B2
6833450	McGall et al.	Dec 2004	B1
6835938	Ghosh et al.	Dec 2004	B2
6838888	Peck	Jan 2005	B2
6841131	Zimmermann et al.	Jan 2005	B2
6845968	Killeen et al.	Jan 2005	B2
6846454	Peck	Jan 2005	B2
6846922	Manoharan et al.	Jan 2005	B1
6852850	Myerson et al.	Feb 2005	B2
6858720	Myerson et al.	Feb 2005	B2
6879915	Cattell	Apr 2005	B2
6880576	Karp et al.	Apr 2005	B2
6884580	Caren et al.	Apr 2005	B2
6887715	Schembri	May 2005	B2
6890723	Perbost et al.	May 2005	B2
6890760	Webb	May 2005	B1
6893816	Beattie	May 2005	B1
6897023	Fu et al.	May 2005	B2
6900047	Bass	May 2005	B2
6900048	Perbost	May 2005	B2
6911611	Wong et al.	Jun 2005	B2
6914229	Corson et al.	Jul 2005	B2
6916113	Van de Goor et al.	Jul 2005	B2
6916633	Shannon	Jul 2005	B1
6919181	Hargreaves	Jul 2005	B2
6927029	Lefkowitz et al.	Aug 2005	B2
6929951	Corson et al.	Aug 2005	B2
6936472	Earhart et al.	Aug 2005	B2
6938476	Chesk	Sep 2005	B2
6939673	Bass et al.	Sep 2005	B2
6943036	Bass	Sep 2005	B2
6946285	Bass	Sep 2005	B2
6950756	Kincaid	Sep 2005	B2
6951719	Dupret et al.	Oct 2005	B1
6958119	Yin et al.	Oct 2005	B2
6960464	Jessee et al.	Nov 2005	B2
6969449	Maher et al.	Nov 2005	B2
6969488	Bridgham et al.	Nov 2005	B2
6976384	Hobbs et al.	Dec 2005	B2
6977223	George et al.	Dec 2005	B2
6987263	Hobbs et al.	Jan 2006	B2
6989267	Kim et al.	Jan 2006	B2
6991922	Dupret et al.	Jan 2006	B2
7008037	Caren et al.	Mar 2006	B2
7025324	Slocum et al.	Apr 2006	B1
7026124	Barth et al.	Apr 2006	B2
7027930	Cattell	Apr 2006	B2
7028536	Karp et al.	Apr 2006	B2
7029854	Collins et al.	Apr 2006	B2
7034290	Lu et al.	Apr 2006	B2
7041445	Chenchik et al.	May 2006	B2
7045289	Allawi et al.	May 2006	B2
7051574	Peck	May 2006	B2
7052841	Delenstarr	May 2006	B2
7062385	White et al.	Jun 2006	B2
7064197	Rabbani et al.	Jun 2006	B1
7070932	Leproust et al.	Jul 2006	B2
7075161	Barth	Jul 2006	B2
7078167	Delenstarr et al.	Jul 2006	B2
7078505	Bass et al.	Jul 2006	B2
7094537	Leproust et al.	Aug 2006	B2
7097974	Stahler et al.	Aug 2006	B1
7101508	Thompson et al.	Sep 2006	B2
7101986	Dellinger et al.	Sep 2006	B2
7105295	Bass et al.	Sep 2006	B2
7115423	Mitchell	Oct 2006	B1
7122303	Delenstarr et al.	Oct 2006	B2
7122364	Lyamichev et al.	Oct 2006	B1
7125488	Li	Oct 2006	B2
7125523	Sillman	Oct 2006	B2
7128876	Yin et al.	Oct 2006	B2
7129075	Gerard et al.	Oct 2006	B2
7135565	Dellinger et al.	Nov 2006	B2
7138062	Yin et al.	Nov 2006	B2
7141368	Fisher et al.	Nov 2006	B2
7141807	Joyce et al.	Nov 2006	B2
7147362	Caren et al.	Dec 2006	B2
7150982	Allawi et al.	Dec 2006	B2
7153689	Tolosko et al.	Dec 2006	B2
7163660	Lehmann	Jan 2007	B2
7166258	Bass et al.	Jan 2007	B2
7179659	Stolowitz et al.	Feb 2007	B2
7183406	Belshaw et al.	Feb 2007	B2
7192710	Gellibolian et al.	Mar 2007	B2
7193077	Dellinger et al.	Mar 2007	B2
7195872	Agrawal et al.	Mar 2007	B2
7198939	Dorsel et al.	Apr 2007	B2
7202264	Ravikumar et al.	Apr 2007	B2
7202358	Hargreaves	Apr 2007	B2
7205128	Ilsley et al.	Apr 2007	B2
7205400	Webb	Apr 2007	B2
7206439	Zhou et al.	Apr 2007	B2
7208322	Stolowitz et al.	Apr 2007	B2
7217522	Brenner	May 2007	B2
7220573	Shea et al.	May 2007	B2
7221785	Curry et al.	May 2007	B2
7226862	Staehler et al.	Jun 2007	B2
7227017	Mellor et al.	Jun 2007	B2
7229497	Stott et al.	Jun 2007	B2
7247337	Leproust et al.	Jul 2007	B1
7247497	Dahm et al.	Jul 2007	B2
7252938	Leproust et al.	Aug 2007	B2
7269518	Corson	Sep 2007	B2
7271258	Dellinger et al.	Sep 2007	B2
7276336	Webb et al.	Oct 2007	B1
7276378	Myerson	Oct 2007	B2
7276599	Moore et al.	Oct 2007	B2
7282183	Peck	Oct 2007	B2
7282332	Caren et al.	Oct 2007	B2
7282705	Brennen	Oct 2007	B2
7291471	Sampson et al.	Nov 2007	B2
7302348	Ghosh et al.	Nov 2007	B2
7306917	Prudent et al.	Dec 2007	B2
7314599	Roitman et al.	Jan 2008	B2
7323320	Oleinikov	Jan 2008	B2
7344831	Wolber et al.	Mar 2008	B2
7348144	Minor	Mar 2008	B2
7351379	Schleifer	Apr 2008	B2
7353116	Webb et al.	Apr 2008	B2
7361906	Ghosh et al.	Apr 2008	B2
7364896	Schembri	Apr 2008	B2
7368550	Dellinger et al.	May 2008	B2
7371348	Schleifer et al.	May 2008	B2
7371519	Wolber et al.	May 2008	B2
7371580	Yakhini et al.	May 2008	B2
7372982	Le	May 2008	B2
7384746	Lyamichev et al.	Jun 2008	B2
7385050	Dellinger et al.	Jun 2008	B2
7390457	Schembri	Jun 2008	B2
7393665	Brenner	Jul 2008	B2
7396676	Robotti et al.	Jul 2008	B2
7399844	Sampson et al.	Jul 2008	B2
7402279	Schembri	Jul 2008	B2
7411061	Myerson et al.	Aug 2008	B2
7413709	Roitman et al.	Aug 2008	B2
7417139	Dellinger et al.	Aug 2008	B2
7422911	Schembri	Sep 2008	B2
7427679	Dellinger et al.	Sep 2008	B2
7432048	Neri et al.	Oct 2008	B2
7435810	Myerson et al.	Oct 2008	B2
7439272	Xu	Oct 2008	B2
7476709	Moody et al.	Jan 2009	B2
7482118	Allawi et al.	Jan 2009	B2
7488607	Tom-Moy et al.	Feb 2009	B2
7504213	Sana et al.	Mar 2009	B2
7514369	Li et al.	Apr 2009	B2
7517979	Wolber	Apr 2009	B2
7524942	Wang et al.	Apr 2009	B2
7524950	Dellinger et al.	Apr 2009	B2
7527928	Neri et al.	May 2009	B2
7531303	Dorsel et al.	May 2009	B2
7534561	Sana et al.	May 2009	B2
7534563	Hargreaves	May 2009	B2
7537936	Dahm et al.	May 2009	B2
7541145	Prudent et al.	Jun 2009	B2
7544473	Brenner	Jun 2009	B2
7556919	Chenchik et al.	Jul 2009	B2
7563600	Oleinikov	Jul 2009	B2
7572585	Wang	Aug 2009	B2
7572907	Dellinger et al.	Aug 2009	B2
7572908	Dellinger et al.	Aug 2009	B2
7585970	Dellinger et al.	Sep 2009	B2
7588889	Wolber et al.	Sep 2009	B2
7595350	Xu	Sep 2009	B2
7604941	Jacobson	Oct 2009	B2
7604996	Stuelpnagel et al.	Oct 2009	B1
7608396	Delenstarr	Oct 2009	B2
7618777	Myerson et al.	Nov 2009	B2
7629120	Bennett et al.	Dec 2009	B2
7635772	McCormac	Dec 2009	B2
7648832	Jessee et al.	Jan 2010	B2
7651762	Xu et al.	Jan 2010	B2
7659069	Belyaev et al.	Feb 2010	B2
7678542	Lyamichev et al.	Mar 2010	B2
7682809	Sampson	Mar 2010	B2
7709197	Drmanac	May 2010	B2
7718365	Wang	May 2010	B2
7718786	Dupret et al.	May 2010	B2
7723077	Young et al.	May 2010	B2
7737088	Stahler et al.	Jun 2010	B1
7737089	Guimil et al.	Jun 2010	B2
7741463	Gormley et al.	Jun 2010	B2
7749701	Leproust et al.	Jul 2010	B2
7759471	Dellinger et al.	Jul 2010	B2
7776021	Borenstein et al.	Aug 2010	B2
7776532	Gibson et al.	Aug 2010	B2
7790369	Stahler et al.	Sep 2010	B2
7790387	Dellinger et al.	Sep 2010	B2
7807356	Sampson et al.	Oct 2010	B2
7807806	Allawi et al.	Oct 2010	B2
7811753	Eshoo	Oct 2010	B2
7816079	Fischer	Oct 2010	B2
7820387	Neri et al.	Oct 2010	B2
7829314	Prudent et al.	Nov 2010	B2
7855281	Dellinger et al.	Dec 2010	B2
7862999	Zheng et al.	Jan 2011	B2
7867782	Barth	Jan 2011	B2
7875463	Adaskin et al.	Jan 2011	B2
7879541	Kincaid	Feb 2011	B2
7879580	Carr et al.	Feb 2011	B2
7894998	Kincaid	Feb 2011	B2
7919239	Wang	Apr 2011	B2
7919308	Schleifer	Apr 2011	B2
7927797	Nobile et al.	Apr 2011	B2
7927838	Shannon	Apr 2011	B2
7932025	Carr et al.	Apr 2011	B2
7932070	Hogrefe et al.	Apr 2011	B2
7935800	Allawi et al.	May 2011	B2
7939645	Borns	May 2011	B2
7943046	Martosella et al.	May 2011	B2
7943358	Hogrefe et al.	May 2011	B2
7960157	Borns	Jun 2011	B2
7977119	Kronick et al.	Jul 2011	B2
7979215	Sampas	Jul 2011	B2
7998437	Berndt et al.	Aug 2011	B2
7999087	Dellinger et al.	Aug 2011	B2
8021842	Brenner	Sep 2011	B2
8021844	Wang	Sep 2011	B2
8034917	Yamada	Oct 2011	B2
8036835	Sampas et al.	Oct 2011	B2
8048664	Guan et al.	Nov 2011	B2
8053191	Blake	Nov 2011	B2
8058001	Crameri et al.	Nov 2011	B2
8058004	Oleinikov	Nov 2011	B2
8058055	Barrett et al.	Nov 2011	B2
8063184	Allawi et al.	Nov 2011	B2
8067556	Hogrefe et al.	Nov 2011	B2
8073626	Troup et al.	Dec 2011	B2
8076064	Wang	Dec 2011	B2
8076152	Robotti	Dec 2011	B2
8097711	Timar et al.	Jan 2012	B2
8137936	Macevicz	Mar 2012	B2
8148068	Brenner	Apr 2012	B2
8154729	Baldo et al.	Apr 2012	B2
8168385	Brenner	May 2012	B2
8168388	Gormley et al.	May 2012	B2
8173368	Staehler et al.	May 2012	B2
8182991	Kaiser et al.	May 2012	B1
8194244	Wang et al.	Jun 2012	B2
8198071	Goshoo et al.	Jun 2012	B2
8202983	Dellinger et al.	Jun 2012	B2
8202985	Dellinger et al.	Jun 2012	B2
8206952	Carr et al.	Jun 2012	B2
8213015	Kraiczek et al.	Jul 2012	B2
8242258	Dellinger et al.	Aug 2012	B2
8247221	Fawcett et al.	Aug 2012	B2
8263335	Carr et al.	Sep 2012	B2
8268605	Sorge et al.	Sep 2012	B2
8283148	Sorge et al.	Oct 2012	B2
8288093	Hall et al.	Oct 2012	B2
8298767	Brenner et al.	Oct 2012	B2
8304273	Stellacci et al.	Nov 2012	B2
8309307	Barrett et al.	Nov 2012	B2
8309706	Dellinger et al.	Nov 2012	B2
8309710	Sierzchala et al.	Nov 2012	B2
8314220	Mullinax et al.	Nov 2012	B2
8318433	Brenner	Nov 2012	B2
8318479	Domansky et al.	Nov 2012	B2
8357489	Chua et al.	Jan 2013	B2
8357490	Froehlich et al.	Jan 2013	B2
8367016	Quan et al.	Feb 2013	B2
8367335	Staehler et al.	Feb 2013	B2
8380441	Webb et al.	Feb 2013	B2
8383338	Kitzman et al.	Feb 2013	B2
8415138	Leproust	Apr 2013	B2
8435736	Gibson et al.	May 2013	B2
8445205	Brenner	May 2013	B2
8445206	Bergmann et al.	May 2013	B2
8470996	Brenner	Jun 2013	B2
8476018	Brenner	Jul 2013	B2
8476598	Pralle et al.	Jul 2013	B1
8481292	Casbon et al.	Jul 2013	B2
8481309	Zhang et al.	Jul 2013	B2
8491561	Borenstein et al.	Jul 2013	B2
8497069	Hutchison et al.	Jul 2013	B2
8500979	Elibol et al.	Aug 2013	B2
8501454	Liu et al.	Aug 2013	B2
8507226	Carr et al.	Aug 2013	B2
8507239	Lubys et al.	Aug 2013	B2
8507272	Zhang et al.	Aug 2013	B2
8530197	Li et al.	Sep 2013	B2
8552174	Dellinger et al.	Oct 2013	B2
8563478	Gormley et al.	Oct 2013	B2
8569046	Love et al.	Oct 2013	B2
8577621	Troup et al.	Nov 2013	B2
8586310	Mitra et al.	Nov 2013	B2
8614092	Zhang et al.	Dec 2013	B2
8642755	Sierzchala et al.	Feb 2014	B2
8664164	Ericsson et al.	Mar 2014	B2
8669053	Stuelpnagel et al.	Mar 2014	B2
8679756	Brenner et al.	Mar 2014	B1
8685642	Sampas	Apr 2014	B2
8685676	Hogrefe et al.	Apr 2014	B2
8685678	Casbon et al.	Apr 2014	B2
8715933	Oliver	May 2014	B2
8715967	Casbon et al.	May 2014	B2
8716467	Jacobson	May 2014	B2
8722368	Casbon et al.	May 2014	B2
8722585	Wang	May 2014	B2
8728766	Casbon et al.	May 2014	B2
8741606	Casbon et al.	Jun 2014	B2
8808896	Choo et al.	Aug 2014	B2
8808986	Jacobson et al.	Aug 2014	B2
8815600	Liu et al.	Aug 2014	B2
8889851	Leproust et al.	Nov 2014	B2
8932994	Gormley et al.	Jan 2015	B2
8962532	Shapiro et al.	Feb 2015	B2
8968999	Gibson et al.	Mar 2015	B2
8980563	Zheng et al.	Mar 2015	B2
9018365	Brenner	Apr 2015	B2
9023601	Oleinikov	May 2015	B2
9051666	Oleinikov	Jun 2015	B2
9073962	Fracchia et al.	Jul 2015	B2
9074204	Anderson et al.	Jul 2015	B2
9085797	Gebeyehu et al.	Jul 2015	B2
9133510	Andersen et al.	Sep 2015	B2
9139874	Myers et al.	Sep 2015	B2
9150853	Hudson et al.	Oct 2015	B2
9187777	Jacobson et al.	Nov 2015	B2
9194001	Brenner	Nov 2015	B2
9216414	Chu	Dec 2015	B2
9217144	Jacobson et al.	Dec 2015	B2
9279149	Efcavitch et al.	Mar 2016	B2
9286439	Shapiro et al.	Mar 2016	B2
9295965	Jacobson et al.	Mar 2016	B2
9315861	Hendricks et al.	Apr 2016	B2
9328378	Earnshaw et al.	May 2016	B2
9347091	Bergmann et al.	May 2016	B2
9375748	Harumoto et al.	Jun 2016	B2
9376677	Mir	Jun 2016	B2
9376678	Gormley et al.	Jun 2016	B2
9384320	Church	Jul 2016	B2
9384920	Bakulich	Jul 2016	B1
9388407	Jacobson	Jul 2016	B2
9394333	Wada et al.	Jul 2016	B2
9403141	Banyai et al.	Aug 2016	B2
9409139	Banyai et al.	Aug 2016	B2
9410149	Brenner et al.	Aug 2016	B2
9410173	Betts et al.	Aug 2016	B2
9416411	Stuelpnagel et al.	Aug 2016	B2
9422600	Ramu et al.	Aug 2016	B2
9487824	Kutyavin	Nov 2016	B2
9499848	Carr et al.	Nov 2016	B2
9523122	Zheng et al.	Dec 2016	B2
9528148	Zheng et al.	Dec 2016	B2
9534251	Young et al.	Jan 2017	B2
9555388	Banyai et al.	Jan 2017	B2
9568839	Stahler et al.	Feb 2017	B2
9580746	Leproust et al.	Feb 2017	B2
9670529	Osborne et al.	Jun 2017	B2
9670536	Casbon et al.	Jun 2017	B2
9677067	Toro et al.	Jun 2017	B2
9695211	Wada et al.	Jul 2017	B2
9718060	Venter et al.	Aug 2017	B2
9745573	Stuelpnagel et al.	Aug 2017	B2
9745619	Rabbani et al.	Aug 2017	B2
9765387	Rabbani et al.	Sep 2017	B2
9771576	Gibson et al.	Sep 2017	B2
9833761	Banyai et al.	Dec 2017	B2
9834774	Carstens	Dec 2017	B2
9839894	Banyai et al.	Dec 2017	B2
9879283	Ravinder et al.	Jan 2018	B2
9889423	Banyai et al.	Feb 2018	B2
9895673	Peck et al.	Feb 2018	B2
9925510	Jacobson et al.	Mar 2018	B2
9932576	Raymond et al.	Apr 2018	B2
9981239	Banyai et al.	May 2018	B2
10053688	Cox	Aug 2018	B2
10272410	Banyai et al.	Apr 2019	B2
10384188	Banyai et al.	Aug 2019	B2
10384189	Peck	Aug 2019	B2
10417457	Peck	Sep 2019	B2
10583415	Banyai et al.	Mar 2020	B2
10754994	Peck	Aug 2020	B2
10773232	Banyai et al.	Sep 2020	B2
10936953	Bramlett et al.	Mar 2021	B2
10975372	Cox et al.	Apr 2021	B2
20010018512	Blanchard	Aug 2001	A1
20010039014	Bass et al.	Nov 2001	A1
20010055761	Kanemoto et al.	Dec 2001	A1
20020012930	Rothberg et al.	Jan 2002	A1
20020025561	Hodgson	Feb 2002	A1
20020076716	Sabanayagam et al.	Jun 2002	A1
20020081582	Gao et al.	Jun 2002	A1
20020094533	Hess et al.	Jul 2002	A1
20020095073	Jacobs et al.	Jul 2002	A1
20020119459	Griffiths	Aug 2002	A1
20020132308	Liu et al.	Sep 2002	A1
20020155439	Rodriguez et al.	Oct 2002	A1
20020160536	Regnier et al.	Oct 2002	A1
20020164824	Xiao et al.	Nov 2002	A1
20030008411	Van Dam et al.	Jan 2003	A1
20030022207	Balasubramanian et al.	Jan 2003	A1
20030022240	Luo et al.	Jan 2003	A1
20030022317	Jack et al.	Jan 2003	A1
20030044781	Korlach et al.	Mar 2003	A1
20030058629	Hirai et al.	Mar 2003	A1
20030064398	Barnes	Apr 2003	A1
20030068633	Belshaw et al.	Apr 2003	A1
20030082719	Schumacher et al.	May 2003	A1
20030100102	Rothberg et al.	May 2003	A1
20030108903	Wang et al.	Jun 2003	A1
20030120035	Gao et al.	Jun 2003	A1
20030130827	Bentzien et al.	Jul 2003	A1
20030138782	Evans	Jul 2003	A1
20030143605	Lok et al.	Jul 2003	A1
20030148291	Robotti	Aug 2003	A1
20030148344	Rothberg et al.	Aug 2003	A1
20030171325	Gascoyne et al.	Sep 2003	A1
20030186226	Brennan et al.	Oct 2003	A1
20030228602	Parker et al.	Dec 2003	A1
20030228620	Du	Dec 2003	A1
20040009498	Short	Jan 2004	A1
20040043509	Stahler et al.	Mar 2004	A1
20040053362	De Luca et al.	Mar 2004	A1
20040086892	Crothers et al.	May 2004	A1
20040087008	Schembri	May 2004	A1
20040106130	Besemer et al.	Jun 2004	A1
20040106728	McGall et al.	Jun 2004	A1
20040110133	Xu et al.	Jun 2004	A1
