Patent Application
20220143035
This application contains a Sequence Listing submitted as an electronic text file named “19-334-PCT_SequenceListing_ST25.txt”, having a size in bytes of 7 kb, and created on Feb. 21, 2020. The information contained in this electronic file is hereby incorporated by reference in its entirety pursuant to 37 CFR § 1.52(e)(5).
The Cyclic GMP-AMP synthase (cGAS)-Stimulator of interferon genes (STING) DNA sensing pathway has emerged as a key component of the innate immune response that is important for antiviral immunity, contributes to specific autoimmune diseases, and mediates important aspects of antitumor immunity. cGAS binds to double-stranded DNA and catalyzes the formation of cyclic GMP-AMP (cGAMP), a diffusible cyclic dinucleotide that activates the endoplasmic adaptor protein STING. Activated STING then serves as a platform for the inducible recruitment of the TBK1 kinase, which phosphorylates and activates the transcription factor IRF3, leading to the induction of the type I interferon mediated antiviral response. It is unclear whether STING-independent DNA sensing pathways are present in human cells.
In a first aspect, the disclosure provides methods for treating of an autoimmune disease or an autoinflammatory disease, comprising administering to a subject in need thereof an amount effective of a DNA-dependent protein kinase (DNA-PK) inhibitor and/or an inhibitor of HSPA8/HSC70, to treat the autoimmune disorder or the auto-inflammatory disorder. In one embodiment, the DNA-PK inhibitor and/or the HSPA8/HSC70 inhibitor are not inhibitors expressed by non-recombinant viruses. In another embodiment, the method comprises administering the DNA-PK inhibitor to the subject, wherein the DNA-PK inhibitor comprises one or more of small molecule inhibitors of activity (such as kinase activity), antisense oligonucleotides directed against the DNA-PK DNA or mRNA; small interfering RNAs (siRNAs), short hairpin RNAs (shRNAs), microRNAs (miRNA) or small internally segmented interfering RNAs (sisiRNA) directed against the DNA-PK protein, DNA, or mRNA; DNA-PK antibodies, and aptamers that bind to DNA-PK. In a further embodiment, the DNA-PK inhibitor is a small molecule inhibitor, including to but not limited to small molecule inhibitors disclosed herein such as NU-7441, M3814, Compound II (2-(Morpholin-4-yl)-benzo[h]chromen-4-one), or Compound III (1-(2-hydroxy-4-morpholinophenyl)ethan-1-one), or pharmaceutically acceptable salts, esters, or prodrugs thereof, or pharmaceutically acceptable salts, esters, or prodrugs thereof.
In one embodiment, the method comprises administering the HSPA8/HSC70 inhibitor to the subject. In a further embodiment, the HSPA8/HSC70 inhibitor comprises a small molecule inhibitor of activity, antisense oligonucleotides directed against the HSPA8/HSC70 DNA or mRNA; small interfering RNAs (siRNAs), short hairpin RNAs (shRNAs), microRNAs (miRNA) or small internally segmented interfering RNAs (sisiRNA) directed against the HSPA8/HSC70 protein, DNA, or mRNA; HSPA8/HSC70 antibodies, aptamers that bind to HSPA8/HSC70, and any other chemical or biological compound that can interfere with HSPA8/HSC70 expression, activity, and/or stability.
In another embodiment, the method further comprises administering an inhibitor of Cyclic GMP-AMP synthase (cGAS) expression, activity, and/or stability, and/or an inhibitor of Stimulator of interferon genes (STING), also known as transmembrane protein 173 (TMEM173)) expression, activity, and/or stability. In one such embodiment, the cGAS and/or STING inhibitor may include, but it not limited to, small molecule inhibitors, antisense oligonucleotides directed against the cGAS or STING DNA or mRNA; small interfering RNAs (siRNAs), short hairpin RNAs (shRNAs), microRNAs (miRNA) or small internally segmented interfering RNAs (sisiRNA) directed against the cGAS or STING protein, DNA, or mRNA; cGAS or STING antibodies, aptamers that bind to cGAS or STING, any other chemical or biological compound that can interfere with cGAS or STING expression, activity, and/or stability.
In one embodiment, the subject has an autoimmune disease. In a further embodiment, the autoimmune disease comprises one or more of Systemic lupus erythematosus (SLE), Discoid lupus, Cutaneous lupus, Sjogrens syndrome, Aicardi-Goutieres syndrome (AGS), pemphigoid (any type), Crohn's disease, endometriosis, fibromyalgia, glomerulonephritis, juvenile arthritis, type 1 diabetes, multiple sclerosis, psoriasis, rheumatoid arthritis, sarcoidosis, scleroderma, and ulcerative colitis. In another embodiment, the subject has an autoinflammatory disease.
In another aspect, the disclosure provides methods for monitoring therapy of a subject being treated for an autoimmune disease and/or an autoinflammatory disease, comprising
(a) determining a baseline level of HSPA8/HSC70 phosphorylation in a biological sample from the subject; and
(b) determining level of HSPA8/HSC70 phosphorylation in a biological sample from the subject 1 or more (2, 3, 4, 5, 6, or more times) after treatment for the autoimmune disease and/or an autoinflammatory disease,
wherein a decrease in HSPA8/HSC70 phosphorylation in the biological sample from the subject after treatment indicates efficacy of the therapy, and wherein an increase in HSPA8/HSC70 phosphorylation in the biological sample from the subject after treatment indicates that the therapy was ineffective. In one embodiment, determining the level of HSPA8/HSC70 phosphorylation comprises determining phosphorylation of serine 638 of human HSPA8/HSC70.
In a further aspect the disclosure provides methods for identifying compounds to treat autoimmune disease and/or autoinflammatory diseases, comprising identifying compounds that inhibit DNA-PK and/or HSPA8/HSC70 expression, activity, and/or stability. In one embodiment, the method comprises identifying compounds that inhibit DNA-PK phosphorylation of HSPA8/HSC70. In another embodiment, the method comprises identifying compounds that inhibit DNA-PK phosphorylation of serine 638 of HSPA8/HSC70.