20040175710	Haushalter	Sep 2004	A1
20040175734	Stahler et al.	Sep 2004	A1
20040191810	Yamamoto	Sep 2004	A1
20040213795	Collins et al.	Oct 2004	A1
20040219663	Page et al.	Nov 2004	A1
20040236027	Maeji et al.	Nov 2004	A1
20040248161	Rothberg et al.	Dec 2004	A1
20040259146	Friend et al.	Dec 2004	A1
20050022895	Barth et al.	Feb 2005	A1
20050049402	Babcook et al.	Mar 2005	A1
20050049796	Webb et al.	Mar 2005	A1
20050053968	Bharadwaj et al.	Mar 2005	A1
20050079510	Berka et al.	Apr 2005	A1
20050100932	Lapidus et al.	May 2005	A1
20050112608	Grossman et al.	May 2005	A1
20050112636	Hurt et al.	May 2005	A1
20050112679	Myerson et al.	May 2005	A1
20050124022	Srinivasan et al.	Jun 2005	A1
20050137805	Lewin et al.	Jun 2005	A1
20050208513	Agbo et al.	Sep 2005	A1
20050214778	Peck et al.	Sep 2005	A1
20050214779	Peck et al.	Sep 2005	A1
20050227235	Carr et al.	Oct 2005	A1
20050255477	Carr et al.	Nov 2005	A1
20050266045	Canham et al.	Dec 2005	A1
20050277125	Benn et al.	Dec 2005	A1
20050282158	Landegren	Dec 2005	A1
20050287585	Oleinikov	Dec 2005	A1
20060003381	Gilmore et al.	Jan 2006	A1
20060003958	Melville et al.	Jan 2006	A1
20060012784	Ulmer	Jan 2006	A1
20060012793	Harris	Jan 2006	A1
20060019084	Pearson	Jan 2006	A1
20060024678	Buzby	Feb 2006	A1
20060024711	Lapidus et al.	Feb 2006	A1
20060024721	Pedersen	Feb 2006	A1
20060076482	Hobbs et al.	Apr 2006	A1
20060078909	Srinivasan et al.	Apr 2006	A1
20060078927	Peck et al.	Apr 2006	A1
20060078937	Korlach et al.	Apr 2006	A1
20060127920	Church et al.	Jun 2006	A1
20060134638	Mulligan et al.	Jun 2006	A1
20060160138	Church	Jul 2006	A1
20060171855	Yin et al.	Aug 2006	A1
20060202330	Reinhardt et al.	Sep 2006	A1
20060203236	Ji et al.	Sep 2006	A1
20060203237	Ji et al.	Sep 2006	A1
20060207923	Li	Sep 2006	A1
20060219637	Killeen et al.	Oct 2006	A1
20070031857	Makarov et al.	Feb 2007	A1
20070031877	Stahler et al.	Feb 2007	A1
20070043516	Gustafsson et al.	Feb 2007	A1
20070054127	Hergenrother et al.	Mar 2007	A1
20070059692	Gao et al.	Mar 2007	A1
20070087349	Staehler et al.	Apr 2007	A1
20070099208	Drmanac et al.	May 2007	A1
20070122817	Church et al.	May 2007	A1
20070128635	Macevicz	Jun 2007	A1
20070141557	Raab et al.	Jun 2007	A1
20070196834	Cerrina et al.	Aug 2007	A1
20070196854	Stahler et al.	Aug 2007	A1
20070207482	Church et al.	Sep 2007	A1
20070207487	Emig et al.	Sep 2007	A1
20070231800	Roberts et al.	Oct 2007	A1
20070238104	Barrett et al.	Oct 2007	A1
20070238106	Barrett et al.	Oct 2007	A1
20070238108	Barrett et al.	Oct 2007	A1
20070259344	Leproust et al.	Nov 2007	A1
20070259345	Sampas	Nov 2007	A1
20070259346	Gordon et al.	Nov 2007	A1
20070259347	Gordon et al.	Nov 2007	A1
20070269870	Church et al.	Nov 2007	A1
20080085511	Peck et al.	Apr 2008	A1
20080085514	Peck et al.	Apr 2008	A1
20080087545	Jensen et al.	Apr 2008	A1
20080161200	Yu et al.	Jul 2008	A1
20080182296	Chanda et al.	Jul 2008	A1
20080214412	Stahler et al.	Sep 2008	A1
20080227160	Kool	Sep 2008	A1
20080233616	Liss	Sep 2008	A1
20080287320	Baynes et al.	Nov 2008	A1
20080300842	Govindarajan et al.	Dec 2008	A1
20080308884	Kalvesten	Dec 2008	A1
20080311628	Shoemaker	Dec 2008	A1
20090036664	Peter	Feb 2009	A1
20090053704	Novoradovskaya et al.	Feb 2009	A1
20090062129	McKernan et al.	Mar 2009	A1
20090074771	Koenig et al.	Mar 2009	A1
20090087840	Baynes et al.	Apr 2009	A1
20090088679	Wood et al.	Apr 2009	A1
20090105094	Heiner et al.	Apr 2009	A1
20090170802	Stahler et al.	Jul 2009	A1
20090176280	Hutchison, III et al.	Jul 2009	A1
20090181861	Li et al.	Jul 2009	A1
20090194483	Robotti et al.	Aug 2009	A1
20090230044	Bek	Sep 2009	A1
20090238722	Mora-Fillat et al.	Sep 2009	A1
20090239759	Balch	Sep 2009	A1
20090246788	Albert et al.	Oct 2009	A1
20090263802	Drmanac	Oct 2009	A1
20090285825	Kini et al.	Nov 2009	A1
20090324546	Notka et al.	Dec 2009	A1
20100004143	Shibahara	Jan 2010	A1
20100008851	Nicolaides et al.	Jan 2010	A1
20100009872	Eid et al.	Jan 2010	A1
20100047805	Wang	Feb 2010	A1
20100051967	Bradley et al.	Mar 2010	A1
20100069250	White, III et al.	Mar 2010	A1
20100090341	Wan et al.	Apr 2010	A1
20100099103	Hsieh et al.	Apr 2010	A1
20100111768	Banerjee et al.	May 2010	A1
20100160463	Wang et al.	Jun 2010	A1
20100167950	Juang et al.	Jul 2010	A1
20100173364	Evans, Jr. et al.	Jul 2010	A1
20100216648	Staehler et al.	Aug 2010	A1
20100256017	Larman et al.	Oct 2010	A1
20100258487	Zelechonok et al.	Oct 2010	A1
20100272711	Feldman et al.	Oct 2010	A1
20100286290	Lohmann et al.	Nov 2010	A1
20100292102	Nouri	Nov 2010	A1
20100300882	Zhang et al.	Dec 2010	A1
20100323404	Lathrop	Dec 2010	A1
20110009607	Komiyama et al.	Jan 2011	A1
20110082055	Fox et al.	Apr 2011	A1
20110114244	Yoo et al.	May 2011	A1
20110114549	Yin et al.	May 2011	A1
20110124049	Li et al.	May 2011	A1
20110124055	Carr et al.	May 2011	A1
20110126929	Velasquez-Garcia et al.	Jun 2011	A1
20110171651	Richmond	Jul 2011	A1
20110172127	Jacobson et al.	Jul 2011	A1
20110201057	Carr et al.	Aug 2011	A1
20110217738	Jacobson	Sep 2011	A1
20110230653	Novoradovskaya et al.	Sep 2011	A1
20110254107	Bulovic et al.	Oct 2011	A1
20110287435	Grunenwald et al.	Nov 2011	A1
20120003713	Hansen et al.	Jan 2012	A1
20120021932	Mershin et al.	Jan 2012	A1
20120027786	Gupta et al.	Feb 2012	A1
20120028843	Ramu et al.	Feb 2012	A1
20120032366	Ivniski et al.	Feb 2012	A1
20120046175	Rodesch et al.	Feb 2012	A1
20120050411	Mabritto et al.	Mar 2012	A1
20120094847	Warthmann et al.	Apr 2012	A1
20120128548	West et al.	May 2012	A1
20120129704	Gunderson et al.	May 2012	A1
20120149602	Friend et al.	Jun 2012	A1
20120164127	Short et al.	Jun 2012	A1
20120164633	Laffler	Jun 2012	A1
20120164691	Eshoo et al.	Jun 2012	A1
20120184724	Sierzchala et al.	Jul 2012	A1
20120220497	Jacobson et al.	Aug 2012	A1
20120231968	Bruhn et al.	Sep 2012	A1
20120238737	Dellinger et al.	Sep 2012	A1
20120258487	Chang et al.	Oct 2012	A1
20120264653	Carr et al.	Oct 2012	A1
20120270750	Oleinikov	Oct 2012	A1
20120270754	Blake	Oct 2012	A1
20120283140	Chu	Nov 2012	A1
20120288476	Hartmann et al.	Nov 2012	A1
20120289691	Dellinger et al.	Nov 2012	A1
20120315670	Jacobson et al.	Dec 2012	A1
20120322681	Kung et al.	Dec 2012	A1
20130005585	Anderson et al.	Jan 2013	A1
20130005612	Carr et al.	Jan 2013	A1
20130017642	Milgrew et al.	Jan 2013	A1
20130017977	Oleinikov	Jan 2013	A1
20130017978	Kavanagh et al.	Jan 2013	A1
20130035261	Sierzchala et al.	Feb 2013	A1
20130040836	Himmler et al.	Feb 2013	A1
20130045483	Treusch et al.	Feb 2013	A1
20130053252	Xie et al.	Feb 2013	A1
20130059296	Jacobson et al.	Mar 2013	A1
20130059761	Jacobson et al.	Mar 2013	A1
20130065017	Sieber	Mar 2013	A1
20130109595	Routenberg	May 2013	A1
20130109596	Peterson et al.	May 2013	A1
20130123129	Zeiner et al.	May 2013	A1
20130130321	Staehler et al.	May 2013	A1
20130137161	Zhang et al.	May 2013	A1
20130137173	Zhang et al.	May 2013	A1
20130137174	Zhang et al.	May 2013	A1
20130137861	Leproust et al.	May 2013	A1
20130164308	Foletti et al.	Jun 2013	A1
20130165328	Previte et al.	Jun 2013	A1
20130196864	Govindarajan et al.	Aug 2013	A1
20130225421	Li et al.	Aug 2013	A1
20130244884	Jacobson et al.	Sep 2013	A1
20130252849	Hudson et al.	Sep 2013	A1
20130261027	Li et al.	Oct 2013	A1
20130281308	Kung et al.	Oct 2013	A1
20130289246	Crowe et al.	Oct 2013	A1
20130296192	Jacobson et al.	Nov 2013	A1
20130296194	Jacobson et al.	Nov 2013	A1
20130298265	Cunnac et al.	Nov 2013	A1
20130309725	Jacobson et al.	Nov 2013	A1
20130323725	Peter et al.	Dec 2013	A1
20130330778	Zeiner et al.	Dec 2013	A1
20140011226	Bernick et al.	Jan 2014	A1
20140018441	Fracchia et al.	Jan 2014	A1
20140031240	Behlke et al.	Jan 2014	A1
20140038240	Temme et al.	Feb 2014	A1
20140106394	Ko et al.	Apr 2014	A1
20140141982	Jacobson et al.	May 2014	A1
20140170665	Hiddessen et al.	Jun 2014	A1
20140178992	Nakashima et al.	Jun 2014	A1
20140221250	Vasquez et al.	Aug 2014	A1
20140274729	Kurn et al.	Sep 2014	A1
20140274741	Hunter et al.	Sep 2014	A1
20140303000	Armour et al.	Oct 2014	A1
20140309119	Jacobson et al.	Oct 2014	A1
20140309142	Tian	Oct 2014	A1
20150010953	Lindstrom et al.	Jan 2015	A1
20150012723	Park et al.	Jan 2015	A1
20150031089	Lindstrom	Jan 2015	A1
20150038373	Banyai et al.	Feb 2015	A1
20150056609	Daum et al.	Feb 2015	A1
20150057625	Coulthard	Feb 2015	A1
20150065357	Fox	Mar 2015	A1
20150065393	Jacobson	Mar 2015	A1
20150099870	Bennett et al.	Apr 2015	A1
20150119293	Short	Apr 2015	A1
20150120265	Amirav-Drory	Apr 2015	A1
20150159152	Allen et al.	Jun 2015	A1
20150183853	Sharma et al.	Jul 2015	A1
20150191524	Smith et al.	Jul 2015	A1
20150191719	Hudson et al.	Jul 2015	A1
20150196917	Kay et al.	Jul 2015	A1
20150203839	Jacobson et al.	Jul 2015	A1
20150211047	Borns	Jul 2015	A1
20150225782	Walder et al.	Aug 2015	A1
20150240232	Zamore et al.	Aug 2015	A1
20150240280	Gibson et al.	Aug 2015	A1
20150261664	Goldman et al.	Sep 2015	A1
20150269313	Church	Sep 2015	A1
20150293102	Shim	Oct 2015	A1
20150307875	Happe et al.	Oct 2015	A1
20150321191	Kendall et al.	Nov 2015	A1
20150322504	Lao et al.	Nov 2015	A1
20150344927	Sampson et al.	Dec 2015	A1
20150353921	Tian	Dec 2015	A9
20150353994	Myers et al.	Dec 2015	A1
20150361420	Hudson et al.	Dec 2015	A1
20150361422	Sampson et al.	Dec 2015	A1
20150361423	Sampson et al.	Dec 2015	A1
20150368687	Saaem et al.	Dec 2015	A1
20150376602	Jacobson et al.	Dec 2015	A1
20160001247	Oleinikov	Jan 2016	A1
20160002621	Nelson et al.	Jan 2016	A1
20160002622	Nelson et al.	Jan 2016	A1
20160010045	Cohen et al.	Jan 2016	A1
20160017394	Liang et al.	Jan 2016	A1
20160017425	Ruvolo et al.	Jan 2016	A1
20160019341	Harris et al.	Jan 2016	A1
20160024138	Gebeyehu et al.	Jan 2016	A1
20160024576	Chee	Jan 2016	A1
20160026753	Krishnaswami et al.	Jan 2016	A1
20160026758	Jabara et al.	Jan 2016	A1
20160032396	Diehn et al.	Feb 2016	A1
20160046973	Efcavitch et al.	Feb 2016	A1
20160046974	Efcavitch et al.	Feb 2016	A1
20160082472	Perego et al.	Mar 2016	A1
20160089651	Banyai	Mar 2016	A1
20160090422	Reif et al.	Mar 2016	A1
20160090592	Banyai et al.	Mar 2016	A1
20160096160	Banyai et al.	Apr 2016	A1
20160097051	Jacobson et al.	Apr 2016	A1
20160102322	Ravinder et al.	Apr 2016	A1
20160108466	Nazarenko et al.	Apr 2016	A1
20160122755	Hall et al.	May 2016	A1
20160122800	Bernick et al.	May 2016	A1
20160152972	Stapleton et al.	Jun 2016	A1
20160168611	Efcavitch et al.	Jun 2016	A1
20160184788	Hall et al.	Jun 2016	A1
20160200759	Srivastava et al.	Jul 2016	A1
20160215283	Braman et al.	Jul 2016	A1
20160229884	Indermuhle et al.	Aug 2016	A1
20160230175	Carstens	Aug 2016	A1
20160230221	Bergmann et al.	Aug 2016	A1
20160251651	Banyai	Sep 2016	A1
20160256846	Smith et al.	Sep 2016	A1
20160264958	Toro et al.	Sep 2016	A1
20160289758	Akeson et al.	Oct 2016	A1
20160289839	Harumoto et al.	Oct 2016	A1
20160303535	Banyai et al.	Oct 2016	A1
20160304862	Igawa et al.	Oct 2016	A1
20160304946	Betts et al.	Oct 2016	A1
20160310426	Wu	Oct 2016	A1
20160310927	Banyai et al.	Oct 2016	A1
20160318016	Hou et al.	Nov 2016	A1
20160333340	Wu	Nov 2016	A1
20160339409	Banyai et al.	Nov 2016	A1
20160340672	Banyai et al.	Nov 2016	A1
20160348098	Stuelpnagel et al.	Dec 2016	A1
20160354752	Banyai et al.	Dec 2016	A1
20160355880	Gormley et al.	Dec 2016	A1
20170017436	Church	Jan 2017	A1
20170066844	Glanville	Mar 2017	A1
20170067099	Zheng et al.	Mar 2017	A1
20170073664	McCafferty et al.	Mar 2017	A1
20170073731	Zheng et al.	Mar 2017	A1
20170081660	Cox et al.	Mar 2017	A1
20170081716	Peck	Mar 2017	A1
20170088887	Makarov et al.	Mar 2017	A1
20170095785	Banyai et al.	Apr 2017	A1
20170096706	Behlke et al.	Apr 2017	A1
20170114404	Behlke et al.	Apr 2017	A1
20170141793	Strauss et al.	May 2017	A1
20170147748	Staehler et al.	May 2017	A1
20170151546	Peck et al.	Jun 2017	A1
20170159044	Toro et al.	Jun 2017	A1
20170175110	Jacobson et al.	Jun 2017	A1
20170218537	Olivares	Aug 2017	A1
20170233764	Young et al.	Aug 2017	A1
20170247473	Short	Aug 2017	A1
20170249345	Malik et al.	Aug 2017	A1
20170253644	Steyaert et al.	Sep 2017	A1
20170298432	Holt	Oct 2017	A1
20170320061	Venter et al.	Nov 2017	A1
20170327819	Banyai et al.	Nov 2017	A1
20170355984	Evans et al.	Dec 2017	A1
20170357752	Diggans	Dec 2017	A1
20170362589	Banyai	Dec 2017	A1
20180029001	Banyai et al.	Feb 2018	A1
20180051278	Cox et al.	Feb 2018	A1
20180051280	Gibson et al.	Feb 2018	A1
20180068060	Ceze et al.	Mar 2018	A1
20180104664	Fernandez	Apr 2018	A1
20180126355	Peck et al.	May 2018	A1
20180142289	Zeitoun	May 2018	A1
20180171509	Cox	Jun 2018	A1
20180236425	Banyai et al.	Aug 2018	A1
20180253563	Peck et al.	Sep 2018	A1
20180264428	Banyai et al.	Sep 2018	A1
20180273936	Cox et al.	Sep 2018	A1
20180282721	Cox et al.	Oct 2018	A1
20180291445	Betts et al.	Oct 2018	A1
20180326388	Banyai et al.	Nov 2018	A1
20180334712	Singer et al.	Nov 2018	A1
20180346585	Zhang et al.	Dec 2018	A1
20180355351	Nugent et al.	Dec 2018	A1
20190060345	Harrison et al.	Feb 2019	A1
20190083596	Orentas et al.	Mar 2019	A1
20190118154	Marsh et al.	Apr 2019	A1
20190135926	Glanville	May 2019	A1
20190224711	Demeris, Jr.	Jul 2019	A1
20190240636	Peck et al.	Aug 2019	A1
20190314783	Banyai et al.	Oct 2019	A1
20190352635	Toro et al.	Nov 2019	A1
20190366293	Banyai et al.	Dec 2019	A1
20190366294	Banyai et al.	Dec 2019	A1
20200017907	Zeitoun et al.	Jan 2020	A1
20200102611	Zeitoun et al.	Apr 2020	A1
20200156037	Banyai et al.	May 2020	A1
20200222875	Peck et al.	Jul 2020	A1
20200283760	Nugent et al.	Sep 2020	A1
20200299322	Indermuhle et al.	Sep 2020	A1
20200299684	Toro et al.	Sep 2020	A1
20200308575	Sato	Oct 2020	A1
20200325235	Tabibiazar et al.	Oct 2020	A1
20200342143	Peck	Oct 2020	A1
20210002710	Gantt et al.	Jan 2021	A1
20210040476	Cox et al.	Feb 2021	A1
20210071168	Nugent et al.	Mar 2021	A1
20210102192	Tabibiazar et al.	Apr 2021	A1
20210102195	Sato et al.	Apr 2021	A1
20210102198	Cox et al.	Apr 2021	A1
20210115594	Cox et al.	Apr 2021	A1
20210129108	Marsh et al.	May 2021	A1
20210142182	Bramlett et al.	May 2021	A1
20210147830	Liss	May 2021	A1
20210170356	Peck et al.	Jun 2021	A1
20210179724	Sato et al.	Jun 2021	A1
20210207197	Gantt et al.	Jul 2021	A1