In another aspect, the disclosure provides pharmaceutical compositions, comprising:
(a) a DNA-PK inhibitor and/or an inhibitor of HSPA8/HSC70; and
(b) an inhibitor of cGAS expression, activity, and/or stability, and/or an inhibitor of STING expression, activity, and/or stability. In one embodiment, the DNA-PK inhibitor and/or an inhibitor of HSPA8/HSC70 comprises a DNA-PK inhibitor. In another embodiment, the DNA-PK inhibitor comprises one or more of small molecule inhibitors of activity (such as kinase activity), antisense oligonucleotides directed against the DNA-PK DNA or mRNA; small interfering RNAs (siRNAs), short hairpin RNAs (shRNAs), microRNAs (miRNA) or small internally segmented interfering RNAs (sisiRNA) directed against the DNA-PK protein, DNA, or mRNA; DNA-PK antibodies, and aptamers that bind to DNA-PK. In a further embodiment, the DNA-PK inhibitor is a small molecule inhibitor, including but not limited to the DNA-PK inhibitors disclosed herein such as NU-7441, M3814, Compound II (2-(Morpholin-4-yl)-benzo[h]chromen-4-one), or Compound III (1-(2-hydroxy-4-morpholinophenyl)ethan-1-one), or pharmaceutically acceptable salts, esters, or prodrugs thereof, or pharmaceutically acceptable salts, esters, or prodrugs thereof. In one embodiment, the pharmaceutical composition comprises an HSPA8/HSC70 inhibitor. In a further embodiment, the HSPA8/HSC70 inhibitor comprises a small molecule inhibitor of activity, antisense oligonucleotides directed against the HSPA8/HSC70 DNA or mRNA; small interfering RNAs (siRNAs), short hairpin RNAs (shRNAs), microRNAs (miRNA) or small internally segmented interfering RNAs (sisiRNA) directed against the HSPA8/HSC70 protein, DNA, or mRNA; HSPA8/HSC70 antibodies, aptamers that bind to HSPA8/HSC70, and any other chemical or biological compound that can interfere with HSPA8/HSC70 expression, activity, and/or stability. In another embodiment, the pharmaceutical composition comprises a cGAS inhibitor. In one such embodiment, the cGAS inhibitor comprises a small molecule cGAs inhibitor, antisense oligonucleotides directed against the cGAS DNA or mRNA; small interfering RNAs (siRNAs), short hairpin RNAs (shRNAs), microRNAs (miRNA) or small internally segmented interfering RNAs (sisiRNA) directed against the cGAS protein, DNA, or mRNA; cGAS antibodies, aptamers that bind to cGAS, and any other chemical or biological compound that can interfere with cGAS expression, activity, and/or stability.
In a further embodiment, the pharmaceutical composition comprises a STING inhibitor. In one such embodiment, the STING inhibitor comprises a small molecule STING inhibitor, antisense oligonucleotides directed against the STING DNA or mRNA; small interfering RNAs (siRNAs), short hairpin RNAs (shRNAs), microRNAs (miRNA) or small internally segmented interfering RNAs (sisiRNA) directed against the STING protein, DNA, or mRNA; STING antibodies, aptamers that bind to STING, and any other chemical or biological compound that can interfere with STING expression, activity, and/or stability. In a further embodiment, the DNA-PK inhibitor, the HSPA8/HSC70 inhibitor, the cGAS inhibitor, and the STING inhibitor are not inhibitors expressed by non-recombinant viruses.
As used herein, the singular forms “a”, “an” and “the” include plural referents unless the context clearly dictates otherwise.
All embodiments of any aspect of the invention can be used in combination, unless the context clearly dictates otherwise.
Unless the context clearly requires otherwise, throughout the description and the claims, the words ‘comprise’, ‘comprising’, and the like are to be construed in an inclusive sense as opposed to an exclusive or exhaustive sense; that is to say, in the sense of “including, but not limited to”. Words using the singular or plural number also include the plural and singular number, respectively. Additionally, the words “herein,” “above,” and “below” and words of similar import, when used in this application, shall refer to this application as a whole and not to any particular portions of the application. The compositions and methods for their use can “comprise,” “consist essentially of,” or “consist of” any of the ingredients or steps disclosed throughout the specification.
The description of embodiments of the disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. While the specific embodiments of, and examples for, the disclosure are described herein for illustrative purposes, various equivalent modifications are possible within the scope of the disclosure, as those skilled in the relevant art will recognize.
In a first aspect, the invention provides methods for treating of an autoimmune disease or an autoinflammatory disease, comprising administering to a subject in need thereof an amount effective of a DNA-dependent protein kinase (DNA-PK) inhibitor and/or an inhibitor of HSPA8/HSC70, to treat the autoimmune disorder or the auto-inflammatory disorder. As disclosed herein, the inventors have identified DNA-PK as a potent, STING-independent DNA sensing pathway (SISDP) that is blocked by the E1A viral oncogene of human adenovirus 5 and the ICP0 product of herpes simplex virus 1. The inventors have further demonstrated that DNA-PK kinase activity drives a robust and broad antiviral response, that the heat shock protein HSPA8/HSC70 is a unique target of the DNA-PK SIDSP, and that detection of foreign DNA and DNA damage trigger distinct modalities of DNA-PK activity. The data demonstrate the utility of DNA-PK and HSPA8/HSC70inhibitors in autoimmune and autoinflammatory disorders, such as those mediated by interferon. In one embodiment, the DNA-PK inhibitor and/or the HSPA8/HSC70 inhibitor are not inhibitors expressed by non-recombinant viruses. In another embodiment, the DNA-PK inhibitor and/or the HSPA8/HSC70 inhibitor are not naturally occurring inhibitors.
DNA-PK is a DNA-activated serine/threonine protein kinase composed of a heterodimer of Ku proteins (Ku70/Ku80) and the catalytic subunit DNA-PKcs, is a critical component of the response to damage, and is present in a wide variety of species.
Any suitable inhibitor of DNA-PK expression and/or activity (such as kinase activity) may be used in the methods disclosed herein. In various embodiments, the inhibitor may comprise small molecule inhibitors of activity (such as kinase activity), antisense oligonucleotides directed against the DNA-PK DNA or mRNA; small interfering RNAs (siRNAs), short hairpin RNAs (shRNAs), microRNAs (miRNA) or small internally segmented interfering RNAs (sisiRNA) directed against the DNA-PK protein, DNA, or mRNA; DNA-PK antibodies, aptamers that bind to DNA-PK, and any other chemical or biological compound that can interfere with DNA-PK expression, activity (such as kinase activity), and/or stability. Based on the present disclosure in light of the level of skill in the art, those of skill in the art can readily identify other DNA-PK inhibitors. In one embodiment, the DNA-PK inhibitor is a small molecule inhibitor. In specific embodiments, the DNA-PK small molecule inhibitor comprises one or more of NU-7441, M3814, Compound II, or Compound III (all shown below), or pharmaceutically acceptable salts, esters, or prodrugs thereof.
In another embodiment, the method comprises administering the HSPA8/HSC70 inhibitor to the subject. Any suitable inhibitor of HSPA8/HSC70 expression and/or activity may be used in the methods disclosed herein. In various embodiments, the inhibitor may comprise small molecule inhibitor of activity, antisense oligonucleotides directed against the HSPA8/HSC70 DNA or mRNA; small interfering RNAs (siRNAs), short hairpin RNAs (shRNAs), microRNAs (miRNA) or small internally segmented interfering RNAs (sisiRNA) directed against the HSPA8/HSC70 protein, DNA, or mRNA; HSPA8/HSC70 antibodies, aptamers that bind to HSPA8/HSC70, and any other chemical or biological compound that can interfere with HSPA8/HSC70 expression, activity, and/or stability.
In another embodiment, the method further comprises administering an inhibitor of Cyclic GMP-AMP synthase (cGAS) expression, activity, and/or stability, and/or an inhibitor of Stimulator of interferon genes (STING), also known as transmembrane protein 173 (TMEM173)) expression, activity, and/or stability. This embodiment provides combined therapies targeting separate immune system activation pathways, and thus provided added therapeutic benefit. Non-limiting, exemplary such inhibitors can include small molecule inhibitors, antisense oligonucleotides directed against the cGAS or STING DNA or mRNA; small interfering RNAs (siRNAs), short hairpin RNAs (shRNAs), microRNAs (miRNA) or small internally segmented interfering RNAs (sisiRNA) directed against the cGAS or STING protein, DNA, or mRNA; cGAS or STING antibodies, aptamers that bind to cGAS or STING, and any other chemical or biological compound that can interfere with cGAS or STING expression, activity, and/or stability. In some embodiments, the cGAS inhibitor may comprise any cGAS inhibitors, such as PF-06928215, disclosed in PLos One 2017 Sep. 21; 12(9):e0184843. doi: 10.1371/journal. pone.0184843. eCollection 2017 and/or RU.521 (Nat Commun. 2017 Sep. 29; 8(1):750. doi: 10.1038/s41467-017-00833-9), or pharmaceutically acceptable salts, esters, or prodrugs thereof. In another embodiment, the STING inhibitor may comprise one or more STING inhibitors disclosed in Nature. 2018 July; 559(7713):269-273. doi: 10.1038/s41586-018-0287-8. Epub 2018 Jul. 4.