Foreign Referenced Citations (228)

Number	Date	Country
3157000	Sep 2000	AU
2362939	Aug 2000	CA
1771336	May 2006	CN
101277758	Oct 2008	CN
102159726	Aug 2011	CN
103907117	Jul 2014	CN
104520864	Apr 2015	CN
104562213	Apr 2015	CN
104734848	Jun 2015	CN
105637097	Jun 2016	CN
10260805	Jul 2004	DE
0090789	Oct 1983	EP
0126621	Aug 1990	EP
0753057	Jan 1997	EP
1314783	May 2003	EP
1363125	Nov 2003	EP
1546387	Jun 2005	EP
1153127	Jul 2006	EP
1728860	Dec 2006	EP
1072010	Apr 2010	EP
2175021	Apr 2010	EP
2330216	Jun 2011	EP
1343802	May 2012	EP
2504449	Oct 2012	EP
2751729	Jul 2014	EP
2872629	May 2015	EP
2928500	Oct 2015	EP
2971034	Jan 2016	EP
3030682	Jun 2016	EP
3044228	Apr 2017	EP
2994509	Jun 2017	EP
3204518	Aug 2017	EP
H07505530	Jun 1995	JP
2001518086	Oct 2001	JP
2002511276	Apr 2002	JP
2002536977	Nov 2002	JP
2002538790	Nov 2002	JP
2006503586	Feb 2006	JP
2006238724	Sep 2006	JP
2008505642	Feb 2008	JP
2008097189	Apr 2008	JP
2008523786	Jul 2008	JP
2008214343	Sep 2008	JP
2009294195	Dec 2009	JP
2016527313	Sep 2016	JP
WO-9015070	Dec 1990	WO
WO-9210092	Jun 1992	WO
WO-9210588	Jun 1992	WO
WO-9309668	May 1993	WO
WO-9320242	Oct 1993	WO
WO-9525116	Sep 1995	WO
WO-9526397	Oct 1995	WO
WO-9615861	May 1996	WO
WO-9710365	Mar 1997	WO
WO-9822541	May 1998	WO
WO-9841531	Sep 1998	WO
WO-9942813	Aug 1999	WO
WO-9953101	Oct 1999	WO
WO-0013017	Mar 2000	WO
WO-0018957	Apr 2000	WO
WO-0042559	Jul 2000	WO
WO-0042560	Jul 2000	WO
WO-0042561	Jul 2000	WO
WO-0049142	Aug 2000	WO
WO-0053617	Sep 2000	WO
WO-0156216	Aug 2001	WO
WO-0210443	Feb 2002	WO
WO-0156216	Mar 2002	WO
WO-0220537	Mar 2002	WO
WO-0224597	Mar 2002	WO
WO-0227638	Apr 2002	WO
WO-0233669	Apr 2002	WO
WO-02072791	Sep 2002	WO
WO-03040410	May 2003	WO
WO-03046223	Jun 2003	WO
WO-03054232	Jul 2003	WO
WO-03060084	Jul 2003	WO
WO-03064026	Aug 2003	WO
WO-03064027	Aug 2003	WO
WO-03064699	Aug 2003	WO
WO-03065038	Aug 2003	WO
WO-03066212	Aug 2003	WO
WO-03089605	Oct 2003	WO
WO-03093504	Nov 2003	WO
WO-03100012	Dec 2003	WO
WO-2004024886	Mar 2004	WO
WO-2004029220	Apr 2004	WO
WO-2004029586	Apr 2004	WO
WO-2004031351	Apr 2004	WO
WO-2004031399	Apr 2004	WO
WO-2004059556	Jul 2004	WO
WO-03060084	Aug 2004	WO
WO-2005014850	Feb 2005	WO
WO-2005051970	Jun 2005	WO
WO-2005059096	Jun 2005	WO
WO-2005059097	Jun 2005	WO
WO-2005093092	Oct 2005	WO
WO-2006023144	Mar 2006	WO
WO-2006044956	Apr 2006	WO
WO-2006076679	Jul 2006	WO
WO-2006116476	Nov 2006	WO
WO-2007073171	Jun 2007	WO
WO-2007109221	Sep 2007	WO
WO-2007118214	Oct 2007	WO
WO-2007120627	Oct 2007	WO
WO-2007137242	Nov 2007	WO
WO-2008003116	Jan 2008	WO
WO-2008006078	Jan 2008	WO
WO-2008027558	Mar 2008	WO
WO-2008045380	Apr 2008	WO
WO-2008054543	May 2008	WO
WO-2008063134	May 2008	WO
WO-2008063135	May 2008	WO
WO-2008068280	Jun 2008	WO
WO-2008103474	Aug 2008	WO
WO-2008109176	Sep 2008	WO
WO-2009132876	Nov 2009	WO
WO-2010001251	Jan 2010	WO
WO-2010025310	Mar 2010	WO
WO-2010025566	Mar 2010	WO
WO-2010027512	Mar 2010	WO
WO-2010089412	Aug 2010	WO
WO-2010141249	Dec 2010	WO
WO-2010141433	Dec 2010	WO
WO-2011020529	Feb 2011	WO
WO-2010141433	Apr 2011	WO
WO-2011053957	May 2011	WO
WO-2011056644	May 2011	WO
WO-2011056872	May 2011	WO
WO-2011066185	Jun 2011	WO
WO-2011066186	Jun 2011	WO
WO-2011085075	Jul 2011	WO
WO-2011103468	Aug 2011	WO
WO-2011109031	Sep 2011	WO
WO-2011143556	Nov 2011	WO
WO-2011150168	Dec 2011	WO
WO-2011161413	Dec 2011	WO
WO-2012013913	Feb 2012	WO
WO-2012061832	May 2012	WO
WO-2012078312	Jun 2012	WO
WO-2012149171	Nov 2012	WO
WO-2012154201	Nov 2012	WO
WO-2013010062	Jan 2013	WO
WO-2013030827	Mar 2013	WO
WO-2013032850	Mar 2013	WO
WO-2013036668	Mar 2013	WO
WO-2013049227	Apr 2013	WO
WO-2013101896	Jul 2013	WO
WO-2013134881	Sep 2013	WO
WO-2013154770	Oct 2013	WO
WO-2013170168	Nov 2013	WO
WO-2013177220	Nov 2013	WO
WO-2014004393	Jan 2014	WO
WO-2014008447	Jan 2014	WO
WO-2014021938	Feb 2014	WO
WO-2014035693	Mar 2014	WO
WO-2014088693	Jun 2014	WO
WO-2014089160	Jun 2014	WO
WO-2014093330	Jun 2014	WO
WO-2014093694	Jun 2014	WO
WO-2014151117	Sep 2014	WO
WO-2014151696	Sep 2014	WO
WO-2014160004	Oct 2014	WO
WO-2014160059	Oct 2014	WO
WO-2014206304	Dec 2014	WO
WO-2015017527	Feb 2015	WO
WO-2015021080	Feb 2015	WO
WO-2015021280	Feb 2015	WO
WO-2015031689	Mar 2015	WO
WO-2015040075	Mar 2015	WO
WO-2015054292	Apr 2015	WO
WO-2015066174	May 2015	WO
WO-2015081114	Jun 2015	WO
WO-2015081142	Jun 2015	WO
WO-2015081440	Jun 2015	WO
WO-2015090879	Jun 2015	WO
WO-2015095404	Jun 2015	WO
WO-2015120403	Aug 2015	WO
WO-2015136072	Sep 2015	WO
WO-2015160004	Oct 2015	WO
WO-2015175832	Nov 2015	WO
WO-2016007604	Jan 2016	WO
WO-2016011080	Jan 2016	WO
WO-2016022557	Feb 2016	WO
WO-2016053883	Apr 2016	WO
WO-2016055956	Apr 2016	WO
WO-2016065056	Apr 2016	WO
WO-2016126882	Aug 2016	WO
WO-2016126987	Aug 2016	WO
WO-2016130868	Aug 2016	WO
WO-2016161244	Oct 2016	WO
WO-2016162127	Oct 2016	WO
WO-2016164779	Oct 2016	WO
WO-2016172377	Oct 2016	WO
WO-2016173719	Nov 2016	WO
WO-2016183100	Nov 2016	WO
WO-2017049231	Mar 2017	WO
WO-2017053450	Mar 2017	WO
WO-2017059399	Apr 2017	WO
WO-2017095958	Jun 2017	WO
WO-2017100441	Jun 2017	WO
WO-2017118761	Jul 2017	WO
WO-2017158103	Sep 2017	WO
WO-2017214574	Dec 2017	WO
WO-2018026920	Feb 2018	WO
WO-2018038772	Mar 2018	WO
WO-2018057526	Mar 2018	WO
WO-2018094263	May 2018	WO
WO-2018112426	Jun 2018	WO
WO-2018119246	Jun 2018	WO
WO-2018156792	Aug 2018	WO
WO-2018170164	Sep 2018	WO
WO-2018170169	Sep 2018	WO
WO-2018170559	Sep 2018	WO
WO-2018200380	Nov 2018	WO
WO-2018231872	Dec 2018	WO
WO-2019014781	Jan 2019	WO
WO-2019051501	Mar 2019	WO
WO-2019079769	Apr 2019	WO
WO-2019084500	May 2019	WO
WO-2019136175	Jul 2019	WO
WO-2019222706	Nov 2019	WO
WO-2020139871	Jul 2020	WO
WO-2020176362	Sep 2020	WO
WO-2020176678	Sep 2020	WO
WO-2020176680	Sep 2020	WO
WO-2020257612	Dec 2020	WO
WO-2021119193	Jun 2021	WO