Representative chemical structures include:
RU.521 (3-[1-(6,7-dichloro-1H-benzimidazol-2-yl)-5-hydroxy-3-methyl-pyrazol-4-yl]-3H-isobenzofuran-1-one; Supplemental
STING inhibitors disclosed in Nature. 2018 July; 559(7713):269-273. doi: 10.1038/s41586-018-0287-8. Epub 2018 Jul. 4, such as:
and
cGAS inhibitors described in PLos One 2017 Sep. 21; 12(9):e0184843. doi: 10.1371/journal. pone.0184843. eCollection 2017,
and
Autoinflammatory diseases are caused by genetic mutations in molecules that are involved in regulating the innate immune response-a “hard wired” defense system that evolved to quickly recognize and act against infectious agents and other danger signals produced by our bodies. Autoimmune diseases are caused by the body's adaptive immune system developing antibodies to antigens that then attack healthy body tissues.
The methods disclosed herein can be used to treat any autoimmune or auto-inflammatory disease. Exemplary autoimmune diseases that can be treated, or development limited, using the methods of the invention include, but are not limited to Systemic lupus erythematosus (SLE), Discoid lupus, Cutaneous lupus, Sjogrens syndrome, Aicardi-Goutieres syndrome (AGS), pemphigoid (any type), Crohn's disease, endometriosis, fibromyalgia, glomerulonephritis, juvenile arthritis, type 1 diabetes, multiple sclerosis, psoriasis, rheumatoid arthritis, sarcoidosis, scleroderma, and ulcerative colitis. In specific embodiments, the autoimmune disease comprises Cutaneous lupus or scleroderma.
As used herein, “treat” or “treating” means accomplishing one or more of the following: (a) reducing the severity of the disease; (b) limiting or preventing development of symptoms, including flares, characteristic of the disease; (c) inhibiting worsening of symptoms characteristic of the disease; (d) limiting or preventing recurrence of the disease or symptoms in subjects that were previously symptomatic for.
In all embodiments disclosed herein, any level of inhibition of activity (such as expression, activity (such as kinase activity), and/or stability) is beneficial to treat the autoimmune disorder or the auto-inflammatory disorder. In various non-limiting embodiments, the inhibitors administered inhibit activity of the relevant target by at least 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 75%, 80%, 85%, 90%, or more compared to activity of the relevant target in a control (such as a base line level determined for the subject, a predetermined threshold level, etc.)
The “amount effective” of the administered therapeutic can be determined by an attending medical personnel based on all relevant factors. The therapeutic(s) may be the sole therapeutic(s) administered, or may be administered with other therapeutics as deemed appropriate by attending medical personnel in light of all circumstances.
The therapeutics may be administered singly, as mixtures of one or more compounds or in mixture or combination with other agents useful for treating such diseases and/or the symptoms associated with such diseases. The compounds may also be administered in mixture or in combination with agents useful to treat other disorders or maladies. The therapeutics may be administered in the form of compounds per se, or as pharmaceutical compositions comprising the therapeutic(s).
The amount of therapeutics(s) administered will depend upon a variety of factors, including, for example, the particular indication being treated, the mode of administration, whether the desired benefit is prophylactic or therapeutic, the severity of the indication being treated and the age and weight of the patient, the bioavailability of the particular therapeutics(s), etc. Determination of an effective dosage of therapeutics(s) for a particular use and mode of administration is well within the capabilities of those skilled in the art. Effective dosages may be estimated initially from in vitro activity and metabolism assays. For example, an initial dosage of therapeutics for use in animals may be formulated to achieve a circulating blood or serum concentration of the therapeutics or metabolite active compound that is at or above an IC50 of the particular therapeutics as measured in as in vitro assay. Calculating dosages to achieve such circulating blood or serum concentrations taking into account the bioavailability of the particular therapeutics via the desired route of administration is well within the capabilities of skilled artisans. Initial dosages of therapeutics can also be estimated from in vivo data, such as animal models.
Dosage amounts will typically be in the range of from about 0.0001 mg/kg/day, 0.001 mg/kg/day or 0.01 mg/kg/day to about 100 mg/kg/day, but may be higher or lower, depending upon, among other factors, the activity of the active therapeutic, the bioavailability of the therapeutic, its metabolism kinetics and other pharmacokinetic properties, the mode of administration and various other factors, discussed above. Dosage amount and interval may be adjusted individually to provide plasma levels of the therapeutic(s) and/or active metabolite compound(s) which are sufficient to maintain therapeutic or prophylactic effect. For example, the therapeutics may be administered once per week, several times per week (e.g., every other day), once per day or multiple times per day, depending upon, among other things, the mode of administration, the specific indication being treated and the judgment of the prescribing medical personnel. In cases of local administration or selective uptake, such as local topical administration, the effective local concentration of therapeutic(s) and/or active metabolite therapeutic(s) may not be related to plasma concentration. Skilled artisans will be able to optimize effective dosages without undue experimentation.
In another aspect, the disclosure provides methods for monitoring therapy of a subject being treated for an autoimmune disease and/or an autoinflammatory disease, comprising
(a) determining a baseline level of HSPA8/HSC70 phosphorylation in a biological sample from the subject; and
(b) determining level of HSPA8/HSC70 phosphorylation in a biological sample from the subject 1 or more (2, 3, 4, 5, 6, or more times) after treatment for the autoimmune disease and/or an autoinflammatory disease,
wherein a decrease in HSPA8/HSC70 phosphorylation in the biological sample from the subject after treatment indicates efficacy of the therapy, and wherein an increase in HSPA8/HSC70 phosphorylation in the biological sample from the subject after treatment indicates that the therapy was ineffective.
The methods can be used to monitor therapy of a subject having any suitable autoimmune or auto-inflammatory disease, including but limited to those disclosed herein. In specific embodiments, the autoimmune disease comprises Cutaneous lupus or scleroderma.
Step (b) can be carried out any number of times over any suitable time frame as deemed appropriate by attending medical personnel. In another embodiment, when the method indicates that the therapy was ineffective, the method further comprises switching to a different therapy or increasing a dose of the therapeutic being administered. Any suitable methods for determining phosphorylation can be used, including but not limited to those disclosed herein. Any suitable biological sample from the subject may be used, including but not limited to blood samples, tissue or skin biopsies, etc. In one embodiment, determining the level of HSPA8/HSC70 phosphorylation comprises determining phosphorylation of serine 638 of human HSPA8/HSC70.