Non-Patent Literature Citations (594)

Entry
Alberts et al.: Molecular Biology of the Cell. 4th edition. New York: Garland Science; 2002. The Generation of Antibody Diversity. https://www.ncbi.nlm.nih.gov/books/NBK26860/ .
Almagro et al.: Progress and Challenges in the Design and Clinical Development of Antibodies for Cancer Therapy. Frontiers in immunology; 8, 1751 (2018) doi:10.3389/fimmu.2017.01751 https://www.frontiersin.org/articles/10.3389/fimmu.2017.01751/full.
Bai. A Novel Human scFv Library with Non-Combinatorial Synthetic CDR Diversity. PLoS One. 10(10):1-18 (2015).
Berg: Biochemistry. 5th ED. New York (2002) 148-149.
Borda et al.: Secret writing by DNA hybridization. Acta Technica Napocensis Electronics and Telecommunications. 50(2):21-24 (2008).
Chervin et al.: Design of T-cell receptor libraries with diverse binding properties to examine adoptive T-cell responses. Gene Therapy. 20(6):634-644 (2012).
Cui et al.: Information Security Technology Based on DNA Computing. International Workshop on Anti-Counterfeiting, Security and Identification (ASID); IEEE Xplore 4 pages (2007).
Fernández-Quintero et al.: Characterizing the Diversity of the CDR-H3 Loop Conformational Ensembles in Relationship to Antibody Binding Properties. Front. Immunol. 9:1-11 (2019).
GE Healthcare. AKTA oligopilot plus. Data File 18-114-66 AD©. 8 pages (2006).
GE Healthcare. Robust and cost-efficient oligonucleotide synthesis. Application Note 28-4058-08 AA. 4 pages (2005).
Geetha et al.: Survey on Security Mechanisms for Public Cloud Data. 2016 International Conference on Emerging Trends in Engineering, Technology and Science (ICETETS). 8 pages (2016).
Goodwin et al.: immunoglobulin heavy chain variable region, partial [Homo sapiens], Genbank entry (online). National Institute of Biotechnology Information. (2018) https://www.ncbi.nim.nih.gov/protein/AXA12486.1.
Hauser et al.: Trends in GPCR drug discovery: new agents, targets and indications. Nature Reviews Drug Discovery, 16, 829-842 (2017). doi:10.1038/nrd.2017.178 https://www.nature.com/articles/nrd.2017.178.
Hopcroft et al.: What is the Young's Modulus of Silicon?. Journal of Microelectromechanical Systems. 19(2):229-238 (2010).
Hötzel et al.: A strategy for risk mitigation of antibodies with fast clearance. mAbs, 4(6), 753-760 (2012). doi:10.4161/mabs.22189 https://www.ncbi.nlm.nih.gov/pubmed/23778268.
Hudson: Matrix Assisted Synthetic Transformations: A Mosaic of Diverse Contributions. Journal of Combinatorial Chemistry. 1(6):403-457 (1999).
Jaiswal et al.: An architecture for creating collaborative semantically capable scientific data sharing infrastructures. Proceeding WIDM '06 Proceedings of the 8th annual ACM international workshop on Web information and data management. ACM Digital Library pp. 75-82 (2006).
Jang et al.: Characterization of T cell repertoire of blood, tumor, and ascites in ovarian cancer patients using next generation sequencing. Oncoimmunology, 4(11):e1030561:1-10 (2015).
Kalva et al.: Gibson Deletion: a novel application of isothermal in vitro recombination. Biological Procedures Online. 20(1):1-10 (2018).
Lebl et al.: Economical Parallel Oligonucleotide and Peptide Synthesizer—Pet Oligator. Int. J. Peptide Res. Ther. 13(1-2):367-376 (2007).
Malecek et al.: Engineering improved T cell receptors using an alanine-scan guided T cell display selection system. Journal of Immunological Methods. Elsevier Science Publishers. 392(1):1-11 (2013).
MLAB 2321 Molecular Diagnostics for Clinical Laboratory Science. Mar. 6, 2015.
Momentiv. Technical Data Sheet. Silquest A-1100. Momentiv. 1-6 (2020).
(Novartis Institutes for Biomedical Research) Immunoglobulin Heavy Chain [Homo sapiens]. National Center for Biotechnology Information. Genbank Entry, pp. 1-2 (2018) https://www.ncbi.nlm.nih.gov/nuccore/MH975524.1ttps://https://www.ncbi.nlm.nih.gov/nuccore/MH975524.1 .
(Novartis Institutes for Biomedical Research) Immunoglobulin Lambda Chain [Homo sapiens]. National Center for Biotechnology Information. Genbank Entry, pp. 1-2 (2018) https://www.ncbi.nlm.nih.gov/nuccore/MH975524.1.
Nucleic acid thermodynamics. Wikipedia. Feb. 4, 2021.
O'Driscoll et al.: Synthetic DNA: The next generation of big data storage. Bioengineered. 4(3):123-125(2013).
Opposition to European Patent No. 3030682 filed Mar. 3, 2021.
Paul et al.: Acid binding and detritylation during oligonucleotide synthesis. Nucleic Acids Research. 15. pp. 3048-3052 (1996).
PCT/US2018/037152 International Preliminary Report on Patentability dated Dec. 17, 2019.
PCT/US2018/037161 International Preliminary Report on Patentability dated Dec. 17, 2019.
PCT/US2018/050511 International Preliminary Report on Patentability dated Mar. 17, 2020.
PCT/US2018/056783 International Preliminary Report on Patentability dated Apr. 30, 2020.
PCT/US2018/057857 International Preliminary Report on Patentability dated Apr. 28, 2020.
PCT/US2019/012218 International Preliminary Report on Patentability dated Jul. 16, 2020.
PCT/US2019/032992 International Preliminary Report on Patentability dated Nov. 24, 2020.
PCT/US2019/068435 International Preliminary Report on Patentability dated Jul. 8, 2021.
PCT/US2019/068435 International Search Report and Written Opinion dated Apr. 23, 2020.
PCT/US2020/019371 International Search Report and Written Opinion dated Jun. 25, 2020.
PCT/US2020/019986 International Search Report and Written Opinion dated Jul. 29, 2020.
PCT/US2020/019986 Invitation to Pay Additional Fees dated Jun. 5, 2020.
PCT/US2020/019988 International Search Report and Written Opinion dated Jul. 29, 2020.
PCT/US2020/019988 Invitation to Pay Additional Fees dated Jun. 8, 2020.
PCT/US2020/038679 International Search Report and Written Opinion dated Oct. 28, 2020.
PCT/US2020/052291 International Search Report and Written Opinion dated Mar. 10, 2021.
PCT/US2020/052291 Invitation to Pay Additional Fees dated Dec. 31, 2020.
PCT/US2020/052306 International Search Report and Written Opinion dated Mar. 2, 2021.
PCT/US2020/052306 Invitation to Pay Additional Fees dated Dec. 18, 2020.
PCT/US2020/064106 International Search Report and Written Opinion dated Jun. 3, 2021.
PCT/US2020/064106 Invitation to Pay Additional Fees dated Apr. 9, 2021.
Pigott et al.: The Use of a Novel Discovery Platform to Identify Peptide-Grafted Antibodies that Activate GLP-1 Receptor Signaling. Innovative Targeting Solutions Inc. (2013) XP055327428 retrieved from the internet: http://www.innovativetargeting.com/wo-content/uploads/2013/12/Pigott-et-al-Antibody-Engineering-2013.pdf.
Ponsel. High Affinity, Developability and Functional Size: The Holy Grail of Combinatorial Antibody Library Generation. Molecules. 16:3675-3700 (2011).
PubChem Data Sheet Acetonitrile. Printed from website https://pubchem.ncbi.nlm.nih.gov/ pp. 1-124 (2020).
PubChem Data Sheet Dichloromethane. Printed from website https://pubchem.ncbi.nlm.nih.gov/compound/Dichloromethane (2020).
PubChem Data Sheet Methylene Chloride. Printed from website https://pubchem.ncbi.nlm.nih.gov/ pp. 1-140 (2020).
Rajpal et al.: A general method for greatly improving the affinity of antibodies by using combinatorial libraries. Proc. Natl. Acad. Sci. 102(24):8466-8471 (2005).
Regep et al.: The H3 loop of antibodies shows unique structural characteristics. Proteins. 85(7):1311-1318 (2017).
Shipman et al.: Molecular recordings by directed CRISPR spacer acquisition. Science. 353(6298):1-16 (2016).
U.S. Appl. No. 15/151,316 Final Office Action dated Jul. 9, 2020.
U.S. Appl. No. 15/156,134 Final Office Action dated Aug. 18, 2021.
U.S. Appl. No. 15/156,134 Office Action dated Nov. 25, 2020.
U.S. Appl. No. 15/245,054 Notice of Allowance dated Dec. 14, 2017.
U.S. Appl. No. 15/272,004 Final Office Action dated Mar. 18, 2021.
U.S. Appl. No. 15/272,004 Office Action dated Jun. 12, 2020.
U.S. Appl. No. 15/619,322 Final Office Action dated Jul. 9, 2021.
U.S. Appl. No. 15/619,322 Final Office Action dated Mar. 30, 2020.
U.S. Appl. No. 15/619,322 Office Action dated Nov. 4, 2020.
U.S. Appl. No. 15/816,995 Office Action dated May 19, 2020.
U.S. Appl. No. 15/835,342 Final Office Action dated Sep. 8, 2020.
U.S. Appl. No. 15/835,342 Office Action dated Apr. 16, 2021.
U.S. Appl. No. 15/902,855 Restriction Requirement dated Apr. 6, 2021.
U.S. Appl. No. 15/921,479 Final Office Action dated Jun. 15, 2020.
U.S. Appl. No. 15/921,479 Office Action dated Apr. 27, 2021.
U.S. Appl. No. 15/991,992 Office Action dated May 21, 2020.
U.S. Appl. No. 15/991,992 Restriction Requirement dated Mar. 10, 2020.
U.S. Appl. No. 16/031,784 Office Action dated May 12, 2020.
U.S. Appl. No. 16/039,256 Final Office Action dated Mar. 30, 2021.
U.S. Appl. No. 16/039,256 Office Action dated Aug. 20, 2020.
U.S. Appl. No. 16/039,256 Restriction Requirement dated May 18, 2020.
U.S. Appl. No. 16/128,372 Final Office Action dated Mar. 18, 2021.
U.S. Appl. No. 16/128,372 Office Action dated Oct. 8, 2020.
U.S. Appl. No. 16/128,372 Restriction Requirement dated May 18, 2020.
U.S. Appl. No. 16/165,952 Office Action dated Mar. 12, 2020.
U.S. Appl. No. 16/239,453 Office Action dated May 11, 2020.
U.S. Appl. No. 16/384,678 Final Office Action dated Oct. 15, 2020.
U.S. Appl. No. 16/530,717 Final Office Action dated Apr. 15, 2020.
U.S. Appl. No. 16/535,777 Final Office Action dated Oct. 20, 2020.
U.S. Appl. No. 16/535,777 Office Action dated Feb. 8, 2021.
U.S. Appl. No. 16/798,275 Office Action dated Feb. 10, 2021.
U.S. Appl. No. 16/854,719 Restriction Requirement dated Jul. 28, 2021.
U.S. Appl. No. 16/906,555 Office Action dated Aug. 17, 2021.
U.S. Appl. No. 17/154,906 Restriction Requirement dated Jul. 26, 2021.
U.S. Appl. No. 15/921,537 Office Action dated Apr. 1, 2020.
Van der Velde: Thesis. Finding the Strength of Glass. Delft University of Technology. 1-16 (2015).
Xu et al.: Coordination between the Polymerase and 5 ′-Nuclease Components of DNA Polymerase I of Escherichia coli. The Journal of Biological Chemistry. 275(27):20949-20955 (2000).
Yazdi et al.: DNA-Based Storage: Trends and Methods. IEEE Transactions on Molecular, Biological and Multi-Scale Communications. IEEE. 1(3):230-248 (2016).
PCT/US2020/019371 International Preliminary Report on Patentability dated Sep. 2, 2021.
PCT/US2020/019986 International Preliminary Report on Patentability dated Sep. 10, 2021.
PCT/US2020/019988 International Preliminary Report on Patentability dated Sep. 10, 2021.
U.S. Appl. No. 16/802,439 Restriction Requirement dated Oct. 1, 2021.
U.S. Appl. No. 16/879,705 Office Action dated Sep. 9, 2021.
U.S. Appl. No. 16/798,275 Final Office Action dated Aug. 30, 2021.
Abudayyeh et al.: C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector. Science, available on line, Jun. 13, 2016, at: http://zlab.mit.edu/assets/reprints/Abudayyeh_OO_Science_2016.pdf, 17 pages.
Acevedo-Rocha et al.: Directed evolution of stereoselective enzymes based on genetic selection as opposed to screening systems. J. Biotechnol. 191:3-10 (2014).
Adessi et al. Solid phase DNA amplification: characterisation of primer attachment and amplification mechanisms. Nucleic Acids Res. 28(20):E87, 2000.
Alexeyev et al.: Gene synthesis, bacterial expression and purification of the Rickettsia prowazekii ATP/ADP translocase, Biochimica et Biophysics Acta, 1419:299-306, 1999.
Ai-Housseiny et al.: Control of interfacial instabilities using flow geometry Nature Physics, 8:747-750, 2012.
Amblard et al.: A magnetic manipulator for studying local rheology and micromechanical properties of biological systems, Rev. Sci. Instrum., 67(3):18-827, 1996.
AndonI and Indyk, Near-Optimal Hashing Algorithms for Approximate Nearest Neighbor in High Dimensions, Communications of the ACM, 51(1):117-122, 2008.
Arand et al.: Structure of Rhodococcus erythropolis limonene-1,2-epoxide hydrolase reveals a novel active site. EMBO J. 22:2583-2592 (2003).
Arkles et al.: The Role of Polarity in the Structure of Silanes Employed in Surface Modification. Silanes and Other Coupling Agents. 5:51-64, 2009.
Arkles: Hydrophobicity, Hydrophilicity Reprinted with permission from the Oct. 2006 issue of Paint & Coatings Industry magazine, Retrieved on Mar. 19, 2016, 10 pages.
Assembly manual for the POSaM: The ISB Piezoelelctric Oligonucleotide Synthesizer and Microarrayer, The Institute for Systems Biology, May 28, 2004 (50 pages).
Assi et al.: Massive-parallel adhesion and reactivity-measurements using simple and inexpensive magnetic tweezers. J. Appl. Phys. 92(9):5584-5586 (2002).
ATDBio: Nucleic Acid Structure, Nucleic Acids Book, 9 pages, published on Jan. 22, 2005. from: http://www.atdbio.eom/content/5/Nucleic-acid-structure.
ATDBio: Solid-Phase Oligonucleotide Synthesis, Nucleic Acids Book, 20 pages, Published on Jul. 31, 2011. from: http://www.atdbio.com/content/17/Solid-phase-oligonucleotide-synthesis.
Au et al.: Gene synthesis by a LCR-based approach: high level production of Leptin-L54 using synthetic gene in Escherichia coli. Biochemical and Biophysical Research Communications 248:200-203 (1998).
Baedeker et al.: Overexpression of a designed 2.2kb gene of eukaryotic phenylalanine ammonialyase in Escherichia coli⋅. FEBS Letters, 457:57-60, 1999.
Barbee et al.: Magnetic Assembly of High-Density DNA Arrays for Genomic Analyses. Anal Chem. 80(6):2149-2154, 2008.
Barton et al.: A desk electrohydrodynamic jet printing system. Mechatronics, 20:611-616, 2010.
Beaucage et al.: Advances in the synthesis of oligonucleotides by the phosphoramidite approach. Tetrahedron. 48:2223-2311, 1992.
Beaucage et al.: Deoxynucleoside phosphoramidites—A new class of key intermediates for deoxypolynucleotide synthesis. Tetrahedron Lett. 22(20):1859-1862, 1981.
Beaucage et al.: The Chemical synthesis of DNA/RNA Chapter 2 in: Encyclopedia of Cell Biology, 1:36-53, 2016.
Beaulieu et al.: PCR candidate region mismatch scanning adaptation to quantitative, high-throughput genotyping, Nucleic Acids Research, 29(5):1114-1124, 2001.
Beigelman et al.: Base-modified phosphoramidite analogs of pyrimidine ribonucleosides for RNA structure-activity studies. Methods Enzymol. 317:39-65, 2000.
Bethge et al.: Reverse synthesis and 3′-modification of RNA. Jan. 1, 2011, pp. 64-64, XP055353420. Retrieved from the Internet: URL:http://www.is3na.org/assets/events/Category%202-Medicinal %20Chemistry%20of%2001igonucleotides%20%2864-108%29.pdf.
Binkowski et al.: Correcting errors in synthetic DNA through consensus shuffling. Nucleic Acids Research, 33(6):e55, 8 pages, 2005.
Biswas et al.: Identification and characterization of a thermostable MutS homolog from Thennus aquaticus, The Journal of Biological Chemistry, 271(9):5040-5048, 1996.
Biswas et al.: Interaction of MutS protein with the major and minor grooves of a heteroduplex DNA, The Journal of Biological Chemistry, 272(20):13355-13364, 1997.