In another aspect, the disclosure provides methods for identifying compounds to treat autoimmune disease and/or autoinflammatory diseases, comprising identifying compounds that inhibit DNA-PK and/or HSPA8/HSC70 expression, activity, and/or stability. The methods can be used to identify compounds for treating any suitable autoimmune or auto-inflammatory disease, including but limited to those disclosed herein. In specific embodiments, the autoimmune disease comprises Cutaneous lupus or scleroderma. In one embodiment, the method comprises identifying compounds that inhibit DNA-PK phosphorylation of HSPA8/HSC70. In another embodiment, the method comprises identifying compounds that inhibit DNA-PK phosphorylation of serine 638 of HSPA8/HSC70.
In all of the methods disclosed herein, the subject may be any subject that has or is at risk of developing cancer. In one embodiment, the subject is a mammal, including but not limited to humans, dogs, cats, horses, cattle, etc.
In another aspect, the disclosure provides pharmaceutical compositions comprising:
(a) a DNA-PK inhibitor and/or an inhibitor of HSPA8/HSC70; and
(b) an inhibitor of cGAS expression, activity, and/or stability, and/or an inhibitor of STING expression, activity, and/or stability.
The pharmaceutical compositions can be used for any suitable purpose, including but not limited to treating autoimmune disorders and/or autoinflammatory diseases, such as by the methods of the disclosure. In one embodiment, the DNA-PK inhibitor and/or an inhibitor of HSPA8/HSC70 comprises a DNA-PK inhibitor. In another embodiment, the DNA-PK inhibitor comprises one or more of small molecule inhibitors of activity (such as kinase activity), antisense oligonucleotides directed against the DNA-PK DNA or mRNA; small interfering RNAs (siRNAs), short hairpin RNAs (shRNAs), microRNAs (miRNA) or small internally segmented interfering RNAs (sisiRNA) directed against the DNA-PK protein, DNA, or mRNA; DNA-PK antibodies, and aptamers that bind to DNA-PK. In a further embodiment, the DNA-PK inhibitor is a small molecule inhibitor. In one such embodiment, the DNA-PK small molecule inhibitor comprises one or more of NU-7441, M3814, Compound II, or Compound III (all shown below), or pharmaceutically acceptable salts, esters, or prodrugs thereof.
In another embodiment, the pharmaceutical composition comprises an HSPA8/HSC70 inhibitor. In one such embodiment, the HSPA8/HSC70 inhibitor comprises a small molecule inhibitor of activity, antisense oligonucleotides directed against the HSPA8/HSC70 DNA or mRNA; small interfering RNAs (siRNAs), short hairpin RNAs (shRNAs), microRNAs (miRNA) or small internally segmented interfering RNAs (sisiRNA) directed against the HSPA8/HSC70 protein, DNA, or mRNA; HSPA8/HSC70 antibodies, aptamers that bind to HSPA8/HSC70, and any other chemical or biological compound that can interfere with HSPA8/HSC70 expression, activity, and/or stability.
In a further embodiment, the pharmaceutical composition comprises a cGAS inhibitor. In one such embodiment, the cGAS inhibitor comprises a small molecule cGAs inhibitor, antisense oligonucleotides directed against the cGAS DNA or mRNA; small interfering RNAs (siRNAs), short hairpin RNAs (shRNAs), microRNAs (miRNA) or small internally segmented interfering RNAs (sisiRNA) directed against the cGAS protein, DNA, or mRNA; cGAS antibodies, aptamers that bind to cGAS, and any other chemical or biological compound that can interfere with cGAS expression, activity, and/or stability. In another embodiment, the cGAS inhibitor comprises any cGAS inhibitors, such as PF-06928215, disclosed in PLos One 2017 Sep. 21; 12(9):e0184843. doi: 10.1371/journal. pone.0184843. eCollection 2017 and/or RU.521 (Nat Commun. 2017 Sep. 29; 8(1):750. doi: 10.1038/s41467-017-00833-9), or pharmaceutically acceptable salts, esters, or prodrugs thereof.
In another embodiment, the pharmaceutical composition comprises a STING inhibitor. In one such embodiment, the STING inhibitor comprises a small molecule STING inhibitor, antisense oligonucleotides directed against the STING DNA or mRNA; small interfering RNAs (siRNAs), short hairpin RNAs (shRNAs), microRNAs (miRNA) or small internally segmented interfering RNAs (sisiRNA) directed against the STING protein, DNA, or mRNA; STING antibodies, aptamers that bind to STING, and any other chemical or biological compound that can interfere with STING expression, activity, and/or stability. In another embodiment, the STING inhibitor comprises one or more STING inhibitors disclosed in Nature. 2018 July; 559(7713):269-273. doi: 10.1038/s41586-018-0287-8. Epub 2018 Jul. 4.
Representative chemical structures include:
RU.521 (3-[1-(6,7-dichloro-1H-benzimidazol-2-yl)-5-hydroxy-3-methyl-pyrazol-4-yl]-3H-isobenzofuran-1-one; Supplemental
STING inhibitors disclosed in Nature. 2018 July; 559(7713):269-273. doi: 10.1038/s41586-018-0287-8. Epub 2018 Jul. 4, such as:
and
cGAS inhibitors described in PLos One 2017 Sep. 21; 12(9):e0184843. doi: 10.1371/journal. pone.0184843. eCollection 2017,
and
In a further embodiment, the DNA-PK inhibitor, the HSPA8/HSC70 inhibitor, the cGAS inhibitor, and the STING inhibitor are not inhibitors expressed by non-recombinant viruses. In another embodiment, the DNA-PK inhibitor, the HSPA8/HSC70 inhibitor, the cGAS inhibitor, and the STING inhibitor are not naturally occurring inhibitors.
The pharmaceutical compositions may further comprise a pharmaceutically acceptable carrier, excipient or diluent. The exact nature of the carrier, excipient or diluent will depend upon the desired use for the composition, and may range from being suitable or acceptable for veterinary uses to being suitable or acceptable for human use.
Pharmaceutical compositions comprising the therapeutic(s) may be manufactured by means of conventional mixing, dissolving, granulating, dragee-making levigating, emulsifying, encapsulating, entrapping or lyophilization processes. The compositions may be formulated in conventional manner using one or more physiologically acceptable carriers, diluents, excipients or auxiliaries which facilitate processing of the compounds into preparations which can be used pharmaceutically. The therapeutics may be formulated in the pharmaceutical composition per se, or in the form of a hydrate, solvate, N-oxide or pharmaceutically acceptable salt. Typically, such salts are more soluble in aqueous solutions than the corresponding free acids and bases, but salts having lower solubility than the corresponding free acids and bases may also be formed. Pharmaceutical compositions may take a form suitable for virtually any mode of administration, including, for example, topical, ocular, oral, buccal, systemic, nasal, injection, transdermal, rectal, vaginal, etc., or a form suitable for administration by inhalation or insufflation.
For topical administration, the therapeutic(s) may be formulated as solutions, gels, ointments, creams, suspensions, etc. Systemic formulations include those designed for administration by injection, e.g., subcutaneous, intravenous, intramuscular, intrathecal or intraperitoneal injection, as well as those designed for transdermal, transmucosal oral or pulmonary administration.
Useful injectable preparations include sterile suspensions, solutions or emulsions of the active therapeutic(s) in aqueous or oily vehicles. The compositions may also contain formulating agents, such as suspending, stabilizing and/or dispersing agent. The formulations for injection may be presented in unit dosage form, e.g., in ampules or in multidose containers, and may contain added preservatives. Alternatively, the injectable formulation may be provided in powder form for reconstitution with a suitable vehicle, including but not limited to sterile pyrogen free water, buffer, dextrose solution, etc., before use. To this end, the active therapeutic(s) may be dried by any technique, such as lyophilization, and reconstituted prior to use.
For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation.
For oral administration, the pharmaceutical compositions may take the form of, for example, lozenges, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers (e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate); lubricants (e.g., magnesium stearate, talc or silica); disintegrants (e.g., potato starch or sodium starch glycolate); or wetting agents (e.g., sodium lauryl sulfate). The tablets may be coated by several methods, for example, sugars, films or enteric coatings.
Liquid preparations for oral administration may take the form of, for example, elixirs, solutions, syrups or suspensions, or they may be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible fats); emulsifying agents (e.g., lecithin or acacia); non-aqueous vehicles (e.g., almond oil, oily esters, ethyl alcohol, cremophore™ or fractionated vegetable oils); and preservatives (e.g., methyl or propyl-p-hydroxybenzoates or sorbic acid). The preparations may also contain buffer salts, preservatives, flavoring, coloring and sweetening agents as appropriate.
Preparations for oral administration may be suitably formulated to give controlled release of the therapeutics. For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner. For rectal and vaginal routes of administration, the compound(s) may be formulated as solutions (for retention enemas) suppositories or ointments containing conventional suppository bases such as cocoa butter or other glycerides.
For nasal administration or administration by inhalation or insufflation, the therapeutics can be conveniently delivered in the form of an aerosol spray from pressurized packs or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, fluorocarbons, carbon dioxide or other suitable gas. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges for use in an inhaler or insufflator (for example capsules and cartridges comprised of gelatin) may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
For ocular administration, the therapeutics may be formulated as a solution, emulsion, suspension, etc. suitable for administration to the eye. A variety of vehicles are suitable for administering compounds to the eye.
For prolonged delivery, the therapeutics can be formulated as a depot preparation for administration by implantation or intramuscular injection. The therapeutics may be formulated with suitable polymeric or hydrophobic materials (e.g., as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, e.g., as a sparingly soluble salt. Alternatively, transdermal delivery systems manufactured as an adhesive disc or patch which slowly releases the therapeutics for percutaneous absorption may be used. To this end, permeation enhancers may be used to facilitate transdermal penetration of the therapeutics.
Alternatively, other pharmaceutical delivery systems may be employed. Liposomes and emulsions are examples of delivery vehicles that may be used to deliver therapeutics. Certain organic solvents such as dimethyl sulfoxide (DMSO) may also be employed.
The therapeutics described herein, or compositions thereof, will generally be used in an amount effective to achieve the intended result, for example in an amount effective to treat or prevent the particular disease being treated, and dosage forms of the compositions generated accordingly.
Detection of intracellular DNA by the cGAS-STING pathway activates a type I interferon-mediated innate immune response that protects from virus infection and can be harnessed to promote anti-tumor immunity. Whether there are additional DNA sensing pathways, and how such pathways might function, remains controversial. We show here that humans—but not mice—have a second, potent, STING-independent DNA sensing pathway that is blocked by the E1A viral oncogene of human adenovirus 5. We identify human DNA-PK as the sensor of this pathway and demonstrate that DNA-PK kinase activity drives a robust and broad antiviral response. We discover that the heat shock protein HSPA8/HSC70 is a unique target of the DNA-PK SIDSP. Finally, we demonstrate that detection of foreign DNA and DNA damage trigger distinct modalities of DNA-PK activity. These findings reveal the existence, sensor, unique target, and viral antagonists of a STING-independent DNA sensing pathway (SIDSP) in human cells.
The cGAS-STING DNA sensing pathway has emerged as a key component of the innate immune response that is important for antiviral immunity (1), contributes to specific autoimmune diseases (2), and mediates important aspects of antitumor immunity (3). cGAS binds to double-stranded DNA and catalyzes the formation of cyclic GMP-AMP (cGAMP; 4, 5), a diffusible cyclic dinucleotide that activates the endoplasmic adaptor protein STING (6). Activated STING then serves as a platform for the inducible recruitment of the TBK1 kinase, which phosphorylates and activates the transcription factor IRF3, leading to the induction of the type I interferon mediated antiviral response (7).
Here, we report the unexpected finding that the E1A oncogene of human adenovirus 5 blocks two distinct DNA sensing pathways in human cells: the well-known cGAS-STING pathway (11), and a second, STING-independent DNA sensing pathway (SIDSP). We identify the DNA damage response protein DNA-PK as the sensor of the SIDSP, along with the heat shock protein HSPA8 as a unique SIDSP target. We show that the SIDSP is potently activated in human and primate cells, but it is weak or absent from mouse cells. Our findings demonstrate that human cells have a second DNA sensing pathway, with implications for host defense, autoimmunity, and anti-tumor immunity.
We previously demonstrated that the viral oncogenes of the DNA tumor viruses are potent antagonists of the cGAS-STING DNA sensing pathway (11). We sought to define the mechanism of this antagonism, focusing on the E1A oncogene of human adenovirus 5, which is constitutively expressed in human HEK 293 cells and is responsible for their transformation. As shown previously (11), we found that HEK 293 cells mounted a robust type I IFN response to RIG-I ligand, but not to transfected calf thymus (CT) DNA, and that CRISPR-mediated disruption of E1A restored the DNA-activated IFN response (
To explore these two DNA sensing pathways in more detail, we turned to additional mouse and human cell lines. We first confirmed that the type I IFN response to transfected CT DNA was STING-dependent in primary mouse fibroblasts at the peak of the response four hours post transfection: both DNA- and cGAMP-activated IFN responses were reduced by 99.9% at this time point in STING-deficient fibroblasts (
Using our control and STING-deficient U937 cells to genetically separate the cGAS-STING pathway from the SIDSP, we evaluated the structural features of the DNA ligands that triggered these pathways. cGAS activation is mediated by its binding to the sugar phosphate backbone of double-stranded DNA in a sequence-independent manner (14, 15). Accordingly, control U937 cells mounted an equally robust antiviral response to both sheared CT DNA and circular plasmid DNA (
Our finding that the activation of the SIDSP requires exposed DNA ends led us to consider two key DNA damage response pathways that are activated by DNA ends: the Ataxia-Telangiectasia Mutated kinase (ATM) pathway that is important for homology-dependent DNA repair, and the DNA-dependent Protein Kinase (DNA-PK) pathway that mediates non-homologous DNA end joining (NHEJ; 16). We transfected STING KO U937 cells with CT DNA in the presence of well-characterized chemical inhibitors of the kinase activities of ATM (Ku-60019; 17) or DNA-PK (Nu-7441; 18). Both of these inhibitors reduced the DNA-activated phosphorylation of the histone H2AX on serine 139 (γ-H2AX) in a concentration-dependent manner, confirming their activity in these cells (
We next used lentiCRISPR to simultaneously target U937 cells with guide RNAs targeting STING and the catalytic subunit of DNA-PK (DNA-PKcs), which is encoded by the PRKDC gene. DNA-PK-targeted cells were severely compromised for growth relative to control cells, as has been previously reported (19), but we managed to generate a clonal line of U937 cells doubly deficient for STING and DNA-PK, verified by western blot and DNA sequencing, together with a third clonal line of STING KO U937 cells (