Bjornson et al.: Differential and simultaneous adenosine Di- and Triphosphate binding by MutS, The Journal of Biological Chemistry, 278(20):18557-18562, 2003.
Blanchard, et al.: High-Density Oligonucleotide Arrays, Biosensors & Bioelectronics, 11(6/7):687-690, 1996.
Blanchard: Genetic Engineering, Principles and Methods, vol. 20, Ed. J. Sedlow, New York: Plenum Press, p. 111-124, 1979.
Blawat et al.: Forward error correction for DNA data storage. Procedia Computer Science, 80:1011-1022, 2016.
Bonini and Mondino: Adoptive T-cell therapy for cancer: The era of engineered T cells. European Journal of Immunology, 45:2457-2469, 2015.
Bornholt et al.: A DNA-Based Archival Storage System, in International Conference on Architectural Support for Programming Languages and Operating Systems (ASPLOS), Apr. 2-6, 2016, Atlanta, GA, 2016, 637-649.
Borovkov et al.: High-quality gene assembly directly from unpurified mixtures of microassay-synthesized oligonucleotides. Nucleic Acid Research, 38(19):e180, 10 pages, 2010.
Brunet: Aims and methods of biosteganography. Journal of Biotechnology, 226:56-64, 2016.
Buermans et al.: Next Generation sequencing technology: Advances and applications, Biochimica et Biophysica Acta (BBA)—Molecular Basis of Disease, 1842:1931-1941, 2014.
Butler et al.: In situ synthesis of oligonucleotide arrays by using surface tension. J Am Chem Soc. 123(37):8887-94, 2001.
Calvert: Lithographically patterned self-assembled films. In: Organic Thin Films and Surfaces: Directions for The Nineties, vol. 20, p. 109, ed. By Abraham Ulman, San Diego: Academic Press, 1995.
Cardelli. Two-Domain DNA Strand Displacement, Electron. Proc. Theor. Comput. Sci., 26:47-61, 2010.
Carlson. Time for New DNA Synthesis and Sequencing Cost Curves, 2014. [Online], Available: http://www.synthesis.cc/synthesis/2014/02/time_for_new_cost_curves_2014. 10 pages.
Carr et al.: Protein-mediated error correction for de novo DNA synthesis. Nucleic Acids Res. 32(20):e162, 9 pages, 2004.
Carter and Friedman. DNA synthesis and Biosecurity: Lessons learned and options for the future. J. Craig Venter Institute, La Jolla, CA, 28 pages, Oct. 2015.
Caruthers. Chemical synthesis of deoxyoligonucleotides by the phosphoramidite method. In Methods in Enzymology, Chapter 15, 154:287-313, 1987.
Caruthers. The Chemical Synthesis of DNA/RNA: Our Gift to Science. J. Biol. Chem., 288(2):1420-1427, 2013.
Caruthers. Gene synthesis machines: DNA chemistry and its uses. Science 230(4723):281-285 (1985).
Casmiro et al.: PCR-based gene synthesis and protein NMR spectroscopy, Structure, 5(11):1407-1412, 1997.
CeGaT. Tech Note available at https://www.cegat.de/web/wp-content/uploads/2018/06/Twist-Exome-Tech-Note.pdf (4 pgs.) (2018).
Cello et al.: Chemical synthesis of poliovirus cDNA: generation of infectious virus in the absence of natural template. Science. 297(5583):1016-8, 2000.
Chalmers et al.: Scaling up the ligase chain reaction-based approach to gene synthesis. Biotechniques. 30(2):249-52, 2001.
Chan et al.: Natural and engineered nicking endonucleases—from cleavage mechanism to engineering of strand-specificity. Nucleic Acids Res. 39(1):1-18, 2011.
Chen et al.: Programmable chemical controllers made from DNA, Nat. Nanotechnol., 8(10):755-762, 2013.
Chen et al.: Chemical modification of gene silencing oligonucleotides fordrug discovery and development. Drug Discov Today. 10(8):587-93 2005.
Cheng et al.: High throughput parallel synthesis of oligonucleotides with 1536 channel synthesizer. Nucleic Acids Res. 30(18):e93, 2002.
Chilamakuri et al.: Performance comparison of four exome capture systems for deep sequencing. BMC Genomics 15(1):449 (2014).
Cho et al.: Capillary passive valve in microfluidic systems. NSTI-Nanotech. 2004; 1:263-266.
Chrisey et al.: Fabrication of patterned DNA surfaces Nucleic Acids Research, 24(15):3040-3047 (1996).
Chung et al.: One-step preparation of competent Escherichia coli: Transformation and storage of bacterial cells in the same solution. Proc Natl Acad Sci U S A. Apr. 1989;86(7):2172-2175.
Church et al.: Next-generation digital information storage in DNA. Science, 337:6102, 1628-1629, 2012.
Cleary et al.: Production of complex nucleic acid libraries using highly parallel in situ oligonucleotide synthesis. Nat Methods 1(3):241-248 (2004).
Cohen et al.: Human population: The next half century. Science, 302:1172-1175, 2003.
Crick. On protein synthesis. Symp Soc Exp Biol12:138-163,1958.
Cruse et al.: Atlas of Immunology, Third Edition. Boca Raton:CRC Press (pp. 282-283) (2010).
Cutler et al.: High-throughput variation detection and genotyping using microarrays, Genome Research, vol. 11, 1913-19 (2001).
Dahl et al.: Circle-to-circle amplification for precise and sensitive DNA analysis. Proc Natl Acad Sci U S A. Mar. 30, 2004;101(13):4548-53. Epub Mar. 15, 2004.
De Mesmaeker et al.: Backbone modifications in oligonucleotides and peptide nucleic acid systems. Curr Opin Struct Biol. Jun. 1995;5(3):343-55.
De Silva et al.: New Trends of Digital Data Storage in DNA. BioMed Res Int. 2016:8072463 (2016).
Deamer et al.: Characterization of nucleic acids by nanopore analysis, Ace. Cham. Res., vol. 35, No. 10, 817-825 (2002).
Deaven. The Human Genome Project: Recombinant clones for mapping and sequencing DNA. Los Alamos Science, 20:218-249, 1992.
Deng et al.: Targeted bisulfite sequencing reveals changes in DNA methylation associated with nuclear reprogramming Nature Biotechnology, 27:352-360 (2009).
Dietrich.et al.: Gene assembly based on blunt-ended double-stranded DNA-modules, Biotechnology Techniques, vol. 12, No. 1, 49-54 (Jan. 1998).
Dillon et al.: Exome sequencing has higher diagnostic yield compared to simulated disease-specific panels in children with suspected monogenic disorders. Eur J Hum Genet 26(5):644-651 (2018).
Dormitzer et al.: Synthetic generation of influenza vaccine viruses for rapid response to pandemics. Sci Translational Medicine, 5(185):185ra68, 14 pages, 2013.
Doudna et al.: Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science 346(6213):1258096-1-1258096-9, 2014.
Douthwaite et al.: Affinity maturation of a novel antagonistic human monoclonal antibody with a long VH CDR3 targeting the Class A GPCR formyl-peptide receptor 1; mAbs, vol. 7, Iss. 1, pp. 152-166 (Jan. 1, 2015).
Dower et al.: High efficiency transformation of E. coliby high voltage electroporation. Nucleic Acids Res. 16(13):6127-45 (1988).
Dressman et al.: Transforming single DNA molecules into fluorescent magnetic particles for detection and enumeration of genetic variations. Proc Natl Acad Sci U S A. Jul. 22, 2003;100(15):8817-22. Epub Jul. 11, 2003.
Drmanac et al.: Human genome sequencing using unchained base reads on self-assembling DNA nanoarrays. Science. Jan. 1, 2010;327(5961):78-81. doi: 10.1126/science.1181498. Epub Nov. 5, 2009.
Droege and Hill, The Genome Sequencer FLXTM System-Longer reads, more applications, straight forward bioinformatics and more complete data sets Journal of Biotechnology, 136:3-10, 2008.
Duffy et al.: Rapid Prototyping of Microfluidic Systems in Poly(dimethylsiloxane). Anal Chem. Dec. 1, 1998;70(23):4974-84. doi: 10.1021/ac980656z.
Duggan et al.: Expression profiling using cDNA microarrays. Nat Genet. Jan. 1999;21(1 Suppl):10-4.
Dvorsky. Living Bacteria Can Now Store Data. GIZMODO internet publication. Retrieved from https://gizmodo.com/living-bacteria-can-now-store-data-1781773517 (4 pgs) (Jun. 10, 2016).
Eadie et al.: Guanine modification during chemical DNA synthesis. Nucleic Acids Res. Oct. 26, 1987;15(20):8333-49.
Eisen. A phylogenomic study of the MutS family of proteins, Nucleic Acids Research, vol. 26, No. 18, 4291-4300 (1998).
Ellis et al.: DNA assembly for synthetic biology: from parts to pathways and beyond. Integr Biol (Camb). Feb. 2011;3(2):109-18. doi: 10.1039/c0ib00070a. Epub Jan. 19, 2011.
El-Sagheer et al.: Biocompatible artificial DNA linker that is read through by DNA polymerases and is functional in Escherichia coli. Proc Natl Acad Sci U S A. Jul. 12, 2011;108(28):11338-43. doi: 10.1073/pnas.1101519108. Epub Jun. 27, 2011.
Elsik et al.: The Genome sequence of taurine cattle: A window of ruminant biology and evolution. Science, 324:522-528, 2009.
Elsner et al.: 172 nm excimer VUV-triggered photodegradation and micropatterning of aminosilane films, Thin Solid Films, 517:6772-6776 (2009).
Engler et al.: A one pot, one step, precision cloning method with high throughput capability. PLoS One. 2008;3(11):e3647. doi: 10.1371/journal.pone.0003647. Epub Nov. 5, 2008.
Engler et al.: Golden gate shuffling: a one-pot DNA shuffling method based on type IIs restriction enzymes. PLoS One. 2009;4(5):e5553. doi: 10.1371/journal.pone.0005553. Epub May 14, 2009.
Erlich and Zielinski, DNA fountain enables a robust and efficient storage architecture. Science, 355(6328):950-054, 2017.
Eroshenko et al.: Gene Assembly from Chip-Synthesized Oligonucleotides; Current Protocols in Chemical biology 4: 1-17 (2012).
European Patent Application No. 12827479.2 Extended European Search Report dated May 18, 2015.
European Patent Application No. 12827479.2 Office Action dated Apr. 10, 2019.
European Patent Application No. 12827479.2 Partial European Search Report dated Jan. 29, 2015.
European Patent Application No. 14834665.3 Communication dated Jan. 16, 2018.
European Patent Application No. 14834665.3 extended European Search Report dated Apr. 28, 2017.
European Patent Application No. 14834665.3 Further Examination Report dated Nov. 28, 2018.
European Patent Application No. 14834665.3 Office Action dated May 2, 2018.
European Patent Application No. 16847497.1 Extended European Search Report dated Jan. 9, 2019.
European Patent Application No. 16871446.7 European Search Report dated Apr. 10, 2019.
European Patent Application No. 16871446.7 First Official Action dated Nov. 13, 2019.
Evans et al.: DNA Repair Enzymes. Current Protocols in Molecular Biology 84:III:3.9:3.9.1-3.9.12 http://www.ncbi.nlm.nih.gov/pubmed/18972391 (Published online Oct. 1, 2008 Abstract only provided).
Fahy et al.: Self-sustained sequence replication (3SR): an isothermal transcription-based amplification system alternative to PCR. PCR Methods Appl. Aug. 1991;1(1):25-33.
Fedoryak et al.: Brominated hydroxyquinoline as a photolabile protecting group with sensitivity to multiphoton excitation, Org. Lett., vol. 4, No. 2, 3419-3422 (2002).
Ferretti et al.: Total synthesis of a gene for bovine rhodopsin. PNAS, 83:599-603 (1986).
Finger et al.: The wonders of Flap Endonucleases: Structure, function, mechanism and regulation. Subcell Biochem., 62:301-326, 2012.
Fodor et al.: Light-directed, spatially addressable parallel chemical synthesis. Science. 251(4995):767-773 (1991).
Fogg et al.: Structural basis for uracil recognition by archaeal family B DNA polymerases. Nature Structural Biology, 9(12):922-927, 2002.
Foldesi et al.: The synthesis of deuterionucleosides. Nucleosides Nucleotides Nucleic Acids. Oct.-Dec. 2000;19(10-12):1615-56.
Frandsen et al.: Efficient four fragment cloning for the construction of vectors for targeted gene replacement in filamentous fungi. BMC Molecular Biology 2008, 9:70.
Frandsen. Experimental setup. Dec. 7, 2010, 3 pages. http://www.rasmusfrandsen.dk/experimental_setup.htm.
Frandsen. The USER Friendly technology. USER cloning. Oct. 7, 2010, 2 pages. http://www.rasmusfrandsen.dk/user_cloning.htm.
Fullwood et al.: Next-generation DNA sequencing of paired-end tags [PET] fortranscriptome and genome analysis Genome Research, 19:521-532, 2009.
Galka et al.: QuickLib, a method for building fully synthetic plasmid libraries by seamless cloning of degenerate oligonucleotides. Plos One, 12, e0175146:1-9 (2017).
Galka et al.: QuickLib, a method for building fully synthetic plasmid libraries by seamless cloning of degenerate oligonucleotides. Plos One, 12, e0175146:S1 figure (2017).
Galka et al.: QuickLib, a method for building fully synthetic plasmid libraries by seamless cloning of degenerate oligonucleotides. Plos One, 12, e0175146:S1 Table (2017).
Galka et al.: QuickLib, a method for building fully synthetic plasmid libraries by seamless cloning of degenerate oligonucleotides. Plos One, 12, e0175146:S2 figure (2017).
Galneder et al.: Microelectrophoresis of a bilayer-coated silica bead in an optical trap: application to enzymology. Biophysical Journal, vol. 80, No. 5, 2298-2309 (May 2001).
Gao et al.: A method for the generation of combinatorial antibody libraries using pIX phage display. PNAS 99(20):12612-12616 (2002).
Gao et al.: A flexible light-directed DNA chip synthesis gated by deprotection using solution photogenerated acids. Nucleic Acids Res. Nov. 15, 2001;29(22):4744-50.
Gao et al.: Thermodynamically balanced inside-out (TBIO) PCR-based gene synthesis: a novel method of primer design for high-fidelity assembly of longer gene sequences. Nucleic Acids Res. Nov. 15, 2003;31(22):e143.
Garaj et al.: Graphene as a subnanometre trans-electrode membrane. Nature. Sep. 9, 2010;467(7312):190-3. doi: 10.1038/nature09379.
Garbow et al.: Optical tweezing electrophoresisof isolated, highly charged colloidal spheres, Colloids and Surfaces A: Physiochem. Eng. Aspects, vol. 195, 227-241 (2001).
GeneArt Seamless Cloning and Assembly Kits. Life Technologies Synthetic Biology. 8 pages, available online Jun. 15, 2012.
Genomics 101. An Introduction to the Genomic Workflow. 2016 edition, 64 pages. Available at: http://www.frontlinegenomics.com/magazine/6757/genomics-101/.
Geu-Flores et al.: USER fusion: a rapid and efficient method for simultaneous fusion and cloning of multiple PCR products. Nucleic Acids Res. 2007;35(7):e55. Epub Mar. 27, 2007.
Gibson Assembly. Product Listing. Application Overview. 2 pages, available online Dec. 16, 2014.
Gibson et al.: Creation of a Bacterial Cell Controlled by A Chemically Synthesized Genome. Science 329(5989):52-56 (2010).
Gibson et al.: Complete chemical synthesis, assembly, and cloning of a Mycoplasma genitalium genome. Science. Feb. 29, 2008;319(5867):1215-20. doi: 10.1126/science.1151721. Epub Jan. 24, 2008.
Goldfeder et al.: Medical implications of technical accuracy in genome sequencing. Genome Med 8(1):24 (2016).
Goldman et al.: Towards practical, high-capacity, low-maintenance information storage in synthesized DNA, Nature, 494(7435):77-80, 2013.
Gosse et al.: Magnetic tweezers: micromanipulation and force measurement at the molecular level, Biophysical Journal, vol. 8, 3314-3329 (Jun. 2002).
Grass et al.: Robust chemical preservation of digital information on DNA in silica with error-correcting codes, Angew. Chemie—Int. Ed., 54(8):2552-2555, 2015.
Greagg et al.: A read-ahead function in archaeal DNA polymerases detects promutagenic template-strand uracil. Proc. Nat. Acad. Sci. USA, 96:9045-9050, 1999.