The activation of DNA-PK requires the Ku70 and Ku80 cofactors that are responsible for DNA end binding and recruitment of DNA-PKcs to damaged DNA (16). We attempted to generate clonal lines of U937 cells deficient for Ku70 and Ku80 but we were not able to recover live knockout cells, likely because they are essential genes in human somatic cells (20, 21). We therefore employed a transient lentiCRISPR approach in STING KO HEK 293 cells to target the XRCC6 (Ku70) and XRCC5 (Ku80) genes at the population level. Three days after selection of transduced cells in puromycin, we observed reduced levels of DNA-PKcs, Ku70, and Ku80 proteins in HEK 293 cells targeted with the respective guide RNAs (
To define the nature of the transcriptional changes in the DNA-PK SIDSP beyond the canonical antiviral cytokine IFNβ, we performed a global mRNA-Seq analysis in WT and STING KO cells, evaluating the changes following DNA transfection and the effect of the DNA-PK inhibitor Nu-7441 on this response. After mapping to the human transcriptome, normalizing read counts across all samples, and removing features with fewer than 10 mean counts per million (CPM), our dataset revealed tight concordance among the three biological replicates within each condition and differential clustering of each condition relative to all others (
We compared DNA-activated WT and STING KO samples at 8 and 16 hours post-transfection to their respective transfection reagent alone controls, in the presence of DMSO or 204 Nu-7441. We focused first on the interferon-mediated antiviral response, objectively defined here by compiling genes in this category delineated by Gene Ontology Consortium terms. We compiled a list of antiviral response genes with a fold change of greater than 1.5 and a false discovery rate (FDR) of <0.05 in any one of the comparisons. A heat map of these 124 differentially expressed genes revealed a broad, potent, and overlapping antiviral program triggered by DNA in both WT and STING KO cells (
We next quantitated the effect of the Nu-7441 DNA-PK inhibitor on global gene expression in WT and STING KO cells. We plotted the fold change values of all differentially expressed genes at 16 hours post DNA transfection, comparing vehicle-treated cells to those treated with 2 μM Nu-7441. In WT cells, we found that Nu-7441 had a mild inhibitory effect on the expression of 718/1024 (70.1%) of differentially expressed genes (
These mRNA-Seq data reveal a number of important features of the DNA-PK SIDSP. First, the SIDSP is a broad and potent antiviral response that results in significant changes in expression of over a thousand human genes. Second, global gene expression in the SIDSP is delayed relative to the DNA-activated antiviral response in WT human cells, highlighting kinetic differences of antiviral signaling that will be interesting to explore in the future. Third, the Nu-7441 inhibitor of DNA-PK kinase activity influences the vast majority of differential gene expression in the SIDSP, as well as a fraction of gene expression in WT cells. Thus, DNA-PK kinase activity is at the apex of the SIDSP, strongly suggesting that it is the primary sensor of this pathway rather than an incidentally activated peripheral component of a distinct pathway. Importantly, these data provide a clear rationale and framework for exploring the utility of DNA-PK inhibitors in IFN-mediated human autoimmune and autoinflammatory disorders.
In our studies of E1A antagonism of IRF3 phosphorylation, we found that the antibody raised against IRF3 pS386 detected a second protein that was approximately 20 kilodaltons larger than IRF3 in DNA-activated HEK 293 cells (
To identify MP, we used the IRF3 pS386 antibody for immunoprecipitation of HEK 293 cell extracts, followed by trypsin digest and mass spectrometry analysis of recovered peptides. To facilitate the identification of MP, we also generated IRF3-deficient HEK 293 cells using lentiCRISPR. Importantly, MP was still robustly phosphorylated after transfection of these IRF3-targeted cells with DNA, demonstrating that MP was not an unusual, slower migrating isoform of IRF3 itself, and that IRF3 was not required for MP phosphorylation (
Among the peptides identified by mass spectrometry that were specifically enriched by IP with IRF3 pS386 antibody compared to control antibody, one protein in particular caught our attention. Heat shock protein A8 (HSPA8), also known as heat shock cognate 70 (HSC70), matched the predicted mass of MP at ˜73 kilodaltons. Most intriguingly, we noted a sequence at the extreme C terminus of HSPA8 that corresponds precisely to the sequence adjoining 5386 in IRF3, suggesting a probable explanation for cross-reactivity of the antibody (
To test whether MP was HSPA8, we generated expression vectors for hemagglutinin (HA) epitope-tagged human HSPA8 and three mutants in which one or both serines at positions 637 and 638 were mutated to alanines. We transfected each of these constructs into HEK 293 cells, waited 24 hours, and then transfected the cells with CT DNA for three hours before immunoprecipitation of the HA-tagged proteins and blotting for IRF3 pS386. We found that the IRF3 pS386 antibody robustly detected the WT HSPA8 protein after DNA transfection, but it failed to detect the single or double alanine-substituted mutant HSPA8 proteins (
Similar to the data presented for IRF3 (
We noted that the amino acids surrounding serine 638 of HSPA8 are completely conserved across mammalian evolution, unlike those surrounding IRF3 (
We next tested for activation of the SIDSP in response to DNA damage, which potently triggers activation of DNA-PK (16). We treated STING KO HEK 293 cells with CT DNA, plasmid DNA, ionizing radiation, or the topoisomerase-II inhibitor etoposide, monitoring activation of both IRF3 and HSPA8 phosphorylation up to 12 hours after treatment. As shown in
We have identified DNA-PK as the sensor of a potent, STING-independent DNA sensing pathway (SIDSP) that is present in human cells but weak or absent from mouse cells. We identify two DNA virus-encoded antagonists of the DNA-PK SIDSP, and we show that a small molecule inhibitor of DNA-PK kinase activity potently reduces the robust and broad transcriptional response triggered by foreign DNA in human cells. Finally, we present evidence that the DNA-PK SIDSP includes unique targets that are triggered only by foreign DNA and not by DNA damage. The existence of a second DNA sensing pathway that is present in human cells but not mouse cells has important implications for our understanding of antiviral immunity, for treating autoimmune diseases, and for the possibility of harnessing this pathway to enhance immune responses to tumors.
We found that the Nu-7441 DNA-PK inhibitor potently reduced nearly all gene expression triggered by the SIDSP, demonstrating that DNA-PK kinase activity drives the SIDSP transcriptional response.
We identified serine 638 of HSPA8 as a unique and specific target of the DNA-PK SIDSP in human cells. We used the conservation of HSPA8 among mammals as a means to explore the activation of the DNA-PK SIDSP in primates and rodents. Consistent with the lack of a significant STING-independent IFN response in mouse fibroblasts, we found that HSPA8 phosphorylation did not occur in mouse cells. However, all primates tested, as well as rats, demonstrated intact HSPA8 phosphorylation, indicating that the SIDSP is broadly present in mammals and that laboratory mice specifically lost a robust SIDSP after their divergence from the common ancestor of mice and rats.
The cGAS-STING antiviral response has become the subject of intense development in the pharmaceutical industry, including efforts to develop inhibitors of cGAS and STING to treat human autoimmune diseases (33-35), as well as agonists of STING to improve immune responses to tumors (36-38). Our discovery of a second DNA-activated antiviral response in human cells has important implications for these efforts. Harnessing agonism of the DNA-PK SIDSP to trigger innate immune responses in the tumor microenvironment could broaden the toolkit of sophisticated adjuvant immunotherapies.