Grovenor. Microelectronic materials. Graduate Student Series in Materials Science and Engineering. Bristol, England: Adam Hilger, 1989; p. 113-123.
Gu et al.: Depletion of abundant sequences by hybridization (DASH): using Cas9 to remove unwanted high-abundance species in sequencing libraries and molecular counting applications. Genome Biology, 17:41, 13 pages, 2016.
Haber et al.: Magnetic tweezers for DNA micromanipulation, Rev. Sci. Instrum., vol. 71, No. 12, 4561-4570 (Dec. 2000).
Han et al.: Linking T-cell receptor sequence to functional phenotype at the single-cell level. Nat Biotechnol 32(7):684-692 (2014).
Hanahan and Cold Spring Harbor Laboratory, Studies on transformation of Escherichia coli with plasmids J. Mol. Biol. 166:557-580 (1983).
Hanahan et al.: Plasmid transformation of Escherichia coli and other bacteria. Methods Enzymol, vol. 204, p. 63-113 (1991).
Harada et al.: Unexpected substrate specificity of T4 DNA ligase revealed by in vitro selection. Nucleic Acids Res. May 2, 19935;21(10):2287-91.
Heckers et al.: Error analysis of chemically synthesized polynucleotides, BioTechniques, vol. 24, No. 2, 256-260 (1998).
Herzer et al.: Fabrication of patterned silane based self-assembled monolayers by photolithography and surface reactions on silicon-oxide substrates Chem. Commun., 46:5634-5652 (2010).
Hoover et al.: DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis, Nucleic Acids Research, vol. 30, No. 10, e43, 7 pages (2002).
Hosu et al.: Magnetic tweezers for intracellular applications⋅, Rev. Sci. Instrum., vol. 74, No. 9, 4158-4163 (Sep. 2003).
Huang et al.: Three-dimensional cellular deformation analysis with a two-photon magnetic manipulator workstation, Biophysical Journal, vol. 82, No. 4, 2211⋅2223 (Apr. 2002).
Hughes et al.: Expression profiling using microarrays fabricated by an ink-jet oligonucleotide synthesizer Nat Biotech 4:342-347 (2001).
Hughes et al.: Principles of early drug discovery. Br J Pharmacol 162(2):1239-1249, 2011.
Hutchison et al.: Cell-free cloning using phi29 DNA polymerase. Proc Natl Acad Sci U S A. Nov. 29, 2005;102(48):17332-6. Epub Nov. 14, 2005.
Imgur: The magic of the internet. Uploaded May 10, 2012, 2 pages, retrieved from: https://imgur.com/mEWuW.
In-Fusion Cloning: Accuracy, Not Background. Cloning & Competent Cells, ClonTech Laboratories, 3 pages, available online Jul. 6, 2014.
International Application No. PCT/US2017/026232 International Preliminary Report on Patentability dated Feb. 26, 2019.
International Application No. PCT/US2017/045105 International Preliminary Report on Patentability dated Feb. 5, 2019.
International Application No. PCT/US2017/052305 International Preliminary Report on Patentability dated Apr. 30, 2019.
International Application No. PCT/US2017/062391 International Preliminary Report on Patentability dated May 21, 2019.
International Application No. PCT/US2018/019268 International Preliminary Report on Patentability dated Sep. 6, 2019.
International Application No. PCT/US2018/050511 International Search Report and Written Opinion dated Jan. 11, 2019.
International Application No. PCT/US2018/057857 International Search Report and Written Opinion dated Mar. 18, 2019.
International Application No. PCT/US2019/012218 International Search Report and Written Opinion dated Mar. 21, 2019.
International Application No. PCT/US2019/032992 International Search Report and Written Opinion dated Oct. 28, 2019.
International Application No. PCT/US2019/032992 Invitation to Pay Additional Fees dated Sep. 6, 2019.
Jackson et al.: Recognition of DNA base mismatches by a rhodium intercalator, J. Am. Chem. Soc., vol. 19, 12986⋅12987 (1997).
Jacobs et al.: DNAglycosylases: In DNA repairand beyond. Chromosoma 121:1-20 (2012)—http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3260424/.
Jacobus et al.: Optimal cloning of PCR fragments by homologous recombination in Escherichia soli. PLoS One 10(3):e0119221 (2015).
Jager et al.: Simultaneous Humoral and Cellular: Immune Response against Cancer—Testis Antigen NY-ES0-1: Definition of Human Histocompatibility Leukocyte Antigen (HLA)-A2—binding Peptide Epitopes. J. Exp. Med. 187(2):265-270 (1998).
Jinek et al.: A Programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science, 337:816-821, 2012.
Jo et al.: Engineering therapeutic antibodies targeting G-protein-coupled receptors; Experimental & Molecular Medicine; 48; 9 pages (2016).
Karagiannis and El-Osta, RNA interference and potential therapeutic applications of short interfering RNAs Cancer Gene Therapy, 12:787-795, 2005.
Ke et al.: Influence of neighboring base pairs on the stability of single base bulges and base pairs in a DNA fragment, Biochemistry, Vo. 34, 4593-4600 (1995).
Kelley et al.: Single-base mismatch detection based on charge transduction through DNA, Nucleic Acids Research, vol. 27, No. 24, 4830-4837 (1999).
Kim et al.: High-resolution patterns of quantum dots formed by electrohydrodynamic jet printing for light-emitting diodes. Nano Letters, 15:969-973, 2015.
Kim et al.: Site specific cleavage of DNA-RNA hybrids by zinc finger/Fok I cleavage domain fusions Gene, vol. 203, 43-49 (1997).
Kim et al.: Chimeric restriction endonuclease, Proc. Natl. Acad. Sci. USA, vol. 91, 883-887 (Feb. 1994).
Kim. The interaction between Z-ONA and the Zab domain of double-stranded RNA adenosine deaminase characterized using fusion nucleases, The Journal of Biological Chemistry, vol. 274, No. 27, 19081-19086 (1999).
Kinde et al.: Detection and quantification of rare mutations with massively parallel sequencing. Proc Natl Acad Sci U S A. Jun. 7, 2011;108(23):9530-5. Epub May 17, 2011.
Kodumal et al.: Total synthesis of long DNA sequences: synthesis of a contiguous 32-kb polyketide synthase gene cluster. Proc Natl Acad Sci U S A. Nov. 2, 2004;101(44):15573-8. Epub Oct. 20, 2004.
Koike-Yusa et al.: Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nature Biotechnology, 32:267-273, 2014 (with three pages of supplemental Online Methods).
Kong et al.: Parallel gene synthesis in a microfluidic device. Nucleic Acids Res., 35(8):e61 (2007).
Kong. Microfluidic Gene Synthesis. MIT Thesis. Submitted to the program in Media Arts and Sciences, School of Architecture and Planning, in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Media Arts and Sciences at the Massachusetts Institute of Technology. 143 pages Jun. 2008.
Kopp et al.: Chemical amplification: continuous-flow PCR on a chip, Science, vol. 280, 1046-1048 (May 15, 1998).
Kosuri and Church, Large-scale de novo DNA synthesis: technologies and applications, Nature Methods, 11:499-507, 2014. Available at: http://www.nature.com/nmeth/journal/v11/n5/full/nmeth.2918.html.
Kosuri et al.: A scalable gene synthesis platform using high-fidelity DNA microchips Nat.Biotechnol., 28(12):1295-1299, 2010.
Kosuri et al.: A scalable gene synthesis by selective amplification of DNA pools from high-fidelity microchips. Nature Biotechnology. 2010; 28:1295-1299.
Krayden, Inc., A Guide to Silane Solutions. Silane coupling agents. 7 pages. Published on May 31, 2005 at: http://krayden.com/pdf/xia_silane_chemistry.pdf.
Lagally et al.: Single-Molecule DNA Amplification and Analysis in an Integrated Microfluidic Device. Analytical Chemistry. 2001 ;73(3): 565-570.
Lahue et al.: DNA mismatch correction in a defined system, Science, vol. 425; No. 4914, 160-164 (Jul. 14, 1989).
Lambrinakos et al.: Reactivity of potassium permanganate and tetraethylammonium chloride with mismatched bases and a simple mutation detection protocol,Nucleic Acids Research, vol. 27, No. 8, 1866-1874 (1999).
Landegren et al.: A ligase-mediated gene detection technique. Science. Aug. 26, 1988;241(4869):1077-80.
Lang et al.: An automated two-dimensional optical force clamp for single molecule studies, Biophysical Journal, vol. 83, 491⋅501 (Jul. 2002).
Lashkari et al.: An automated multiplex oligonucleotide synthesizer: development of high-throughput, low-cost DNA synthesis. Proc Natl Acad Sci U S A. Aug. 15, 1995;92(17):7912-5.
Lausted et al.: POSaM: a fast, flexible, open-source, inkjet oligonucleotide synthesizer and microarrayer, Genome Biology, 5:R58, 17 pages, 2004. available at https://www.ncbi.nlm.nih.gov/pmc/articles/PMC507883/.
Leamon et al.: A massively parallel PicoTiterPlate based platform for discrete picoliter-scale polymerase chain reactions. Electrophoresis. Nov. 2003;24(21):3769-77.
Lee et al.: Microelectromagnets for the control of magnetic nanoparticles, Appl. Phys. Lett., vol. 79, No. 20, 3308-3310 (Nov. 12, 2001).
Lee et al.: A microfluidic oligonucleotide synthesizer. Nucleic Acids Research 2010 vol. 38(8):2514-2521. DOI: 10.1093/nar/gkq092.
Lee: Covalent End-Immobilization of Oligonucleotides onto Solid Surfaces; Thesis, Massachusetts Institute of Technology, Aug. 2001 (315 pages).
Leproust et al.: Agilent's Microarray Platform: How High-Fidelity DNA Synthesis Maximizes the Dynamic Range of Gene Expression Measurements. 2008; 1-12. http://www.miltenyibiotec.com/˜/media/Files/Navigation/Genomic%20Services/Agilent_DNA_Microarray_Platform.ashx.
Leproust et al.: Synthesis of high-quality libraries of long (150mer) oligonucleotides by a novel depurination controlled process. Nucleic Acids Research. 2010; 38(8):2522-2540.
Lesnikowski et al.: Nucleic acids and nucleosides containing carboranes. J. Organometallic Chem. 1999; 581:156-169.
Leumann. DNA analogues: from supramolecular principles to biological properties. Bioorg Med Chem. Apr. 2002;10(4):841-54.
Levene et al.: Zero-mode waveguides for single-molecule analysis at high concentrations. Science. Jan. 31, 2003;299(5607):682-6.
Lewontin and Harti, Population genetics in forensic DNA typing. Science, 254:1745-1750, 1991.
Li et al.: Beating Bias in the Directed Evolution of Proteins: Combining High-Fidelity on-Chip Solid-Phase Gene Synthesis with Efficient Gene Assembly for Combinatorial Library Construction. ChemBioChem 19:221-228 (2018).
Li et al.: Beating bias in the directed evolution of proteins: Combining high-fidelity on-chip solid-phase gene synthesis with efficient gene assembly for combinatorial library construction. First published Nov. 24, 2017, 2 pages, retrieved from: https://doi.org/10.1002/cbic.201700540.
Light source unit for printable patterning VUV-Aligner/ USHIO Inc., Link here: https://www.ushio.co.jp/en/products/1005.html, published Apr. 25, 2016, printed from the internet on Aug. 2, 2016, 3 pages.
Limbachiya et al.: Natural data storage: A review on sending information from now to then via Nature. ACM Journal on Emerging Technologies in Computing Systems, V(N):Article A, May 19, 2015, 17 pages.
Link Technologies. Product Guide 2010. Nov. 27, 2009, 136 pages. XP055353191. Retrieved from the Internet: URL:http://www.linktech.co.uk/documents/517/517.pdf.
Lipshutz et al.: High density synthetic oligonucleotide arrays, Nature Genetics Supplement, vol. 21, 20-24 (Jan. 1999).
Lishanski et al.: Mutation detection by mismatch binding protein, MutS, in amplified DNA: application to the cystic fibrosis gene, Proc. Natl. Acad. Sci. USA, vol. 91, 2674-2678 (Mar. 1994).
Liu et al. Comparison of Next-Generation Sequencing Systems. J Biomed Biotechnol 2012: 251364 (2012).
Liu et al.: Rational design of CXCR4 specific antibodies with elongated CDRs. JACS, 136:10557-10560, 2014.
Liu et al.: Enhanced Signals and Fast Nucleic Acid Hybridization By Microfluidic Chaotic Mixing. Angew. Chem. Int. Ed. 2006; 45:3618-3623.
Lizardi et al.: Mutation detection and single-molecule counting using isothermal rolling-circle amplification. Nat Genet. Jul. 1998;19(3):225-32.
Li et al.: Functional domains in Fok I restriction endonuclease, Proc. Natl. Acad. Sci. USA, 89:4275-4279, 1992.
Lu et al.: Methyl-directed repair of DNA base-pair mismatches in vitro, Proc. Natl. Acad. Sci. USA, 80:4639-4643, 1983.
Lund et al.: A validated system for ligation-free uracilexcision based assembly of expression vectors for mammalian cell engineering. DTU Systems of Biology. 2011. 1 page. http://www.lepublicsystemepco.com/files/modules/gestion_rubriques/REF-B036-Lund_Anne%20Mathilde.pdf.
Ma et al.: Versatile surface functionalization of cyclic olefin copolymer (COC) with sputtered SiO2 thin film for potential BioMEMS applications. Journal of Materials Chemistry, 11 pages, 2009.
Ma et al.: DNA synthesis, assembly and application in synthetic biology. Current Opinion in Chemical Biology. 16:260-267, 2012.
Mahato et al.: Modulation of gene expression by antisense and antigene oligodeoxynucleotides and small interfering RNA Expert Opin. Drug Delivery, 2(1):3-28, 2005.
Margulies et al.: Genome sequencing in open microfabricated high-density picolitre reactors. Nature. 437(7057):376-80, 2005.
Martinez-Torrecuadrada et al.: Targeting the Extracellular Domain of Fibroblast Growth Factor Receptor 3 with Human Single-Chain Fv Antibodies Inhibits Bladder Carcinoma Cell Line Proliferation; Clinical Cancer Research; vol. 11; pp. 6282-6290 (2005).
Matteucci et al.: Synthesis of deoxyoligonucleotides on a polymer support. J. Am. Chem. Soc. 103(11):3185-3191, 1981.
Matzas et al.: Next generation gene synthesis by targeted retrieval of bead-immobilized, sequence verified DNA clones from a high throughput pyrosequencing device. Nat. Biotechnol., 28(12):1291-1294, 2010.
Mazor et al.: Isolation of Full-Length IgG Antibodies from Combinatorial Libraries Expressed in Escherichia coli; Antony S. Dimitrov (ed.), Therapeutic Antibodies: Methods and Protocols, vol. 525, Chapter 11, pp. 217-239 (2009).
McBride & Caruthers. An investigation of several deoxynucleoside phosphoramidites useful for synthesizing deoxyoligonucleotides. Tetrahedron Lett. 24: 245-248, 1983.
McGall et al.: Light-directed synthesis of high-density oligonucleotide arrays using semiconductor photoresists. Proc Natl Acad Sci U S A. 93(24):13555-60, 1996.
McGall et al.: The Efficiency of Light-Directed Synthesis of DNA Arrays on Glass Substrates. J. Am. Chem. Soc. 119(22):5081-5090, 1997.
Mei et al.: Cell-free protein synthesis in microfluidic array devices Biotechnol. Prog., 23(6):1305-1311, 2007.
Mendel-Hartvig. Padlock probes and rolling circle amplification. New possibilities for sensitive gene detection. Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 1175. Uppsala University. 2002, 39 pages, http://www.diva-portal.org/smash/get/diva2:161926/FULLTEXT01.pdf.
Meyers and Friedland, Knowledge-based simulation of genetic regulation in bacteriophage lambda. Nucl. Acids Research, 12(1):1-16, 1984.
Meynert et al.: Quantifying single nucleotide variant detection sensitivity in exome sequencing. BMC Bioinformatics 14:195 (2013).
Meynert et al.: Variant detection sensitivity and biases in whole genome and exome sequencing. BMC Bioinformatics 15:247 (2014).
Milo and Phillips. Numbers here reflect the number of protein coding genes and excludes tRNA and non-coding RNA. Cell Biology by the Numbers, p. 286, 2015.
Mitra et al.: In situ localized amplification and contact replication of many individual DNA molecules. Nucleic Acids Res. 27(24):e34, 1999.
Morin et al.: Profiling the HeLa S3 transcriptome using randomly primed cDNA and massively parallel short-read sequencing. Biotechniques, 45:81-94, 2008.
Morris and Stauss. Optimizing T-cell receptor gene therapy for hematologic malignancies. Blood, 127(26):3305-3311, 2016.
Muller et al.: Protection and labelling of thymidine by a fluorescent photolabile group, Helvetica Chimica Acta, vol. 84, 3735-3741 (2001).
Mulligan. Commercial Gene Synthesis Technology PowerPoint presentation. BlueHeron® Biotechnology. Apr. 5, 2006 (48 pgs).
Nakatani et al.: Recognition of a single guanine bulge by 2-Acylamino-1 ,8-naphthyridine, J. Am. Chem. Soc., vol. 122, 2172-2177 (2000).
Neiman M.S.: Negentropy principle in information processing systems. Radiotekhnika, 1966, No. 11, p. 2-9.
Neiman M.S.: On the bases of the theory of information retrieval. Radiotekhnika, 1967, No. 5, p. 2-10.
Neiman M.S.: On the molecular memory systems and the directed mutations. Radiotekhnika, 1965, No. 6, pp. 1-8.
Neiman M.S.: On the relationships between the reliability, performance and degree of microminiaturization at the molecular-atomic level. Radiotekhnika, 1965, No. 1, pp. 1-9.
Neiman M.S.: Some fundamental issues of microminiaturization. Radiotekhnika, 1964, No. 1, pp. 3-12.
Nishikura. A short primer on RNAi: RNA-directed RNA polymerase acts as a key catalyst Cell, 107:415-418, 2001.
Nour-Eldin et al.: USER Cloning and USER Fusion: The Ideal Cloning Techniques for Small and Big Laboratories. Plant Secondary Metabolism Engineering. Methods in Molecular Biology vol. 643, 2010, pp. 185-200.
Nouri et al.: Proliferation-resistant biotechnology: an approach to improve biological security; Nature Biotechnology; vol. 27, No. 3, 234-236; (2009) XP055577207.
Ochman et al. Genetic applications of an inverse polymerase chain reaction. Genetics. Nov. 1988;120(3):621-3.
Organick et al.: Random access in large-scale DNA data storage. Nature Biotechnology, Advance Online Publication, 8 pages, 2018.
Organick et al.: Scaling up DNA data storage and random access retrieval, bioRxiv, preprint first posted online Mar. 7, 2017, 14 pages.
Pan et al.: An approach for global scanning of single nucleotide variations. Proc Natl Acad Sci U S A. Jul. 9, 2002;99(14):9346-51.
Pankiewicz. Fluorinated nucleosides. Carbohydr Res. Jul. 10, 2000;327(1-2):87-105.
PCT/IL2012/000326 International Preliminary Report on Patentability dated Dec. 5, 2013.
PCT/IL2012/000326 International Search Report dated Jan. 29, 2013.
PCT/US2014/049834 International Preliminary Report on Patentability dated Feb. 18, 2016.
PCT/US2014/049834 International Search Report and Written Opinion mailed Mar. 19, 2015.
PCT/US2014/049834, Invitation to Pay Additional Fees and, where applicable, protest fee, dated Jan. 5, 2015.
PCT/US2015/043605 International Preliminary Report on Patentability dated Feb. 16, 2017.
PCT/US2015/043605 International Search Report and Written Opinion dated Jan. 6, 2016.
PCT/US2015/043605 Invitation To Pay Additional Fees dated Oct. 28, 2015.
PCT/US2016/016459 International Preliminary Report on Patentability dated Aug. 17, 2017.
PCT/US2016/016459 International Search Report and Written Opinion dated Apr. 13, 2016.
PCT/US2016/016636 International Preliminary Report on Patentability dated Aug. 17, 2017.
PCT/US2016/016636 International Search Report and Written Opinion dated May 2, 2016.
PCT/US2016/028699 International Preliminary Report on Patentability dated Nov. 2, 2017.
PCT/US2016/028699 International Search Report and Written Opinion dated Jul. 29, 2016.
PCT/US2016/031674 International Preliminary Report on Patentability dated Nov. 23, 2017.
PCT/US2016/031674 International Search Report and Written Opinion dated Aug. 11, 2016.
PCT/US2016/052336 International Preliminary Report on Patentability dated Mar. 29, 2018.
PCT/US2016/052336 International Search Report and Written Opinion dated Dec. 7, 2016.
PCT/US2016/052916 International Preliminary Report on Patentability dated Apr. 5, 2018.
PCT/US2016/052916 International Search Report and Written Opinion dated Dec. 30, 2016.
PCT/US2016/064270 International Preliminary Report on Patentability dated Jun. 14, 2018.
PCT/US2016/064270 International Search Report and Written Opinion dated Apr. 28, 2017.
PCT/US2017/026232 International Search Report and Written Opinion dated Aug. 28, 2017.
PCT/US2017/036868 International Search Report and Written Opinion dated Aug. 11, 2017.
PCT/US2017/045105 International Search Report and Written Opinion dated Oct. 20, 2017.
PCT/US2017/052305 International Search Report and Written Opinion dated Feb. 2, 2018.
PCT/US2017/062391 International Search Report and Written Opinion dated Mar. 28, 2018.
PCT/US2017/066847 International Search Report and Written Opinion dated May 4, 2018.
PCT/US2018/022487 International Search Report and Written Opinion dated Aug. 1, 2018.
PCT/US2018/022493 International Search Report and Written Opinion dated Aug. 1, 2018.
PCT/US2018/037152 International Search Report and Written Opinion dated Aug. 28, 2018.
PCT/US2018/037161 International Search Report and Written Opinion dated Oct. 22, 2018.
PCT/US2018/037161 Invitation to Pay Additional Fees dated Aug. 27, 2018.
PCT/US2018/056783 International Search Report and Written Opinion of the International Searching Authority dated Dec. 20, 2018.
PCT/US2018/19268 International Search Report and Written Opinion dated Jun. 26, 2018.
PCT/US2018/19268 Invitation to Pay Additional Fees and, where applicable, protest fee dated May 2, 2018.
PCT/US2018/22487 Invitation to Pay Additional Fees and, where applicable, protest fee dated May 31, 2018.
PCT/US2018/22493 Invitation to Pay Additional Fees and, where applicable, protest fee dated May 31, 2018.
Pease et al.: Light-generated oligonucleotide arrays for rapid DNA sequence analysis. Proc Natl Acad Sci U S A. May 24, 1994;91(11):5022-6.
Peisajovich et al.: BBF RFC 28: A method for combinatorial multi-part assembly based on the type-lis restriction enzyme aarl. Sep. 16, 2009, 7 pages.
Pellois et al.: Individually addressable parallel peptide synthesis on microchips, Nature Biotechnology, vol. 20, 922-926 (Sep. 2002).
Petersen et al.: LNA: a versatile tool for therapeutics and genomics. Trends Biotechnol. Feb. 2003;21(2):74-81.
Pierce and Wangh. Linear-after-the-exponential polymerase chain reaction and allied technologies Real-time detection strategies for rapid, reliable diagnosis from single cells Methods Mol. Med. 132:65-85 (2007) (Abstract only).
Pierce et al.: Linear-after-the-exponential polymerase chain reaction and allied technologies. Real-time detection strategies for rapid, reliable diagnosis from single cells. Methods Mol Med. 2007;132:65-85.
Pirrung. How to make a DNA chip. Angew. Chem. Int. Ed., 41:1276-1289, 2002.
Plesa et al.: Multiplexed gene synthesis in emulsions for exploring protein functional landscapes. Science, 10.1126/science.aao5167, 10 pages, 2018.
Pon. Solid-phase supports for oligonucleotide synthesis. Methods Mol Biol. 1993;20:465-96.
Poster. Reimagine Genome Scale Research. 2016, 1 page. Available at http://www2.twistbioscience.com/Oligo_Pools_CRISPR_poster.
Powers et al.: Optimal strategies for the chemical and enzymatic synthesis of bihelical deoxyribonucleic acids. J Am Chern Soc., 97(4):875-884, 1975.
Pray. Discovery of DNA Structure and Function: Watson and Crick, Nature Education, 2008, 6 pages, available at: http://www.nature.com/scitable/topicpage/discovery-of-dna-structure-and-function-watson-397.
Prodromou et al.: Recursive PCR: a novel technique for total gene synthesis. Protein Eng. Dec. 1992;5(8):827-9.
Puigbo. Optimizer: a web server for optimizing the codon usage of DNA sequences. Nucleic Acid Research, 35(14):126-131, 2007.
Qian and Winfree. Scaling up digital circuit computation with DNA strand displacement cascades. Science, 332(6034):196-1201, 2011.
Qian et al.: Neural network computation with DNA strand displacement cascades, Nature, 475(7356):368-372, 2011.
Quan et al.: Parallel on-chip gene synthesis and application to optimization of protein expression. Nature Biotechnology. 2011; 29:449-452.
Rafalski and Morgante. Corn and humans: recombination and linkage disequilibrium in two genomes of similar size. Trends in Genetics, 20(2):103-111, 2004.
Raje and MUrma. A Review of electrohydrodynamic-inkjet printing technology. International Journal of Emerging Technology and Advanced Engineering, 4(5):174-183, 2014.
Rastegari et al.: XNOR-Net: ImageNet Classification Using Binary Convolutional Neural Networks, in ECCV 2016, Part IV, LNCS 9908, p. 525-542, 2016.
Reimagine SequenceSpace, Reimagine Research, Twist Bioscience, Product Brochure, Published Apr. 6, 2016 online at: www2.twistbioscience.com/TB_Product_Brochure_04.2016, 8 pages.
RF Electric discharge type excimer lamp. Products Catalog. Excimer lamp light source flat excimer, 16 pages dated Jan. 2016. From: http://www.hamamatsu.com/jp/en/product/category/1001/3026/index.html.
Richmond et al.: Amplification and assembly ofchip-eluted DNA (AACED): a method for high-throughput gene synthesis. Nucleic Acids Res. Sep. 24, 2004;32(17):5011-8. Print 2004.
Roche. Restriction Enzymes from Roche Applied Science—A Tradition of Premium Quality and Scientific Support. FAQS and Ordering Guide. Roche Applied Science. Accessed Jan. 12, 2015, 37 pages.
Rogozin et al.: Origin and evolution of spliceosomal introns. Biology Direct, 7:11, 2012.
Ruminy et al.: Long-range identification of hepatocyte nuclear factor-3 (FoxA) high and low-affinity binding Sites with a chimeric nuclease, J. Mol. Bioi., vol. 310, 523-535 (2001).
Saaem et al.: In situ synthesis of DNA microarray on functionalized cyclic olefin copolymer substrate ACS Applied Materials & Interfaces, 2(2):491-497, 2010.
Saboulard et al.: High-throughput site-directed mutagenesis using oligonucleotides synthesized on DNA chips. Biotechniques. Sep. 2005;39(3):363-8.
Sacconi et al.: Three-dimensional magneto-optic trap for micro-object manipulation, Optics Letters, vol. 26, No. 17, 1359-1361 (Sep. 1, 2001).
Saiki et al.: Analysis of enzymatically amplified beta-globin and HLA-DQ alpha DNA with allele-specific oligonucleotide probes. Nature 324:163-166 (1986).
Sandhu et al.: Dual asymmetric PCR: one-step construction of synthetic genes. Biotechniques. Jan. 1992;12(1):14-6.
Sargolzaei et al.: Extent of linkage disequilibrium in Holstein cattle in North America. J.Dairy Science, 91:2106-2117, 2007.
Schaller et al.: Studies on Polynucleotides. XXV.1 The Stepwise Synthesis of Specific Deoxyribopolynucleotides (5). Further Studies on the Synthesis of Internucleotide Bond by the Carbodiimide Method. The Synthesis of Suitably Protected Dinucleotides as Intermediates in the Synthesis of Higher Oligonucleotides. J. Am. Chem. Soc. 1963; 85(23):3828-3835.
Schmalzing et al.: Microchip electrophoresis: a method for high-speed SNP detection. Nucleic Acids Res 28(9):E43 (2000).
Schmitt et al.: New strategies in engineering T-cell receptor gene-modified T cells to more effectively target malignancies. Clinical Cancer Research, 21(23):5191-5197, 2015.
Seelig et al.: Enzyme-Free Nucleic Acid Logic Circuits, Science 314(5805):1585-1588, 2006.
Sharan et al.: Recombineering: a homologous recombination-based method of genetic engineering. Nat Profile 4(2):1-37 (originally pp. 206-223) (2009).
Sharpe and Mount. Genetically modified T cells in cancer therapy: opportunities and challenges. Disease Models and Mechanisms, 8:337-350, 2015.
Sierzchala et al.: Solid-phase oligodeoxynucleotide synthesis : a two-step cycle using peroxy anion deprotection, J. Am. Chern. Soc., vol. 125, No. 44, 13427-13441 (2003).
Simonyan and Zisserman. Very Deep Convolutional Networks for Large-Scale Image Recognition, Published as a conference paper at Int. Conf. Learn. Represent., pp. 1-14, 2015.
Singh-Gasson et al.: Maskless fabrication of light-directed oligonucleotide microarrays using a digital micromirror array, Nature Biotechnology, vol. 17, 974-978 (Oct. 1999).
Skerra. Phosphorothioate primers improve the amplification of DNA sequences by DNA polymerases with proofreading activity. Nucleic Acids Res. Jul. 25, 1992; 20(14):3551-4.
Smith et al.: Removal of Polymerase-Produced mutant sequences from PCR products, Proc. Natl. Acad. Sci. USA, vol. 94, 6847-6850 (Jun. 1997).
Smith et al.: Generating a synthetic genome by whole genome assembly: phiX174 bacteriophage from synthetic oligonucleotides. Proc Natl Acad Sci U S A. Dec. 23, 2003;100(26):15440-5. Epub Dec. 2, 2003.
Smith et al.: Generation of cohesive ends on PCR products by UDG-mediated excision ofdU, and application for cloning into restriction digest-linearized vectors. PCR Methods Appl. May 1993;2(4):328-32.
Smith et al.: Mutation detection with MutH, MutL, and MutS mismatch repair proteins, Proc. Natl. Acad. Sci. USA, vol. 93, 4374-4379 (Apr. 1996).
Smith et al.: Direct mechanical measurements of the elasticity of single DNA molecules using magnetic beads, Science, vol. 258, 1122-1126 (Nov. 13, 1992).
Solomon et al.: Genomics at Agilent: Driving Value in DNA Sequencing.https://www.agilent.com/labs/features/2010_genomics.html, 8 pages (Aug. 5, 2010).
Soni et al.: Progress toward ultrafast DNA sequencing using solid-state nanopores. Clin Chem. Nov. 2007;53(11):1996-2001. Epub Sep. 21, 2007.
Southern et al.: Analyzing and comparing nucleic acid sequences by hybridization to arrays of oligonucleotides: evaluation using experimental models. Genomics. Aug. 1992;13(4):1008-17.
Sproat et al.: An efficient method for the isolation and purification of oligoribonucleotides. Nucleosides & Nucleotides. 1995; 14(1&2):255-273.
Srivannavit et al.: Design and fabrication of microwell array chips for a solution-based, photogenerated acid-catalyzed parallel oligonuclotide DNA synthesis. Sensors and Actuators A, 116:150-160, 2004.
Srivastava et al.: RNA synthesis: phosphoramidites for RNA synthesis in the reverse direction. Highly efficient synthesis and application to convenient introduction of ligands, chromophores and modifications of synthetic RNA at the 3′-end, Nucleic Acids Symposium Series, 52(1):103-104, 2008.
Steel. The Flow-Thru Chip A Three-dimensional biochip platform. In: Schena, Microarray Biochip Technology, Chapter 5, Natick, MA: Eaton Publishing, 2000, 33 pages.
Stemmer et al.: Single-step assembly of a gene and entire plasmid from large numbers of oligodeoxyribonucleotides. Gene. Oct. 16, 1995;164(1):49-53.