In summary, we have described the existence of a potent STING-independent DNA sensing pathway (SIDSP) in human cells, and we have identified its sensor, a unique target, two distinct viral antagonists, and a potent small molecule inhibitor of the response.
Sheared CT DNA (Sigma) and 2′3′ cGAMP (Invivogen) were purchased and diluted in water; ISD oligos were ordered from Integrated DNA Technologies and annealed in water (30); RIG-I ligand was synthesized in vitro as previously described using HiScribe™ T7 High Yield RNA Synthesis Kit (39). For plasmid stimulations, midiprepped pcDNA3 was either untreated or sonicated with a Covaris M220 focused ultrasonicator at 5% ChIP (factory setting). Nu-7441 and Ku-60019 (SelleckChem) were suspended in DMSO and used to treat cells for 1 hour prior to stimulation with nucleic acid ligands. For Nu-7441, we used 0.25, 0.5, 1, or 2 μM. For Ku-60019, we used 0.125, 0.25, 0.5, or 1 μM. Untreated cells received the same amounts of plain DMSO.
HEK 293 cells were grown in DMEM supplemented with 10% FCS, L-glutamine, penicillin/streptomycin, sodium pyruvate, and HEPES. U937 and THP1 cell lines were grown in RPMI supplemented as above, and differentiated prior to stimulation using 100 nM phorbol myristoyl acetate (PMA) for 24 hours and then rested in media lacking PMA for 24 hours.
HEK 293 cells were plated at 0.5 million/well in a 6 well dish in 2 mL media the day before stimulation for protein harvest. For RNA harvest and qPCR, U937 cells were plated at 0.25 million/well in a 24 well dish. In the 6 well dish format, cells received 8 μg of CT DNA, ISD100, or pcDNA3 complexed with 8 μl of Lipofectamine™ 2000. 10 μM cGAMP was complexed with 8 μl Lipofectamine™ and 1 μg RIG-I ligand was complexed with 1 μl Lipofectamine™ to achieve comparable induction of IFN across treatments in competent cells. Stimulations done in 24 well plates were scaled by ¼. Etoposide (prepared in DMSO) was diluted in culture media to 50 μM, and untreated cells received the same volume of DMSO. Cells were irradiated with 30 Gy using a Rad Source RS 2000 X-irradiator.
Supernatants from stimulated cells were harvested 24 hours post-stimulation and used to stimulate a HeLa cell line stably expressing an ISRE-luciferase reporter as described previously (11).
Cells were harvested by trypsinization (U937 cells) or vigorous wash with PBS (HEK293 cells), pelleted, and lysed using either a 1% Triton-X-100 buffer (20 mM HEPES, 150 mM NaCl, 10% glycerol, 1 mM EDTA, Pierce phosphatase/protease inhibitors) or, for samples requiring measurement of DNA-PK protein levels, RIPA buffer (150 mM NaCl, 1% Triton-X-100, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris pH 8.0, Pierce phosphatase/protease inhibitors). Lysates were vortexed and incubated on ice for 15 minutes before clearing by centrifugation for 15 minutes. Proteins were separated on Bolt 4-12% Bis-Tris gels (ThermoFisher) in MES buffer for 30 minutes at 200 V and transferred to Immobilon-FL PVDF membrane (Sigma). Blots were blocked in 5% BSA/TBST for 30 minutes prior to incubation with primary. The pIRF3 S386 blots were incubated at 4° C. overnight and washed at least 30 minutes in TBST prior to secondary incubation to prevent background. In order to better resolve DNA-PK (470 kDa), lysates were run on 3-8% Tris-acetate gels (ThermoFisher) for 2 hours at 150 V and then transferred in 5% methanol for 3 hours at 20 V at 4° C.
VSV-G pseudotyped, self-inactivating lentivirus was prepared by transfecting a 60-80% confluent 10-cm plate of HEK 293T cells with 1.5 μg of pVSV-G expression vector, 3 μg of pMDLg/pRRE, 3 μg pRSV-Rev and 6 μg of pRRL lentiCRISPR vectors using Poly(ethyleneimine) (PEI; Sigma). Media was replaced 24 hours post-transfection and harvested 24 hours later for filtration with a 0.45 μm filter (SteriFlip, Millipore). Approximately 1 million cells were transduced with 10 mL filtered virus. Targeting NHEJ components efficiently was difficult; best results were achieved by increasing transduction rates with sequential transductions on two consecutive days. Cells were plated for stimulations while still under selection at day 4 post first transduction.
For CRISPR/Cas9 gene targeting, we generated pRRL lentiviral vectors in which a U6 promoter drives expression of a gRNA, and an MND promoter drives expression of Cas9, a T2A peptide, and either a puromycin or blasticidin (40). gRNA sequences are as follows, where the (G) denotes a nucleotide added to enable robust transcription off the U6 promoter and the underlined sequence denotes the Protospacer Adjacent Motif (PAM): H1 off-target control: (G)ACGGAGGCTAAGCGTCGCAA (SEQ ID NO:1) (41); TMEM173 (STING): GGTGCCTGATAACCTGAGTATGG (SEQ ID NO:2) (40); TBK1: (G)CATAAGCTTCCTTCGTCCAGTGG (SEQ ID NO:3) (7); PRKDC (DNA-PK): GCAGGAGACCTTGTCCGCTGCGG (SEQ ID NO:4); XRCC6 (Ku70): GATCCGTGGCCCATCATGTCTTGG (SEQ ID NO:5); XRCC5 (Ku80): GTTGTGCTGTGTATGGACGTGGG (SEQ ID NO:6); ATM guide 1: (G)CCAAGGCTATTCAGTGTGCGAGG (SEQ ID NO:7) (41); ATM guide 2: (G)TGATAGAGCTACAGAACGAAAGG (SEQ ID NO:8) (41); and E1A (G)AAGACCTGCAACCGTGCCCGGGG (SEQ ID NO:9) (Lau, et al 2015) (11). Guides against PRKDC, XRCC6, and XRCC5 were designed using Benchling.
KO cell lines were generated by limiting dilution, screened by western blot, and verified by Sanger sequencing and functional assays. The STING/DNA-PK DKO U937 cell line was produced by transducing U937s simultaneously with a STING lentiCRISPR puro virus and a DNA-PK lentiCRISPR blasticidin virus, selecting in 10 μg/ml puro and 5 μg/ml blasticidin, and seeding in 96 well plates immediately after selection. Very few colonies grew, and the verified DKO clone grew markedly slower than H1 non-targeted control clones or the STING KO clones, as expected (19).
PCR primers used for amplifying genomic DNA surrounding CRISPR targeting sites in clonal lines were as follows (Forward/Reverse):
Amplicons were cloned using the Zero Blunt™ TOPO PCR Cloning kit (ThermoFisher), prepared as plasmids, and then several individual plasmids were sequenced. Sequencing alignments were made using Benchling™.