Stryer. DNA Probes and genes can be synthesized by automated solid-phase methods. Biochemistry, 3rd edition, New York: W.H. Freeman and Company, 1988; 123-125.
Stutz et al.: Novel fluoride-labile nucleobase-protecting groups for the synthesis of 3′(2′)-O-amino-acylated RNA sequences. Helv. Chim. Acta. 2000; 83(9):2477-2503.
Sullivan et al.: Library construction and evaluation for site saturation mutagenesis. Enzyme Microb. Technol. 53:70-77 (2013).
Sun et al.: Structure-Guided Triple-Code Saturation Mutagenesis: Efficient Tuning of the Stereoselectivity of an Epoxide Hydrolase. ACS Catal. 6:1590-1597 (2016).
Takahashi. Cell-free cloning using multiply-primed rolling circle amplification with modified RNA primers. Biotechniques. Jul. 2009;47(1):609-15. doi: 10.2144/000113155.
Tanase et al.: Magnetic trapping of multicomponent nanowires, The Johns Hopkins University, Baltimore, Maryland, p. 1-3 (Jun. 25, 2001).
Taylor et al.: Impact of surface chemistry and blocking strategies on DNA microarrays. Nucleic Acids Research, 31(16):e87, 19 pages, 2003.
The Hood Laboratory, Beta Group. Assembly Manual for the POSaM: The ISB Piezoelelctric Oligonucleotide Synthesizer and Microarrayer, Inkjet Microarrayer Manual Version 1.2, 50 pages, May 28, 2004.
The SLIC. Gibson, CPEC and SLiCE assembly methods (and GeneArt Seamless, In-Fusion Cloning). 5 pages, available online Sep. 2, 2010.
Tian et al.: Accurate multiplex gene synthesis from programmable DNA microchips. Nature. Dec. 23, 2004;432(7020):1050-4.
Tsai et al.: Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing Nat. Biotechnol., 32(6):569-576, 2014.
Twist Bioscience \| White Paper. DNA-Based Digital Storage. Retrieved from the internet, Twistbioscience.com, Mar. 27, 2018, 5 pages.
U.S. Appl. No. 14/241,874 Final Office Action dated Jan. 28, 2019.
U.S. Appl. No. 14/241,874 Office Action dated Feb. 27, 2017.
U.S. Appl. No. 14/241,874 Office Action dated Jul. 14, 2016.
U.S. Appl. No. 14/241,874 Office Action dated May 4, 2018.
U.S. Appl. No. 14/452,429 Notice of Allowance dated Jun. 7, 2016.
U.S. Appl. No. 14/452,429 Office Action dated Oct. 21, 2015.
U.S. Appl. No. 14/452,429 Restriction Requirement dated Dec. 12, 2014.
U.S. Appl. No. 14/885,962 Notice of Allowance dated Nov. 8, 2017 and Sep. 29, 2017.
U.S. Appl. No. 14/885,962 Office Action dated Dec. 16, 2016.
U.S. Appl. No. 14/885,962 Office Action dated Sep. 8, 2016.
U.S. Appl. No. 14/885,962 Restriction Requirement dated Mar. 1, 2016.
U.S. Appl. No. 14/885,963 Notice of Allowance dated May 24, 2016.
U.S. Appl. No. 14/885,963 Office Action dated Feb. 5, 2016.
U.S. Appl. No. 14/885,965 Office Action dated Aug. 28, 2018.
U.S. Appl. No. 14/885,965 Office Action dated Aug. 30, 2017.
U.S. Appl. No. 14/885,965 Office Action dated Feb. 10, 2017.
U.S. Appl. No. 14/885,965 Office Action dated Feb. 18, 2016.
U.S. Appl. No. 14/885,965 Office Action dated Jan. 4, 2018.
U.S. Appl. No. 14/885,965 Office Action dated Jul. 7, 2016.
U.S. Appl. No. 15/015,059 Final Office Action dated Jul. 17, 2019.
U.S. Appl. No. 15/015,059 Office Action dated Aug. 19, 2019.
U.S. Appl. No. 15/015,059 Office Action dated Feb. 7, 2019.
U.S. Appl. No. 15/135,434 Notice of Allowance dated Feb. 9, 2018.
U.S. Appl. No. 15/135,434 Office Action dated Nov. 30, 2017.
U.S. Appl. No. 15/135,434 Restriction Requirement dated Jul. 12, 2017.
U.S. Appl. No. 15/151,316 Office Action dated Jun. 7, 2018.
U.S. Appl. No. 15/151,316 Office Action dated Oct. 4, 2019.
U.S. Appl. No. 15/151,316 Final Office Action dated Feb. 21, 2019.
U.S. Appl. No. 15/154,879 Notice of Allowance dated Feb. 1, 2017.
U.S. Appl. No. 15/156,134 Final Office Action dated Jan. 3, 2020.
U.S. Appl. No. 15/156,134 Office Action dated Apr. 4, 2019.
U.S. Appl. No. 15/187,714 Final Office Action dated Sep. 17, 2019.
U.S. Appl. No. 15/187,714 Office Action dated Apr. 4, 2019.
U.S. Appl. No. 15/187,714 Restriction Requirement dated Sep. 17, 2018.
U.S. Appl. No. 15/187,721 Notice of Allowance dated Dec. 7, 2016.
U.S. Appl. No. 15/187,721 Office Action dated Oct. 14, 2016.
U.S. Appl. No. 15/233,835 Notice of Allowance dated Oct. 4, 2017.
U.S. Appl. No. 15/233,835 Office Action dated Feb. 8, 2017.
U.S. Appl. No. 15/233,835 Office Action dated Jul. 26, 2017.
U.S. Appl. No. 15/233,835 Restriction Requirement dated Nov. 4, 2016.
U.S. Appl. No. 15/245,054 Office Action dated Mar. 21, 2017.
U.S. Appl. No. 15/245,054 Office Action dated Oct. 19, 2016.
U.S. Appl. No. 15/268,422 Final Office Action dated Oct. 3, 2019.
U.S. Appl. No. 15/268,422 Office Action dated Mar. 1, 2019.
U.S. Appl. No. 15/268,422 Restriction Requirement dated Oct. 4, 2018.
U.S. Appl. No. 15/377,547 Final Office Action dated Feb. 8, 2019.
U.S. Appl. No. 15/377,547 Office Action dated Jul. 27, 2018.
U.S. Appl. No. 15/377,547 Office Action dated Mar. 24, 2017.
U.S. Appl. No. 15/377,547 Office Action dated Nov. 30, 2017.
U.S. Appl. No. 15/433,909 Non-Final Office Action dated Feb. 8, 2019.
U.S. Appl. No. 15/433,909 Restriction Requirement dated Sep. 17, 2018.
U.S. Appl. No. 15/602,991 Final Office Action dated Dec. 13, 2018.
U.S. Appl. No. 15/602,991 Notice of Allowance dated Oct. 25, 2017.
U.S. Appl. No. 15/602,991 Office Action dated May 31, 2018.
U.S. Appl. No. 15/602,991 Office Action dated May 31, 2019.
U.S. Appl. No. 15/602,991 Office Action dated Sep. 21, 2017.
U.S. Appl. No. 15/603,013 Final Office Action dated Nov. 6, 2019.
U.S. Appl. No. 15/603,013 Office Action dated Jan. 30, 2018.
U.S. Appl. No. 15/603,013 Office Action dated Jul. 10, 2018.
U.S. Appl. No. 15/603,013 Office Action dated Oct. 20, 2017.
U.S. Appl. No. 15/619,322 Office Action dated Aug. 14, 2019.
U.S. Appl. No. 15/682,100 Office Action dated Jan. 2, 2018.
U.S. Appl. No. 15/682,100 Restriction Requirement dated Nov. 8, 2017.
U.S. Appl. No. 15/709,274 Notice of Allowance dated Apr. 3, 2019.
U.S. Appl. No. 15/729,564 Final Office Action dated Dec. 13, 2018.
U.S. Appl. No. 15/729,564 Office Action dated Jan. 8, 2018.
U.S. Appl. No. 15/729,564 Office Action dated Jun. 6, 2018.
U.S. Appl. No. 15/729,564 Office Action dated May 30, 2019.
U.S. Appl. No. 15/816,995 Office Action dated Sep. 20, 2019.
U.S. Appl. No. 15/816,995 Restriction Requirement dated Apr. 4, 2019.
U.S. Appl. No. 15/835,342 Office Action dated Dec. 2, 2019.
U.S. Appl. No. 15/835,342 Restriction Requirement dated Sep. 10, 2019.
U.S. Appl. No. 15/844,395 Office Action dated Jan. 24, 2020.
U.S. Appl. No. 15/844,395 Restriction Requirement dated May 17, 2019.
U.S. Appl. No. 15/860,445 Final Office Action dated Dec. 13, 2018.
U.S. Appl. No. 15/860,445 Office Action dated May 30, 2018.
U.S. Appl. No. 15/921,479 Office Action dated Nov. 12, 2019.
U.S. Appl. No. 15/921,479 Restriction Requirement dated May 24, 2019.
U.S. Appl. No. 15/960,319 Office Action dated Aug. 16, 2019.
U.S. Appl. No. 16/006,581 Office Action dated Sep. 25, 2019.
U.S. Appl. No. 16/239,453 Office Action dated Nov. 7, 2019.
U.S. Appl. No. 16/384,678 Office Action dated Jan. 21, 2020.
U.S. Appl. No. 16/409,608 Office Action dated Sep. 9, 2019.
U.S. Appl. No. 16/530,717 Office Action dated Sep. 6, 2019.
U.S. Appl. No. 16/535,777 Office Action dated Jan. 23, 2020.
U.S. Appl. No. 16/535,779 First Action Interview dated Feb. 10, 2020.
U.S. Appl. No. 14/452,429 Office Action dated Apr. 9, 2015.
U.S. Appl. No. 15/603,013 Office Action dated Jun. 26, 2019.
Unger et al.: Monolithic microfabricated valves and pumps by multilayer soft lithography. Science. Apr. 7, 2000;288(5463):113-6.
Vaijayanthi et al.: Recent advances in oligonucleotide synthesis and their applications. Indian J Biochem Biophys. Dec. 2003;40(6):377-91.
Van Den Brulle et al.: A novel solid phase technology for high-throughput gene synthesis. Biotechniques. 2008; 45(3):340-343.
Van Der Werf et al.: Limonene-1,2-epoxide hydrolase from Rhodococcus erythropolis DCL14 belongs to a novel class of epoxide hydrolases. J. Bacteriol. 180:5052-5057 (1998).
Van Tassell et al.: SNP discovery and allele frequency estimation by deep sequencing of reduced representation libraries. Nature Methods, 5:247-252, 2008.
Vargeese et al.: Efficient activation of nucleoside phosphoramidites with 4,5-dicyanoimidazole during oligonucleotide synthesis. Nucleic Acids Res. Feb. 15, 1998;26(4):1046-50.
Vincent et al.: Helicase-dependent isothermal DNA amplification. EMBO Rep. Aug. 2004;5(8):795-800.
Verma et al.: Modified oligonucleotides: synthesis and strategy for users. Annu Rev Biochem 67:99-134 (1998).
Visscher et al.: Construction of multiple-beam optical traps with nanometer-resolution position sensing, IEEE Journal of Selected Topics in Quantum Electronics, vol. 2, No. 4, 1066-1076 (Dec. 1996).
Voldmans et al.: Holding forces of single-particle dielectrophoretic traps. Biophysical Journal, vol. 80, No. 1,531-541 (Jan. 2001).
Vos et al.: AFLP:A new technique for DNA fingerprinting. Nucleic Acids Res. Nov. 11, 1995;23(21):4407-14.
Wagner et al.: Nucleotides, Part LXV, Synthesis of 2′-Deoxyribonucleoside 5'-Phosphoramidites: New Building Blocks for the Inverse (5′-3′)-Oligonucleotide Approach. Helvetica Chimica Acta, 83(8):2023-2035, 2000.
Wah et al.: Structure of Fok I has implications for DNA cleavage, Proc. Natl. Acad. Sci. USA, vol. 95, 10564-10569 (Sep. 1998).
Wah et al.: Structure of the multimodular endonuclease Fok I bound to DNA, Nature, vol. 388, 97-100 (Jul. 1997).
Walker et al.: Strand displacement amplification—an isothermal, in vitro DNA amplification technique. Nucleic Acids Res. Apr. 11, 1992;20(7):1691-6.
Wan et al.: Deep Learning for Content-Based Image Retrieval: A comprehensive study, in Proceedings of the 22nd ACM International Conference on Multimedia—Nov. 3-7, 2014, Orlando, FL, p. 157-166, 2014.
Warr et al.: Exome Sequencing: current and future perspectives. G3: (Bethesda) 5(8):1543-1550 (2015).
Weber et al.: A modular cloning system for standardized assembly of multigene constructs. PLoS One. Feb. 18, 2011;6(2):e16765. doi: 10.1371/journal.pone.0016765.
Welz et al.: 5-(Benzylmercapto)-1H-tetrazole as activator for 2′-O-TBDMS phosphoramidite building blocks in RNA synthesis. Tetrahedron Lett. 2002; 43(5):795-797.
Westin et al.: Anchored multiplex amplification on a microelectronic chip array Nature Biotechnology, 18:199-202 (2000) (abstract only).
Whitehouse et al.: Analysis of the mismatch and insertion/deletion binding properties of Thermus thermophilus, HB8, MutS, Biochemical and Biophysical Research Communications, vol. 233, 834-837 (1997).
Wiedenheft et al.: RNA-guided genetic silencing systems in bacteria and archaea. Nature, 482:331-338, 2012.
Wijshoff. Structure and fluid-dynamics in Piezo inkjet printheads. Thesis. Venio, The Netherlands, published 2008, p. 1-185.
Wirtz. Direct measurement of the transport properties of a single DNA molecule, Physical Review Letters, vol. 75, No. 12, 2436-2439 (Sep. 18, 1995).
Withers-Martinez et al.: PCR-based gene synthesis as an efficient approach for expression of the A+T-rich malaria genome, Protein Engineering, vol. 12, No. 12, 1113-1120 (1999).
Wood et al.: Human DNA repair genes, Science, vol. 291, 1284-1289 (Feb. 16, 2001).
Wosnick et al.: Rapid construction of large synthetic genes: total chemical synthesis of two different versions of the bovine prochymosin gene. Gene. 1987;60(1):115-27.
Wright and Church. An open-source oligomicroarray standard for human and mouse. Nature Biotechnology, 20:1082-1083, 2002.
Wu et al.: Sequence-Specific Capture of Protein-DNA Complexes for Mass Spectrometric Protein Identification PLoS ONE. Oct. 20, 2011, vol. 6, No. 10.
Wu et al.: RNA-mediated gene assembly from DNA arrays. Angew Chern Int Ed Engl. May 7, 2012;51(19):4628-32. doi: 10.1002/anie.201109058.
Wu et al.: Specificity of the nick-closing activity of bacteriophage T4 DNA ligase. Gene. 1989;76(2):245-54.
Wu et al.: An improvement of the on-line electrophoretic concentration method for capillary electrophoresis of proteins an experimental factors affecting he concentration effect, Analytical Sciences, vol. 16, 329-331 (Mar. 2000).
Xiong et al.: Chemical gene synthesis: Strategies, softwares, error corrections, and applications. FEMS Microbiol. Rev., 32:522-540, 2008.
Xiong et al.: A simple, rapid, high-fidelity and cost-effective PCR-based two-step DNA synthesis method for long gene sequences. Nucleic Acids Res. 2004, 32(12):e98.
Xiong et al.: Non-polymerase-cycling-assembly-based chemical gene synthesis: Strategies, methods, and progress. Biotechnology Advances. 26(2):121-134, 2008.
Xu et al.: Design of 240,000 orthogonal 25mer DNA barcode probes. PNAS, 106(7):2289-2294, 2009.
Yang et al.: Purification, cloning, and characterization of the CEL I nuclease, Biochemistry, 39(13):3533-35, 2000.
Yazdi et al.: A Rewritable, Random-Access DNA-Based Storage System, Scientific Reports, 5, Article No. 14138, 27 pages, 2015.
Yehezkel et al.: De novo DNA synthesis using single molecule PCR Nucleic Acids Research, 36(17):e107, 2008.
Yes HMDS vapor prime process application note Prepared by UC Berkeley and University of Texas at Dallas and re-printed by Yield Engineering Systems, Inc., 6 pages (http://www.yieldengineering.com/Portals/0/HMDS%20Application%20Note.pdf (Published online Aug. 23, 2013).
Youil et al.: Detection of 81 of 81 known mouse Beta-Globin promoter mutations with T4 Endonuclease VII- The EMC Method. Genomics, 32:431-435, 1996.
Young et al.: Two-step total gene synthesis method. Nucleic Acids Res. 32(7):e59, 2004.
Zhang and Seelig. Dynamic DNA nanotechnology using strand-displacement reactions, Nat. Chem., 3(2):103-113, 2011.
Zheleznaya et al.: Nicking endonucleases. Biochemistry (Mosc). 74(13):1457-66, 2009.
Zheng et al.: Manipulating the Stereoselectivity of Limonene Epoxide Hydrolase by Directed Evolution Based on Iterative Saturation Mutagenesis. J. Am. Chem. Soc. 132:15744-15751 (2010).
Zhirnov et al.: Nucleic acid memory. Nature Materials, 15:366, 2016.
Zhou et al.: Microfluidic PicoArray synthesis of oligodeoxynucleotides and simultaneous assembling of multiple DNA sequences Nucleic Acids Research, 32(18):5409-5417, 2004.
Zhou et al.: Establishment and application of a loop-mediated isothermal amplification (LAMP) system for detection of cry1Ac transgenic sugarcane Scientific Reports May 9, 2014, vol. 4, No. 4912.

Related Publications (1)

	Number	Date	Country
	20200181667 A1	Jun 2020	US

Provisional Applications (1)

	Number	Date	Country
	62518489	Jun 2017	US

Continuations (1)

	Number	Date	Country
Parent	PCT/US2018/037152	Jun 2018	US
Child	16712678		US

Methods for seamless nucleic acid assembly

Information

Patent Number

Date Filed

Date Issued

Inventors

Original Assignees

Examiners

Agents

CPC

Field of Search

US

International Classifications

Term Extension

Abstract