RNA Isolation and qPCR
Cells were harvested in Trizol before purification via Direct-zol™ RNA miniprep (Genesee Scientific) per manufacturer's instructions with an additional dry spin after disposing of the final wash to prevent carryover. cDNA was generated using EcoDry™ double primed premix (Clontech). qPCR was performed using iTaq supermix on the Bio-Rad CFX96 Real-Time system. Human gene PCR primer sequences are as follows: GAPDH Fwd: 5′-AACAGCCTCAAGATCATCAGC-3′ (SEQ ID NO:16), GAPDH Rev: 5′-CACCACCTTCTTGATGTCATC-3′ (SEQ ID NO:17) IFNB1 Fwd: 5′-ACGCCGCATTGACCATCTATG-3′ (SEQ ID NO:18), IFNB1 Rev: 5′-CGGAGGTAACCTGTAAGTCTGT-3′ (SEQ ID NO:19). Mouse primer sequences are as follows:
cGAMP Quantitation Assay
Cells were plated at 100,000 cells/well in a 24 well tissue culture dish. 24 hours later, cells were transfected with either 10 μg/ml CT DNA in Lipofectamine™ 2000 (Invitrogen; ratio of 1 μL Lipofectamine™ per 1 μg CT DNA; (32), or with an identical volume of Lipofectamine™ 2000 alone. 4 hours later, cells were harvested and lysates were prepared using cGAMP EIA assay protocol provided by manufacturer (Arbor Assays), in a volume of 200 μL sample suspension buffer.
mRNA-Seq and Analysis
Total RNA was added directly to lysis buffer from the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara), and reverse transcription was performed followed by PCR amplification to generate full length amplified cDNA. Sequencing libraries were constructed using the NexteraXT™ DNA sample preparation kit (IIlumina) to generate Illumina-compatible barcoded libraries. Libraries were pooled and quantified using a Qubit® Fluorometer (Life Technologies). Dual-index, single-read sequencing of pooled libraries was carried out on a HiSeq2500 sequencer (Illumina) with 58-base reads, using HiSeq™ v4 Cluster and SBS kits (IIlumina) with a target depth of 5 million reads per sample. Base calls were processed to FASTQs on BaseSpace™ (Illumina), and a base call quality trimming step was applied to remove low-confidence base calls from the ends of reads. The FASTQs were aligned to the human reference genome using the STAR aligner, and gene counts were generated using htseq-count. QC and metrics analyses were performed using the Picard family of tools (v1.134).
Exploratory analysis and statistics were run using R (version 3.5.1) and bioconductor (version 3.7). The gene count matrix was filtered by a row mean of ten or greater counts and normalized with EDGER. Log CPM transformation was performed using voom through the limma bioconductor package (3.34.8). Statistical analysis (including differential expression) was performed using the limma package (42, 43).
Co-expression was performed on genes statistically significant in the differential expression analysis (threshold: linear fold change >=|1.5| and FDR <=0.05) in at least one comparison. The union of these DE genes were loaded into R and filtered by known interferon signaling genes using all of the GO terms. Correlations (ward.2 clustering and euclidean distance) were run on the union of log 2FC using the WGCNA and heatmap.2 bioconductor packages in R (42, 44, 45).
To identify HSPA8 using mass spectrometry, we performed immunoprecipitation of CT-DNA stimulated HEK293 cells using the antibody to IRF3 pS386 crosslinked to Dynabeads™ (ThermoFisher) overnight at 4 C, then washed three times in lysis buffer and two times in ammonium biocarbonate (50 mM) before peptide digestion (V5280, Promega). Peptides were loaded onto a 3-cm self-packed C18 capillary pre-column (Reprosil™ 5 μM, Dr. Maisch). After a 10-min rinse (0.1% Formic Acid), the pre-column was connected to a 25-cm self-packed C18 (Reliasil™ 3 μM, Orochem) analytical capillary column (inner diameter, 50-μm; outer diameter, 360-μm) with an integrated electrospray tip (˜1-μm orifice). Online peptide separation followed by mass spectrometric analyses was performed on a 2D-nanoLC system (nanoAcquity™ UPLC system, Waters Corp.). Peptides were eluted using a 150-min gradient with solvent A (H2O/Formic Acid, 99.9:1 (v/v)) and B (Acetonitrile/Formic Acid, 99.9:1 (v/v)): 10 min from 0% to 10% B, 105 min from 10% to 40% B, 15 min from 40% to 80% B, and 20 minutes with 100% A. Eluted peptides were directly electrosprayed into a Orbitrap QExactive™ mass spectrometer (Thermo Fisher Scientific) equipped with a high energy collision cell (HCD). The mass spectrometer was operated in a data-dependent mode to automatically switch between MS and MS/MS acquisitions. Each full scan (from m/z 300-1500) was acquired in the Orbitrap™ analyzer (resolution=70,000), followed by MS/MS analyses on the top twenty most intense precursor ions that had charge states greater than one. The HCD MS/MS scans were acquired using the Orbitrap™ system (resolution=17,500) at normalized collision energy of 28%. The precursor isolation width was set at 2 m/z for each MS/MS scan and the maximum ion accumulation times were as follows: MS (100 ms), MS/MS (100 ms). MS/MS data files were searched using the Comet algorithm (46), and the data were further processed using the Institute for System's Biology's Trans-Proteomic Pipeline (47). Static modification of cysteine (carbamidomethylation; 57.02 Da) was used in the search.
PCR and InFusion™ cloning (Clonetech) were used to generate N-terminal HA-tagged WT and alanine mutant human HSPA8 constructs from HEK 293 cell cDNA. A murine HSPA8 cDNA clone (Transomic technologies, Clone ID BC089322) was used as template to generate the epitope-tagged mouse versions.
0.25 million STING KO HEK293s were seeded in 12 well format the day before transfection with 0, 1, 2 or 4 μg of ICP0 expression plasmid using Lipofectamine™ 2000 at a 1 μl:1 μg DNA ratio. Empty pcDNA3 was used to bring the total amount of transfected DNA up to 4 μg total. 24 hours post-transfection, the cells were treated with 4 μg CT DNA or 4 μL Lipofectamine™ 2000 alone and harvested 3 hours later in RIPA buffer with phosphatase inhibitors for analysis by western blot. Wild-type HSV-1 strain KOS and ICP0-null HSV-1 strain 7134 were prepared in Vero cells and ICP0-complemented Vero cells, respectively (52), using a MOI of 0.01 for 48 hrs before virus-containing media was collected, spun down to remove any cells, and aliquoted for storage at −80 C. Tittering was performed by serial dilution and plaque assay on the appropriate Vero cell line. Plaques were visualized by fixing/staining in 20% methanol with 0.2% crystal violet.
All experiments presented in this study, except the mRNA-Seq studies, were done two or more times, with biological triplicates for each condition in RT-qPCR experiments. Quantitative data were visualized and analyzed using GraphPad™ Prism software. Multiple unpaired t-tests with significance determined by Holm-Sidak method were used to compare differences between groups, unless otherwise noted for specific tests in figure legends. Significance is indicated as follows: *p<0.05. **p<0.01, ***p<0.001, ****p<0.0001.
This application claims priority to U.S. Provisional Patent Application Ser. Nos. 62/813,482 filed Mar. 4, 2019 and 62/964,865 filed Jan. 23, 2020, each incorporated by reference herein in their entirety.
This invention was made with government support under Grant No. R21 AI130940, awarded by the National Institutes of Health (NIH). The government has certain rights in the invention.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US20/20747 | 3/3/2020 | WO | 00 |
| Number | Date | Country | |
|---|---|---|---|
| 62813482 | Mar 2019 | US | |
| 62964865 | Jan 2020 | US |
